Government Dental College - Rajasthan

37867416 tenders are invited annual rate contract for supply of oral pathology items for hospital use. 1 isopropyl alcohol 99.9% 5 ltr 2 xylene max limit of impurities <_0.01% 5 ltr 3 acetone weight / ml at 20 degree centigrade is 0.789 0.791gm 5 ltr 4 eosin stain ready to use 500 ml 5 haematoxylin stain ready to use 500 ml 6 paraffin wax paraffin wax with ceresin at 60 degre 7 hydrochloric acid ar ( hcl ) 500 ml 8 acetic acid max limit of impurities 0.01% weight per ml at 20 degree is 1.048 1.0519 500 ml 9 dpx ( mounting agent ) refractive index 1.515 to 1.525 250 ml 10 formaldehyde ( 4% of formaldehyde ) 11 pap stain kit 3 minute rapid kit 1 kits with reagents 12 hematoxylin powder passes performance test 5gm 13 mercuric oxide 250gm 14 eosin powder eosin y power 25gm 15 tissue paper roll 6 rolls / packet 16 filter paper 12.5 cm diameter 1pkt 17 glass slides marker slide on the side 25x75 ± 1mm 1box 18 glass cover slips 22”x50” rectangular 10 / box 19 microtome blade high profile disposable, high profile, stainless steel 50 blades / box 20 congo red stain ready to use 1kit 21 masson trichrome stain ready to use 1kit 22 sudan black stain ready to use 1 kit 23 measuring beaker 200 ml borosil glass with marking unit 24 measuring beaker 50 ml borosil glass with marking unit 25 measuring beaker 500 ml borosil glass with marking unit 26 processing jars 1 litre borosil glass jars with screwed metal cap 1 piece 27 pas stain ready to use 1kit 28 diamond marker 1 piece 29 camel pen stain solution 1 piece 30 geimsa stain solution ready to use 500ml 31 ethyl alcohol 500ml 32 deionized water 5000 ml 33 glycerol refractive index 1.471 1.473 500ml 34 permanent marker pen thin black 1piece 35 aluminum postassium 36 distilled water 5 lit. 37 gram stain kit 1 kit 38 culture media nutrient agar 500gm each 39 antibiotic sensitivity test kit 1 kit 40 surgical blade holder 1 pieces 41 disposable plastic tubes 10 packets 10 ml 7 packets5ml 42 micropipette tips small units 43 tournicate units 44 capillary tube’s 1pkt x 10 pieces 45 bd vacutainer needle unit 46 vacutainer tubes plain ( glass ) 3ml 47 vacutainer tubesedta ( glass ) 3ml 48 leishmann stain 500ml 49 plain test tubes ( glass ) 5ml 50 plain test tubes 10ml 51 rbc fluid 500ml 52 wbc diluting fluid 500ml 53 cbc reagent kit abx minidil 20 lts lysebio 1lts abx cleaner l lts 54 n / 10hcl 500ml 55 leishmann buffer 500ml 56 esr solutions 3.8% sodium 500ml 23 citrate 57 neubuer chamber cover slip 1pkts 58 cell counting chamber units 59 tissue specimen bottles 1k piece 60 floxin b powder 250gm 61 sugar vail vacutainer ( floride vail ( glass ) 2ml 62 pt tubes ( vacutainer vail ) ( glass ) 2ml 63 printing paper roll for cbc machine units 64 black marker 15 pen 65 test tubes 5ml 66 test tubes 2 ml 67 block boxes...

Department Of Atomic Energy - Rajasthan

37860858 bids are invited for chemicals 1 53 sulfuric acid 98 percent , methyl orange indicator , xylene cyanol ff , hydrochloric acid min. 35 percent , sodium hydroxide pellets , phenolphthalein , silver sulfate , ammonium iron ii sulfate hexahydrate , mercury ii sulfate , potassium dihydrogen ortho phosphate , di potassium dihydrogen ortho phosphate anhydrous , di sodium hydrogen phosphate heptahydrate , ammonium chloride , magnesium sulfate heptahydrate , calicium chloride dihydrate , iron iii chloride hexahydrate , d glucose, anhydrous, dextrose , l glutamic acid hydrochloride , sodium azide , sodium chloride , silver nitrate , potassium chromate , aluminium potassium sulfate dodecahydrate , aluminium ammonium sulfate dodecahydrate , bromo phenol blue indicator , hydroquinone , barium perchlorate anhydrous , perchloric acid 60 percent , thorin indicator , eriochrome black t indicator , total hardness indicator tab , sodium sulfite anhydrous , edta acid , edta disodium salt dihydrate , magnesium chloride hexahydrate , calcium carbonate precipitated , methyl red indicator , calcon metal indicator , methanol , potassium bromate , dodecyl sulfate sodium salt , potassium iodide , starch soluble , manganese ii sulfate monohydrate , starch 1 percent aqueous solution stabilized , sodium carbonate anhydrous , potassium hydroxide pellets , whatman filter paper , alkali blue indicator , toluene , acetic acid glacial , bromothymol blue indicator , d sorbitol 98 percent , hexamythylenetetramine , xylenol orange indicator , 4 dimethyl amino benzaldehyde , hydronium sulfate , anode solution for coulomatric kf titration , cathode solution for coulomatric kf titration total quantity : 9865...

Government Medical College - Rajasthan

37860249 rate contract for chemicals, test kits, reagents, media and glassware , (a)chemicals preferred make: merck, cdh, qualigens, srl, himedia, thermofisher , absolute alcohol /ethanol absolute ar , acetic acid glacial ar , acetone ar , acid fuchsin m.s/ certified , agar agar powder , albumin egg flakes , alcian blue m.s/ certified , amido black stain , aluminum sulphate ar , aluminum chloride , alkaline haematin d regentwith haemoglobin standard 9.0 g/dl , alkaline haematin d regentwith haemoglobin standard &15.0 g/dl , ammonia solution30% , ammonium oxalate ar , ammonium potassium sulphate (alum) , ammonium sulphate ar , aniline blue m.s/ certified , anti microbial hand rub , anti sera a, anit sera b and anti sera d one set of blood group antiseras containing each of 10ml. all antisera must be monoclonal must be able to deduct weakerblood groups , avidity nust be less than 5 second , barium chloride ar , basic fuchsin m.s/ certified , agar agar bacteriological , bees wax, yellow , benedict’s reagents qualitative lr , benzidine powder , benzidine powder dihydrochloride , biebrich scarlet m.s certified , bouin’s fluid fixing solution , brilliant cresyl blue m.s/ certified , bromophenol blue , boric acid ar , borate buffer ph 9.0 , borax powder ep , buffer tablets6.2 ph , buffer tablets7.0 ph , buffer tablets9.2 ph , calcium chloride ar , congo red m.s/ certified , carbol fuchsin dilute , carbol fuchsin strong , carmine m.s./certified , cedar wood oil , charcoal activated ar , citric acid ar , crystal violet m.s/ certified , csf diluting fluid , dextrose ndhydrous /d glucose , d.p.x. mountant , darbkin’s solution , deionised water , distilled water , di sodium hydrogen ortho phosphate , diastage , emry powder no 2 , emry powder no 3 , eosin water soluble , eosinophil counting fluid , esbach’s reagent , ehrlich’s reagents solution , ethylene diamine tetra acitic acid (edta) , fast green ms , ferric ammonium sulphate , fetal hb kits , formal dehyde (37 41%) w/var , fouchet’s reagents , field staina sol’n , field stainb sol’n , gram’s iodine ms , g6pd reagent kit (qualitative) , giemsa stain powder m.s/certified , giemsa stain solution , glycerol ar , gold chloride m.s , hematoxylin powder ms/certified , hematoxylin may’s soln ms , haemoglobin standard , hemocue hb microcuvettes , hydrochloric acid (concentrated) , hydrogen peroxide (6%) , iodine powder , iso propyl alcohol ar , kaolin light ep , labogent/labklin(glass cleaning solution ) , leishman’s stain solution m.s , leishman’s stain powderm.s/ certified , light green m.s/ certified , liquid paraffin oil heavy , liquid paraffin oil light , lithium carbonate ar , lugol’s iodine , mercuric oxide red purified , metanil yellow m.s/ certified , methanol ep (acetone free) , methyl violet m.s/ certified , methyline blue m.s/ certified , myeloperoxidase stain , neutral red m.s/ certified , n/10 hcl , nitric acid ar , normal saline 0.9% , paraffin wax with ceresin, in block form (600 620) , paraffin wax with ceresin, in block form (580 600) , peanut oil , periodic acid m.s/ certified , phenol crystal , phosphomolibidic acid , phosphotungestic acid ar , picric acid (saturated) , platelet count fluid , phloxin –b m.s/ certified , phenyle , potassium dichromate , potassium ferrocynide , potassium hydroxide pellets , potassium iodine ar , sodium acetate ep(anhydrous) , sodium chloride ep , sodium citrate 3.8% , sodium carbonate , sodium dihydrogen ortho phosphate , sodium hypo chlorite solution 4% , sodium hydrogen phosphate ar , sodium di hydrogen phosphate ar , sodium nitrate ar , sodium nitropruside , sodium sulphate ar , sodium thiosulphate , sudan black , spirit , sulphosalicylic acid , potassium metabisulphite ar , potassium permangnatepurified , ponceau’s stain , rapid pap’s kit , rbc counting fluid , reticulocyte count fluid , semen diluting fluid , silver nitrate ep , xylene sulphur free , sulpher powder , sulphuricacid pure , thymol crystal , toludine blue m/s certified , tris buffer phosphate , tris sodium citrate , wbc counting flude , hexamine , chromium trioxide , sodium powder , b antibody forimmuno histochemistry (ihc test) (a) products should be mouse/rabbit monoclonal type. (b) price will be calculated on per ml basis. (c) it should have shelf life of minimum 12 months from supply. (d) due to low consumption & short expiry, small packing (1x2/6ml)preferred (e) all antibodies should be usfda/bis approved (not registered only). the certificate should be provided. , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp dab substrate buffer & dab chromogen for 100 tests or 10ml along with histozyme enzyme , polymer based detection kit (should contain peroxide block,post primary block, secondary antibody tagged wirt hrp, dab substrate buffer & dab chromogen for 250 tests or 25ml along with histozyme enzyme , hematoxyleane , adhesive for ihc/ tissue bond , alk 1 (monoclonal mouse anti human cd246, clone) , alk 1 (monoclonal mouse anti human cd246, clone) , alpha feto protein (afp) (polyclonal rabbit anti human ) , alpha feto protein (afp) (polyclonal rabbit anti human ) , amacr (monoclonal mouse anti human clone 13h4) , amacr (monoclonal mouse anti human clone 13h4) , androgen receptor (ar) , androgen receptor (ar) , antibody diluent (vidas rub igm) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 6 (monoclonal mouse anti human bcl6, clonepg b6p) , bcl 2 , bcl 2 , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , ber ep4 (monoclonal mouse anti human epithelial antigen, clone) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , beta catenin (monoclonal mouse anti –human beta catenin, clone ß catenin 1) , bob 1 , bob 1 , brachyury , brachyury , calcitonin (polyclonal rabbit anti human calcitonin) , calcitonin (polyclonal rabbit anti human calcitonin) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , caldesmon (monoclonal mouse anti –human caldesmon clone h cd) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret 1) , calretinin (monoclonal mouse anti –human calretinin, cloneclone dak calret1) , cam 5.2 , cam 5.2 , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 10 (monoclonal mouse anti –human cd10,clone 56c6) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 117 (c kit) (polyclonal rabbit cd117) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 128 (monoclonal mouse anti –human cd128 clone mi15) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 1a (monoclonal mouse anti – humancd1a,clone 010) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 2 (monoclonal mouse anti –human cd2,clone ab75) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 20 (monoclonal mouse anti –human cd21,clone l26) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 21 (monoclonal mouse anti –human cd15,clone 1f8) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 22 (monoclonal mouse anti –human cd22,clone dak cd22) , cd 2 (monoclonal mouse anti –human) , cd 2 (monoclonal mouse anti –human) , cd 20 (monoclonal mouse anti –human cd20,clone ber h2) , cd 20 (monoclonal mouse anti – human cd20,clone ber h2) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 21 (monoclonal mouse anti – human cd21,endothelial cell jc70a) , cd 22 , cd 22 , cd 24(monoclonal mouse anti – human cd24, classii clone qbend 10) , cd 24 (monoclonal mouse anti –human cd24, classii clone qbend 10) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 45 (cd45, leucocyte common antigen, clone 2b11+pd7/26) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 5 (monoclonal mouse anti – humancd4,clone 4b12) , cd 56 (monoclonal mouse anti – human cd56,clone 122c2) , cd 56 (monoclonal mouse anti –human cd56,clone 122c2) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 57 (monoclonal mouse anti –human cd57,clone tb01) , cd 61 , cd 61 , cd 68 (monoclonal mouse anti –human cd68,clone pgm1) , cd 68(monoclonal mouse anti – human cd68,clone pgm1) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 7 (monoclonal mouse anti –human cd5,clone 4c7) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 79 a (monoclonal mouse anti –human cd79a,clone jcb117) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 8 (monoclonal mouse anti – human cd8,clone c8/144b) , cd 99 (monoclonal mouse anti – human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd 99 (monoclonal mouse anti –human cd99mic2 gene products, ewing’s sarcoma marker,clone 12e7) , cd11c , cd11c , cd14 , cd14 , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cd15 (monoclonal mouse anti – human cd15,clone carb 2) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , cea (monoclonal mouse anti – human carcinoembryonic antigen,clone ii 7) , chromogranin , chromogranin , citrate retrieval buffer ( ph. 6.0) , tris edta retrieval buffer (ph. 9.0) , immuno wash buffer , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 19 (monoclonal mouse anti – human cytokeratin 19,rck 108) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 20 (monoclonal mouse anti – human cytokeratin 20,clone ks20.8) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 5/6 (monoclonal mouse anti – human cytokeratin 5/6,clone d 5/16 b4) , ck 7 (monoclonal mouse anti – human cytokeratin 7,clone ov tl12/20) , ck 7 (monoclonal mouse anti –human cytokeratin 7,clone ov tl12/20) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , ck ae 1/ae3 (monoclonal mouse anti –human cytokeratin,clone ae1/ae3) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , cyclin d1 (monoclonal mouse anti –human cyclind1,clone ep12) , dab chromogen , dab substrate buffer (100ml) , delimiting pen /novo pen/pap pen , desmin (monoclonal mouse anti –human desmin,clone d22) , desmin (monoclonal mouse anti –human desmin,clone d22) , dog 1 , dog 1 , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , e cadherin (monoclonal mouse anti –human e cadherin,clone nch 2) , egfr , egfr , ema (monoclonal mouse anti – human epithelial membrane antigen,clonee29) , ema (monoclonal mouse anti –human epithelial membrane antigen,clonee29) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , estrogen receptor (er) (monoclonal rabbit anti –human estrogen receptor,clone ep1) , fl i 1 , fl i 1 , galectin 3 , galectin 3 , gfap (polyclonal rabbit gfap) , gfap (polyclonal rabbit gfap) , glypican 1 , glypican 1 , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg (polyclonal rabbit anti human chorinc gonadotropin) , hcg beta , hcg beta , her 2 neu (polyclonal rabbit anti human cerb 2) , her 2 neu (polyclonal rabbit anti human cerb 2) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmb 45 (monoclonal mouse anti human melanosome clone hmb45) , hmwck (monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hmwck(monoclonal mouse anti human cytokeratin, high molecular weight clone 24be12) , hpv , hpv , ihc coated slides , immuno wash buffer , inhibin , inhibin , inhibin alpha , inhibin alpha , ini 1 , ini 1 , kappa light chain (polyclonal rabbit anti human kappa light chains) , kappa light chain (polyclonal rabbit anti human kappa light chains) , ki 67 (ki 67 antigen clone mib 1) , ki 67 (ki 67 antigen clone mib 1) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , lambda light chain (polyclonal rabbit anti human lambda light chains.) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , mammaglobin (monoclonal mouse anti human mammaglobin clone204 1a5) , melan a (monoclonal mouse anti human melan a clone a102) , melan a (monoclonal mouse anti human melan a clone a102) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , mpo ( myeloperoxidase) (polyclonal rabbit anti human myeloperoxidase) , muc 2 , muc 2 , muc 5 ac , muc 5 ac , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , mumi – protein (monoclonal mouse anti human mum1 protein clonemum1p , myo d1 , myo d1 , myogenin (monoclonal mouse anti myogenin clone f5d) , myogenin (monoclonal mouse anti myogenin clone f5d) , napsin a , napsin a , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , nse (monoclonal mouse anti human neuron specific enolase bbs/nc/vi h14) , oct 2/4 , oct 2/4 , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 53 (monoclonal mouse anti human p52 protein clone do 7) , p 63 , p 63 , pax 8 , pax 8 , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , pax 5 (monoclonal mouse anti human b cell specific activator protein dak pax5) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , plap (placental alkaline phosphatase) (monoclonal mouse anti human placental alkaline phosphate clone 8a9) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , progesterone receptor (pr) (monoclonal mouse anti human progesterone receptor clone pgr 626) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , psa (prostate specific antigen) (polyclonal rabbit anti human prostate specific antigen) , s 100 (polyclonal rabbit antis100) , s 100 (polyclonal rabbit antis100) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sma (mono clonal mouse anti human smooth muscle actin1a4) , sox 11 , sox 11 , synaptophysin (monoclonal mouse antisynaptophysin sy28) , synaptophysin (monoclonal mouse antisynaptophysin sy28) , tdt , tdt , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , thyroglobulin (polyclonal rabbit anti human thyroglobulin) , tle 1 , tle 1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , ttf 1 (monoclonal mouse antithyroid transcription factor (ttf 1)clone 8g7g2/1 , vimentin (monoclonal mouse antivimentin v9) , vimentin (monoclonal mouse antivimentin v9) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , wt 1 (monoclonal mouse anti human wilms’tumar 1 (wt1) protein clone 6f h2) , c antibody for immunofluorescence microscopy , albumin, polyclonal fitc ready to use for immunofluorescence rabbit anti albumin conjugated to fluorescein isothiocyanate. , c1q complement, polyclonal fitc ready to use for immunofluorescence rabbit anti c1q complement conjugated to fluorescein isothiocyanate , c2c complement, polyclonal fitc ready to use for immunofluorescence sheep anti c2c complement conjugated to fluorescein isothiocyanate , fibrinogen, polyclonal fitc ready to use for immunofluorescence rabbit anti fibrinogen conjugated to fluorescein isothiocyanate , immunoglobulin a (iga), polyclonal fitc ready to use for immunofluorescence sheep anti iga conjugated to fluorescein isothiocyanate , immunoglobulin g (igg), polyclonal fitc ready to use for immunofluorescence sheep anti igg conjugated to fluorescein isothiocyanate , immunoglobulin m (igm), polyclonal fitc ready to use for immunofluorescence rabbit anti igm conjugated to fluorescein isothiocyanate , kappa, polyclonal fitc ready to use for immunofluorescence rabbit anti kappa conjugated to fluorescein isothiocyanate , lambda, polyclonal fitc ready to use for immunofluorescence rabbit anti lamda conjugated to fluorescein isothiocyanate , mount staining reagent , blocking reagent , c antibody for immunofluorescence microscopy , (1)cal.thromboplastin/neoplastine with solvent (sta neoptimal 5) , (2)pt neoplastin (sta neoptimal 10) , (3)aptt activated partial thromoplastin (c.k.prest 2) , (4) fib.2 fibrinogen (sta fibrinogen 5) , (5) calcium cloride (sta cacl2 0.025 m , other items for coagulometer (6)cuvette (sta cuvettes) , (7)fintips for start 4 1.25 ml , (8) steel bals (sta steel bals , (9)thermal paper size 50 mm , c antibody for immunofluorescence microscopy , (1) actime , (2) erba protime ls , (3) erba actime , (4) reaction tubes su 40 , (5) reaction tubes su 40 , (6) erba factor vii deficient plasma , (7) erba factor x deficient plasma , (8) erba factor ix deficient plasma , (9) erba factor viii deficient plasma , (10)erba factor xi deficient plasma , (11)erba factor xii deficient plasma , (12)erba thrombin reagent , (13)erba thrombin time , (14) thermal printer paper (printer paper roll kit) , (15)erba calcium chloride , (16) erba control p , (17) erba control n , (18) erba control n plus , (19) erba control p plus , (20) control plasma n , (21) erba d dimer calibrator , (22)erba d dimer control n + p , (23)erba d dimer r , (3) properiatory items/reagents/consumable for fully automated esr analyzer model: vasmatic cube 80 make:transasia , (1)vasmatic esr controls normal , (2)abnormal , (3) transponder , (4)esr vaccutainer , (4) properiatory items/reagents/consumables for electronic blood cell counter sysmex xs 800i proprietary items for make : sysmex , (1) cell pack pk dcl , (2) stromatolyser 4dl ffd 200a , (3) sulpholyser sls 220 a , (4) stromatolyser 4ds ffs 800a , (5) cell clean , (6) control xs 800i tri level , (7)pm kit & air pump assembly , (8)solenoid valve lvm11 6a2(av199859) , (9)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (10) tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (11)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (12)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (13)calibrator for 5 part hematology analyzer , (5) proprietary item for machine: reagents for fully automated diferential haematology analyzer,model: xn 10 / xn 1000 / xn 550 / xn 350 make: sysmex , (1)cell pack dcl , (2) cell pack dfl , (3)sulfolyser , (4)flurocell wdf , (5)flurocell wnr , (6)lysercell wnr , (7)lysercell wdf , (8)fluorcell ret , (9)fluorcell plt , (10)cell clean , (11)xn check (tri level) control , (12)xn check bf (l1 3.0ml: l2 3.0 ml) , (13)xn cal(calibrator) , (14)pm kit & air pump assembly for xn series , (15)solenoid valve lvm11 6a2(av199859) , (16)tube polyurethane 1.2mm x 2.5mm(442 5337 3) , (17)tube polyurethane 1.35mm x 3.35mm(442 5331 1) , (18)tube polyurethane 1.8mm x 3.4mm(442 5055 4) , (19)tube silicone 1/32 x 3/32 f7391(442 5279 4) , (6) rajasthan medical service corporation ltd approved items for electronic blood cell counter 3 part, model: abx micros es 60,make: horiba , (1) minidil lmg , (2) abx lyse bio , (2)abx cleaner , (4) minoclair , (5) minitrol 16(2l) , (6) minitrol 16(2n) , (7) minotrol 16(2h) , (8)minotrolcalibrator , (9) printer roll , (7)proprietary items / consumables for urine analyzersmodel: aution eleven ae 4020, make: arkray , (1) aution screen , (2) urine sticks tlt 10 a , (3) aution sticks 10 pa , (8) proprietary items strips for urine analyzers , 1 urine analyzer strips 10 parameters , 2 mas ua dip tube control bi level , 3 uro dipcheck 200 calibration strip , (9)proprietary items /consumables for histopathology slide cover slipper model: clear vuemake thermo , 1 superfrost, microscopic slides ground edge 90 deg, 76x26 mm. , 2 clear vue mountant , 3 cover slip hoppers 24 mmx50mm #1.5 , 4 gemini basket with white slide retainer , 5 gemini basket with black slide retainer , (10)proprietary kits /consumables for hplc machinelaboratories, model d 10,make: bio rad , 1 diabetic control. bi , 2 hemoglobin a2 control , 3 eqas haemoglobin prog , 4 d 10 dual reorder pack , 5 d 10 microvials 0.1x 1.5 ml , 6 d 10 printer paper,1 , 7 d 10 dual a2/f/a1c ca , 8 d 10 dual analytical , (11)proprietary items / consumables for automated cryostat (frozen microtome)model: hm525 cryostat & automated roroty microtome model 355 s, make: thermo , 1 cryomatrix , 2 cryostat oil , 3 mx 25 primer low profile disposableblades , (12) proprietary items / consumables for histopathologytssue embedding station, model: eci 350 make: myr,spain , 1 plastic embedding rings , 2 plastic tissue embedding cassettes with lid , 3 metallic base moulds , 4 histowax , (13) proprietary items / consumables kits for lbc machine model: thin prep 2000 make hologic usa marketed by m/s hemogenomics , (1)complete pack of gyn kits for lbc , (2)complete pack of non gyn kits for lbc , (3)eosin solution0.2% 5 lit , (4)hematoxilin modified( harris, gill ii pap1: 5 lit , (5)papanicolaou 2b orange ii; 5 lit , (6)papanicolaou 2b ea50; 5 lit , (14)proprietaryitemformachine:itemsreagents&consumablesforserum,urineelectrophoresis model:pretty ,make :srl , 1 serum protein kit , 2 alkaline hemoglobins kit , 3 destain solution conc: product code sre 201m , (15)proprietary items /reagents/kits for cytocentryfuge machine model: cytospin 4 make: thermo , 1 tpx reusable chamber with caps , 2 ez mega funnels with filter cards for large vol. samples , 3 double cyto funnels with filter cards , 4 single cyto funnels with brown filter cards , 5 single cyto funnels with white filter cards product code 5991040 , 6 white filter cards , 7 polysine slides for cytology , (16)proprietary reagents &consumables for urine analyzer ,m/s roche diagnostic india pvt ltd , 1 urine analyzer strip compur 10 (roshe) (propriety items for urine analyser) , 2 tharmal paper roll 110 mm , 3 control test mcalibration strip , (17) proprietary reagents / consumablesfor fully automated esr analyzer model: test 1,make : alifax ,marketed by suyog diagnostics , 1 universal card for 10000 tests , 2 universal card for 4000 tests , 3 universal card for 20000 tests , 4 latex control kit 06 test (quality control kit) , 5 latex control kit 30 test (quality control kit) , 6 latex caliber kit 6 tests , 7 pump tube for esr analyzer , 8 capillary tubes , 9 sample aspiration needle , (18) proprietary reagents /consumablesforgel electrophoresismodel: sas 1 & sas2 make : helenabio sciences marketed by suyog diagnostics , 1 rep prep , 2 disposablesample cup , 3 sas – 1 applicators , 4 sas – sp 24 kit , 5 sas – 1ife 4 kit , 6 sas – 1 urine anal sis kit , 7 sas – 1 high res 12 kit , 8 sas – 1 alk phos kit , 9 sas – 1 alk hb kit , 10 sas – 1 acid hb kit , 11 sas – 1 lipo kit , 12 sas – 1 ld vis kit , 13 sas – 1 carbon electrode , 14 sas – 1 metal electrode , 14 sas – 1 sample tray , 15 sas – 1 ife antisera template , 16 sas – 1 gel block remover , 17 electrophoresis staining tray , 18 serum fixative , 19 sas supplementarydestain , 20 sas supplementarywash additive , 21 sas barcode set , 22 lipotrol control , 23 afsa2hemo control , 24 afsc hemo control , 25 kemtrol serum control normal kit , 26 kemtrol serum control abnormal kit , 27 immunofixation control , 28 alk phos control , 29 igg ief control , 30 igd antiserum , 31 ige antiserum , 32 urinetotal antiserum , 33 urine micro antiserum , 34 urine macro antiserum , 35 gam antiserum , 36 free ka a antiserum , 37 free lambda antiserum , 38 kappa antiserum , 39 lambda antiserum , 40 staining dish , 41 incubation chamber , 42 development weight , 43 hbs solubility screening kit , (19) proprietary reagents/ consumables for electronic blood cell counter 5part differential haematology analyzermake: horiba, model: yumizen h2500 , (1) abx basolyse , (2) abx cleaner , (3) abx diluent , (4) abx fluocyte , (5) abx lysebio , (6) abx monoclair , (7) abx minocal (calibrator) , (8)abx nucedif , (9) difftrol (control) normal , (10) difftrol (control)low , (11) difftrol (control) high , (12)minotrol retic(retic control) (2n) , (13) minotrol retic (retic control) (1l1h) , (20) proprietary reagents/ consumables for automated haematology slide stainer model: aerospray haematology pro, make elitech ,marketed by suyog diagnostics , (1) hematology buffer ph 6.8/7.2 , (2) hematology thiazin stain , (3) hematology eosin stain , (4) hematology aerofix additive for methanol , (21) proprietary reagents/ consumables forfully automated haematology analyzer model:elite 580, make: transasia , (1) elite h 580 diluent , (2) elite h 580 lyse 1 , (3) elite h 580 lyse 2 , (4) elite h 580 lyse 3 , (5)h clean , (6)calibrator , (7)control l , (8)control n , (9)control h , (10) pm kit for elite 580 , (22) proprietary reagents/ consumablesfor fully automated coagulation analyser, model acl elite pro, make –instrumentation laboratory, marketed by suyog diagnostics , (1)recombiplastin 2g 8ml (pttest) , (2)synthasil (aptt test ) with cacl2 , (3)fib c (2 ml ) fibrinogen , (4)thrombin time , (5)factor deficiennt viii , (6)factor deficient ix , (7)d dimer , (8)proclot (protein c) , (9)protein s activity , (10)liquid antithrombin acl elite family , (11)factor v leiden (apcr) , (12)drvvt screen , (12)drvvt confurm , (14)vwf antigen , (15)calibration plasma , (16)special level control 1 , (17)special level control2 , (18)normal control , (19)low abnormal control , (20)high abnormal control , (21)la positive control , (22)la negative control , (22)factor diluent , (24)clean a , (25)clean b , (26)wash r (elite) , (27)rotors (elite) , (28)sample cups , (29) d dimer control , (23) proprietary reagents/ consumables for urine chemistry / sediment microscopic analyser model labureader plus 2 & urised minimodel: 77 electronica hungary, marketed by suyog diagnostics , (1)urised cuvette , (2)labustrip u11 urine strips , (3)urinalysis controls 2 levels , (4)dip tube urinalysis + micro 2 levels , (5)urinalysis + micro normal , (6)urinalysis + micro abnormal , (24) proprietary reagents/ consumables for fully automated coagulation analyzer , model: sta compact max make stago , (1)sta neoptimal 5 , (2)sta neoptimal 10 , (3)sta neoptimal 20 , (4)sta c.k.prest 5 , (5) c.k.prest 2 , (6)c.k.prest 5 , (7)fibri prest automate 2 , (8)sta liquid fib , (9)sta fibrinogen 5 , (10)fibri prest automate 5 , (11)sta thrombin 2 , (12)sta reptilase , (13)sta thrombin 10 , (14)d di test , (15)sta liatest d di , (16)sta liatest d di plus , (17)coag control n+p , (18)sta d di control , (19)sta owren koller , (20)sta cacl2 0.025m , (21)sta cleaner solution , (22)sta desorb u , (23)sta cuvettes , (24)fintipps for st art 4 1.25ml , (25)sta steel balls , (26)sta cuvettes , (27)white stirrer magnet for pt(s 0091098) , (28)red stirrer magnet for aptt (s 0091124) , (29)connected pipette , (30)liquid cooling glycol , (31)lamp halogen , (32)maintainance kit compact , (33)yearly additional maintainance kit compact , (34)yearly maintainance kit compact , (35)red stirred magnet for (s 0091124) , (36)ball dispenser , (37)connected pipette , (38)needle arm n 3 with nut b , (39)syringe and o ring , (40)photometry box fan filter , (25) proprietary reagents/ consumables abg analyzer, model nova stat profile phox plus l,make nova biomedical,usa marketed by surgitech , soaking (polishing)solution , reference line: external beze 1 each phox s , sample probe : phox & phox b , po2 sensor, 1 each: phox s , ph sensor,1 each: phox s , pco2 sensor, 1each: phox s , po2 membrance cap kit, 6/bx:phox s , waste tubing harness: external bezel , phox s , so2% calibration ampules: (ampoules) , ph(na+) conditioning solution , po2 membrance cap kit, 3/bx:phox s , reagent pack; phox coox , reagent pack harness:phox coox , glucose sensor (1 each): phox s , na sensor, 1 each: phox+/c/l , potassium sensor phox+/c/l , chloride sensor phox+/c/l , ionized calcium sensor (1 each):phox s , pump harness assembly:phox coox , sample line assy: phox coox , reference sensor,1 each phox s , w/r pump complete tubing assy phox+/c/l/m (inconnector tbgs) , lactate membrane kit (3/pkg): phox s , lactate sensor (1 each); phox s , glucose membrane kit (3/pkg):phox+s , calibrator pack b: phox plus l , calibrtaor pack c; phox plus l , phox+econo, on board qc(tri level) , tri level external qc ampoules (phox plus) , probe: phox & phox plus , lactate membrane kit , pco2 membrane caps , po2 membrane caps , w/r pump complete tubing assy (basic; no connector tubings) lea , air detector , printer paper , (26)proprietary item for machine: ihc antigen, model : montage opus , make: diagnostic biosystem , tris edta retrieval buffer ph 9 (10x) , citrate buffer ph 6(10x) , immuno wash buffer (10x) , hematoxylin kit , dp 3 1 step (10x)de paraffinization solution , proprietary item for machine : karyotyping & fish cytogenetic workstation make: metasystem, model:ikaros , cll panel , xl cll probe kit , xl 6q21/6q23/6cen , xl mdm2 , myelomapanel , xl cdkn2c/cks1b , xl dleu/lamp/12cen , xl igh ba , xl 5p15/9q22/15q22 , xl atm/tp53 , nmyc , tissue pretreatment kit , dapi + antifade , bladder cancer , xce 3/7/17 , xl cdkn2a , sarcoma panel , xl mdm2 , xl etv6 , xl ewsr1 ba , xl mycn amp , xl ddit3 ba , xl ss18 ba , xl foxo1 ba , xl fus ba , glioma , xl 1p36/1q25 del , xl 19p/19q del , xl mycn amp , aml panel , xl t(15;17) df , xl t(8;21) plus , xl mecom 3q26 , or , xl t(3;3) gata2/mecom df , xl tp53/nf1 , xl rara ba , cml panel , xl iso(17q) , or , xl tp53/nf1 , or , xl tp53/17cen , xl tet2 , mm relex fish panel , xl t(4;14) fgfr3/igh df , xl t(6;14) ccnd3/igh df , xl t(11;14) myeov/igh df , xl t(14;16) igh/maf df , xl t(14;20) igh/mafb df , mpn panel , xl fgfr1 , xl 4q12 , xl 5q32 pdgfrb ba , xl bcr/abl1 plus , xl jak2 , prenatal , xa aneuscore ii (xa 13/18/21 + xa x/y) , xa aneuscore (xa 13/21 + xa x/y/18) , all panel , xl bcr/abl1 plus , xl t(12;21) etv6/runx1 df , xl mll plus , xl abl2 ba , mds panel , xl 5q31/5q33/5p15 , xl del(7)(q22q31) , xl del(20q) plus , or , xl 20q12/20qter/8cen plus , cen 8 (if xl del(20q) is used) , lung cancer , xl alk ba , xl ros1 gopc ba , xl egfr amp , e blood collection tubes & vacutainer , clot activator for serum vaccum tube with gel 3.5 ml, 13 x 75mm with yellow cap , clot activator for serum with gel 5 ml, 13 x 100 mm with yellow cap , evacuated blood collection tube with spray dried k2edta with lavender cap , sodium citrate evacuated tube with tube in tube technology sealed from the top to avoid citrate leakage for coagulation test with vacuum (with na citrate 0.109 mi 3.2%) , evacuated tube for silica clot activator/silicon coated made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol.4.0 ml. , blood collection needle 21 or 22 gauge with cap for evacuated tube. , blood collection needle 21 or 22 gauge with cap and safety lock for evacuated tube. , evacuated tube for spray coated with sodium fluoride (3mg.), na2edta (6mg.) made of clear latex polyethylene terephthalate with hemogard 13 mm x 75 mm, vol. 2.0 ml. , evacuated tube needle holder , blood lancet for high blood flow. , complete blood collection kit , paediatric collection products , clot activator paediatric blood collection tubes with cap for serum , paediatric blood collection tubes with spray dried k2 edta. , safety lok blood collection and infusion set with luer adapter. manually activated safety shield to fully cover needle for paediatric and microbiology. 21g x 0.75 inch needle x 12 inch tubing. , urine sampling products , kit for routine urinalysis , urine kit for culture & amp , other items / miscellaneous items/plasticwares make accumax(p’fact), axiva,starlab,eppendrof , adhesive tape/ micropore , aluminum test tube rack (12 hole) , anti human globulin (coomb’s test) , auto pipette tips 1 ml fix , auto pipette tips 10 ?l , auto pipette tips 100 ?l , auto pipette tips 100 1000 ?l , auto pipette tips 2 ml fix , auto pipette tips 5 ml fix , auto pipette tips 10 ml fix , auto pipette tips 200 1000 ?l variable , auto pipette tips 20 200 ?lvariable , auto pipette tips 50 ?l , bone marrow aspiration needle (jamshidi) , bone marrow aspiration needle(salah’s)ss , bone marrow aspiration needle (disposable) , lumber puncture needle (disposable) , bovine albumin 4% higher titer will be preferred , diamond pencil export quality , disposable needle 22 g , disposable needle 24 g , disposable latex rubber gloves 6.5” , disposable surgical blade/ scalpel blade (22 no) , disposable surgical gloves latex rubber 6.5” , disposable surgical gloves latex rubber 7.0” , disposable surgical gloves latex rubber 7.5” , disposable syringes2 ml , disposable syringes5 ml , disposable syringes 10 ml , disposable syringes 20 ml , disposable needle 22 g , disposable needle 24 g , esr kits. 10 tubes with cups and stand , filter papers (whatman) no 1 , glass marking pencil red , glass marking pencil white , l.p.needle 22g x 2.5 inch , l.p.needle 22g x 2.5 inch , spirit lamp (ss) , litmus paper (indicator paper red ) , litmus paper (indicator paper blue) , micro pipette 1000 ?l , micro pipette40 200 ?l variable , micropipette 20?l fix , micropipette 50?lfix , micropipette 10?l fix , micropipette 100?lfix , micropipette 5ml fix , micropipette 1ml fix , micropipette 2ml fix , improved neubauer chamber , plastic bucket 50 lit with lid , reagent rack plastic , polythene bagsyellow, blue, black for bmw , pregnancy test (hcg card test) , stethoscopes , sticker for cytology size (2 x 1.5 cm) , stop watch , syringe cutter / needle destroyer isi mark , tournicates , tissue paper roll , lens cleaning tissue paper ( kimwipes) , urine container (plastic) non sterile 50 ml , urine strip for albumin & sugar , urine strip for pregnancy test , urine strip for ketone bodies & sugar , urine strip for micro albinuria (micral strips) , urine strip for multiple test (7 parameter) , urine strip for occult blood , vacutainertubes 5 ml (blood collection vial edta) , wooden spatula pap smear (ayre) , cyto brush for pap smear , thermal paper roll 75 mm , thermal paper roll 110 mm , bone marrow patient entry register , urine reporting form , cytology reporting form(fnac) , cytology entry register (fnac) , cytology fluid entry register , cytology entry register (pap’s) , cytology reporting form(pap’s) , urine test entry register , fnac sticker , hematology entry register , hematology cbc reporting form , reporting form csf , hematology reporting form stool , reporting form bone marrow , histopathology entry register , histopathology reporting form , histopathology requisition form , histopathology slide sticker , outdoor patient entry register , hand wash soap , washing powder , ream/zerox paper , duster clothe , nitrile gloves powder free length 9.5 inch, s, m, l , nitrile gloves powder free length 12.0 inch, s, m, l , (g.) list of glassware , micro glass slides, polished edges, lint free (transparent) size 75x25x1.25mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 75x25x1.0 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.25 mm 50 slides in each pkts , micro glass slides, polished edges, lint free (transparent) size 76x26x1.0 mm 50 slides in each pkts , cover slip english glass/imported lint free smooth edges (transparent) size 22x50 no. 1 , cover slip english glass/ imported lint free smooth edges (transparent) size 22x50 no. 0 , cover slip english glass/imported lint free (transparent) size 22x22 no. 1 , cover slip english glass/imported lint free (transparent) size 22x22 no. 0 , cover slip english glass/imported lint free (transparent) size 18x18 no. 1 , cover slip english glass/imported lint free (transparent) size 18x18 no. 0 , high profile microtome disposable blade (50 blade each pkt.) , low profile microtome disposable blade (50 blade each pkt.) , rubber teat for dropper , dropper big size (glass) , dropper medium size (glass) , capillary tubes (micro) , test tube brush , beaker with spout 1000 ml , beaker with spout 500 ml , beaker with spout 50 ml , conical flask flat bottom500 ml , measuring cylinder graduated 1000 ml , measuring cylinder graduated 500 ml , measuring cylinder graduated 100 ml , funnel (big) , funnel (medium) , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x10x20cm , museum jars ( acrylic, clear transparent with inner plate & molded lid )size 15x12x20cm , reagent bottle 2000 ml , reagent bottle 60 ml , reagent bottle 120 ml , reagent bottle 250 ml , reagent bottle 500 ml , reagent bottle 1000 ml , canada blossom bottle 20 ml , couplin jar , wash bottle plastic 500 ml , urino meter , esbach’s albunometer , hb tube round top/gdr,isi mark (sahli,s) , hb pipette 20? top isi mark with rubber teat (sahli) , pertidish 110 mm(glass) , rbc pipette top/gdr isi mark , wbc pipette top/gdr isi mark , stirrer for h.b.meter (sahli) , test tubes 12x75 mm(glass) , test tubes 12x100 mm (glass) , test tubes 18x150 x1.2mm with rim (glass) , bulb for microscopes halogen (6v 12 w) make; philips, labomed , h. other items with specifications , hemocytometer improved, , haemoglobbino meter ( sahali method) , slide box (plastic) 50 slides capacity . , slide box (plastic) 100 slides capacity. , slide tray (aluminium)....

Jhalawar Medical College and SRG Hospital - Rajasthan

37822348 tender for rate contract for general items for vrdl / rtpcr lab at medical college and hospital jhalawar 1 microbiology 2 absorbent paper roll 3 absorbent paper sheet 4 aluminum foil 5 autoclavable pp plastic racks for 96 places 6 bags, biohazard, (transparentautoclavable 7 cetylpyridinium chloride (cpc) for bioch emistry mw 358.01>98% 8 cold chain box (12 lit.) 9 cotton roll 10 diamond pencil 11 di sodium hydrogen phosphate 12 disposable head caps 13 disposable lab gownspp (large and medium) 14 disposable shoe cover 15 disposable syringes 5 ml (22 & 24 gauge) 16 dnase/rnasesurface decontaminant 17 dropper bottle 18 droppers, sterile, plastic 1.5 ml, graduated 19 droppers, sterile, plastic 3.0 ml, graduated,disposable 20 edta 21 ethanol 95% 22 filter paper 23 fluorescent staining kit for afb 24 formaldehyde 25 glass funnel 26 gloves nitrile, size s m l 27 gloves, latex size s m l 28 glycerol 29 hydrochloric acid, fuming (37%) 30 hydrogenperoxyde 30% 31 immersion oil 32 laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab 33 laboratory thermometer 34 l asparagine 35 lint free soft tissue 36 liquid dispensingwash bottle plastic (500ml) 37 lj medium base powder ready mix 38 loop, disposable 10 µl 39 loopholder 40 loopholder rack 41 magnesium sulphate 42 malachite green 43 mask (disposable surgical) 44 mccartney bottle 15 ml 45 mccartney bottle 7 ml 46 mcfarland standard set 47 micro pipette stand pipette stands for 5 pipettes 48 micropipette tips nuclease& pyrogen free & aerosol barrier (0.1 20µl) maximum recovery/minimum retentionfiltered, racked, sterile 49 micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery/minimum retentionfiltered, racked, sterile (100 1000µl) 50 micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery/minimum retentionfiltered, racked, sterile( 2 200µl) 51 molecular grade ethanol 52 molecular grade isopropanol 53 n95 respirators (niosh approved) 54 na acetate 55 n acetyl l cysteine (nalc) powder 56 naphthyl ethylendiamine 57 needle destroyer 58 niacin strips 59 nichrome wire 60 nicotinamide 61 parafilm 62 pcr tubes flat snap cap 0.2 ml 63 pcr tubes strip with flat cap optical for rtpcr 0.2 ml 64 phenol 65 plastic racks (15 ml tubes) 66 plastic racks for 15 ml conical falcon tubes 67 plastic racks for 2 ml mct, autoclavable, 68 plastic racks for 50 ml conical falcon tubes 69 plastic storage box for0.2 ml pcr tubes with lid 70 plastic storage box with lid for 2 mlcryovials 10x10 71 potassium dihydrogen phosphate 72 potassium permanganate 73 sample collection container sterile 74 cryovials 75 screw cap(hinged) mct tapered(1.5ml ) 76 slide drying racks 77 snap cap (hinged) mct tapered(1.5 ml ) 78 snap cap (hinged)mct roundbottom (2 ml ) 79 sodium chloride, nacl 80 sodium hydroxide, naoh 81 sodium hypochlorite solution 82 sodium nitrate 83 spray bottles sprayldpe 500 ml 84 spray bottles plastic pp 250 ml 85 sputum container 86 staining bottle 87 staining rack 88 sterile blue tips bulk (1000µl) 89 steriletips bulk (10µl) 90 sterile yellow tips bulk (100µl) 91 sulfuric acid, concentrated 92 sulphanilamide 93 test tube rack pp for vtm tubes 94 tissue roll 95 torniquet 96 tri magnesium di citrate 97 tube, centrifuge, 15 ml with screw cap 98 tube, centrifuge, 50 ml with screw cap 99 tubes cryovial, sterile with screwcap, 2 ml 100 tubes reaction, 2 ml 101 universal bottle for cultures, 28 ml 102 water molecular biology grade 103 xylene 104 zinc powder 105 zn acid fast staining kit 106 autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 ml cryovials 107 autoclavable pp racks for 1.5 ml mct 48 samples (24 pieces) ...

Medical Health And Family Welfare - Rajasthan

37421256 to purchase pathology lab reagents under the mukhymantri nishulk janch yojna ( mnjy ) , s. creatinine kit ( for semi auto ) , s. glucose , s. creatinine kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. cholestrol kit ( for semi auto ) , s. bilirubin t kit ( for semi auto ) , s. bilirubin d kit ( for semi auto ) , s. urea kinetic , urea berthlot ( end point ) , urea berthlot ( end point ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. sgot kit ( for semi auto ) , s. sgpt kit ( for semi auto ) , s. alkaline phosphatage kit ( for semi auto ) , s. total protien ( for semi auto ) , s. albumin ( for semi auto ) , s. ldh ( for semi auto ) , s. ldh ( for semi auto ) , s. amylase ( for semi auto ) , s. amylase ( for semi auto ) , s. uric acid ( for semi auto ) , s. calcium kit ( for semi auto ) , s. calcium kit ( for semi auto ) , s. ck nac ( for semi auto ) , s. ck mb ( for semi auto ) , s. ck mb ( for semi auto ) , s. triglyceride kit ( for semi auto ) , s. triglyceride kit ( for semi auto ) , hdl direct , s. hdl cholestrol ppt , biochemestry control , erba xl wash , chloride , gamma gt , lipase , phosphorus , cystatin c , csf protein test , hemocysteine , afb stain ( ready to use ) , autoclave tap 1 ( thermopile spors ) , acetone liquid , aluminium foil , ayer spatulla disposable ( sterile ) , absolute alcohal 99 % , adhesive tap 0.5 inch , aslo kit , anti abd , ahg ( anti human globulin ) vial , ahg ( anti human globulin ) vial , anti a1 , acetic acid galcil 5% , buffer bottle , blotting paper sheet , bleeching powder , banedict solution , blood mixer , beakar glass , beakar glass , bovine albumin , bovine albumin , bovine albumin 22% , bovine albumin 22% , bd vaccutionor blood collection needle 21, 22 , blood collection tube for esr black cap 4 ml. , capillary tube , chickengunia cards igg igm , crp kit , cover slip 22x60x.4 mm. ( blue star, gem, top only ) , cover slip 22x50x.4 mm. . ( blue star, gem, top only ) , cover slip 22x40x.4 mm. . ( blue star, gem, top only ) , cover slip 20x25x.4 mm. . ( blue star, gem, top only ) , cover slip 24x60x.4 mm ( blue star, gem, top only ) , cover slip for neubauer chamber 1mm thick , copper sulphate powder , copper sulphate powder , copper sulphate powder , chloroscope with reagent , coplin jar , cell for gluometer , cover slip 18x18 mm ( blue star, gem, top only ) , cell counter for dlc 8 key , clot activator vial red cap 4 ml. , clot activator vial red cap 6 ml. , diastix , disposable needle 22 mm , disposable needle 24 mm , disposable syringe 5 ml. , disposable syringe 10 ml. , disposable droper , disposable gloves 6 , disposable gloves 6.5 , disposable gloves 7 , disposable gloves 7.5 , dropping bottle plastick 100 ml. , dropping bottl plastick 500 ml. , dpx mount , diamond marker , drabkin’s solution and control solution , distilled water , dengue test kit ( ns1 igg igm combopack by rapid card test ) , dengue elisa test kit ( ns1 ) , dengue elisa test ( igm ) , dengue rapid card ( igg, igm ) , esr fluid ( sodium citrate ) , esr tube ( pippate ) disposable , esr ( pippate ) glass with cap disposable , edta powder , eosin stain , ethylalcohol absolute , eosinophil diliuting fluid , field stain a , field stain b , forceps ( simple ) , jsb stain i , jsb stain ii , flask glass ( borosil ) , flask glass ( borosil ) , fnac plunger , fixative for cyotology ( 99% methanol ) , filter paper , formaline , glass marking pencil ( red ) , geimsa stain , geimsa stain , glycrine , gel activator vial 4 ml. , gel activator vial 8 ml. , hypochlorite 5% solution , hbsag rapid test cards , hb tube square , hb pippate , heamatoxyline mono hydrted ms reagent , hand sanitizer , hand sanitizer , k3 ( cbc ) vial double cap , k3 ( cbc ) vial single cap , koh solution , liquid parrafin , lugols iodine , leishmen’s stain , liquid cleaning agent for glass / plastic , liquid hand soap ( savlon ) , liquid hand soap ( dettol ) , liquid hand soap ( lifeboy ) , lancet , lens paper , multi stix , micro tips 5 20 ul , micro tips 200 ?l , micro tips 1000 ?l , micro glass slide 1.33mm ( blue star, gem, top only ) , micro glass slide 1.25mm ( blue star, gem, top only ) , micro glass slide76x26 mm ( blue star, gem, top only ) , micro pippate fix volume 10?l , micro pippate fix volume 20?l , micro pippate fix volume 50?l , micro pippate fix volume 100?l , micro pippate fix volume 500?l , micro pippate fix volume 1000?l , micro pippate varible 10 100 ?l , micro pippate varible 100 1000 ?l , micro pippate stand plastick , macountoss , face mask disposable , new methehylne bluefor reticulocyte stain , methehylne blue1% , n / 10 hcl , improved neubaurs chambar ( counting chambar ) , nitric acid ( hno3 ) , oil imersion lens , pt vials , pcv tube , papnaculer stain ready to use , plastic dropper , pasture pippate , propyle alcolhal , platelet diluting fluid , ppe kits , ph paper strip , prob cleaner for cbc machine accurex , paper roll for semi auto anaylser 4.5 , reporting cbc paper roll50mm x 20m , reporting cbc paper roll57mm x 20m. , reporting cbc paper roll 57mm x 10m. , rubbur bulb b dropper , ra factor kit , rapid malaria test cards ( antigen ) , rapid malaria ( antigan , antibody ) combopack , sulphar powder , semiauto anylaser printer roll , sticker for sample vials , sample vial with cover 5 ml , sample vial with cover 10 ml. , staining reactanguler beaker , staining rack , spirt lamp , test tube glass 3 inch ( 12x75 ) borosil , test tube glass 4 inch ( 12x100 ) borosil , test tube pvc 2 inch , test tube pvc 3 inch , test tube pvc 4 inch , test tube pvc 6inch , tlc fluid , tec fluid , trbc fluid , tissue paper roll , tourniquit , test tube stand plastic for 48tubes , test tube stand plastic for 100 tubes , trop t rapid test card , thromboplastin ( pt reagent ) , test tube cleaning brush , thermacol box , digital thermomater with sensor for regrigetor , tongue depresser disposble , urine pregnancy strips , urine pregnancy cards , uristicx , urine pots with label and cover 30 ml. , urine anyalser paper roll 57mm x 10mtr , vdrl test kit , vdrl card , vdrl rapid test strip , vtm ( viral transport media ) , vacctuainer plane 4 ml. , vacctuainer plane 8 ml. , vacctuainer k2 edta 4 ml. , vacctuainer k3 edta 4 ml. , widal slide kits ( 4x5ml. ) , widal tube agglutation reagent , wbc diluting fluid , widal card , wintrobe tube esr , xylene , zeeper plastic 6 inch , zeeper plastic 8 inch , z n stain , psa kit , psa kit ( elisa method ) , aluminum ammonium sulphate hydarted , acetic a , glacial acetic a , ammonium hydride 1% , eosin yellow a , eosin yellow b , light green sf , potash alum , timer electronic , slide cabinet ( 100 slide ) , slide staning bucket with handle , slide box , measuring cylinder glass and silikon 50 ml. , measuring cylinder glass and silikon 100 ml. , measuring cylinder glass and silikon 500 ml. , measuring cylinder glass and silikon 1000 ml. , hcv card ( rapid test ) , cuscos speculun , mask n 95 , glucostrip for glucocare sence glucometer , glucostrip for bio sence glucometer , disposable pap smear kit , anit a , anit b , anti d , sargical mask 3 layer , lysol 50% , digital thermomater for refrigertor with display , sprayer bottle 500 ml. / 1000 ml. , beakar glass 100 ml. , covid 19 rapid card , pencil cell for glucometer / timer , ketostx , paper roll for pt anaylser ( 116mmx20 mtr. ) , torrniquet belt, tubler ( cotton material flexible ) , hiv rapid test card , gram stain , serum magnisium test kit , serum lithium test kit , csf protin test kit , csf chloride test kit , csf suger test kit , urine total protin test ( 24 hour ) test kit , acid phosphatase test kit , accu chek glucometer strip , glucocare sence glucometer , bio sence glucometer , ggt test kit , x press glucometer , x press glucometer strip , glucometer spark , glucometer spark strip , control d glucometer , control d glucometer strip...

Medical College - Rajasthan

37282339 tender for supply of various type of test kits and consumables for pathology department 1 syringe (5 ml) 2 syringe (10 ml) 3 syringe (2 ml) 4 glass slide 76mmx width 26mm+0/ 1mm 5 filter paper 42 no. whatman 6 cedar wood oil 7 lancet 1x 200 8 methnol 9 deionisedwater 10 ketone body strip urine 11 urine stick for alb. sugar 12 tissue paper roll 5 mtr. 13 sod. nitropurside 4% 14 eshach,s reagent 15 oil immersion lens imported can befit in existing microscope 16 capillary tube 17 tourniquet 18 xylene 19 sulphar powder 20 adhesive roll 21 disposable plain vial 12x110 mm yellow colour (label printed p.b.m. hospital, bikaner) 22 disposable plain vial 12x110 mm blue colour (label printed p.b.m. hospital, bikaner) 23 disposable plain vial 12x110 mmred colour (label printed p.b.m. hospital, bikaner) 24 halogen blub (6v 20 walt) 25 acetic acid 26 semen diluting fluid 27 thermal paper 27x54(cbc roll) 28 thermal paper 20x54(cbc roll) 29 field stain a & b 30 haemoglovino meter 31 antisera for grouping a,b,d 32 hydrochloric acid 33 disposable gloves 6.5 34 disposable gloves7 35 disposable gloves7.5 36 yellow tips 37 disinfection hand wash 38 nitric acid 39 esr cup (tip top) 40 plastic droper big 41 micro cover glasses (cover slip) 22x22 mm 42 esbach albumeno meter 43 normal saline 44 urine analyzer strip with urine analyzer 16 pera meter 45 urino meter 46 reticulocte count stain 47 ehrlich reagant 48 liquid parafin 49 disposable esr tube with vial 50 leishman stain powder 51 wbc & rbc pipette 52 sodium citrate testtube 53 8 kev manual cell counters 54 leishman stain solution,liquid 55 micropipette 20,50,100 56 hemocytometer 57 suger strip 58 cbc vial purple cap k3 edtawith safety cap( label printed p.b.m. hospital, bikaner) ...

Sardar Patel Medical College - Rajasthan

37244157 supply of various type of test kits and consumables for pathology department syringe ( 5 mii 2. syringe ( i0 ml ) i synge ( 2 ml ) 4. glass slide 76mnx iidth 26mm+o / lmmin ricrips4anian _.. . cedar wood oil aancet i x 200 . methnol 9. deionised water ‘•. keaonebody strpurine n . i. urine stick for aib. sggar 12. tissue paper roil 5 mtr. u. sod. nitropurside 4% 14. eahach, s rrent oii immersion lens imp ( ) rtei ) can beti in existing i’ capiliary tube 17. tournmquet ‘a. xylene ‘. sulphar powder i. adhesive roll 21 disposable plain vial i2xi 10 mm yeliow colour ( iabel p!jtcd p.n.m. hospital. rikaner ) 21 disposable plain vial l2x1 i0mm biue colour ( iabel printed p.13.m. hospital, bikaner ) , 26. semen diluting fluid 27. [ hermnl paper 27x54 ( crc’ roll ) 28. lhermalpper_20x54 ( cic roli ) 29. field stain a & b .w linernoglovino_meter 31. antisera_forgroupingab.d 32. i ivdrochjoric atid . 33. disposable gloves 6.5 . pli ble gloves 7 . 35 disposable gloves 7.5 36. yellow tips 37. disinfection hand wash 3s. nitric acid 39. esr cup çrip top ) 4°. fiasticedro 41. micro cover glasses! ( cover slip ) 22x22mm 42. esbach albumeno meter 43. urine analyzer sirip wiih urine analyaer 16 pera meter 45 llrino!meter 46. reticulocte count stain 47. ehrlich reagant 48. liquid parafin 49. disposable esr tube.with vial, etc., ...

Medical And Health Services - Rajasthan

37192252 tender for mnjy lab x ray ecg test good purchase & bio medical items 1 2 preg card uristix four parameter 3 uristix albu@sugar 5 sample vial clot activator k3vial double cap edta vial 6 7 sugar kit erba2 / 200 urea kit5 / 20 8 9 sgotkit5 / 20 sgptkiterba5 / 20 10 serum aukuine phospate kit erba 5 / 20 11 12 13 14 15 bilirubin.kit 2 / 2 / 60 erba creatinine kit 2 / 2 / 60 erba 5 cholestrolkit 5 / 30 erba vdrl test kit sd hbsag testekit sd — 16 hdl chlestrol 2 / 50 erba 17 triglisride test kit 5 / 50 18 19 total protein kit 5, / so erba albumine kit 5 / 50 erba 20 21 22 gloco strip ijesman_solution 500 xylene 500 23 rbc diluting fluid 500, 24 wbc diluting fluid 500 25 sooium citrate 3.8 / so0 26 n / 10hcl500 27 tissue_paper roul 28 urine container 29 vidal test kit becon / span / arkray 3° glass slide 31 cover slip 32 lencet 33 test tube without cap rai vial 34 sugar vial disttle water 5 litter jsbn1 37|jsblii, 38 cappliary tube 39 heamocue strip 40 anlayzer printer roul 41 cell counter printer roll 42 filter paper 43 hiv kit esr tube 5 liquid parrafin oil 46 minidil2oltrhoriba .._ 47 abx_lyse blo 1 ltr horiba ‘ lyse cleanr 1 ltr horiba 49 monoclalr 500 ml horiba 50 minotrol s1 sulpher_power 52 blood group kit span / arkrey 53 blue.tips yellow tips 55 tunigate 56 esr disposable toptech 57 urine multisticks strips s8 micro piptte 10 100 59 micro piptte 100 1000, etc....

Medical Health And Family Welfare - Rajasthan

37117560 supply of lab regents / x ray / ecg under mnny ( investigation ) 1 antihuman globulin 2 anti sera abd 3 aso test 4 blood collection beg 5 blood collection beg pead 6 blue tips 7 yellow tips 8 capillary tubes 9 cover slip 10 crp test 11 distilled water 12 esr tube set disposable 13 glass marking pencil 14 glass slide 15 glycerine 16 hb estimation cardl / hemocue 17 hb pipette 20 micro 18 hepatitis b card 19 hepatitis c card 20 hiv tridot kit / triline 21 hytrogen proxjde 30% 22 jsb l stain 23 jsb 2 stain 24 k 3 edta blood collection via l 5 m ltube 25 labopol 26 lancet 27 lugols iodine 28 malaria card test ( jmitra ) 29 methanol 30 microprotein 31 multistix ( alb+sug+spgravity+ph+b.salt / pigment ) 32 n / 10 hcl 33 parafin oil 34 ra factor test 35 sodium hydrochloride 10% 36 strip for acetone detection in urine 37 sulphur powder 38 test tube glass 10x100 mm 39 test tube glass 12x100mm 40 sahils hb tube round 41 test tube glass 12x80 mm 42 tes ttube plastic 12x100 mm 43 tissue paper roll 44 typhydot test 45 urine pregnancy test card 46 uristix ( alb+sug ) strip ( siemens ) 47 vdrltest strip 48 widal test 49 xylene 50 hb meter ( squar bottom ) 51 hbtube ( squar bottom ) 52 filter paper 53 hiv kit for elisa 54 hbsag kit for elisa 55 vdrl kit for elisa 56 dengue kit for elisa lgm sd 57 micro pipette 0 100 micro. it. 58 micro pipette 100 100 micro. it. 59 micro pipette 5 micro. it. ( fix ) 60 micro pipette 10 micro. it. ( fix ) 61 micro pipette 500 micro. it. ( fix ) 62 staining jar 63 scrub typhus rapid test kit 64 scrub typhus elisa kit 65 chikunguniya rapid test kit 66 chikunguniya elisa kit 67 plastic container for urine sample collection 68 dengue ns 1 lgg & lgm detection rapid test ( jaimitra ) 69 slide dry rack 70 blood bag tripple 71 plastic test tube rack 72 timer 73 microscope blub 6v 20wgu ( low voltage halogen lamp ) 74 abx diluent mini ( horiba 3 part hematology analyzer ) 75 abx lyse bio ( horiba 3 part hematology analyzer ) 76 abx cleaner ( horiba 3 part hematology analyzer ) 77 abx minoclair ( horiba 3 part hematology analyzer ) 78 horiba 3 part hematology analyzer control regents 79 fluid pack 80 daily rinse kit 81 electrode 82 b.sugar ( erba machine ) 83 b.urea ( erba machine ) 84 s.albumin ( erba machine ) 85 s.alk.phosphatase ( erba machine ) 86 s.amylase ( erba machine ) 87 s.bilirubin ( erba machine ) 88 s.calcium ( erba machine ) 89 s.cholesterol, liquid form ( erba machine ) 90 s.creatinine ( erba machine ) 91 s.hdl cholesterol ( erba machine ) 92 s.hdl cholesterol, direct method, ( erba machine ) 93 s. ldh ( erba machine ) 94 s.triglyceride, liquid form ( erba machine ) 95 s.uric acid ( erba machine ) 96 sgot, liquid form ( erba machine ) 97 sgot, liquid form ( erba machine ) 98 total protein ( erba machine ) 99 ck nac 100 ck mb 101 sodium citrate collection vial ( 3.2% ) 102 uniplastin regent 103 sprit 104 diamond marker 105 carbol fuchsin 106 h2so4 25% 107 methylene blue 108 babmoo sticks 109 blood sugar strips 110 immersion oil 111 digital x ray film, fuji di hl ( blue base ) 8*10 112 digital x ray film fuji di hl ( blue base ) 10*12 113 digital x ray film carestream 8*10 114 digital x ray film carestream 10*12 115 dental x ray film 116 ecg roll ) , contec 117 ecg roll ( comen 1200a ) 12 channal 118 ecg roll bpl single channal 119 ecg gelly 120 bp instrument ( mercurial ) 121 bp monitor ( digital ) 122 developer 123 needle holder 124 edta vaccutainer vial 125 vaccutainer plain 126 vaccutainer needle 127 cbc roll ( for horiba 3 part machine 57x10 ) 128 semi auto analyzer printing roll for stat fax 300 a 129 fixer...

Ministry Of Defence - Rajasthan

36978500 bids are invited for methyl isobutyl ketone , acetyle acetone , xylene , ethyle acetate 25 liter plastic barrels , 25 litre isopropyl alcohol packed in hdpe drum...

University Of Agriculture - Rajasthan

36885038 tender for supply of laboratory chemicals and accessories 1 ethyl acetate pure, 99%ar 2 3 p anisaldehyde gallic acid monohydrate 4 acetic acid glacial ar s hydrochloric acid abt.35% pure 6 hydrogen peroxide 7 magnesium carbonate, light 8 nitric acid mi. 69% pure 9 orthophosphoric acid 10 petroleum ether 40 60rc ar 11 potassium dihydrogen phosphate anhydrous 12 saponin ( from plant ) 13 sodium carbonate anhydrous ar 14 5 sul phosal icylic acid dihydrate trichloroacetic acid folin ciocatteu reagent ( ml ) thioglycolic acid, 80% solution in water coomassie brilliant blue g 250 19 phytic acid sodium saft 1og acetic anhydride 2, 2 bipyridine , 22 citric acid anhydrous 23 perchloric acid _______. c 24 sodium hydrogen carbonate 25 tannic acid 26 sodium hydroxide powder 27 acetone 28 chloroform ar 29 bovine serum albumin 30 acrylamide:bisacrylamide ( 19:1 ) 31 32 ose special, low leo bind silane chloroform 33 34 diphenylamine_reagent 35 dithiothreitol ( dtt ) 36 fehling solution a 37 fehling solution b 38 glucose 39 glycerol 40 iodine solution 41 mg acetate 42 molisch reagent 43 n, n, n’, n’ tetramethylenediamine ( temed ) 44 ninhydrine 46 polyethylene glycol 47 potassium acetate 48 proteinasek 49 sodium acetate anhydrous 50 sodium bicarbonate solution 7.5% 51 trisodium citrate ( g ) 52 25mm mgci2 53 phenol crystal 54 6x gel loading dye 55 xylene cyanol 56 sodium phosphate dibasic anhydrous 57 sodium phosphate monobasic anhydrous 58 benedict reagent 59 picric acid 60 buffer capsules ph 40±0.05 61 buffer capsules ph 7.0±0.05 62 buffer capsules ph 9.2±0.05 63 triton x 100 64 tween 80 ( g ) . e 65 ethanol 66 micro tips ( 0.2 1o ul ) 67 micro tips ( 2 200 pl ) 68 micro tips ( 100 1oo0 u1 ) 69 micro tips ( 5000 pl ) , etc....

Medical Health And Family Welfare - Rajasthan

36750465 supply of chemical regents in xray sonography and blood bank in govt hospital chittorgarh , x ray, & sonography items , computerize digital x ray film 8 x 10 , computerize digital x ray film 11 x 14 , digital x ray cassets 14x17 , digital x ray cassets 14x14 , digital x ray cassets 10x12 , sonography paper roll , sonography jelly , e.c.g. jelly , e.c.g. paper roll bpl , biochemistery reagent , blood suger ( end point ) , blood urea ( fixed time ) , blood urea ( brith lot ) , s.creatanine ( fixed time ) , cholestrol ( end point ) , triglyceride ( end point ) , hdl reagent direct , bilirubin t&d ( end point ) , sgot ( kinetic ) , sgpt ( kinetic ) , alkaline phosphatase , s. a. phosphatas , amylase , uric acid , s. ldh , s.ck mb , s.ck nac , calcium , albumin , total protine , crpquantitative , crp qualitative , rf factor , raquantitative , bio chemistery reagents for fully autometic , wash 1 , wash 2 , blood sugar , blood urea , blood creatinine , blood cholesterol , blood triglycerides , hdl , blood bilirubin total , blood bilirubin direct , blood s.g.p.t. , blood s.g.o.t. , blood total protein , blood albumin , alk. phos. , uric acid , calcium , amylase , ck mb , ck nac , ldh , crp , auto wash , xl wash , erba norm , xl multical , albumin , alkaline phosphatase , bilirubin direct , bilirubin total , calcium , creatinine enzymatic , creatinine jaffe , cholestrole , glucose ( god pod ) , glucose hexokinase uv , total protein , triglyceride , crp , sgot el , sgpt , amylase , urea , uric acid , hdl cholesterol with calibrator , ldh p , phosphorus , rapid test , hbsag , hcv rapid , dengue combo ns1 antigen+lgg 1gm antibodytest , dengue antibody test , malariyaantigen test , pregnancy test , thaypi dot test , scrub thypus igm antibody test , chikungunya igm antibody test , vdrl test strip , urine albumin sugar test , urine analyser test strip 10 paramiter , leptospirosis rapid kit , hepatitis a , hepatitis e , typhoid iggigm , elisa test kit for lab , dengue ns1ag microlisa , scrub typhus igm elisa , chikungunya igmelisa , dengue 1gm microlisa , leptospirosis elisa kit , reagents for 5 part hematology analyser ( trans ) , h 560 diluent , h 560 lyse 1 , h 560 lyse 2 , h 560 elite h clean , h 560 controls ( h, n, l ) , h 560 calibrator , control h , control n , control l , calibrator , reagent for 5 part hematology analyser ( mindray ) , m 52 diluents , m 52 diff lyse , m 52 lh lyse , probe cleaner , calibrator , control low , control high , control nusmal , reagent for 3 part hematology analyser ( mindray ) , m 30 diluents , m 30 diff lyse , m 30 lh lyse , probe cleaner , reagents for ecl 105 , erba protime ls , erba actime , erba calcium chloride , erba ddimer , erba ddimer calibrator , erba ddimer control n+p , erba single reaction cuvettes src 10 , thermal printer paper rolls 3x57mmx15m , test kit forictc ( subject tonacoapproved ) , hiv tridot , hiv triline , hiv comb aids , rekteble neddle , vacuum 3.8 % sodium citrate esrblood collection. tube , floride blood collection vail , blood sample trensport vail ct gel , elisa kits for blood bank ( subject tonacoapproved ) , h.i.v.kit , h.c.v. kit , hbs ag. kit , reagents for blood bank , bovine albumin , anti a1b , anti “a1, ( lectin ) , anti “h” , anti “d”. igg+igm ( monoclonal ) , anti humen globuline ( ahg ) , blood grouping anti sera abd , r.p.r. test ( latex ) , cpda blood collection bag 350 ml , cpda blood collection bag 100 ml , cpda blood collection bag ( triple ) 350 ml , cpda blood collection bag ( triple ) 450 ml , cpda blood collection bag ( double ) 350 ml , cpda blood collection bag ( penta ) 450 ml , screw cap vial plain 5 ml , tourniquit belt ( standred quality ) , glass droper ( pauster pipet ) , hb haemocue 301 cuvet ( a meter and a lancet will be givenat free of cost on purchase of every 1500 microcuvettes ) , serology kits , r.a. factor , widal test , crp test qualitative , aso test , microbiology , mac conkey agar with 0.15% bile salts, cv and nacl 500 gm , nutrient agar , cled agar , sulfide indole motility agar , kovacs indole reagents , mannitol powder , glucose powder , lactose powder , sucrose powder , hydrogen peroxide 3 / 6% , oxidase reagent , mueller hinton agar , sda with chloramphenicol , crystal violet powder , agar powder bacteriological grade , thioglycollate powder , acetone , grams stain kit , hi chrome agar for candida 100 , potassium hydroxide , sda , lactophenol cotton blue , capsule stains , cary blair medium , safranin stain , lowenstein jensen powder , ferric chloride powder , bile esculine agar , peptone powder , selenite f broth powder , india ink or nigrosin , methylene blue stain , glutaraldehyde , ethylacohol , spirit , potassium tellurite agar , zn staining kit , tcbs agar , xylene , glucose phsphate broth , 0.5 mc farland standard , bromocersol purple indicator , andrades indicator , sodium hypochloride 10% , glassware and other plastic consumables etc. for microbiology ( all below glassware should be made of borosilicate glass preferably 3.3 glass & should meet standards of astm e, iso 9001, 7348, 3585 & din 12331 , glass petri dish culture 90 mm , glass slides size 75 mmx25mmx1.35mm , single cavity glass slide for motility , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml;100 / pk , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 30 ml:100 piece / pack , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 120 ml:40 piece / pack , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a, usp certicate , amber coloured wide mouth graduated glass bottle 500ml , glass funnel plain 60 degree angle long stem, size 75 mm , u shaped glass rod , glass beaker with spout ( discarding jar ) 1 ltr , test tube glass size 10mmx150mm , test tube glass size 20mmx150mm , measuring pipette with rubber bulb 10 ml ( mohr type ) glass b , measuring cylinder, with class a certificate capacity 1000ml with stopper , measuring cylinder, with class a certificate capacity 250 ml with stopper , durhams tube , cover slip 2*2 cm square , antibiotics discs for microbiology , amikacin 30 mg , amoxyclav 30 mcg , ampicillin 2mg , axithromycin 15 mcg , aztreonam 30 mcg , bacitracin 50 disc / vl , bile esculin discs , cefazolin ( cz ) 30 mcg , cefipime 30 mcg , cefixime 5mcg , cefoperazone sulbactum 75 mcg , cefoperazone sulbactum 30mcg , cefotaxime 30 mcg , cefoxitin 30 mcg , ceftazidime 30mg , ceftazidime / clavulamic acid 30 mg , ceftazidime / clavulamic acid10 mg , ceftriaxone 30 mcg , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mg , clindamycin 2 mcg , colistin 10 mcg , co trimoxazole 23 75 / 1.25 mg , erythromycin , gentamicin 10mcg , gentamicin 120mcg , imipenem 10mg , levofloxacin 5mcg , linezolid 30mg , meropenem 10 mcg , metronidazole5 mg , nitrofurantoin 300 mcg , novobiocin 30 mg , onpg disc , optochin disc ( for s.pnemonioe ) , oxidase discs. , penicillin g 10 units , piperacillin 100 mg , pipera tazobactum 100 / 10 mcg , polymyxin b 300 units , teicoplanin 30 mcg , tetracycline 30 mg , tobramycin 10 mcg , vancomycin 30 mcg , fosfomycin 200 mcg , tigecycline 15 mcg , cinoxacin 100 mcg , norfloxacin 100 mcg , oxacillin 10 mcg , other plastic consumables , slide boxes for students for 20 slides , heavy duty gloves heat resistand, category iii glove, preferably en 407 performance level , test tube stand polypropylene 3 tier for test tubes , paraffin film m rolls 2inch width 250 feet length , falcon tube ( conical ) polypropylenem usp class vi, max g force of 15, 000 xg:50 ml, 360 piece / pk , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each , test tube rack holder 40 50 holes vents plastic centrifugal deck , universal eto sterile plastic ( pp ) containers ( 30ml ) 100 piece in pack , coplin jars pp for keeping slides pack of 12 , sterile swab with collection vial ( hirmedia pref. ) 100 piece / pkt , spatula spoon shaped plastic for chemical dispense ( gradueated ) , filter paper size no.1 460x570: no of circles / sheets , autoclave bowie dick tape 1 pack of 30 test, complies to ansi / aami / iso 11140 5:2007 class 2 , ph paper strips 1 14 ph range himedia, fisher scientific , disposable 100 cm diameter petri dish , disposable test tubes 10 mm diameter 5 ml capacity , discarding tub 3 litre , sterile samole container , glass marking pencil , plastic basket for sample transportation 1feetx1.5feet , miscellaneous steel item , forcep stainless steel non corosive surgical grade ( 00 & higher ) , nichrome straight wire ( 2 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , nichrome loop wire ( 3mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , sterile stainless stell surgical blade of 11 nos. pack of 100 piece , forcep for cover glasses, kunhe type , steel rod for staining in practical lab , utility tray for slides , stainless steel forceps, pointed , autoclavable, size 8 inch, ss 410, 2 nos / pack , test tube washing brushes steel , scissors , spirit lamp , other kits and consumables for microbiology , anti hbsag elisa igm 4th generation, should include reactive and non reactive controls, sensitivity of more than or equal to 99%: specificity of more than or equal to 99%. analytical sensitivity: less than or equal to 0.50 ng / ml. no cross reactivity with hcv, tp, hiv or cmv: result time: preferable less than 90 min , anti hbeag elisa specimen: plasma or serum: sensitivity :97% or greater & specificity 99 100 % whichever is more shelf life greater than 12 months , anti hcv igm elisa 4th generation, microplate elisa coated with recombinant / synthetic peptide antigens for core, ns3, ns4 and ns5 and antibody to hcv core antigen: the assay should have relative sensitivity of 100% & specificity of more than or equal to 99% result time:90 min or less , anti hav elisa igm based on capture elisa, should detect igm anti hav in serum or plasma, should be evaluated in bbi hav serum conversion & hav mixed titre performance panel: sensitivity:3mlu / ml or 100% : specificity 99% or more incubation: time 3.5 hours or less: no cross reactivity with hbv, hiv, cmv , hav antigen elisa sample type:stool: specificity:91% of the elisa positive samples should also hav pcr positive.cross reacitivity should be not known , anti hev elisa igm indirect elisa: antibody capture based, 100% specific & 97% & above sensitive or sandwich elisa: double antifen based specificity & sensitivity greater than or equal to 99% , dengue igm elisa igm captureelisa; tested on serum or plasma , specificity :98% or more no9 cross reaction with chik, hcvm syphilis, hbsag, ana, hiv, rf, malaria: no interference with substances like edta3.5 ?mol / l & bilirubin 10 mg / dl ce marked preferably us fda cleared , dengure ns1 elisa ( based on sandwich elisa, test can be performed on serum, plasma , sensitivity= 99%: specificity = 98%: result time: preferably 100 mins or less: preferably us fda approved , ra latex agglutination polystyrene latex particles are used : diagnostidc sensitivity should be > 99%specificity >99% : iso, gmp certified , aso latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 99% specificity >98% iso, gmp certified , crp latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 96% specificity >97% iso, gmp certified , widal tube or slide agglutination iso certified widal antigens s, typhio & h antigens, s paratyphiah & bh antigen . positive & negative controls: sensitivity>89% & specificity > 88% time of result preferable less than 5 min. icmr approved ce / iso 13458 certified. ce rep registered . storage cond.: 2 8 degrees , rpr reagin antibodies based on flocculation principle using non treponemal antigen. tested on serum , plasma , sensitivity or 85% or more in primary syphilis and a specificity of 93% or more. the assay should be calibrated to who reference serum and the same should be supported by statement in kit insert and certifidate from manufacturer: result within 20 mins: should include positive and negative serum controls. , tpha kit or tp antibody kit cassette device with desicant, detect igg, m7 a antibodies: use serum , plasma or whole blood speciment. lateral flow doulbel sandiwich elisa technology, sensitiity 97% & more specificity 99% or more, external evaluation validates performance. , rota virus igm elisaenxyme immmunoaasays using polyclonal or monoclonal antibodies against the group a specific antigen ( vp 6 ) , lower detection limit of rotavirus antigen :< 10 ng / ml, specificity: 99% & above & sensitivity : 98% & above. , occult blood test performed in stool, reaction time 10min, guaiac or preferably anti haemoglobin antibodies based immunochromatographic assay based which is more sensitive than guaiac testing, no dietary restrictions, clia waived: storage 2 30 c, specificity>96% accuracy 97%, detection limit 50 ng / ml of heamologbin or 6?g hemoglobin / g feces. , others , vtm , parafilm tape roll ( 4inchx125 ft. ) , n / 10hcl , elisa reader paper roll , sample cup em 200 , 3.8% sodium citrate , field’s stain a , field’s stain b , 10% soduum hypo. , k3 vaccuim blood collection duble cape vail 3ml , k3 vaccuim blood collection duble cape vail 6ml , clot activator vail gel 5 ml , clot activator vail gel 10ml , citrate vial 2 ml , yellow tips , blue tips , micro slide , test tube 12*100mm , test tube 12*75mm , test tube plastic , lab use tissue paper roll ( 120 mtr ) , test tube stand ( 48 holes ) , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , methanol , urine dispo contaner plastic ( 50ml ) , bio waste bag ( red, yellow, black, blue ) capacity 60 90 litre ( large ) , cover slip , gimsa stain solution , leisman stain , glycerin , zedinol , glass beaker 500ml , glass beaker 250ml , glass beaker 100ml. , liquid parrafin , gluco strip with glucometer ( a meter of same brand will be given at free of cost on purchase ofevery 500 strips ) , auto pipete , auto pipete , auto pipete , auto pipete , auto pipete , multi channel auto pipete ( 8 channel ) , multi channel auto pipete ( 8 channel ) , e.c.g. roll ( 50 m.m.× 20 mtr ) , bandaid ( round ) , gel card for cross match , gel card for blood group , liqued hand wash , urine analyser printer pepar roll 50 / 52 mm , cbc printer paper roll , nitril gloves all size...

Medical Health And Family Welfare - Rajasthan

36710125 supply of chemical regents in x ray sonography laboratary and blood bank in govt hospital chittorgarh , x ray, & sonography items , computerize digital x ray film 8 x 10 , computerize digital x ray film 11 x 14 , digital x ray cassets 14x17 , digital x ray cassets 14x14 , digital x ray cassets 10x12 , sonography paper roll , sonography jelly , e.c.g. jelly , e.c.g. paper roll bpl , biochemistery reagent , blood suger ( end point ) , blood urea ( fixed time ) , blood urea ( brith lot ) , s.creatanine ( fixed time ) , cholestrol ( end point ) , triglyceride ( end point ) , hdl reagent direct , bilirubin t&d ( end point ) , sgot ( kinetic ) , sgpt ( kinetic ) , alkaline phosphatase , s. a. phosphatas , amylase , uric acid , s. ldh , s.ck mb , s.ck nac , calcium , albumin , total protine , crpquantitative , crp qualitative , rf factor , raquantitative , bio chemistery reagents for fully autometic , wash 1 , wash 2 , blood sugar , blood urea , blood creatinine , blood cholesterol , blood triglycerides , hdl , blood bilirubin total , blood bilirubin direct , blood s.g.p.t. , blood s.g.o.t. , blood total protein , blood albumin , alk. phos. , uric acid , calcium , amylase , ck mb , ck nac , ldh , crp , auto wash , xl wash , erba norm , xl multical , albumin , alkaline phosphatase , bilirubin direct , bilirubin total , calcium , creatinine enzymatic , creatinine jaffe , cholestrole , glucose ( god pod ) , glucose hexokinase uv , total protein , triglyceride , crp , sgot el , sgpt , amylase , urea , uric acid , hdl cholesterol with calibrator , ldh p , phosphorus , rapid test , hbsag , hcv rapid , dengue combo ns1 antigen+lgg 1gm antibodytest , dengue antibody test , malariyaantigen test , pregnancy test , thaypi dot test , scrub thypus igm antibody test , chikungunya igm antibody test , vdrl test strip , urine albumin sugar test , urine analyser test strip 10 paramiter , leptospirosis rapid kit , hepatitis a , hepatitis e , typhoid iggigm , elisa test kit for lab , dengue ns1ag microlisa , scrub typhus igm elisa , chikungunya igmelisa , dengue 1gm microlisa , leptospirosis elisa kit , reagents for 5 part hematology analyser ( trans ) , h 560 diluent , h 560 lyse 1 , h 560 lyse 2 , h 560 elite h clean , h 560 controls ( h, n, l ) , h 560 calibrator , control h , control n , control l , calibrator , reagent for 5 part hematology analyser ( mindray ) , m 52 diluents , m 52 diff lyse , m 52 lh lyse , probe cleaner , calibrator , control low , control high , control nusmal , reagent for 3 part hematology analyser ( mindray ) , m 30 diluents , m 30 diff lyse , m 30 lh lyse , probe cleaner , reagents for ecl 105 , erba protime ls , erba actime , erba calcium chloride , erba ddimer , erba ddimer calibrator , erba ddimer control n+p , erba single reaction cuvettes src 10 , thermal printer paper rolls 3x57mmx15m , test kit forictc ( subject tonacoapproved ) , hiv tridot , hiv triline , hiv comb aids , rekteble neddle , vacuum 3.8 % sodium citrate esrblood collection. tube , floride blood collection vail , blood sample trensport vail ct gel , elisa kits for blood bank ( subject tonacoapproved ) , h.i.v.kit , h.c.v. kit , hbs ag. kit , reagents for blood bank , bovine albumin , anti a1b , anti “a1, ( lectin ) , anti “h” , anti “d”. igg+igm ( monoclonal ) , anti humen globuline ( ahg ) , blood grouping anti sera abd , r.p.r. test ( latex ) , cpda blood collection bag 350 ml , cpda blood collection bag 100 ml , cpda blood collection bag ( triple ) 350 ml , cpda blood collection bag ( triple ) 450 ml , cpda blood collection bag ( double ) 350 ml , cpda blood collection bag ( penta ) 450 ml , screw cap vial plain 5 ml , tourniquit belt ( standred quality ) , glass droper ( pauster pipet ) , hb haemocue 301 cuvet ( a meter and a lancet will be givenat free of cost on purchase of every 1500 microcuvettes ) , serology kits , r.a. factor , widal test , crp test qualitative , aso test , microbiology , mac conkey agar with 0.15% bile salts, cv and nacl 500 gm , nutrient agar , cled agar , sulfide indole motility agar , kovacs indole reagents , mannitol powder , glucose powder , lactose powder , sucrose powder , hydrogen peroxide 3 / 6% , oxidase reagent , mueller hinton agar , sda with chloramphenicol , crystal violet powder , agar powder bacteriological grade , thioglycollate powder , acetone , grams stain kit , hi chrome agar for candida 100 , potassium hydroxide , sda , lactophenol cotton blue , capsule stains , cary blair medium , safranin stain , lowenstein jensen powder , ferric chloride powder , bile esculine agar , peptone powder , selenite f broth powder , india ink or nigrosin , methylene blue stain , glutaraldehyde , ethylacohol , spirit , potassium tellurite agar , zn staining kit , tcbs agar , xylene , glucose phsphate broth , 0.5 mc farland standard , bromocersol purple indicator , andrades indicator , sodium hypochloride 10% , glassware and other plastic consumables etc. for microbiology ( all below glassware should be made of borosilicate glass preferably 3.3 glass & should meet standards of astm e, iso 9001, 7348, 3585 & din 12331 , glass petri dish culture 90 mm , glass slides size 75 mmx25mmx1.35mm , single cavity glass slide for motility , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml;100 / pk , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 30 ml:100 piece / pack , mccartney flat bottle:aluminium cap with bromo butyle rubber liner, neutral glass, autoclavable capacity 120 ml:40 piece / pack , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a, usp certicate , amber coloured wide mouth graduated glass bottle 500ml , glass funnel plain 60 degree angle long stem, size 75 mm , u shaped glass rod , glass beaker with spout ( discarding jar ) 1 ltr , test tube glass size 10mmx150mm , test tube glass size 20mmx150mm , measuring pipette with rubber bulb 10 ml ( mohr type ) glass b , measuring cylinder, with class a certificate capacity 1000ml with stopper , measuring cylinder, with class a certificate capacity 250 ml with stopper , durhams tube , cover slip 2*2 cm square , antibiotics discs for microbiology , amikacin 30 mg , amoxyclav 30 mcg , ampicillin 2mg , axithromycin 15 mcg , aztreonam 30 mcg , bacitracin 50 disc / vl , bile esculin discs , cefazolin ( cz ) 30 mcg , cefipime 30 mcg , cefixime 5mcg , cefoperazone sulbactum 75 mcg , cefoperazone sulbactum 30mcg , cefotaxime 30 mcg , cefoxitin 30 mcg , ceftazidime 30mg , ceftazidime / clavulamic acid 30 mg , ceftazidime / clavulamic acid10 mg , ceftriaxone 30 mcg , cefuroxime 30 mcg , chloramphenicol 30 mcg , ciprofloxacin 5mg , clindamycin 2 mcg , colistin 10 mcg , co trimoxazole 23 75 / 1.25 mg , erythromycin , gentamicin 10mcg , gentamicin 120mcg , imipenem 10mg , levofloxacin 5mcg , linezolid 30mg , meropenem 10 mcg , metronidazole5 mg , nitrofurantoin 300 mcg , novobiocin 30 mg , onpg disc , optochin disc ( for s.pnemonioe ) , oxidase discs. , penicillin g 10 units , piperacillin 100 mg , pipera tazobactum 100 / 10 mcg , polymyxin b 300 units , teicoplanin 30 mcg , tetracycline 30 mg , tobramycin 10 mcg , vancomycin 30 mcg , fosfomycin 200 mcg , tigecycline 15 mcg , cinoxacin 100 mcg , norfloxacin 100 mcg , oxacillin 10 mcg , other plastic consumables , slide boxes for students for 20 slides , heavy duty gloves heat resistand, category iii glove, preferably en 407 performance level , test tube stand polypropylene 3 tier for test tubes , paraffin film m rolls 2inch width 250 feet length , falcon tube ( conical ) polypropylenem usp class vi, max g force of 15, 000 xg:50 ml, 360 piece / pk , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each , test tube rack holder 40 50 holes vents plastic centrifugal deck , universal eto sterile plastic ( pp ) containers ( 30ml ) 100 piece in pack , coplin jars pp for keeping slides pack of 12 , sterile swab with collection vial ( hirmedia pref. ) 100 piece / pkt , spatula spoon shaped plastic for chemical dispense ( gradueated ) , filter paper size no.1 460x570: no of circles / sheets , autoclave bowie dick tape 1 pack of 30 test, complies to ansi / aami / iso 11140 5:2007 class 2 , ph paper strips 1 14 ph range himedia, fisher scientific , disposable 100 cm diameter petri dish , disposable test tubes 10 mm diameter 5 ml capacity , discarding tub 3 litre , sterile samole container , glass marking pencil , plastic basket for sample transportation 1feetx1.5feet , miscellaneous steel item , forcep stainless steel non corosive surgical grade ( 00 & higher ) , nichrome straight wire ( 2 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , nichrome loop wire ( 3mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) , sterile stainless stell surgical blade of 11 nos. pack of 100 piece , forcep for cover glasses, kunhe type , steel rod for staining in practical lab , utility tray for slides , stainless steel forceps, pointed , autoclavable, size 8 inch, ss 410, 2 nos / pack , test tube washing brushes steel , scissors , spirit lamp , other kits and consumables for microbiology , anti hbsag elisa igm 4th generation, should include reactive and non reactive controls, sensitivity of more than or equal to 99%: specificity of more than or equal to 99%. analytical sensitivity: less than or equal to 0.50 ng / ml. no cross reactivity with hcv, tp, hiv or cmv: result time: preferable less than 90 min , anti hbeag elisa specimen: plasma or serum: sensitivity :97% or greater & specificity 99 100 % whichever is more shelf life greater than 12 months , anti hcv igm elisa 4th generation, microplate elisa coated with recombinant / synthetic peptide antigens for core, ns3, ns4 and ns5 and antibody to hcv core antigen: the assay should have relative sensitivity of 100% & specificity of more than or equal to 99% result time:90 min or less , anti hav elisa igm based on capture elisa, should detect igm anti hav in serum or plasma, should be evaluated in bbi hav serum conversion & hav mixed titre performance panel: sensitivity:3mlu / ml or 100% : specificity 99% or more incubation: time 3.5 hours or less: no cross reactivity with hbv, hiv, cmv , hav antigen elisa sample type:stool: specificity:91% of the elisa positive samples should also hav pcr positive.cross reacitivity should be not known , anti hev elisa igm indirect elisa: antibody capture based, 100% specific & 97% & above sensitive or sandwich elisa: double antifen based specificity & sensitivity greater than or equal to 99% , dengue igm elisa igm captureelisa; tested on serum or plasma , specificity :98% or more no9 cross reaction with chik, hcvm syphilis, hbsag, ana, hiv, rf, malaria: no interference with substances like edta3.5 ?mol / l & bilirubin 10 mg / dl ce marked preferably us fda cleared , dengure ns1 elisa ( based on sandwich elisa, test can be performed on serum, plasma , sensitivity= 99%: specificity = 98%: result time: preferably 100 mins or less: preferably us fda approved , ra latex agglutination polystyrene latex particles are used : diagnostidc sensitivity should be > 99%specificity >99% : iso, gmp certified , aso latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 99% specificity >98% iso, gmp certified , crp latex agglutination polystyrene latex particles are used diagnostic sensitivity should be > 96% specificity >97% iso, gmp certified , widal tube or slide agglutination iso certified widal antigens s, typhio & h antigens, s paratyphiah & bh antigen . positive & negative controls: sensitivity>89% & specificity > 88% time of result preferable less than 5 min. icmr approved ce / iso 13458 certified. ce rep registered . storage cond.: 2 8 degrees , rpr reagin antibodies based on flocculation principle using non treponemal antigen. tested on serum , plasma , sensitivity or 85% or more in primary syphilis and a specificity of 93% or more. the assay should be calibrated to who reference serum and the same should be supported by statement in kit insert and certifidate from manufacturer: result within 20 mins: should include positive and negative serum controls. , tpha kit or tp antibody kit cassette device with desicant, detect igg, m7 a antibodies: use serum , plasma or whole blood speciment. lateral flow doulbel sandiwich elisa technology, sensitiity 97% & more specificity 99% or more, external evaluation validates performance. , rota virus igm elisaenxyme immmunoaasays using polyclonal or monoclonal antibodies against the group a specific antigen ( vp 6 ) , lower detection limit of rotavirus antigen :< 10 ng / ml, specificity: 99% & above & sensitivity : 98% & above. , occult blood test performed in stool, reaction time 10min, guaiac or preferably anti haemoglobin antibodies based immunochromatographic assay based which is more sensitive than guaiac testing, no dietary restrictions, clia waived: storage 2 30 c, specificity>96% accuracy 97%, detection limit 50 ng / ml of heamologbin or 6?g hemoglobin / g feces. , others , vtm , parafilm tape roll ( 4inchx125 ft. ) , n / 10hcl , elisa reader paper roll , sample cup em 200 , 3.8% sodium citrate , field’s stain a , field’s stain b , 10% soduum hypo. , k3 vaccuim blood collection duble cape vail 3ml , k3 vaccuim blood collection duble cape vail 6ml , clot activator vail gel 5 ml , clot activator vail gel 10ml , citrate vial 2 ml , yellow tips , blue tips , micro slide , test tube 12*100mm , test tube 12*75mm , test tube plastic , lab use tissue paper roll ( 120 mtr ) , test tube stand ( 48 holes ) , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , micro auto pipet , methanol , urine dispo contaner plastic ( 50ml ) , bio waste bag ( red, yellow, black, blue ) capacity 60 90 litre ( large ) , cover slip , gimsa stain solution , leisman stain , glycerin , zedinol , glass beaker 500ml , glass beaker 250ml , glass beaker 100ml. , liquid parrafin , gluco strip with glucometer ( a meter of same brand will be given at free of cost on purchase ofevery 500 strips ) , auto pipete , auto pipete , auto pipete , auto pipete , auto pipete , multi channel auto pipete ( 8 channel ) , multi channel auto pipete ( 8 channel ) , e.c.g. roll ( 50 m.m.× 20 mtr ) , bandaid ( round ) , gel card for cross match , gel card for blood group , liqued hand wash , urine analyser printer pepar roll 50 / 52 mm , cbc printer paper roll , nitril gloves all size...

Medical And Health Services - Rajasthan

36457627 tender for supply of laboratory equipment 1 a.s.l.o. kit ( rapid ) 2 acetic acid 3 alkine phosp. ( for semiautoanalizer ) 4 amylase test kit 5 auto analyzer paper role 6 auto pippetes tips ( 5ml. / micro lit. ) 7 blood sugger kit ( for semiautoanalizer ) 8 blood urea kit ( for semiautoanalizer ) 9 blue tipes 10 yellow tipes 11 c.r.p. kit ( quantative ) 12 c.r.p. kit ( qualittive ) 13 capilary tube ( isi marked ) 14 stop watch 15 abx cbc detergernt solution horiba co. 16 abx cbc diluent ( 20 ltr ) horiba co. 17 abx cbc lyse ( 1 ltr ) horiba co. 18 cbc printer paper 19 cbc probe cleaner ( 1 ltr ) 20 cbc mono clair ( 500 ml ) 21 cbc controll horiba co. 22 centirfuse tube ( isi marked ) 23 chamber cover slip 24 cholstol kit ( for semiautoanalizer ) 25 ck nac test kit 26 ckmb test kit 27 cl+ 28 coombes test ( direct ) 29 coombes test ( indirect ) 30 hiv rapid card 31 cubette calorimeter 32 chikengunia elisa test kit 33 chikengunia rapid test kit 34 dengue kit ( elisa method kit ) ns1, igg, igm ( other ) 35 dengue kit ( elisa method kit ) ns1, igg, igm ( j.mitra ) 36 dengue kit ( elisa method kit ) ns1, igg, igm ( s.d. ) 37 dengue rapid kit ns1 igm / igg ( other ) 38 dengue rapid kit ns1 igm / igg ( j.mitra ) 39 dengue rapid kit ns1 igm / igg ( s.d. ) 40 disttil water ( 5 ltr. tin ) 41 dlc counter 42 dropper 43 e.d.t.l. powder 44 plane vial ( double cap ) 45 e.s.r. pipetts ( use and throw ) 46 electolyte kit chlorine 47 erba cell wash for biochem. 48 esr stand 49 esr tube glass 50 tissue paper role 51 filter paper / blooting paper 52 fuchet regent for bile pigment 53 glass pfncil ( marking ) 54 gluco strips bg 02, 03 ( dr. morpfn ) 55 glucometer 56 glucometer strip ( other ) 57 jsb ist & iind 58 k+ 59 lactin a kit ( rapid ) 60 ldh test kit 61 lenset 62 lipidprofile 63 liqucilince ( e ) 64 lismans stain 250ml / 500ml 65 m.t. vail 10 tu 66 malaria fild stain a 67 malaria fild stain b 68 slide box ( 100 slide ) 69 slide staning stand 70 beakar 250 350ml ( slide staning ) 71 micro clear glass slide ( 76*26*0.95 ) with ground polish edge ( isi marked ) 72 micro pipette 0 50 other 73 micro pipette 0 50 erba 74 micro pipette 0 100 other 75 micro pipette 0 100 erba 76 micro pipette 0 500 other 77 micro scopice cober slip 78 eye piece 5x ( microscope ) 79 eye piece 10x ( microscope ) 80 microscope lense 10x 81 microscope lense 40x 82 microscope lense 100x 83 xylene ( for microscope lence cleaning ) 84 micro pipette 0 500 erba 85 multisticks ( for urine ) 86 n / 10 solution 87 na+ 88 neuber’s chamber 89 nitic acid 90 p.t. tube ( isi marked ) with cork & sticker 91 platelet counting fluid ( rees ecker ) 92 pregnancy kit card other 93 pregnancy kit card acon 94 pregnancy kit card s.d. 95 pregnancy kit card jmitra 96 promthrombin testkit 97 r.a. factor ( rapid ) 98 rbc pipette 99 rh view box 100 s. calcium 101 s.g.o.t. ( for semiautoanalizer ) other 102 s.g.o.t. ( for semiautoanalizer ) erba. co. 103 s.g.p.t. ( for semiautoanalizer ) other 104 s.g.p.t. ( for semiautoanalizer ) erba. co. 105 seman analysis sierm count 106 serum albumin test kit 105 serum bilirubin ( for semiautoanalizer ) 106 serum cretinine kit ( for semiautoanalizer ) 107 serum hdl 108 serum ldl 109 serum protin 110 serum protine ( for semiautoanalizer ) 111 serum trigly ceride 112 sodium citrate 113 sulfur powder 114 scrub typhous elise kit elise for igg / igm 115 scrub typhous elise test kit 116 scrub typhous rapid test kit 117 t.s.h. 118 t3 119 t4 120 tec fluid 121 test tube 10 ( isi marked ) 122 test tube 4 ( isi marked ) 123 test tube holder 124 test tube stand 125 test tube ( isi marked ) 126 tlc fluid 127 tlc pipetts ( isi marked ) 128 triglyceride 129 uric acid ( for semiautoanalizer ) 130 urine analizer ( strip ) 131 urine container 30ml with stikar 132 urinstrip ( aib & sugger ) 133 multistrip ( urin ) 134 v.d.r.l. 135 vdrl rapid card 136 yellow tipes 137 wbc fluid 138 widal test ( slide method ) 139 aslo 50 t 140 blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes 1 abx diluent 2 abx alphalyse 3 abx eosinofix 4 abx cleaner 141 abx minoclear 1 reagents for elisa reader 2 hiv elisa 1x100t 3 hbs ag elisa 1x100t 142 hcv alisa 1x100t 143 fully auto analyser model erbaxl 300 reageuts, chemicals & disposables 144 albumin system pack 145 amylase system pack 146 bilirubin t&d system pack 147 urea system pack 148 cholestrol system pack 149 alkaline phosphate system pack 150 glucose system pack 151 s. creatnin system pack 152 calcium system pack 153 total protein system pack 154 trigly ceride system pack 155 hdl colestrol direct system pack 156 sgot system pack 157 sgpt system pack 158 chloride system pack 159 uric acid system pack 160 ck system pack 161 ckmb system pack 162 sample cup system pack 163 ggt system pack 164 ldl cholestrol with calibrator system pack 165 ldhp system pack 166 microprotein system pack 167 phosporus system pack 168 x l multical system pack 169 x l wash system pack 170 regent for fully auto anlyzar ( randox ) s a human assayed multi sera level 2 b human assayed multi sera level 3 c calibration sera level 3 d wash solution no.1 e wash solution no. 2 f ast ( got ) liquid g alt ( gpt ) ( liquid ) h alk. phos. ( liquid ) i bilirubin direct liquid j bilirubin total liquid k calcium liquid l cholesterol liquid m glucose liquid n creatinine liquid o urea liquid p uric acid liquid q triglycerides liquid r c1 wash solution 171 regent 1 trop t test kit ( rodhe deiuh ) ( rodhe deiuh ) 2 trop i test kit ( rodhe deiuh ) ( rodhe deiuh ) 172 quantitative crp kit 173 edta tube double cap 174 heamoglobin meter ( squar shape ) ( isi mark ) 175 cloted vial with stikar 176 multi channel pippet ( 0μl 50μl ) ( 50μl 100μl ) ( 100μl 1000μl ) erba 177 ( cbc rotater ) 178 cross match card 179 blood group card 180 glass measuring cylinder 181 vdrl rotater 182 elisa machine / reader / washer one set 96 test ( rayto ) wave length range 400 750 nm 183 blood weight machine ( ) 184 blood donation donor coatch 185 binocular microscope 186 tissu paper role 187 cover slip size ( 18x18mm micro cover glass ) no.1....

Medical Health And Family Welfare - Rajasthan

36402103 supply of lab and blood bank regents in govt bdm district hospital kotputli , list for laboratry & blood bank regents , elisa test kit for hiv 96 test (4th generation) , elisa test kit for hiv 96 test (3rd generation) , elisa test kit for hcv 96 test , elisa test kit for hcv 96 test (4th generation) , elisa test kit for hbsag 96 test(4th generation) , elisa test kit for hbsag 96 test(3rd generation) , elisa test kit for dengue igm 96 test , elisa test kit for dengue igg 96 test , elisa test kit for dengue ns 1 96 test , elisa test kit for scrub typhus 96 test , elisa test kit for chickengunia96 test , rapid test card malaria pan ldh 1 piece , rapid test card malaria antigen 1 piece , rapid test card for dengue ns1 1 piece , rapid test card for dengue igm 1 piece , rapid test card for dengue ns1 + igm ( combo ) 1 piece , rapid test card for hiv(4th generation) 1 piece , rapid test card for hiv 1 piece , rapid test card for hcv 1 piece , rapid test card for hcv (3rd generation) 1 piece , rapid test card for hcv (4th generation) 1 piece , rapid test card for hbsag 1 piece , rapid test card for scrub typhus 1 piece , rapid test card for chickengunia 1 piece , rapid test card for typhoid igm + igg 1 piece , rapid test card for syphilis 1 piece , rapid test strip for syphilis 1 piece , rapid test card for hiv & syphilis 1 piece , pregnency test strip 1 piece , pregnency test card 1 piece , antisera anti. a monoclonal 10 ml , antisera anti b monoclonal 10 ml , antisera anti ab monoclonal 10 ml , antisera anti d igm monoclonal 10 ml , antisera anti d (igm + igg) monoclonal 10 ml , lectin a1 monoclonal 10 ml , ahg monoclonal 10 ml , antisera anti h monoclonal 10 ml , blood grouping test kit (abd kit) (monoclonal) 10 ml each , bovine alumine 22% 10 ml , gel card ahg (coomb gel card) for cross match 1 piece , gel card ahg (coomb gel card) for blood group 1 piece , liss solution 500 ml ( ready ) , blood sample collection edta vial single cap5 ml 100 piece , blood sample collectionplainvial single cap 5 ml 100 piece , blood sample collectionpt vial single cap 5 ml 100 piece , blood sample vial5ml (edta)double cap 100 piece , blood sample vial 5ml (plain) double cap 100 piece , blood sample collectionclot activater vial single cap 5 ml 100 piece , blood collecting bag cpda 1 paed 100ml 1 piece , blood collecting bag cpda 1 350ml single 1 piece , aslo test kit 4ml ( latex ) , aslo test kit 50ml ( quantitative ) , analyser paper roll for horiba 3 part cbc 1 piece , analyzer paper roll for semi biochemistry analyzer 1 piece , analyzer paper roll for lura urineanalyzer 1 piece , pasture pippett (plastic) volume 5 ml 1 piece , wash bottel 2 ltr , wash bottel 5 ltr , wash bottel 10 ltr , throat swab (cotton) 100 piece , throat swab (nylon) 100 piece , throat swab (dacron) 100 piece , plastic zip lock pocket 100 piece , blood sugar test strip with acquachek with glucometer (50 strip) , blood urea test kit , blood sugar accusure insci glucometer strip (50 strip) , crp test kit4ml ( latex ) , crp test kit50ml ( quantitative ) , crp titration test kit4ml , cover slip for neubar chamber 100 piece , cover slip for glass slide 100 piece , counting chamber (neubar) 1 piece , capilary tube 1.5 mm diameter x 10 15 cm length (50 piece) , cbc roll (pos 555 tl) (55mm×15 mtr) 1 roll , ckmb trop t test card(1 piece) , ckmb trop i card(1 piece) , cknac trop t test card (1 piece) , ck mb solution 1x25 ml , ck nac solution 1x25 ml , disposal droper(100 piece) , plastic test tube with screw cap 10ml(100 piece) , plastic test tube with screw cap 5ml(100 piece) , disposal plastic test tube 5ml(100 piece) , disposal plastic test tube 10ml(100 piece) , disposable face mask (100 piece) , disposal cap(100 piece) , edta solution 500ml bottel , drabkin solution 5 ltr. pack , dettol liquid (500ml) , esr standwestergen blood test pipet (5 test stand) 1 piece , esr tube glass for westergen mathod 1 piece , disposable plastic esr pippet 100 piece , esr pippet cuff 100 piece , elicote vial 100 piece , floride vacutainor vial 100 piece , glass slide 76mmx26mm 100 piece , haemoglobinometer (german made)top 1 piece , hb tube square haemometer mesauring tube (top) 10 piece , giemsa stain 500 ml , methylene blue stain500 ml , gention violet stain 500 ml , jsb i (solution ) 500ml , jsb ii (solution) 500 ml , leishman stain 500ml , lense cleaning paper packet (50 page) , lable chips (paper) 1000 piece , liquid parafin 500ml , micro tips 1000 micro ltr 1000 piece , micro tips 200 micro ltr 1000 piece , micro tips 50 micro ltr 1000 piece , micro tips 20 micro ltr 1000 piece , micro scope blub isi 1 piece , microscope lense (made in german, japan, poland) 1 piece , micro pippet10 to 100 micro 1 piece , micro pippet100 to1000 micro 1 piece , multichannel micropippet for elisa 1 piece , n/10 hcl 500ml , n95 mask with respirator 1 piece , n95 mask without respirator 1 piece , mask tripple layer 100 piece , pap stain 500 ml , hematoxylin and eosin stain 500 ml , p.p. e.kit for swine flue 1 piece , p.p. e.kit sitra approved, 90 gsmwith (n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit 100 gsm sitra approved, 90 gsmwith (n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit for corona with (triple layer mask, googles,face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit googles 1 piece , face shield 1 piece , surgical sterile gloves 6 no 1 pair , surgical sterile gloves 6.5 no 1 pair , surgical sterile gloves 7 no 1 pair , surgical sterile gloves 7.5 no 1 pair , disposal rubber gloves large size 1 piece , disposal rubber gloves medium size 1 piece , infrared thermometer 1 piece , multi surface disinfectant liquid 500 ml , foot press sanitizer stand 1 piece , uv disinfection sanitizres 1 piece , pulse oxymeter finger tip 1 piece , r.a. test kit 4ml ( latex ) , r.a. test kit 50ml ( quantitative ) , test tube stand 100 test tube (steel) 1 stand , sodium citrate solution 500ml , sterile water 5 l packing , semen dilutingfluid 100 ml , spinal niddle 26 g 1 piece , triplefilterd disttled water5 l packing , test tube stand steel 24 test tube , test tube stand steel 12 test tube , test tube stand plastic12 test tube , test tube stand plastic24 test tube , test tube stand plastic48 test tube , test tube stand plastic50 test tube , tissue paper roll 1 piece , arm tourniquites for blood sampling 1 piece , urine test strip for albumine, sugar & ketone body 100 piece , urine test strip (albumine sugar) 100 piece , urine container (disposable) 30ml , vtmvial forswine flu & corona 1 piece , vial 5 ml (open mouth) for cross match (plastic) 100 piece , vial 5 ml (open mouth) for cross match (glass) 100 piece , vacutainor plain vial 5 ml 100 piece , vacutainor edta k3 vial 5 ml 100 piece , vacutainor holder and niddlemulti sample 100 piece , vacume test tube edta (with niddle) 2ml 100 piece , vacume test tube edta (with niddle) 5ml 100 piece , vacume test tube plain (with niddle) 2ml 100 piece , vacume test tube plain (with niddle) 5ml 100 piece , widal test kit 4 x 5 (to, th, ah, bh) 1 kit rate , dettol hand wash 500ml , phenyle 5 ltr. , vacutainor sodium citrate test tube 100 piece , cuso4 solution for hemoglobine estimation 100 piece , wintrobs tube 100 piece , disposable esr test tube 100 piece , swine flu vaccine 0.5 ml , sodium hypochloride 6% 5 ltr. , sodium hypochloride 5% 5 ltr. , sodium hypochloride 4% 5 ltr. , xylene 100ml , coplin staining jar 100 ml , coplinstainingjar 200 ml , staining jar 250 ml , gram staning regent (readymade) 100 ml , sticker roll for computer (4 x 4 size) 1 roll , culture bottle 100 ml , culture bottle 200 ml , culture bottle 500 ml , gluteraldehyde 5 ltr. , vial for calcium test 100 piece , prolyle control (for electrolite machine) , multi control for semi auto biochemistry analyzer , bar code sticker l x w (2x1) 5000 piece , wax ribbon roll forbar code sticker l x w (2x1) 5000 piece , digital dlc counter machine 1 piece , regents forsemi auto analyser machine , serum calcium test kit liquid (2x100 ml) , serum creatinine test kit liquid (2x100 ml) , serum cholestrol test kit liquid (2x100 ml) , serum bilirubin test kit liquid (200 ml) , serum sgot test kit (2x50 ml) , spirit 5 ltr. (methylated) , serum sgpt test kit(2x50 ml) , s. alk. phosphate kit liquid (2x50 ml) , s. protein total liquid (2x50 ml) , s. albumin kit liquid (2x50 ml) , s. ldh liquid (2x50 ml) , s. amylase liquid (2x50 ml) , s. uric acid liquid (2x50 ml) , p.p.e kit for hiv 1 piece , serum ldh test kit liquid (2x50 ml) , blood sugar test kit (2x500 ml) , cpkmm trop ttest kit 1x25ml , cpkmb trop t test kit 1x25ml , hdl chloresterol test kit (erba, span) (2x50 ml) , triglyceride test kit (2x50 ml) , regents for culture media , nutrient agar plate 1 piece , sheep blood agar plate 1 piece , macconkey agar plate 1 piece , triple sugar iron agar 1 piece , urea agar base(christensen) (autoclavable) 1 piece , citrate agar , oxidase discs (50 discs/vl) , gram stains kit 50 ml , grams crystal violet , kovacs indole regent , whatman filter paper no 1 100 piece , gention violet staning 100 ml , crystal violet stain100 ml , grams iodine 100 ml , lugol iodine 100 ml , aluminium slide tray for 10 slide 1 piece , potassium iodide 200 gm , safranin counter stain 100 ml , acetone solution 100 ml , absolute ethyl alcohol 100 ml , 95 % ethyl alcohol100 ml , methyl alcohol 100 ml , phosphate buffer solutions (ph 7.2) 500 ml , vial 50 ml 1 piece , folken tube 1 piece , autoclave strip 1 piece , powder sucrose 75 gm , lancet with guard 100 piece , niddle 26 g 100 piece , niddle 23 g 100 piece , draining rack , measuring cylinder 100 ml , measuring cylinder 200 ml , slide staining rack 1 piece , nicrome loop 1 piece , pt vial for pt inr 100 piece , plastic gown (disposable) 1 piece , plastic gown (washable) 1 piece...

Medical Health And Family Welfare - Rajasthan

36167062 supply of various types of test kits, rejents and materials for laboratory and blood bank at mahatma gandhi hospital bhilwara , n/10 hcl (h b meter sahilis ) 1x500 ml , copper sulphate powder 1x500 gm , hb meter tube (square) (h b meter sahilis ) 1x1 tube , whatsmans filter paper (circular) (bt manual) 1x100 pcs , lancet(bt manual) 1x100 pcs , lancet(bt manual) 1x200 pcs , capillary tube fine (bt ct manual) 1x100 tube , neubar chamber (tlc manual) 1x1 unit , wbcpipette (tlc manual) 1x1 pcs , methanol (dlc & pbf manual) 1x2.5 ltr , methanol (dlc & pbf manual) 1x500 ml , field stain (dlc & pbf manual) 1x500 ml a+1x500 ml b (a+b) kit , glass slides (dlc & pbf manual) 1x50 slide pkt , cedar wood oil(dlc & pbf manual) 1x500 ml , reticulocytecount fliud (dlc & pbf manual) 1x100 ml , mgg stain(dlc & pbf manual) 1 kit , rapid papstain(dlc & pbf manual) 1 kit , leishmansstain(dlc & pbf manual) 1*500 ml cytochrome+1x500 ml stock buffer (2x) , leishmansstain(dlc & pbf manual) 1 kit , esr stand with marking(esrmanual) 1x1 pcs , esr test cup (plastic)(esrmanual) (1x500 cup pkt) , esr pipette (glass)(esrmanual) (1x5 pipette) , esr pipette with bulb (disposable autosuck) (esr manual) (1x100 pipette) , tri sodium citrate 3.8% (solution) (esr manual) (1x500 ml) , stop watch (esr manual) 1x1 pcs , k3 edta tube (double cap) cbc (1x100 tube pkt) , urine albumin/sugar strip (manual) (1x100 strip) , container 50 ml capacity disposable with screw cap plastic (urine albumin/sugar manual) (1x100container) , multi stix (urine complete manual) 16 parameter (1x100 stix) , multi stix (urine complete manual) 12 parameter (1x100 stix) , cover slip (urine complete manual) (1x50x20) , urine pregnancy test strip (manual) (1x100 strip) , urine pregnancy test strip (manual) (1x50 strip) , urine pregnancy test card (manual) (1x30 card) , urine pregnancy test card (manual) (1x50 card) , lugols iodine (stool test manual) (1x125 ml) , 33% acetic acid(common reagent for urine stool manual) (1x500 ml) , sulpher powder (common reagent for urine stool manual) (1x400 gm) , keto diastic (for urine manual) (1x50) , hemo spot test for occult blood (1x100) , hemo spot test for occult blood (1x200) , trop t rapid (cardic enzyme test) (1x1) , trop irapid (cardic enzyme test) (1x1) , sky blue cap tube (for pt inr) (1x100) , coombs reagent (abo rh agglutination,slide) (1x5 ml) , coombs reagent (abo rh agglutination,slide) (1x10 ml) , bovine albumin 22% (abo rh agglutination,slide) (1x5 ml) , bovine albumin 22% (abo rh agglutination,slide) (1x10 ml) , blood sugar reagent enzymatic (for semi auto god/pod) (2x200 ml) , urea berthlot (for semi auto urease end point (liquid)) (2x100 ml) , urea kinetic (for semi auto) 5x20 ml , creatinine (jaffes for semi auto,initial rate) r1 2x60 ml r2 2x60 ml , sgot for semi auto (without pridoxal phosphate ifcc method) 5x20 ml , sgpt for semi auto (without pridoxal phosphate ifcc method) 5x20 ml , alkaline phosphate kinetic (for semi auto, pnpp) (12x5 ml) , total protein (semi auto analyzwer) (2x50 ml) , albumin(semi auto analyzwer) (2x50 ml) , bilirubin total (for semi auto,jendrassik & grof (1x200 ml) , bilirubin direct (for semi auto,jendrassik & grof (1x200 ml) , uric acid (for semi auto,mono vial) (1x50) , calcium (for semi auto,mono vail) (1x50 ml) , ck mb kinetic (for semi auto) r1 2x8 mlr2 2x1 ml , ck nac kinetic (for semi auto) r1 2x8 mlr2 2x1 ml , amalyse kinetic (for semi auto) (2x20 ml) , cholesterol (for semi auto,enzymatic) (20x50 ml) , hdl cholesterol (for semi auto) (2x20 ml) , triglycerides enzymatic (for semi auto) (1x50 ml x4) , lipase (for semi auto) , ggt (for semi auto) , hba1c(for semi auto) , na+(for semi auto) , k+(for semi auto) , cl (for semi auto) , csf protein fluid (for csf protein manual) (1x100 ml) , code free (blood sugar strip rapid) (1x100) , sample cup plastic (for biochemistry) (1x500) , hepatitis b (hbsag) card (1x100) , hepatitis b (hbsag) card (1x50) , hepatitis b (hbsag) card (1x30 card) , hepatitis b (hbsag) strip (1x30) , hepatitis b (hbsag) strip (1x50) , hepatitis b (hbsag) strip (1x100) , hepatitis b (hbsag) elisa 3rd generation (1x96) , hepatitis b (hbsag) elisa 4th generation (1x96) , vdrl carbon reagent 1*10 ml , vdrl elisa anti body test1*96 , vdrl rapid strip (1x30) , vdrl rapid strip (1x50) , vdrl rapid strip (1x100) , vdrl rpr( rapid) kit (1x50tests) , vdrl rpr( rapid) kit (1x100 test) , hiv rapid card triline(1x30) , hiv rapid card triline(1x50) , hiv rapid tridot (1x50) , hiv rapid tridot (1x100) , hiv rapid combaids (1x48) , hiv elisa 3rd generation (1x96) , hiv elisa 4 thgeneration 1*96 , anti hcv anti bodyrapid card (1x30) , anti hcv anti bodyrapid card (1x50) , hcv elisa 3 rd generation (1x96) , hcv elisa 4thgeneration (1x96) , malaria rapid card antigen/ldh (1x30) , malaria rapid card antigen/ldh (1x50) , malaria rapid card antigen/ldh (1x100) , malariaelisa pan antigen1*96 , pan malaria (rapid pf/pv)(1x100) , pan malaria (rapid pf/pv)(1x50) , pan malaria (rapid pf/pv)(1x30) , widal test kit (vials) (to,th,ah,bh) agglutination rgf 1*4*5 ml , typhoid igm antibody card test(1x1) , aslo kit (agglutination) (1x50) , aslo kit (agglutination) (1x100) , r.a. factor kit (agglutination,qualitative) (1x50) , r.a. factor kit (agglutination,qualitative) (1x100) , jsb i (mp test slide method) (1x500 ml) , jsb ii(mp test slide method) (1x500 ml) , z.n. stain rapid kit (sputum for afb) (1x2x100 ml) , z.n. stain rapid kit (sputum for afb) 1 kit , sprit lamp (sputum for afb staining) (1x1) , geimsa stain , crp (latex agglutination) (1x100) , crp (latex agglutination) (1x50) , dengue rapid antibody (igg+igm)+antigen (ns1)combo card (1x1) , dengue antibody (igg+igm) rapid card (1x1) , dengue antigen (ns1) rapid card (1x1) , dengue elisa antibody (igm) (1x48) , dengue elisa antibody (igm) (1x96) , dengue elisa antigen (ns1) (1x48) , dengue elisa antigen (ns1) (1x96) , scrub tyhpus rapid card (antibody igm) (1x30) , scrub tyhpus elisa (antibody igm) (1x96) , scrub tyhpus elisa (antibody igm) (1x48) , chikungunya rapid card (antibody igm) (1x30) , chikungunya elisa (antibody igm) (1x48) , chikungunya elisa (antibody igm) (1x96) , vtm with swab (for swine fiu) (1x1) , ppe kit (for swine flu) (1x1) , transfer blood bag (without anti coagulant) 100 ml (1x10x10) , blood collection bag (cpda single bag )350 ml (1x10x10) , blood collection bag (cpda single bag )100 ml (1x10x10) , blood collection bag (cpda double bag )350 ml (1x6x10) , blood collection bag (cpda double bag )450 ml (1x6x10) , blood collection bag (cpda double bag with sagm )450 ml (1x6x11) , blood collection bag (cpda tripple bag withoutsagam ) 450 ml (1x5x10) , blood collection bag (cpda tripple bag withsagam ) 450 ml (1x5x10) , blood collection bag (cpda tripple bag with sagam ) 350 ml (1x5x10) , blood collection bag (cpda quadriplebag with sagam) 350 ml (1x4x10) , blood collection bag (cpda quadriplebag with sagam) 450 ml (1x4x10) , quantiple 450 ml (1x3x10) , bio medical waste white bucket with pedal top 25 lit. (1x1) , ns (0.9%) normal saline(1x500 ml) , test tube rack plastic 1x96 wells (1x1) , test tube rack plastic 1x48 wells (1x1) , soft ball (exercise ball)(1x8) , pipette stand plastic (1x1) , antisera stand plastic (1x1) , antisera anti a1 lactin (1x5 ml) , antisera anti h (1x5 ml) , antisera anti ab (1x5 ml) , anti human globulin (ahg) (1x5 ml) , anti a polycolonol (abo rh agglutination,slide) (1x10 ml) , anti b polycolonol (abo rh agglutination,slide) (1x10 ml) , anti d polycolonol (abo rh agglutination,slide) (1x10 ml) , a,b,d vial (abo rh agglutination,slide) (1x3x10 ml) , anti sera amonoclonal(abo rh agglutination,slide) (1x10 ml) , anti sera bmonoclonal(abo rh agglutination,slide) (1x10 ml) , anti sera dmonoclonal(abo rh agglutination,slide) (1x10 ml) , glass test tube 4 (1x100) , glass test tube 3 (1x100) , disposable mask(1x100) , disposable mask(1x50) , mask tripple layer (1x1) , mask n 95 (1x1) , dropper plastic 5 ml (1x100) , micropore transparent tape 1 (1x1) , micropore transparent tape 2 (1x1) , micropore transparent tape 3 (1x1) , band aid (1x100) , bandage 10 cm (1x12) , tongue dipresser wooden (1x100) , zipper polythen (for packing medium size) (1x100) , printer ribbon dot matrix (1x10) , vaccutainer (red top ) for biochemistry 5ml (1x100) , bio medical waste greenbucket with pedal top 25 lit. (1x1) , bio medical waste red bucket with pedal top 25 lit. (1x1) , bio medical waste blue bucket with pedal top 25 lit. (1x1) , bio medical waste yellow bucket with pedal top 25 lit. (1x1) , bio medical waste black bucket with pedal top 25 lit. (1x1) , gel+clot activatervial with cap (3ml) 1 *100 , clot activator vial 4ml 1 *100 , plain screw cap tube 5ml (1x100) , oil immersion lens (for microscope) (1x1) , liquid paraffin(for microscope) (1x500 ml) , tourniquet (buckle type) (1x1) , touniquiet (velcro) (1x1) , rectified spirit(1x500 ml) , phenyl (1x5 ltr) , lyzol (1x5 ltr) , toilet cleaner (1x500 ml) , acid for washing (1x500 ml) , mop (1x1) , dusting cloth (1x1) , doormat 4*6 (1x1) , glass cleaner(1x500 ml) , puncture proof box(1x1) , b.p. instrument (mercury) (1x1) , b.p. instrument dial (1x1) , b.p. instrument digital (1x1) , b.p. instrument cuff with cover (1x1) , b.p. instrument armlet rubber (1x1) , bulb rubber (1x1) , weight machine digital up to 150 kg (1x1) , weight machine arroe up to 150 kg (1x1) , postal scale 1kg (1x1) , tips stand (1x1) , beaker glass 500 ml (1x1) , measuring cylinder 500 ml (1x1) , slipeer rubber (1x1) , calcium sandoz 100 tablet chewable (1x100) , bucket blue with sieve (for bio medical waste) 25 ltr (1x1) , bucket red with sieve (for bio medical waste) 25 ltr (1x1) , micro pipette 10ul(fix volume) (1x1) , micro pipette 20ul(fix volume) (1x1) , micro pipette 50ul(fix volume) (1x1) , micro pipette 100ul(fix volume) (1x1) , micro pipette 500ul(fix volume) (1x1) , micro pipette 1000ul(fix volume) (1x1) , micro pipette 5 50ul(variable) (1x1) , micro pipette 20 200ul(variable) (1x1) , micro pipette 100 1000ul(variable) (1x1) , paper gloves (1x100) , surgical gloves latex disposable (large) (1x100) , surgical gloves latex disposable (medium) (1x100) , surgical gloves latex disposable (smsll) (1x100) , surgical gloves latex 6 (1x1 pair) , surgical gloves latex6.5 (1x1 pair) , surgical gloves latex7 (1x1 pair) , surgical gloves latex7.5 (1x1 pair) , surgical examinination gloves (free size) (1x100) , hand sanitizer (liquid) (1x500 ml) , sodium hypo chloride 5% (1x5 ltr) , test tube rack aluminium (1x72 wells) (1x1) , test tube rack aluminium (1x96wells) (1x1) , test tube rack plastic (1x48 wells) (1x1) , test tube rack plastic (1x96 wells) (1x1) , test tube rack plastic (1x24 wells) (1x1) , slide tray aluminium for 20 slides (1x1) , slide tray aluminium for 24 slides (1x1) , disposable needle 20 nos (1x100) , disposable needle 22 nos (1x100) , disposable needle 24 nos (1x100) , disposable needle 26 nos (1x100) , disposable needle 23 nos (1x100) , disposable syringe 2cc with needle (1x100) , disposable syringe 5cc with needle (1x100) , disposable syringe 10cc with needle (1x50) , blue tips(1x500) , yellow tips (micro) (1x1000) , tissue paper (1x1 roll) , d.i. water (1x5 ltr) , glass marking pencil (1x10) , permanent marker pen (1x1) , marker pen fine tip(1x1) , cotton (1x500 gm) , cpda penta bag 450 ml (1x1x1) , cpda penta bag 450 ml (1x10x6) , cpda penta bag 450 ml (1x10x10) , d.w.(0tds)(1x5ltr) , digital tharmameter 1 pcs , glucometer (code free) (1x1) , blood sugar strip code free (1x100) , accucheck active (blood sugar strip )(1x50) , glucometer cell (1x1) , carbon bush for centrifuge machine (1x2) , grams stain (1x500 ml) , liquid soap for hand wash (1x500 ml) , scalpal blade 11 to 23no (1x100 pcs ) , syringe 20 cc with needle (1x25 pcs) , syringe 50 cc with needle (1x25 pcs) , torch igm elisa (1x96) , torch igm elisa (1x48) , torch igg elisa (1x96) , torch igg elisa (1x48) , hepttitis a elisa (1x96) , hepttitis a elisa (1x48) , thermal printer paper roll (size 57x25mm) (1x12) , anti hav rapid card (1x50) , anti hev rapid card (1x50) , hiv elisa (igg+igm+antibody combo) (1x96) , hiv elisa (igg+igm+antibody combo) (1x48) , surgical knife blade 23 no. (1x100) , aluminium screw for 30 ml glass bottle (30 ml) , bath soap , gdw 5% (glass bottle) (500 ml) , ns (glass bottle) (500 ml) , bio medical waste bag black 50ltr (1x100) , digital weighing machine cell (1x1) , pencil cell (small/medium) (1x1) , liss/coombs (24x12) , diluent (1x500 ml) , abo/rh (4x12) , abo/d+ reverse (24x12) , binocular microscope eye piece 10 x (1x1) , binocular microscope eye piece 5 x (1x1) , binocular microscope objective lens 10 x (1x1) , binocular microscope objective lens 40 x (1x1) , binocular microscope bulb (1x1) , glass slide size 75mmx25mmx1.35mm(1x50) , anti hav elisa igm (1x96) , hbsag elisa (1x96) , hcv tridot pack 4th genration (1x100) , tpha rapid kit (1x1) , brucella igm elisa (1x96) , micropore tap 4 (1x1) , biological indicator of autoclabe machine1 roll , anti hbs ag (hepa card) pack size(1x100test) , ana (16 strips) , japanese encephalitis igm (1x96 tests) , rota virus igm elisa(1x96) , rotavirus/adenovirus latex agglutination(1x100 test) , salmonella o ag group c for salmonella 5 ml x 1 (1 vial) , brucella igm elisa96 test/kit , measles igm (mu capture) (1x96 tests) , hsv 2 card test pack size(100 test) , rubber chestbulb for ecg lead 1 pcs , bio medical waste greenbucket with pedal top 50 lit. (1x1) , bio medical waste red bucket with pedal top 50 lit. (1x1) , bio medical waste blue bucket with pedal top 50 lit. (1x1) , bio medical waste yellow bucket with pedal top 50 lit. (1x1) , bio medical waste black bucket with pedal top 50 lit. (1x1) , plastic bag for biomedical waste 25 ltr red (1x100) , plastic bag for biomedical waste 25 ltr green (1x100) , plastic bag for biomedical waste 25 ltr yellow (1x100) , plastic bag for biomedical waste 25 ltr black (1x100) , plastic bag for biomedical waste 25 ltr blue (1x100) , plastic bag for biomedical waste 50 ltr red (1x100) , plastic bag for biomedical waste 50 ltr green (1x100) , plastic bag for biomedical waste 50 ltr yellow (1x100) , plastic bag for biomedical waste 50 ltr black (1x100) , plastic bag for biomedical waste 50 ltr blue (1x100) , formaldehyde solution (1x5 ltr) , cotton mop (1x1) , dry mop (1x2) , d dimer qualitative (1x60) , d dimer quantitative (1x100) , il 6 (1x100) , pro calcitranin (1x100) , ferritin (1x100) , hba1c kit (1x100) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x500 ml) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x1 ltr) , h2o2 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) (1x5 ltr) , deoxycholate citrate agar(500 gm) , mac conkey agar (500 gm) , nutrient agar (500 gm) , cled agar (500 gm) , mycological peptone (500 gm) , mannitol motility agar (500 gm) , christian urea agar (500 gm) , triple sugar iron media(500 gm) , simmons citrate agar (500 gm) , kovacs indole reagent (500 gm) , mannitol powder (500 gm) , glucose powder(500 gm) , lactose powder (500 gm) , sucrose powder (500 gm) , hydrogen peroxide 3/6% (500 ml) , oxidase reagent 100 gm , mueller hinton agar(500 gm) , potassium di hydrogen phosphate powder 500gm (500 gm) , robertson’s cooked meat broth medium 500 gm (500 gm) , bile salt powder with cholic acid content >= 45.0%, certified, 250 gm (250 gm) , sda with chloramphenicol500 gm (500 gm) , xylose lysine deoxycholate agar (xld agar ) (500 gm) , crystal violet powder 100 gm/pack (500 gm) , thioglycollate powder 500 gm (500 gm) , iodine crystals 100/500 gm(500 gm) , sodiumbicarbonate 500 gm (500 gm) , ammonium oxalate powder 500 gm (500 gm) , potassium permanganate powder 500gm (500 gm) , calcium chloride 100 gm (500 gm) , zeihl neelsen stain kit500 ml with proper cas number, certified (2000 ml) , brain heart infusion broth 500 gm (500 gm) , acetone 500 ml (500 gm) , leishman stainpractical grade for microsopy twin pack 500 ml(500 gm) , leishman stainpractical grade for microsopy 100 gm powder(500 gm) , bile esculin agar 500 gm (500 gm) , selenite f brothpowder( 100gm) , grams stain kit(2 ltr) , dermatophyte test agar & supplement(500 gm) , hi chrome agar for candida 100gm (500 gm) , potassium hydroxide 500 gm (500 gm) , sda with chloramphenicol500 gm (500 gm) , sodium chloride (anhydrous) 500 gm (500 gm) , india ink or nigrosin 100 gm , lactophenol cotton blue(500 gm) , albert stain 100 ml each a& b 100 ml , lowenstein jensen powder 500gm(500 gm) , phenol crystals 500 mg (500 mg) , mannitol motility agar 100 gm , of basal medium 500 gm (500 gm) , ferric chloride powder 500 gm (500 gm) , amikacin (30mg) (2000 discs) , amoxyclav (30 mcg) (2000 discs) , ampicillin(2mg) (2000 discs) , azithromycin(15mcg) (2000 discs) , aztreonam(30mcg) (2000 discs) , bacitracin (50 discs/vl)(1000 discs) , bile esculin discs (500 discs) , cefazolin (cz) (30 mcg) (2000 discs) , cefipime(30mcg) (2000 discs) , cefixime (5mcg) (2000 discs) , cefoperazone sulbactum(75mcg/30mcg) (2000 discs) , cefotaxime (30 mcg) (2000 discs) , cefoxitin (30 mcg) (2000 discs) , ceftazidime (30mg) (2000 discs) , ceftazidime /clavulamic acid (30/10mg) (2000 discs) , ceftriaxone (30mcg) (2000 discs) , cefuroxime(30 mcg) (2000 discs) , chloramphenicol(30mcg) (2000 discs) , ciprofloxacin (5mg) (2000 discs) , clindamycin 2 mcg (2000 discs) , colistin (10mcg) (2000 discs) , co trimoxazole (23 75/1.25mg)(2000 discs) , erythromycin(2000 discs) , gentamicin(10mcg) (2000 discs) , gentamicin(120mcg) (2000 discs) , imipenem (10mg) (1000 discs) , levofloxacin (5mcg) (2000 discs) , linezolid(30mg) (2000 discs) , meropenem(10mcg) (1000 discs) , metronidazole(5mg)(2000 discs) , nalidixic acid (30mg) (1000 discs) , nitrofurantoin(300mcg) (2000 discs) , novobiocin (30 mg) (2000 discs) , onpg discs(1000 discs) , optochin disc (for s.pnemonioe ,,) (1000 discs) , oxidasediscs. (1000 discs) , ofloxacin (5mcg) (1000 discs) , penicillin g(10units) (1000 discs) , piperacillin (100mg) (2000 discs) , pipera tazobactum(100/10 mcg)(2000 discs) , polymyxin b(300units) (1000 discs) , teicoplanin(30mcg) (1000 discs) , tetracycline (30mg) (1000 discs) , ticarcillin clavulanic acid (75/10 mcg) (2000 discs) , tobramycin(10mcg) (2000 discs) , vancomycin(30mcg) (2000 discs) , fosfomycin 200 mcg (1000 discs) , cefoxitin + cloxacillin (2000 discs) , tigecycline 15 mcg (2000 discs) , cephazolin(30mcg) (2000 discs) , cinoxacin(100mcg) (1000 discs) , norfloxacin(100mcg) (2000 discs) , ertapenem(10mcg) (1000 discs) , oxacillin(10mcg) (1000 discs) , cefoxitin(30mcg) (2000 discs) , glass petri dish culture,90mm (50 pcs) , glass slides size 75mm x 25mm x 1.35 mm, 50/pk (500 pcs) , single cavity glass slide for motility 1 pcs , mccartney bottle w/ aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml ; 100/pk (100 pcs) , mccartney flat bottle :aluminium cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 30 ml; 100 piece /pack (100 pcs) , volumetric conical erlenmeyer flask (glass) 50 ml graduated w/ stopper, class a, usp certificate, (5 pcs) , volumetric conical flasks, erlenmeyer, narrow mouth, 100 ml (5 pcs) , volumetric conical erlenmeyer flask (glass) 500 ml graduated class a , usp certificate (5 pcs) , graduated laboratory dropping bottle with rubber dispenser fitted250 ml capacity of borosilicate glass(5 pcs) , amber coloured wide mouth graduated glass bottle 500 ml (5 pcs) , glass funnel plain 60 degree angle long stem, size 75mm (2 pcs) , glass beaker borosil 100 ml with spout (10 pcs) , u shaped glass rod(2 pcs) , glass beaker of 2 lt , heavy duty , double graduation metric scale (5 pcs) , glass beaker with spout (discarding jar) 1lt(5 pcs) , test tube glass size 12cm x 150 mm (50 tubes per pack) (1x50) , measuringpipette with rubber bulb 10 ml (mohr type) class b(5 pcs) , measuring cylinder, with class a certificate capacity 1000ml with stopper 1 pcs , measuring cylinder, with class a certificate ;capacity 250ml with stopper (2 pcs) , slide boxes for students for 100 slides 600 slide , heavy duty gloves heat resistant , category iii glove, preferably en 407 performance levels (4 pairs) , test tube stand polypropylene 3 tier fortest tubes(20 piece) , paraffin films m rolls 2 inch width 250 feet length(5 pack) , falcon tube (conical) polypropylene ,usp class vi, max g force of 15,000xg ;50 ml ,360 piece/pk (500 pcs) , falcon tube (conical) polypropylene 15 ml 1 pack of 300 each (300 pcs) , test tube rack holder 40 50 holes vents plastic centrifugal deck(10 pcs) , universal eto sterile plastic(pp) containers(30ml) 100 piece in pack (1000 pcs) , coplin jars pp for keeping slides pack of 12 (12 pcs) , sterile swab with collection vial ( himedia pref.) 100 piece/pkt (500 pcs) , screw cappedvial 3 ml polypropylene for serum storage(2 pcs) , spatula spoon shaped plastic for chemical dispense (graduated) 10 piece , autoclave bowie dick tape 1 pack of 30 tests, complies to ansi/aami/iso 11140 5:2007 class 2. (100 test) , ph paper strips 1 14 ph range himedia , fisher scientific(200 strips) , forcep stainless steel non corosive surgical grade (00 & higher) (3 pcs) , nichrome straight wire (2 mm) embedded in brass rod with heat resistant handle (preferably himedia) (5 pcs) , nichrome straight wire (3 mm) embedded in brass rod with heat resistant handle (preferably himedia) (5 pcs) , sterile stainless steel surgical blade of 15 nos. (500 pcs) , sterile stainless steel surgical blade of 23 nos.skin friendly cost effective(400 pcs) , steel surgical scalpel blade chisel/ handle (2 pcs) , forceps for cover glasses, kuhne type (4 pcs) , glass or diamond marker(5 pcs) , stainless steel tub 25 ltfor glass wash (2 pcs) , utility tray320x260x70mm for transport of samples(2 pcs) , forcep autoclavable, size 12 inch,blunt tip, ss 410 2 nos/pack (2 pcs) , forcep autoclavable, size 8 inch, blunt tip, ss 410 2 nos/pack (2 pcs) , stainless steel forceps, pointed, autoclavable, size 8 inch, ss 410 2 nos/pack 1 pcs , tongs stainless steel 12 inch for beaker (borosil)1 pcs , stainless steel forceps, pointed tips and handles 8 inch, 2 no/pack(100 pcs) , test tube washing brushes steel(pack of 10) (10 pcs) , zinc sulphate 100gm , cover slip 22 mm (1x50) , surgical gloves free size (not powderd) (nitrile hand gloves) (1x100) , xylene (1x500 ml) , slide drying tray aluminium (1x1) , sliper plastic (1x1) , sodium polyanethol sulphonate powder 5 gmsigma1 bottle...

Medical College - Rajasthan

36093405 supply of chemicals histology & pt inr machine reagents supply work i histology reagentcost paraffin wax with ceresin.6o.62c3o kg alochol(99.9%)20 ltr acetone 2o ltr xylene (sulpher free)20 ltr formaline 2o ltr heamatoxylene powders nos sodium iodides nos cytrike acid nos chloral hydrates nos aluminium ammoonium sulphate5 nos eiosine yellows nos l set for block preparationio set prothrombin time reagents kit(200 test ) etc ...

Shree Karan Narendra Agriculture University - Rajasthan

36053823 rate contract for chemicals for 2022 23 and 2023 24 1 1, 2 dichloroethane 2 1 naphthol ar 3 2 3 5 tri phenyl tetrazolium chloride ( ttc ) 4 2, 4 d 5 2, 4 dinitro phenyl hydrazine ( dnph ) 6 2, 6, dicholorophenol indophenol ( dcip ) 7 30% hydrogen peroxide ar grade 8 5 sulphosalicylic acid dihydrate ar 9 absolute alcohol 10 absorbant cotton 11 acetic acid glacial ar 12 acetocarmine solutions 13 acetone 14 acetone ( hplc grade ) 15 acetone ar ( special grade ) 16 acid fuchsine 17 acrylamide 18 activated charcoal ar grade 19 agar powder ( bacteriological grade ) 20 almunium chloride 21 aluminium chloride hexahydrate extrapure ar, 99% 22 aluminium foil 23 ammonia solution sp. gr 0.91 24 ammonium acetate ar grade 25 ammonium chloride 26 ammonium dihydrogen ortho phosphate 27 ammonium ferrous sulphate hexahydrates 28 ammonium molybdate ar grade 29 ammonium molybdate tetrahydrate extrapure 30 ammonium oxalate monohydrate 31 ammonium persulphate ( aps ) 32 ammonium sulphate 33 anhydrous sodium carbonate 34 anthorne reagent ( 2 n ) 35 anthrone ar 36 apron coat 37 ascorbate 38 ascorbic acid 39 azoxystrobin 40 azoxystrobin + hexaconazole 41 azoxystrobin +tebuconazole 42 bacillus subtilis 43 bap 44 bap solution 45 banzyl adenine 46 barium chloride dihydrate 47 barium sulphate 48 beef extractar grade 49 benomyle 50 bis acrylamide 51 blitox 50% wp ( coc ) 52 borex 53 boric acid ( powder ) 54 bovine serum albumin ( bsa ) 55 brassinolids 56 bromocresol blue indicator 57 bromocresol green 58 bromocresol purple sodium salt 59 bromophenol blue ( bpb ) 60 bromothymol blue indicator powder 61 buffer ampule ( setof 6 ) 62 buffer tablet of ph ( 4.0 ) 63 buffer tablet of ph ( 7.0 ) 64 cadmium chloride monohydrate 65 calciumnitrate tetrahydrate 66 calcium carbonate ar grade 67 calcium chloride 99% extra pure 68 calcium sulphate anhydrous 69 calcium sulphate dihydrate 70 captan 71 carbandzim+ mancozeb 72 carboxin 37.5% + thiram 37.5% ( vitavax power ) 73 carmine powder 74 castor oil 75 catechol extrapure 99% 76 cedar wood oil medium 77 chloroform ( ethanol stabilized ) 78 chloroform ( hplc grade ) 79 chlorothalonil 80 chlortetracycline hydrochloride 81 citric acid 82 clove oil 83 cobalt chloride hexahydrate ( cocl2.6h2o ) 84 cobaltus chloride 85 cobaltus nitrate hexahydrate 86 sulphuric acid ( h2so4 ) 87 coomassie brilient blue r250 88 copper sulfate pentahydrate ( cuso4.5h20 ) 89 copper sulphate 90 corn meal media 91 cotton blue 92 crystal violet ar grade 93 ctab ( cetyl trimethylammonium bromide ) 94 czapek”s dox agar 95 d ( + ) ribose 96 darco g 60 ( activated charcoal ) 97 liquid detergent ( lab garade ) 98 dextrose 99 d fructose a / r 100 di sodium hydrogen arsenate 101 dibasic sodium phosphate 102 diehylene tri amine penta acetic acid ( dtpa ) ar grade 103 diethyl ether ar ( stabilised ) 104 diethyline tri amine penta actic acid ( dtpa ) 105 difenconazole 106 dimethyl sulfoxide ( dmso ) 107 diphenylamine indicator 108 di sodium hydrogen arsenate 109 disodium tetrachloropalladate ( na2pdcl4 ) 110 dntps mix 111 edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 112 ethanol hplc grade 113 ethidium bromide 114 ethyl alcohol 115 ethyl methanesulfonate ( ems ) 116 ethylene alcohol 117 ethylenediaminetetraacetic acid ( na2edta ) 118 eucalyptus oil 119 ferric chloride 120 ferrion indicator 121 ferrous ammonium sulphate ar grade 122 ferrous sulphate ( feso4.7h2o ) ar 123 ferrous sulphate hypt 124 filter paper sheet 125 folin & ciocalteu’s phenol ( fcp ) reagent ar 126 folins uric acid 127 formaldehyde 128 fosetyl al 129 gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 130 glacial acetic acid 131 glucose ar grade 132 glutamic acid 133 glycerene 134 glycerol 135 glycine 136 gum acacia 137 n haxen 138 hexaconazole 139 hexaconazole 4% + zineb 68% 140 hoagland’s no. 2 basal salt mixture 141 huwasam spray ( nanosilver & peroxide ) 142 hydrochloric acid 143 hydrochloric acid 0.5n aq. solution 144 hydrochloric acid lr 145 hydrogen dichloroethan 146 hydrogen peroxide 30% 147 hydrogen peroxide 6% 148 hydroquinone 149 hydroxyl amines ( ha ) 150 hydroxylamine hydrochloride 151 iaa 152 iaa solution 153 iba 154 iba solution 155 iodide crystals 156 iodine ar grade 157 iron sulphate 158 iron tartrate 159 isoamyl alcohol 160 isopropanol alcohol 161 jasmonic acid 162 kavach ( syngenta ) 163 kh2po4 164 labolene 165 lactic acid ar 166 l ascorbic acid extrapure 167 l glycine ( triglycine ) extrapure, 99% 168 linseed oil 169 linseed oil cake 170 l phenylalanine extrapure chr, 99% 171 l tyrosine for biochemistry 172 magnesium chloride 173 magnesium sulfate heptahydrate ( mgso4.7h20 ) 174 malt agar 175 malts media 176 mancozeb 177 manganese sulfate monohydrate ( mnso4.h20 ) 178 manganese sulphate 179 manitol ar grade 180 martin’s media 181 mercaptoethanol 182 mercuric chloride ar 183 metalaxyl m ( ridomil gold ) 184 metaphosphoric acid 185 methanol 186 methanol ( ar grade ) 187 methanol hplc grade 188 methionine 189 methyl blue indicator ar grade 190 methyl methanesulfonate ( mms ) 191 methyl orange indicator 192 methyl red indicator 193 mgcl2 194 molyclean ma 03 phosphate free 195 molysol ‘e’ ar 196 monobasic sodium phosphate 197 myclobutanil 198 n ( 1 naphthyl ) ethylene diamine hcl ( n ned ) 199 n n methylenebisacrylamide 200 n orthophosphoric acid 201 n propanol 202 naa 203 naa solution 204 neemoil 205 nesseller reagent 206 nessler reagent ar grade 207 n hexane 99% ar 208 nicotinic acid 209 ninhydrin ar ( 99% assay ) 210 nitric acid 211 nitro blue tetrazolium ( nbt ) 212 nutrient agar 213 nutrient agar readymade 214 oat meal media 215 o dianisidine 216 orcinol 217 oxalic acid 218 oxaloacetic acid 219 p nitrophenyl sulphate 220 pacelio uslilacinus 221 paraffin wax 222 pcnb ( pentachloronitrobenzene ) 223 pda readymade 224 peg 6000 225 peptonear grade 226 petroleum ether ( 60 1000c ) 227 petroleum ether 60 80c 228 phenophthalin indicator 229 phenol ( 2n ) 230 phenol crystalline extrapure ar 231 phenol disalfonic acid 232 phenolphthalein indicator powder 233 phosphoric acid 234 p nitrophenol phosphate ar grade 235 polyvinylpyrolidone ( pvp ) 236 potasium meta bi sulphite 237 potassiumdicromate 238 potassiumhydroxide pellets 239 potassiumiodide 240 potassium acetate 241 potassium chloride 242 potassium chromate ar 243 potassium dichromate 244 potassium dichromate 245 potassium dihydrogen phosphate 246 potassium ferricyanide 247 potassium hydrogen sulphate 248 potassium iodide ( ki ) 249 potassium metabisulphite 250 potassium oxalate 251 potassium permanganate ar grade 252 potassium permangnate 253 potassium sulphate 254 potassium tartrate 255 potato dextrose broth 256 pottassium hydroxide 85% ar 257 pottassium nitrate 99% ar 258 propiconazole ( tilt ) 259 propineb ( antracol ) 70 w% 260 protein ladder marker ( mid range ) 261 pyridoxine hcl 262 pyrogallol extrapure 263 rapd marker ( molecular markers different series ) . 264 raxil ( bayer ) 265 resorcinol ar 266 rutin trihydrate pure 99% 267 saffranin 268 salicyclic acid 269 sesame oil 270 silver nitrate 271 sodiumchloride 272 sodium acetate anhydrous 273 sodium acetate trihydrate 274 sodium arsanate 275 sodium azide 276 sodium benzoate 277 sodium bicarbonate 278 sodium chloride 279 sodium chloride ar grade 280 sodium citrate 281 sodium cobalt nitrite 282 sodium dihydrogen phosphate 283 sodium dodicyl sulfate 284 sodium hydrogen carbonate ar grade 285 sodium hydroxide ar grade 286 sodium hydroxide extrapure ar 287 sodium hypochloride 288 sodium molybdate dihydrate ( na2moo42h20 ) 289 sodium nitrite 290 sodium phosphate 291 sodium potassium tartarate tetrahydrate 292 sodium silicate 293 sodium thiosulphate 294 sodium tungstate dihydrate extrapure ar, 99% 295 stannous chloride dihydrate 296 streptocycline 297 streptomycin sulfate 298 sucrose 299 sulfex 300 sulphailamide 301 sulphosalicylic acid 302 sulphuric acid 303 sulphuric acid 98% ar 304 taq buffer 305 taq polymerase ( su / pl ) 306 tebuconazole 307 temed 308 tergitol np 10 309 thiamine hcl 310 thiobarbituric acid 311 thiophanate methyl 70% wp 312 toluene 313 total hardness indicator tablets 314 tri chloroacetic acid 315 trichoderma harzianum 316 tricyclozol 8% + mancozeb 62% 317 triethylamine ( tea ) 318 triphenyl formazan ( tpf ) ar grade 319 tris hcl 320 triton x 100 321 universal indicator solution 322 v8 agar medium ( vinegar ) 323 vitavax power 324 wettable sulfur 325 xylene 326 yeast extract ar grade 327 zinc chloride 328 zinc oxide 329 zinc sulfate tetrahydrate ( znso4.4h20 ) 330 zinc sulphate heptahydrate...

Medical College - Rajasthan

35894046 rate contract for chemicals for pathology department , a.chemical & reagent and consumables , acid nitric lr , acid periodic ar , acid oxalic lr , acid hydrochloric lr , acid n/10 hcl ar , acid fuchsin lr , acid glacial acetic ar , acid phosphomolybdic lr , acid phosphotungstic lr , acid sulphuric lr , acide picric lr , acide formic lr , acid ascorbic lr , acid trichrocetic lr , acid cromic/chromictrioride lr , acid n/1 hcl ar , ammonium solution (liquid ammonia) lr , acetone ar , aluminium pot. sulphate ar (pot. alum) , aluminium ferric sulphate (iron alum) , albumin egg (flakes ) ar (himedia) , aniline blue lr , basic fuchsin lr , biebrich scarlet lr , crystal violet lr , congo red lr , dpx mount lr , eosin yellowar , formaldehyde 37 40% lr (formaline) , gold chloride lr , haemotoxylin lr , hexamine ar , isopropyl alcohol ar , light green s/f ar , methyl blue ar , paraffin wax 60 620c with cercine , paraffin wax in pelletes 58 60 c with cercine , potassium iodate lr , potassium hydroxidelr , potassium metabisulphate lr , phenol crystal (melted) lr , silver nitrate ar , sodium thiosulphate lr , sodium metabisulphate lr , dionised water , glycerin ar , sodium iodate lr , methanol ar , ether solvent lr , hydrogen peroxide (h2o2) , toluidine blue , xylene s/f ar , iodine , ferric chloride , alcian blue , activated charcoal powder , ethanol absulate , methyl voilet , giemsa stain powder a , oil immersion ar (1x30) , oil immersion ar (1x125) , neutral red , sodium hydrogen orthophosphate , may greenwald solution , leishman stain powder (rankem) , sodium citrate , potassium ferocynide , briliant crystal blue , sodium hydroxide (naoh) , sodium chloride (nacl) ar , disodium hydrophosphate , dextrose (glucose) , sodium nitrate , sodium acetate , liquid paraffin , potassium acetate , tlc fluid (trunks solution) , trbc fluid (hymes solution) , ammonium sulphate , trisodium citrate , benedicts reagents , sodium nitropruside , sodium toroculate , sulphur powder , lishman stain solution , spirit r/f , urine multisticker , blood group antisera abd , aluminium potassium , sulphate decarbohydrate ar , citric acid , hydroqunon , gelatin , fast green , normal saline 0.9% , lab detergent neutril , ammonium acetate , auromine , aluminium potassium ar , ammonium hydroxide (pure) ar , fast blue bb salt , fast gormet gbc salt ar , naphlyl acetate , parasanidine , hand wash gel , ammonium molibdate ar , aluminium ammonium sulphate , cytromatrix embedding medium , clestain blue , cobaltuse chloride , dettol , ferric ammonium citrate , gyecophosphate disodium salt hydrate , gentim violet , methyl green , new fushion , ossium tetraoxide , potassium carbonate , sodium bisulphate , tolidin blue , yellow ammonium sulphate , ammonium chloride , ab cotton , sodium hydrogen phosphate...

Sms Medical College - Rajasthan

35876352 rate contract for chemicals for pathology department (nit 224) 1. acidnitriclr 2. acid periodic ar 3. acidoxaliclr 4. acid hydrochloric lr 5. acid n/10 hclar 6. acid fuchsin lr 7. acid glacial acetic ar 8. acid phosphomolybdic lr 9, acid phosphotungstic lr 10. acid sulphuric lr 11. acid picric lr 12. acid formic lr . 13. acid ascorbic lr 14. acid trichloracetic lr 15. acid cromic/ chromictrioride lr 16. acid nil hcl ar 17. ammonium solution (liquid ammonia) lr 18. acetone ar 19. alumninium pot. sulphate ar (pot. alum) 20. aluminium ferric sulphate (iron alum) 21. albumin egg (flakes) ar (himedia) 22. aniline blue lr 23. basic fudhsin lr 24. l3iebrich scarlet lr 25. crystal violet lr 26. congo red lr 27. dpx mount lr 28. eosin yellow ar 29. formaldehyde 37 40% lr (formaline) 30. gold chloride lr 31. haemotoxylin lr 32. ilexamine ar 33. isopropyl alcohol ar 34. light green s/f ar 35. methyl blue ar 36. paraffin wax 60 62°c with cercine 37. parainn wax in pellets 5 8 60°c with cercine 38. potassium lodate lr 39. potassium hydroxide lr. 40. potassium metabisulphate lr 41. phenol crystal (melted) lr 42. silver nitrate ar 43. sodium thiosuiphate lr 44. sodium metabisulphate lr 45. dionised water 46. glycerin ar 47. sodium lodate lr — 48. methanol ar 49. ether solvent lr 50. hydrogen peroxide (h202) 51. toluidine blue 52. — xylene s/f ar 53. iodine 54. ferric chloride 55. alcian blue 56. activated charcoal powder ethanol absulate 57. 58. methyl voilet 59. giemsa stain powder a 60. oil immersion ar (1x30) 61. oil immersion ar (1x125) 62. 63. neutral red sodium hydrogen orthrophosphate 64. may greenwald solution . 65. leishman stain powder (rankem) 66. sodium citrate 67. potassium ferocynide — 68. briliant crystal blue 69. sodium hydroxide (naoh) 70. sodium chloride (nac1) ar — 71. disodium hydrophosphate 72. dextrose (glucose) 73. sodium nitrate 74. sodium acetate 75. liquid paraffin 76. potassium acetate ____ 77. tlc fluid (trunks solution) 78. trbc fluid (hymes solution) 79. ammonium sulphate 80. trisodium citrate 81. benedicts reagents — 82. sodium nitropruside .____r 83. sodium toroculate __________ 84. sulphur powder 85. lishman stain solution _____ 86. spirit r/f 87. urine multisticker blood group antisera abd 89. aluminium potassium 90. sulphate decarbohydrate ar 91. citric acid 92. hydroqunon 93. gelatin 94. fast green 95. normal saline 0.9% 96. lab detergent neutril 97. ammonium acetate 98. auromine 99. aluminium potassium ar 100. ammonium hydroxide (pure) ar 101. fastbluebb salt 102. fast gormet gbc salt ar 103. naphlyl acetate 104. parasanidine 105. hand wash gel 106. ammonium molibdate ar 107. aluminium ammonium sulphate 108. — cytromatrix embedding medium 109. clestain blue 110. cobaltuse chloride ill. dettol 112. ferric ammonium citrate 112. ferric ammonium citrate 113. gyecophosphate disodium salt hydrate 114. gentim violet 115. methyl green 116. new fushion 117. ossium tctraoxide 118. potassium carbonate 119. sodium bisulphate 120. tolidin blue 121. yellow ammonium sulphate 122. ammonium chloride 123. ab cotton 124. sodium hydrogen phosphate etc ...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

35370427 tender for reagents supply hametroxyline delafield, eosin, formaldehyde, cassette plastic, dpx mount, microscopic slide, cover slip, diamond pencil, nitric acid, xylene, acetone, filter paper, egg albumin, distill water, pap stain kit, microtome blade, tissue paper, field stain kit, cotton, rapid afb kit, pas staining kit, leishman stain kit, etc....

National Institute Of Ayurveda - Rajasthan

35315066 rate contract for supply of chemicals and glassware , chemicals : , zinc sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , sulphuric acid ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 ml , barium chloride ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , barium sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , copper sulphate ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , sodium hydroxide ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 500 gm , folin & ciocalteus phenol reagent ar grade and equivalent (cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards) 100 ml , sodium potassium titrate ar cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , sodium carbonate ar cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , bsa standard cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10ml , ammonium molybdedate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , diehthyl amine ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100ml , cresolphthalein ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10g , hydroxy quinoline ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , formaldehyde ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5l , carboxy methyl cellulose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , hydrochloric acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , picric acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 g , leishman’s stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 250 ml , phosphate buffer solution ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , ammonium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , goldner’s strichome ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , gooding & steward’s fluid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sheep blood agar ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , acetone ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , xylene ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , benzene ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , ethanol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 200 ltr , harris haematoxyline ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , eosine yellow ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , iso propyl alcohol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , n butane for hplcar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , acetonitrile for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , water for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , methanol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 l , ethanol for hplc ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , sodium carbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , phenol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , gallic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 gm , aluminium chloride hexa hydrate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , quercetin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25 g , gum acacia ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , acetic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , pepsin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , sodium citrate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , urathane ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , formic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5l , glycerin cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 l , streptozotocin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , phenolphathaline indicator ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125ml , paraformaldehyde ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , sucrose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , citrate buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1000ml , tris buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100ml , nicotinamide ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , nitro blue tetrazolium ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 3g , phosphate buffer ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5l , ascorbic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , phosphate buffer solution ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 ltr , bovine serum albumin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , fetal bovine serum ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , penicillin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25g , streptomycin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 gm , dulbecco modified eagles medium (dmem) ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , cadmium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500gm , distilled water ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 litre , sudan black dye ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100gm , von kosa stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , trichome masson stain ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , periodic acid shiff ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500ml , dpx mount ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 250 ml , cedar wood oil ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125ml , ova albumin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , aluminum chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , nonxynol 9 ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25gm , hydrogen peroxide 30% ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 litre , dtnb ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10g , edta (sodium salt) ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50g , sodium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , potassium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , magnesium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , sodium biocarbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , monosodium phosphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , glucose ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , calcium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , sodium hydrogen phosphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500g , polyvinyl pyrrolidone ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , trichloro acetic acid ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100g , tertiary butyl alcohol ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25g , l. methionine ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50 gm , sodium potassium tartarate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium hydroxide ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , triton x 100 ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 ml , riboflavin ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 10 gm , sodium carbonate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , copper sulphate ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium chloride ar grade and equivalent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , ez cleaner for hemotology analyzer cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 125 ml , acetylcholine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , seratonine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 gm , 2 diphenyl 1 picrylhydrazyl cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 gm , hypoxanthin cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 25 gm , xanthin oxidase cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 unit , diethylenetri amine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 100 ml , penteacetic acid cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , nitro blue tetrazolium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 mg , phosphate buffer cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , folin ciocalteau regent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sodium bicarbote cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 ltr , aluminium chloride cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 5 gm , sodium nitrate cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , dimethyl sulfoxide cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , edta disodium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , disstilled water cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards5 ltr , cortisole cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 1 ml , carboxymethyl cellulose sodium cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , triethanolamine cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , sodium biocarbonate cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , sodium hydroxide cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 gm , 0.2n sulphuric acid cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2.5 ltr , recombinant human il 01 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , interlukin 6 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , recombinant human il 01 cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , tnf alpha cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 2?g , kt03 lyse solution cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 500 ml , probe cleanser cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 50ml , kt03 diluent cdh/rankem/merck/himedia/and substanitcy equalient to chemical composition standards 20 ltr , glasswares : , beakers 5 ml , beakers 10 ml , beakers 25 ml , beakers 50 ml , beakers 100 ml , beakers 250 ml , beakers 500 ml , beakers 1000 ml , beakers 2000 ml , beakers 5000 ml , bottle 25 ml , bottle 50 ml , bottle 100 ml , bottle 250 ml , bottle 500 ml , burettes 25 ml , burettes 50 ml , cylinders 5 ml , cylinders 10 ml , cylinders 25 ml , cylinders 50 ml , cylinders 100 ml , conical flask 10 ml , conical flask 25 ml , conical flask 50 ml , conical flask 100 ml , conical flask 250 ml , conical flask 500 ml , funnel 50 mm , funnel 75 mm , test tube mm 25x200 , watch glass 120 mm , crucible 30 ml , ml6 contractor 230v ac (2no+2nc) or equilant...

Indian Army - Rajasthan

35302383 supply of consumables and expendable medical stores supply of consumables and expendable medical stores , abdominal drain size22 fr , abdominal drain size26 fr , abdominal drain size30 fr , absolute alchohol bott of (500ml) , adhesive plaster micro porous tape 1 inches box of 12 , adhesive plaster microporous tape 3 inches box of 4 , adhesive plaster zinc oxide 7.5 cm x 5 mtr , aed pacing pads , afb kit (ready to use) (2x100 ml) , amylase test kit (4x20 ml) , arm sling (large) , arm sling pouch , arm sling( medium) , aso titre estimation kit (1.4 ml) , baby mucous sucker , bandage dvt stocking large , bandage dvt stocking medium , bandage dvt stocking small , bandage triangular , bilirubin total and direct estimationtest kit (6x44ml)(3x22 ml) , bone marrow aspiration and biopsy needle (disposable) 8 x 4 cm needle , bougie , bovine albumin (10 ml) , catheter suction endobronchial with terminaltransparentnon toxic pvc tubing sizefg 10, length 45 cm , catheter suction endobronchial with terminal transparent non toxic pvctubing sizefg 12 length 50 cm , catheter suction endobronchial with terminal transparent non toxic pvc tubing size fg 14 length 50 cm , ceasarean drapes , central venous catheter(3 lumen) 7fr18g (bbraun/ vygon ) , chest drainage size26 fr , chest drainage size30 fr , chloroform ar (analytical grade) (500ml) , cholesterol estimation test kit(5x20 ml) , ck mb kit (2x44) (2x11) , ck nac (2x44) (2x11) , clavicle bracel , clavicle bracem , clavicle braces , clavicle bracexl , cord clamp , cot finger splint , cover slips (22x50mm)(20 pkt of 10gm each) , crape bandage 15cm , crutches elbow adjustable , dark glass , disposable blade for microtom ( (high profile) (50 blade) , disposable embedding plastic ring(pack of 100) small size , disposable embedding plastic ring (pack of 100) large size , disposable embedding plastic ring (pack of 100) medium size , disposable gown , disposable lscs drape , disposable otpack , disposable ot drape , disposable petridish 90mm eto sterile (pack of 50) , disposable port 10mm , disposable port 5mm , disposable port 7mm , draw sheets disposable , dressing medicated gauze parafin, 10 cm x 10 cm square, tin of 24 , dressing, first aid, unmedicated sterile pack , ear buds bott of 100 , endoloop , erba actime (6x5 ml) , erba calcium chloride (10x10) , erba control ddimer n+p 5x1 ml ,5x1ml , erba d dimer r,1x7 ml , erba ddimer calibrator 1x1 ml , erba protime ls 50 (2x5 ml) , erba reaction cuvettes (1000 nos) , ether solvent 500 ml , fallopian ring , fibrin glue , formaldehyde solution (10 ltr) , functional knee support , g6pd test kit (pack of 50 test) , gauze surgical, open wove, unmedicated : 60 cm x 3 metres packet , gauze surgical, open wove, unmedicated: 60 cm wide , glass cuvette for pt (micro lab) (pack of 100 tube) , glucon d (500gm) , gomoris stain(500 ml) , heel cup (silicon or carbon copolymer) , hme filter , i gel size 1.0 , i gel size 1.5 , i gel size 2.0 , i gel size 2.5 , i gel size 4.0 , i gel size 5.0 , isetrol level 1,2,3(3x10x1.0 ml) , johnson baby buds , kit estimation of triglyceride test kit(5 x 20ml) , kit for estimation of ldh (2x10ml) , kit for estimation of sgot (4 x 24ml) (liquixx) , kit for estimation of sgpt ( 4 x 24ml) (liquixx) , kit for estimation of uric acid (5x 10ml liquixx) , kit lipase (1x20 ml) (1x5ml) , knee cap xl , knife bard packer, blade size 2 fitting (commercial no. 20) packet of 6 , knife bard packer, blade size 2 fitting (commercial no.22) packet of 6 , knife bard packer,. blade size 2 fitting (commercial no. 23) poacket of 6 , laryngeal mask airway size 2.0 , laryngeal mask airway size 3.0 , lectin for sub groups sera a1 (05 ml) , leishmans stain ready to use (500ml) , lignocaine 10% spray , lignocaine hydrochloride gel 0.2% 30gm , loop pds no 1 round body heavy , lot basilocid 500ml , lot cutacept 500ml , lotion betadin 10% bott of 100 ml , lumber puncture needle blue , lumber puncture needle yellow , may grunwald giemsa stain (mgg stain) ready to use(3x250) , mersilk 3/0, 3/8 cutting needle size 26mm with suture length 76mm , mersilk non absorbable braided suture blackno 2.0round bodied 76 cm , mersilk non absorbable braided suture black no 1 round bodied 76 cm , mersilk non absorbable braided suture black no 1.0cutting bodied 76 cm , mersilk non absorbable braided suture black no 3.0cutting bodied 76 cm , micro pipettes size 100 ul , micro pipettes size 10ul , micro pipettes size 200 ul , micro pipettes size 25ul , micro pipettes size 50 ul , micro pipettes size 500 ul , microlyte cal a (280 ml) , microlyte cal b (280 ml) , microlyte deproteinizer (100 ml) , micropore size 10cm , micropore size 6.0cm , mini spike , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 2.0cutting bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 3.0cutting bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 3.0round bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglecaprone 25, undyed) no 4.0round bodied 70 cm , monocrylabsorbable suture synthetic (monofilament poliglycaprone 25, undyed) no 4.0cutting bodied 70 cm , mpo stain (500 ml) , normal saline pouch 500 ml self collapsible , nylon non absorbable suture monofilament no 2.0 cutting 70 cm , nylon non absorbable suture monofilament no 3.0 cutting 70 cm , nylon non absorbable suture monofilament no 4.0 cutting 70 cm , pas stain (reddy to use) (3x500ml) , pds no 1 round body heavy , pencil cautry lead disposable , perritonial dialysis catheter (adult) , pigtail catheter drainage system with dialater set , pointed needle , pop slab 10 cm , pop slab 15 cm , port site dressing 2.5 cm x 2.5 cm , primapore size20cmx10cm , primapore size25cmx10cm , primapore size 15cmx8cm , primapore size 8.3cmx6cm , prolene non absorbable suture (monofilament polypropylene blue) no 1 cutting70 cm , prolene non absorbable suture (monofilament polypropylene blue) no 1 round bodied 70 cm , prothrombin test kit (1x5 ml)(isi value 1.0) , rams cannula size 0 , reticulocyte stain(ready to use) , reusableembedding plastic ring (pack of 100) medium size , reusable embedding plastic ring(pack of 100) small size , ribbon gauze , roller bandage 6cm , roller bandage10cm , serum (ahg) anti human globuline (05 ml) , sevoflurane , silk non absorbable braided suture 06 reelx 25mtr size no 1 , soda lime 05 kg jar , soft swab 10cmx10cm , specimen retrieval pouch endobag , spinal needle 27g , stain haemotoxilline(500 ml) ready to use , steam autoclave tape roll , sterile specimen bottle , sterile urine container (pack of 100) , strips `albumin` and glucose bottle of 100 strips(uristix) , strips `kitone` and glucose bottle of 100 strips(uristix) , surgical blade size 10 (packet of 6) , surgical blade size 11 (packet of 6) , surgical blade size 12 (packet of 6) , surgical blade size 15 (packet of 6) , swab stick disposable (pkt of 500 swab) , sysmex xp cell clean (50 ml) , sysmex xp 100eightcheck trilevel 3 wp (lxnxh) 3x1.5ml , sysmex xp 100 dil 20ltr , sysmex xp 100 stromatolyser wh (3x500ml) , t shapedbandage , tennis elbow support , thermograph for blood storage cabinet , tissue paper roll , tube test, 12 x 75 mm rimless , typhi igg & igm card(40 test kit) , under water seal drainage , urine bag , urine catheter size08fr , urine catheter size12fr , urine catheter size14fr , urine catheter size16fr , vicrylabsorbable suture no 1 round bodied 90 cm , vicrylrapid absorbable suture no 1/0 round bodied heavy needle , vicrylrapid absorbable suture no 2/0 round bodied heavy needle , vicryl rapid double needle 2 0, 150 cm with round body and reverse cutting double armed , walking aid monopod assist , walking stick tetra pod , widal test kit (4x5ml) 45 test , xylene (xyol pure) bott of 500 ml , yankur suction tube disposable...

Department of Agricultural Research and Education - Rajasthan

35135160 bids are invited for srl brand only supply aceton gc hs , hydrochloric acid , isopropanol gc , methanol extrapur ar acs exiplus , chloroform isoml alcohol for colecular biology , phenol chlororom isomyl alcohol , trichoroacetic acid extrapure , tis buffer for hplc , agar powder for microbiology , luria bertani agar , potato dextrose agar , sodium bicarbonate extrapure , n hexane pure , xylene cyanol ff extrapure , ar exiplus mutli compendial , bromophenol blue acs exiplus multi compendial , ethidium bromide for molecular biology , thoglycolic acid exiplus multi compendial , petroleum ether hplc uv spectoscopy , n butyy alcohol extrapure ar acx exiplus multi compendial , toluene extrapure ar acs exiplus multi compendial total quantity : 65...

Department Of Education - Rajasthan

34898280 bids are invited for verniar caliper , screw gauge 25mm , sphe ro meter , dcc wire , resistance wire ureka , resistance wire contan , resistance wire manghine , copper caprimeter pot , drowing bord woden , simple pendulam dob sel , stop clock , stop watch , thermameter 110c , therma meter , therma meter room temp , minimum maximum therma meter , drowing bord pin , sonometer , meter sccle wooden 1 mtr , meter bridge , potentiometer , resohance app , tunning fork set , rubber pad , stand. with claimp iron , plug kcc one way , plug kcc two way , resistance box 100000 , resistance box 100 , resistance box , rhehosted , zinc rod heavy , lacklanchi cell , denial cell , poras pot field , poras pot empty , cell box 2 cell plastic , ameter , volt meter dc 12 holt , galvenometer , induction cail , barmagnet , miliameter 500 ma , optical bench. 1 mtr. ss p , pn juction diode add p , pnp transistor , zener diode ap p , lens holder plastic , transistor loose , compass both side glass , solated weight , inclain plan p , hooks law app p , digital multimeter , parrol gram app p , battery eliminitor , reagent batlle nm 250 ml , reagent batlle nm 500 ml , reagent batlle wm 250 ml , reagent batlle wm 500 ml , dropping bottle 125 ml dolyks , glass tube , igawion tube , certifuge machire hand drive , certifuge machire remi electric , filter paper rim 500 nos , filter paper 125 , water bath copper , corck borar sel , pestal motor , weight machine , china disc , bunsen burner , pippel vlumatric 25ml , burrel 50 ml borocil a , test tube 25x150 borocil a , test tube 15x125 borocil a , test tube 12x100 borocil a , funnel 2 pvc. , funnel 100mm pvc. , test tube holder brass , test tube stand pvc. , spettula , sprit lamp ss , wash bottle 500 ml pvc. , reogent. bottle nm125ml borocil , beoker 100 ml borocil , beaker 250ml borocil , beaker 500ml borocil , conical. flask 250ml borocil , conical. flask 500ml borocil , flate. bottle flask. , conical. flask 500ml borocil , flate. bottle flask. 500ml borocil , dropper g , glass rod. , plaitinum wire , wire gauge. with fram , tonas , univer scal. ckeimp. , boss head , try pot stand , junior medical compound microscope , disseting microscope , forcep. big. , forcep. small , scisser small , scisser big , test. tube holder , test. tube stand , test. tube brush , stop. watch , niddle with plastic handal , dissecting brush , auxano meter , staing rock wooden , try. pot. stand , wire gauge , water bath electric rectangale , s phygnometer , stethoscope , dissecting tray. , electronic balance 300gm cap , test tube 15x125 borocilcole , watch glass , petric disc , plain slide , cavity slide , cover. slipe. , becker , becker 250ml borocilicete , measuring cylender 500ml pvc. , measuring cylender 100ml pvc , conicel flask. 250ml borocilicate , funnel 75mm pvc , gangoes potometer borociliate , gangoes respairometer borociliate , bell jar. soda glass , specimen jar. empty plastic , dropping bottle 60ml sodaglass , wash bottle 500ml pvc , dropper plastic , dessicator polykab. 300ml , thermameter clinic , funnel pvc , sprit. lamp aluminium , all permanan slide at the list , meosis. slide , mitosis slide , model amba , model frog , model eye , model ear , model brain , human skelition without box , all raxine charts at the list , all specimen at the list , specimen , material cutting dicot rot, stem leaf , material cutting monoct rot, stem leaf , filter paper 100 nos. , p.h. paper glaxo , saffarawine glaxo , eiosine glaxo , glycerol glaxo , methylene blue glaxo , fast green lanco , xylene rankem , formeldenyde glaxo , chloroform glaxo , acetocarmine lancer , bendicy solu. glaxo , steel almihra , teacher chair...

Medical Health And Family Welfare - Rajasthan

34846615 supply of lab regents , 1. anaesthetics , hcv test ( tri dot rapid card ) , hbsag test ( rapid card ) , hbsagelisa test kit ( 4th gen. ) , hiv test ( tri dot rapid card ) , hivelisa test kit ( 4th gen. ) , hcvelisa test kit ( 4th gen. ) , vdrl test kit ( strip ) , urine pregnancy testkit ( card ) , dengue test kit ( rapid card ) , dengue igm elisa test kit , dengue ns 1 elisa test kit , id card for gel card cross matching ( for biorad machine ) , pt test reagent kit ( 4x2 ml ) , widal test kit , malaria card ( rapid test for malaria antigen ) , crp test , aslo test kit , r.a. factor kit ( slide method ) , anti a, anti b& anti d ( monoclonal igg & igm ) , anti d ( monoclonal igg & igm ) , anti d monoclonaligm , anti h lectin , anti a1 lectine , bovine albumin , anti human globulin ( coomb’s sera ) , multistix urine test strips ( for 10 parameter ) , urine strip for ketones & glucose , leishman stain liquid ( ready to use ) , giemsa stain solution ( ready to use ) , field stain reagent ( a+b ) , whatman’s filter paper , ph.paper ( litmus paper ) , cover slip for slide , capillary tube for clotaing time , esr stand , methanol , dionised water , sample cup for biochemistry , ecoshield , absolute isopropenol ( molecular grade ) , reservior trough , plain glass test tube , 96 well vtm rack ( for 15 ml vtm ) , blood sugar test kit ( manual ) , s. urea ( manual ) , s. creatinine ( manual ) , s. bilirubin ( manual ) , s. sgot ( manual ) , s. sgpt ( manual ) , w.b.cdiluting fluid , r.b.c diluting fluid , semen diluting fluid , eosinophil diluting fluid , platelet diluting fluid , sahli’s haemoglobinometer , hb.tube , hb. pipette , w.b.c pipette , r.b.c pipette , improved neubauer counting chamber , clean sole solution ( glass ware ) , levermed lab airticals disinfectant , combystyne labairticle disinfectant , tourniquet , sealer tips , yellow tips micro pipette ( 10 100 ?l ) , blue tips for micro pipette ( 1000 ?l ) , sterile urine container screw cap 30ml , liss ( low ionic strength saline ) , 3.2% sodium citrate coated disposable esr tube / pipette , pricker disposable ( lancet ) , sulphur powder , glacial acetic acid , liquid paraffin ( heavy ) , iodine solution , xylene , microscope glass slide , k3 edta disposable vaccutainer vial , plain disposable vaccutainer vial , sodium floride ( naf ) disposable vaccutainer vial , clot activator disposable vaccutainer vial , 3.2% sodium citrate disposable vaccutainer vial , chikengunya igm elisa test kit , scrub typus elisa test kit , ethanol molecular grade ( 500 ml ) , aerosol barrier tips 10 ?l , aerosol barrier tips 20 ?l , aerosol barrier tips 100 ?l , aerosol barrier tips 200 ?l , aerosol barrier tips 1000 ?l , water molecular grade 500 ml , self locking cable tie for bmw bags , micro pipette stand , low profile pcr plate with sealer , pcr plate sealer , rnase zap , 70% ethanol ( 500 ml packing ) , cryo gloves all size , falcon tube 50 ml , falcon tube 15 ml , pt test vial , creatinine manual kit 2x100ml , urea manual kit 2x100ml , scrub typhus rapid card test kit. , chikungunya rapid card test kit. , serum cholesterol test kit ( manual ) , serum triglycerides test kit ( manual ) , serum hdl test kit ( manual ) . , serum alkaline phosphatase test kit ( manual ) . , serum protein test kit ( manual ) . , serum albumin test kit ( manual ) . , autoclave single channel micropipettes 100 1000ul , autoclave single channelmicropipettes 0 100ul , autoclave single channelmicropipettes 0 50ul , autoclave single channelmicropipettes 0 10ul , autoclave single channelmicropipettes 0 200ul...

Medical And Health Services - Rajasthan

34806181 supply of lab reagents i hcv test tri dot rapid card ) 2 hbsag test ( rapid card ) 3 lll3sag eisa test kit ( 4th gen ) 4 iiiv test ( tr dot rapid card ) 5 hiv ehsa test kit ( 4th gen. ) 6 hcv eisa test kit 4th gen ) 7 vdrl test kit ( strip ) 8 urine pregn—cy test kit ( card ) 9 dengue tut kit ( rapid card ) 10 dengue 1gm ehsa test kit i i denue ns i elisa test kit 12 ii ) card for gel card cross matching ( for biorad machine ) 13 pt i’est reagent kit ( 4x2 ml ) 14 widal test kit 15 malaria card ( rapid test for malaria antigen ) 16 crptes 17 aslo test kit 18 r.a. factor kit ( slide method ) 19 anti a, anti b & anti d ( monoclonal tg ( &, 20 21 amid ( monoclonal igg & im ) anti d monoclonal 1gm 22 anti h lcctin 23 anti al lectine 24 bovine albumin 25 anti human globulin rcoombs sera ) 26 multistix urine test strips ( for 10 parameter ) 27 urine sthp for ketones & glucose 28 leishnan stain liguid çready to use ) 29 giemsa stain solution ( ready to use ) 30 field stain reagent ( a+b ) 31 whatmans filter paper 32 p1 i paper ( litmus paper ) 33 cover slip for slide 34 capillary tube ror clotaing time 35 esr stand 36 methanol 37 dionised water 38 sample cup for biochemistry 39 ecoshield 40 absolute isopropenol ( molecular grade ) 41 reservior trough 42 plain glass test lube, 43 96 well vtm ( for 15 ml vth4 ) 44 blood sugar test kit ( manual ) 45 s. urea ( manual ) 46 s. creatinine ( manual ) 47 s. bilirubin ( manual ) 48 s. sgot ( manual ) 49 s. sgpt ( manual ) 50 w.13.c diluting fluid 51 r.b.c diluting fluid 52 semen i ) iluting fluid 53 losinophil diluting fluid 54 platelet diluting fluid 55 sahlis ilaemoglobinomcter 56 iibtube 57 iib. pipette 58 w.b.c pipette 59 r.b.c pipette 60 improved neubauer counting chanber 61 clean sole solution ( glass ware ) 62 levermed lab airticals disinfectant 63 combystyne labairticle disinfectant 64 tourniquet, 3.2% sodium citrate coated disposabie esr tube / pipette 71 pricker disposablclancct ) 72 sulphur powder 73 glacial acetic acid 74 liquid paraffin ( heavy ) 75 iodine solution 76 xylene 77 microscope glass slide 78 k3 edta disposable vaccuta ner vial 79 plain disposable vaccuta net vial 80 sodium floride ( naf ) disposable vaccutaner vial 81 clot activator disposable vaccutaner vial 82 3.2% sodium citrate disposable vaccuta net vial 83 chikengunya 1gm elisa test kit 84 scrub typus elisa test kit 85 ethanol molecular grade ( 500 ml ) 86 aerosol barner tips 10 pl 87 aerosol barrier tips 20 pi 88 aerosol bather tips 100 lul 89 aerosol bather tips 200 ul 90 aerosol barrier tips 1000, etc....

Department of Agricultural Research and Education - Rajasthan

34435952 bids are invited for srl brand only supply acetic acid glacial extrapure ar acs exiplus code 93602 , aceton gc hs 99.9 for ovi residual analysis code 89140 , acrylamide 3x cryst extrapure ar, 99.9 for electrophoresis code 15657 , n n methyl bisacrylamide 3x cryst for molecular biology 99.5 code 67320 , edta disodium salt dihydrate for molecular biology 99.5 code 43272 , glycerol glycerin for molecular biology 99.5 code 43272 , glycine for molecular biology, 99.5 code 64072 , hydrochloric acid 5n aq solution code 34472 , indicator papers ph 2.0 10.5 wide range code 27671 , indicator papers ph 6.5 9.0 narrow range code 61169 , isopropanol gc hs, 99.9 code 10140 , brilliant blue r code 93473 , methanol extrapur ar acs exiplus 99.8 code 37152 , chloroform isoamyl alcohol 24 1 for molecular biology code 85563 , phenol chloroform isoamyl alcohol 25 24 1 ph 8.0 for molecular biology code 69031 , polyvinylpyrrolidone pure pvp k 30 exiplus code 65155 , sodium carbonate anhydrous extrapure ar acs exiplus 99.9 code 93857 , sodium lauryl sulphate extrapure ar acs 99 code 54468 , n n n n tetramethyl ethylenediamine teme for molecular biology 99.5 code 52145 , trichloroacetic acid extrapure 99 code 90544 , tris buffer for hplc 99.9 code 56995 , ethylmethanesulphonate ems extrapure 99 code 85108 , agar powder for microbiology code 77981 , luria bertani broth code 22006 , luria bertani agar code 46502 , potato dextrose agar code 71788 , silica gel blue self indicating coarse 5 8 mesh code 85148 , citric acid anhydrous extrapure ar acs exiplus multi compendial, 99.5 code 16842 , sodium bicarbonate extrapure 99 code 56398 , n hexane pure 99 code 77045 , xylene cyanol ff extrapure ar exiplus multi compendial code 75122 , bromophenol blue acs exiplus multi compendial code 93676 , ethidium bromide for molecular biology 95 code 93079 , thioglycolic acid exiplus multi compendial 80 code 74118 , petroleum ether 60 80 for hplc uv spectroscopy code 15340 , n butyl alcohol extrapure ar acs exiplus multi compendial 99.5 code 15612 , toluene extrapure ar, acs exiplus multi compendial 99.5 code 95227...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

Jawaharlal Nehru Medical College - Rajasthan

34135658 pathology lab items pathology lab items , list of pathology lab items reagents / kits / chemical / glassware / polyware etc year 2022 24 , acetic acid glacial sq 99 100% 2.5 ltr. , acetone ar 2.5 ltr. , acid fuschin 25gm , aluminium chloride sq anhydrous 500gm , aluminium potassium sulphate ( postassium alum ) ar 500gm , albuno meter , alcian blue 8 gs , ammonia solution lr 500ml , ammonium bromide 100gm , ammonium oxalate 500gm , aniline blue ( water soluble ) 25gm , anti sera a , anti sera b , anti sera d , azure ii 100 gm , atrx antibody , basic fuschin 25gm , biebrick scarlet 25 gm , blood / serum sample tube , borex ar 500gm , boric acid 500gm , brilliant cresyl blue 25gm , chromogranin antibody , calcium chloride lr 500gm , carbol fuchsin conc. stain solution 200ml , carbol fuchsin ( zn strong ) 500ml , carmine ar 25gm , cd 3 antibody , cd 5 antibody , cd 10 antibody , cd 20 antibody , cd 23 antibody , cd 30 antibody , cd 45 antibody , charcoal ar 200gm , chlorauric acid ( gold chloride ) , chromium trioxide ( chromic acid, ) , chromotrope ar 25 gm , citric acid ar 500gm , sta c.k. prest , ck 7 antibody , ck 20 antibody , ck 5 / 6 antibody , calretinin antibody , coag control , congo red ar 100gm , coombs serum ( ahg ) polyclonal 5ml , cover glass , crystal violet 25gm , crystal violet 100gm , d.m. water 5ltr , dab background sniper mach 2 hrp polymer combo , deionised water ( triple deionised ) , deka phan ( 100 strips ) , urine control urinorm , desmin antibody , diluent for dna extraction , diva decloakerm 20x , dpx mountant 250ml , disposable esr pipette , ema antibody , er antibodies , esr pipette ( glass ) ( marrienfield made in germany ) , esr pipette glass , ethanol , eosin yellow ( water soluble ) , erba h3 contri level , ferric ammonium sulphate , filter paper sheet , filter card for cytospin , formaldehyde solution 37 41% w / v ar 5 ltr. , funnel filtering for glass , gentian violet ar 25gm , giemsa.s staining powder 25 gm , glass beaker various sizes , glass slide 1.35 mm , glass slides , glass test tube 100 x 12 mm , glass test tube 75 x 12 mm , glycerol ( glycerine ) ar 500ml , gfap antibody , haemeto critcapillary , haemotoxylin crystal 25gm , hand sanitizer , hmb 45 antibody , hep par 1 antibody , her 2 antibodies ( creb 2 ) , hplc variants ii test kit ar 500 test , hplc lyphocheck a2 control 0.5 ml x 4 , hydrochloric acid ( conc ) 2.5ltr. , hydrogen peroxide ( 3% ) 500ml , hydrogen peroxide solution 30% w / v ( 100 volumes ) lr 500ml , hydroquinone ar 5 gm , hypochlorite solution , idh1 antibody , iodine crystal ar 100gm , isopropyl alcohol 2.5 ltr. , jet cassettes with lid disposable , k3 edta tube vacutainer , 3.2% sodium ctrate vacutainer , ki67 antibody , lancet , leishman stain liquid , light green, sf yellowish , liquid parafin , lithium carbonate , lysercell wnr ( 5 ltr. ) , flourocell wnr , sulfolyser 5l , xn control l1 , xn control l2 , xn control l3 , xn cal , measuring cylinder 1000 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , mercuric chloride 100gm , mercuric oxide ( yellow ) , methanol ar 2.5 ltr. , methyl blue 10 gm. , methyl orange 5 gm. , methyl violet 20 gm. , micro pipette 100?l , micro pipette 200?l , micro pipette 50?l , micropipette variable volume upto 1 ml , micropipette variable volume upto 200 micro ltr. , microscope bulb ( philips ) ( .6v / 20w ) , microscopic cover glass 22x 50 mm , mpo ( myeloperoxidease ) stain kit , museum mounting jar ( glass ) ( varioussize ) , multistix ( urine ) , nuclear fast red stain 5 gm , nuclear fast red ( kernechtrot ) , neubaur counting chamber ( marrien field made in germany ) , nitric acid ( 69 72% ) , napsin a antibody , oil red o ar 100gm , orcein synthetic 5gm , orinasys gk , orinasys gp , orange g6 , oxalic acid 500gm , pan ck antibody , periodic acid phenol ( carbolic acid ) , phosphotungstic acid ar 100gm , p63 antibody , phosphomolybdic acid , picric acid ar 500 gm , pipette tips blue vol . 1000 ?l , pipette tips yellow vol . 200 ?l , ph strips , polylysine coated slides , ponceau 2r 25 gm , potassium acetate , potassium bromide 100gm , potassium carbonate 10 gm , potassium carbonate 25 gm , potassium chloride 500 gm , potassium dichromate 500gm , potassium dihydrogen phosphate 500gm , potassium ferocyanide ar 500 gm , potassium hydroxide ( koh ) , potassium iodide ar 100 gm , potassium nitrate , potassium permanganate lr 100gm , procold coolent , propylene glycol , pr antibodies , pt kit , qualitative filter paper diameter mm size 460x570 sheets grade 1 , quinoline yellow 25gm , rapid pap stain , resorcinol , reticulocyte count stain 25 ml , reti culocyte counting reagent , sodium acetate , sodium bicarbonate , sodium nitrate lr 25 gm , sodium bisulfite 500gm , sma antibody , sodium barbiturate 500gm , sodium chloride lr 500gm , sodium citrate 500gm , sodium hydroxide pellets , sodium hypochlorite 4% 2.5 ltr. , sodium hypochlorite solution ( 4% naclo 74.4 ) , sodium metabisulfite ar 500 gm , sodium phosphate monobasic 500gm , sodium black b 100gm , sodium thiosulphate 500gm , sta balls , sta cacl 2 , sta c.k prest , sta neoplastin cl+10 , sta cuvette , stago coagulation control. ( n+p ) , sta neophnal , sta cleaner solution , sta cuvettes 1000 , sta coag control n+p vial , stago coagulation control , sulfolyser 5 ltr. , sulphuric acid , sysmex cell pack dcl , sysmex sulfolyser , sysmex stromatolyser 4dl , sysmex stromatolyser 4ds 42 ml x 3 , s100 antibody , synaptophysin antibody , tartazine 5 gm , tbs 40x buffer , test tube l x b=12x100 mm , thermal paper roll 47 x55mm x 30 mts. , tissue paper roll , thionine , toluidine blue o , torniquete , transponder ( esr ) , trichloroacetic acid 100gm , 500ml ready made , tri sodium citrate dihydrate 500gm , ttf1antibody , tdt antibody , universal card alifex , latex control , urine container , urine control urinorm , vimentine antibody , writing pen for thermograph temperature recording , xylene , xylene ( sulphur ) free ar , xn check l1 , xn check l2 , xn check l3 , xn cal , zinc sulphate , tbs auto wash buffer 40 x 250 ml , mach 2 univ hrp polymer with dab & background sniper , diva decloakerm 20x 250 ml , er monoclonal ( clonal sp1 ) , pr monoclonal ( clonal sp2 ) , creb b 2 , hydrophobic pap pen , orinasys gp , micro pipette 1000 ?l , sta neoplastin 12x10x5 ml , phloxine b 25 gm , sulphuric acid 500 ml , tbs solution 40x biocare 250 ml , transponder , paraffin wax with ceresin 2 kg , periodic acid 100 gm , phenol 500gm , sta cephascreen , sta cacl 2 , sta liquid fib , sta dwren koller , sta liatest fdp , sta fdp control , sta fdp calibrator , sta desorb u , 3.2 % sodium citrate vial ( vacutainer ) , field stain i 500 ml , field stain ii 500 ml , glass marking pen...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33896694 supply of various laboratory items of m.m.n.n.j.y it paraffin wax 60 62% with ceresin absolute akohol ( ethanol 3 distilled water 4 xylene 5 sidit 6 cotton roll ( item related to schedule 1 as per rtpp rules 2013. priority will be given to msme sector hence enclose msme certificate i 7 micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass } b chloral hydrate 9 among solution 10 formaldehyde solution 40% 11 white adhesive tape u mfaotorne disposable blade high profile. 13 filter pape round 100x1 pkt 14 cassettes 3 crn.x1.5cm. ( plastic ) —yellow 15 cassettes 3 cm.3c2.5cnt. ( plastic ) —white 16 lain gloves sterilized 6.5p.0 / 75 no. 17 latex gloves unsterilized 6.5 / 7.0 / 7.5 no. i 18 dextrose 19 albumin powder 20 leishman stain 21 sulphur powder 22 sodium acetate 23 potassium ) acetate 24 potassium nitrate 25 benedlcts solution 26 acetone 27 dpx solution 28 cover slip libc18 0.1 man english glass 29 cover slip 22x22 0.1 mm english glass 30 cover slip 22360 0.1 mm english glass 31 glycerine 32 di— ionized water 33 schlffs reagent 34 bees wax 35 cea ( primary antibodies ) 36 gfap ( primary antibodies ) 37 hmb 4s ( primary antibodies ) 38 death ( primary antibodies ) 39 ema ( primary antibodies ) 40 bc12 temary setitakein4 41 hmwck ( primary antibodies ) 42 ck7 ( primary antibodies ) 43 er ( pnrnary antibodies ) 44 cd30 ( primary antibodies ) 45 cds ( primary antibodies ) 46 co23 ( primary antibodies ) 47 ck20 ( pdmary antibodies ) 48 1367 ( primary antibodies ) 49 cd10 ( primary antibodies ) 50 synaptoplvysin ( primary antibodies ) si pr ( primary antibodies ) 52 mpo ( primary antibodies ) 53 pax•5 ( primary antibodies ) 54 cd3 ( primary antibodies ) 55 vit1 ( primary antibodies ) 56 swo ( primary antibodies ) 57 aeuae3 ( muld ck ) ( primary antibodies ) 58 sma ( primary antibodies ) s9 inhibit ( primary antibodies ) 60 hpv ( primary antibodies ) 61 pi4 peran rams* 62 eber ( primary antbodes ) 63 oript avvin rebtedhes ) 64 cod ( primary antibodies ) 65 arnyioid ( primary antibodies ) 66 her 2— neu ( primary antibodies ) 67 vimentin ( primary antibodies ) 68 chromcieamin ( primary antibodies ) 60 antigens retrial buffer diva deciosket mr ( for manual ihc staining ) 70 background snapper ( for manual inc staining ) 71 wash buffer tbs autowash buffer 40x ( for manual ihc staining ) 72 imp polymer detection kit ( for manual ihc staining ) 73 pohtlysine coated slides ( for manual inc staining ) 74 peroxidaxed block 1 ( for manual ihc stain:mg ) 75 beuzold dab chtornogen ( for manual ihc staining ) 76 betazold dab substrate buffer ( for manual ihc staining ) 77 cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) sway! disinfectandfor cryostate ) i churls for cryostat microtome by thermofisher ( for cryostate ) microtorne blades ( high definition ) l cell pack dcl rd / sulfolyser 1....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33775824 lab equipment and material in labs supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp. 28 wash bottles 50o ml. 29 reagent bottle 12s ml. 30 reagent bottle 2so ml. 31 reagent bottle 500 ml. 32 ! reagent bottle 2so ml. 33 reagent bottle 5o0 ml. 3.4 dropping bottles 125 ml. 35 glass tube 6x10 mm. 36 fusion tube 6x10 mm. 37 centrifuge machine ( fourt.t. ) 3s centruge machine ( fourt.t. ) 39 filter paper ( sheet ) , i 4o filter paper ( v ) 41 , water bath 41 water bath 42 cork borer 43 pastel and mostars 15 cm. 44 pastel and mostars 20 cm. 4s weighing machine 1kg 1 c1nder 500 ml 47 cylinder 100o ml. i 48 condenser 500 ml. 49• separating funnel 10o0 ml. 50 ‘ gas genrator 1 bter 51 thermometer 30 cm._long 52 thermometer 3o cm. long 53 thermometer 30cm. long ! 54 thermometer indus. max mi 55_pipette stand pvc etc...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33757904 supply of lab equipment and material in labs 1* junior medical compound microscope 2* dissecting microscope 3 forcep ( large ) 4 forcep ( small ) 5* i scissor ( small ) 6 scissor ( large ) 7* test tube holder 8 test tube stand 91 test tube brush 10* i stop watch 11 i needle with plastic handle 12 dissecting brush 13* arc auxanometers 14 staining rack 15 tripod stand wire mess 16 water bath rectangular ( electric ) 17 sphygmomanometer 18 stethoscope 19 dissecting tray 20 1 electric balance dieital , 1 test tube 2 watch glass petridls slides plane watch glass cavity slides cover slips 5 6 7 4 sim petri dish 10 beaker beaker 11 measuring cylinder 12 measuring cylinder 113 conical flask 14 funnel 15* ganongpotometer 16* respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19* dropping bottle glass 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25* funnel glass pvc 26* sprit lamp , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set , 1 testis ( mammal ) t.s. 2 ovary ( mammal ) t.s. 3* liver ( mammal ) t.s. 4 blastula t.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set, amoeba 2 dissected frog anatomy 3 eye 4* ear 5 brain l.s. 6* human skeleton , ilia pedigree analysis 2 colour blindness pedigree analysis excretory system of human 3 4 respiratory system of human 5* circulatory system of human 6 reproductive system of human ( rale ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf i 12* dicot leaf 13 monocot stem 14 dicot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants , 1 sicyon 2 tape worm 3 liver fluke 4 ascaris male 5 ascaris female 6* earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pita 13 unio 14 octopus 15 star fish 16 labeo 17 scoliodon 18 ranatigrina 19* 20 21 hyla draco bat, 1 monocot leaf dicot leaf filter paper ph paper saffranine h eosin glycerin methyl blue fast green 10* xylene 11 i formalin 12 chloroform 13 acetocormine 14 benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22* canada balsam 23 starch powder 24 sucrose 25 cobalt chloride 26 iodine solution 27 f boric acid 28 i potassium chloride 29 f blood testing kit 30 sprit , 1* beaker 100 ml. 2 beaker 250 ml. 3 beaker 500 ml. 4* flask conical 250 ml. nn 5 flask conical 500 ml. nw 6 flask flat bottom 500 rill 7 dropper 10 ml. 8 glass rod 9 j platinum wire 35x0.2 mr 10 wire guage 15x15 cm. 11 crucible tong 12* universal clamp 13* j boss heads 14 tripod stand 15 china dish 100 ml. 16 burner teclu 1 17* pippettes 25 ml. 18* burette 50 ml. 19* test tubes 55ml. 20 test tubes 13 ml. 21 test tubes 7 ml. 22 funnel 25 ml. 23 funnel 100 ml. 24* test tube holder 25 test tube stand 26 spatula 27 sprint lamp....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Sms Medical College - Rajasthan

33636877 rate contract for chemicals and media items for microbiology department ( nit 45 ) t , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Medical College - Rajasthan

33634315 rate contract for chemical and media items for microbiology department rate contract for chemical and media items for microbiology department , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

Rajasthan University Of Health Science - Rajasthan

33465082 regents and consumables items for microbiology lab regents and consumables items for department microbiology lab , electrical items : , alberts stain , alkaline peptone water , alpha naphthol ar , aniline , anti hbc igm elisa kit , anti hbeab elisa test kit , hbeag elisa kit , anti hbs antibody elisa kit , antiinuelear antibody ( ani ) elisa kit , cytomegalovirus ( cmv ) igg elisa kit , cytomegalovirus ( cmv ) igm elisa kit , hav igm elisa kit , hcv igm elisa kit , hev igm elisa kit , herpes simplex virus ( hsv 1 & 2 ) igg elisa kit , herpes simplex virus ( hsv 1 & 2 ) igm elisa kit , rubella igg elisa kit , rubella igm elisa kit , toxoplasma igg elisa kit , scrb typhus igm ag elisa kit , toxoplasma igm elisa kit , biodegradable plasic bags ( yellow, red, blue, black ) , blood agar base , blood culture bottle ( adult ) – glass bottle of 100 ml capacity with lid of aluminum with rubber cork in it. , corn meal agar , cover slips 22 x 22 mm , crp test kit , deoxycholate citrate agar , di sodium hydrogen phosphate , discarding plastic buckets ( yellow, red, blue, black ) 20 litre , disposable polythene gloves , dubos medium , ecoshield , edta powder , filter paper sheet whartman no. 1 , fluid thioglycollate broth ( anaerobic ) with indicator , formalin pellets , h2o2 ( 30% ) , koh pellets , kovcks indole reagents , l arginine , l lysine mono dihydrochloride , loeffler serum medium base bovine serum , lowenstein jensen medium , macconkey broth , maltose , mannitol , mannitol salt agar , mccartney bottle , methyl red powder , mr vp medium ( glucose phosphate broth ) , n acetyl l cysteine , n naphthyl ethylene diamine dihydrochloride , n, n, n, n tetra methyl p phenylenediamine dihydrochloride , nigrosin 10% , nutrient agar , oxidase disc , peptone water , perforated bucket ( red, blue ) 15 litre double bin , petridish glass 90 mm , petridish glass 75 mm , ph indicator strips 6.5 to 9 ph measurement , phenol , pottasium dihydrogen phosphate , pregnancy test card , readymade blood culture bottle with sterile brain heart infusion medium, size 5 ml , readymade blood culture bottle with sterile brain heart infusion medium, size 50 ml , robertson cooked meat medium readymade , sabraud’s dextrose agar , selenite f broth bacteriological , sim agar , simmons citrate agar , sodium chloride , sodium hydroxide pellets , sodium hypochlorite solution , sterile autoclavable skirted plate 96 wells x 0.3 ml , sterile readymade plates of blood agar ( 90 mm size ) , sterile readymade plates of macconkey agar ( 90 mm size ) , sterile readymade plates of nutrient agar ( 90 mm size ) , sterile transport medium ( stuart medium ) with test tube and swab individually packed , sulphanilamide , tcbs , trypticase soya broth , tsi agar , urea agar base , viral transport medium , widal slide test , wilson and blair medium , xylene , xylose , resazurin powder , sterile readymade plates of dca ( 90mm size ) , sterile readymade plates of tcbs ( 90mm ) , vancomycin powder , vencomycin disc , amikacin 30 ?g , amoxyclav 20 / 10 ?g , amphotericin b , ampicillin + sulbactum , aztreonam 30?g , bacitracin ( 0.04 unit ) , bile esculin disc , cefixime 5 ?g , cefoperazone + sulbactum 75 / 10 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotetan , cefoxitin 30 ?g , cefpodoxime 10 ?g , ceftazidime + clavulanic acid 30 / 10?g , ceftazidime 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalexin 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clotrimazole , colistin , cotrimoxazole 25 ?g , cyclopirox 50 ?g , dalfopristine , daptomycin , doripenam 10?g , doxycycline 30 ?g , e strip for esbl detection , e strip for mbl detection , e strip oxacillin , ertapenam 10?g , erythromycin 10 ?g , faropenam , fluconazole 25 ?g , fosfomycin 200 ?g , furazolidone 50 ?g , fusidic acid , gentamicin 120?g , gentamycin 10 ?g , griseofulvin 10 ?g , hippurate , imipenam 10 ?g , itraconazole 8 ?g , kanamycin , ketoconazole 15 ?g , lincomycin 10 ?g , linezolid 30 ?g , meropenam 10 ?g , miconazole 10 ?g , moxalactum , nalidixic acid 30?g , netilmycin 30 ?g , nitrofurantoin 300 ?g , novobiocin , nystatin , ofloxacin 5 ?g , onpg , optochin , oxacillin 1 ?g , piperacillin + tazobactum 100 / 10 ?g , piperacillin 100 ?g , polymyxin b 30 units , pristinomycin 15?g , quinopristin , teicoplanin 30 ?g , terbinafine 1 ?g , tetracycline 30 ?g , ticarcillin+clavulanic acid 75 / 10 ?g , ticarcillin75µg , tigecyclin 15?g , v factor , vancomycin 30 ?g , voriconazole 1 ?g , x + v factor , x factor , immersion oil , ( occuet blood in stool ) kit hemoccult sensa aninophezone test , hcv igmrapid card , occult blood stool , rpr test kit...

Department Of Medical Education - Rajasthan

33432025 supply of general items for tb / vrdl / rt pcr lab 1 absorbent paper roll 2 absorbent paper sheet 3 aluminum foil 4 autoclavable pp plastic racks for 96 places 5 bags, biohazard, ( transparent autoclavable ) 6 cetylpyridinium chloride ( cpc ) for biochemistry mw 358.0 1>98% 7 cold chain box ( 12 lit. ) , 8 cotton roll 9 diamond pencil 1o di sodium hydrogen phosphate 11 disposable head caps disposable lab gownspp ( large and 12 medium ) 13 disposable shoe cover disposable syringes 5 ml ( 22 & 24 14 gauge ) 15 dnase / rnase surface decontaminant 16 dropper bottle droppers, sterile, plastic 1 .5 ml, 17 graduated droppers, sterile, plastic 3.0 ml, 18 graduated, disposable 19 edta 20 ethunol 95% 21 filter paper 22 fluorescent staining kit for afb 23 formaldehyde 24 glass funnel 25 gloves nitrile, size s m l 2s gloves. latex size s m’ l 27 glycerol, 28 hydrochloric acid, fuming ( 37% ) 29 hydrogenperoxyde 30% 30 immersion oil laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for 31 pcr lab 32 laboratory thermometer 33 l asparagine 34 lint free soft tissue liquid dispensing wash bottle 35 plastic ( 500ml ) 36 u medium base powder ready mix 37 loop, disposable 10 i1 38 loopholder 39 loopholder rack 4o magnesium sulphate 41 malachite green 42 mask ( disposable surgical ) 43 mccartney bottle 15 ml 44 mccartney bottle 7 ml 45 mc farland standard set micro pipette stand pipette stands 46 for5pipettes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20iil ) maximum recovery / minimum retention 47 filtered, racked, sterile micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimum retention filtered, raqked, sterile 48 ( i00 l000jil ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / minimum retention filtered, racked, sterle ( 49 2 200 ji l ) molecular grade ethanol 50 molecular grade isopropanol 51 52 n95 respirators ( niosh approved ) 53 na acetate n acetyl l cysteine ( nalc ) 54 powder 55 naphthyl ethylendiamine 56 needle destroyer 57 niacin strips 58 nichrome wire 59 nicotinamide 60 paraflim 61 pcr tubes flat snap cap 0.2 ml 62 pcr tubes strip wiih flat cap optical for rt pcr 0.2 ml 63 phenol, 64 plastic racks ( 15 ml tubes ) plastic racks for 15 ml conical 65 falcon tubes plastic racks for 2 ml mct, 66 autoclavable. plastic racks for 50 ml conical 67 falcon tubes plastic storage box for 0.2 ml pcr 68 tubes with lid plastic storage box with lid for 2 ml 69 cryovials i ox 10 7o potassium dihydrogen phosphate 71 potussium permanganate 72 sample collection container sterile 73 cryovials screw cap ( hinged ) mct tapered 74 ( 1.5ml ) 75 slide drying racks snap cap ( hinged ) mct tapered 76 ( 1.5 ml ) snap cap ( hinged ) mct round 77 bottom ( 2 ml ) 78 sodium chloride, naci 79 sodium hydroxide, naoh, 80 sodium hypochlorite solution 81 sodium nitrate 82 spnay botties spnaylde 500 ml 83 spray bottles plastic pp 250 ml 84 sputum container 85 staining bottle 86 staining rack 87 sterile blue tips bulk ( l000iil ) 88 sterile tips bulk ( l0ll ) , 89 sterile yellow tips bulk ( 10011l ) 90 sulfuric acid, concentrated 91 sulphanilamide 92 test tube rack pp for vtm tubes 93 tissue roll 94 torn iguet 95 tr maynesium di eitrgteu 96 tube, centrifuge, 15 ml with screw cap 97 tube, centrifuge, 50 ml with screw cap 98 tubes cryovial, sterile with screwcap. 2 ml 99 tubes reaction. 2 ml 100 universal bottle for cultures. 28 ml 101 water molecular biology grade 102 xylene 103 zinc powder 104 zn acid fast staining kit 105 autoclavable pp cryoboxes suitable for storage at 80 c 10 xi0 samples for2rnlcryovials, autoclavablepp racks for 1.5 ml 106 mct 48 samples ( 24 pieces ) ....

Jhalawar Medical College and SRG Hospital - Rajasthan

33421913 rate contract supply of general items for tb / vrdl / rt pcr labs at medical college and hospital jhalawar , microbiology dept. , absorbent paper roll , absorbent paper sheet , aluminum foil , autoclavable pp plastic racks for 96 places , bags, biohazard, ( transparent autoclavable ) , cetylpyridinium chloride ( cpc ) for biochemis mw 358.01>987% , cold chain box ( 12 lir ) , cofton roll , diamond pencil , di sodium hydrogen phosphate , disposable head caps , disposable iab gownspp ( large and medium ) , disposable shoe cover , disposable syringes 5 ml ( 22 & 24 gauge , dnase / rnase surface decontaminant , dropper bottle , droppers, sterile, plastic 1.5 ml, graduated , droppers, sterile, plastic 3.0 ml, graduated, disposable , edta , ethanol 95% , filter paper , fluorescent staining kit for afb , formaldehyde , glass funnel , gloves nitrile, size s m l , gloves, iatex size s m l , glycerol , hydrochloric acid, fuming ( 37% ) , hydrogenperoxyde 30% , immersion oil , laboratory fumigant bacteriocidal tuberculocidal virucidal suitable for pcr lab , laboratory thermometer , l asparagine , lint free soft tissue , liquid dispensing wash bottle plastic ( 500m1 ) , lj medium base powder ready mix , loop, disposabte 10 pl , loopholder , loopholder rack , magnesium sulphate , malachite green , mask ( disposable surgical ) , mccartney bottle 15 mt , mccartney bottle 7 ml , mc farland standard set , micro pipette stand pipette stands for 5 pipttes , micropipette tips nuclease & pyrogen free & aerosol barrier ( 0.1 20p1 ) maximum recovery / lvlinim u m retention filtered racked, sterile , micropipette tips nuclease & pyrogen free & aerosol barrier maximum recovery / minimurt retention filtered, racked sterile ( 100 100ul ) , micropipette tips nuclease & pyrogen free & aerosol barrier, maximum recovery / ivlinimum retention filtered, racked sterile ( 2 200ul ) , molecular grade ethanol , molecular grade isopropanol , n95 respirators ( niosh approved ) , na acetate , n acetyl l cysteine ( nalc ) powder , naphthyl ethylendiimine , needle destroyer , niacin strips , nichrome wire , nicotinamide , parafilm , pcr tubes flat snap cap 0.2 ml , pcr tubes strip with flat cap optical for rt pcr0.2 ml , phenol i , plastic racks ( 15 ml tubes ) , plastic racks for 15 ml conical falcon tubes , plastic racks for 2 ml mct, autoclavab le, , plastic racks for 50 ml conical falcon tubes , plastic storage box for 0.2 ml pcr tubes with lid , plastic storage box with lid for 2 ml cryovials 10x10 , potassium dihydrogen phosphate , potassium permanganate , sample collection container sterile , cryovials , screw cap ( hinged ) mct tapered ( 1.5ml ) , slide drying racks , snap cap ( hinged ) mct tapered ( 1.5 ml ) , cap ( hinged ) mct tapered ( 2 ml ) , sodium chloride, nacl , sodium hydroxide, naoh , sodium hypochlorite solution , sodium nitrate , spray bottles sprayldpe 500 ml , spray bottles plastic pp 250 ml , sputum container , staining bottle , staining rack , sterile biue tips butk ( 1000u1 ) , sterile tips butk ( 10ul ) , sterile yellow tips bulk ( l00ul ) , sulfuric acid, concentrated , sulphanilamide , test tube rack pp for vtm tubes , tissue roll , torniquet , tri magnesium di citrate , tube, centrifuge, 13 ml with screw cap , tube, centrifuge, 50 ml with screw cap , tubes cryovial, sterile with screwcap, 2 ml , tubes reaction, 2 ml , universal bottle for culturcs, 28 ml , water molecular biology grade , xylene , zinc powder , zn acid fast stainidg kit , autoclavable pp cryoboxes suitable for storage at 80 c 10 x10 samples for 2 mlcryovials , autoclavable pp racks for 1.5 ml mct 48 samples ( 24 pieces ) ...

Medical Health And Family Welfare - Rajasthan

33349004 rate contract tender for supply of consumables item , acetic acid , calcium chloride fused , boric acid , hydrogen per oxide , hydrochloric acid , phospho molybdic acid , sudan ii , nitric acid , sulphuric acid , acetone , ammonium molybdate , di ammonium hydrogen phosphate , iso amyl alcohol , ammonium hydroxide solution , antimony ( iii ) chloride , ammonium ferric sulphate , acetonitrile , bismuth subnitrate , bromocresol green indicator ar , chloroform , carbon tetra chloride , petroleum ether 60 80 , phloroglucinol , phenol , paraffin liquid , resorcinol , sodium hydroxide pelletes , diethyl ether , fehling solution a , furfural , glycerol , xylene , methyleneblue solution indicator , methylorange indicator , fehling solution b , silver nitrate , di phenyl carbazide , petroleum ether 40 60 , phenopthaline indicator , cobalt sulphate , fast red ( allura red ) colour , alkali blue 6 b indicator , rosaniline acetate , zinc acetate , potassiumhydroxide , benzene , hexane , n heptane , potassium iodide , sudan i , sudan iii , sudan iv , sodium hydoxide solution , silica gel , toluene , furfuraldehyde , aluminum oxide ( al2o3 ) , tartrazine color , sunset yellow color fcf , carmosine color , ponceau 4rcolor , brilliant blue color , fast green fcf color , metanil yellow color , iodine monochloride ampules , ninhydrine , potassium chromate , potassium dichromate , starch soluble , sulphur powder , tri sodium citrate , ampules 0.1n sodium hydroxide of 6 , ampules 0.1n sodium thiosulphate of 6 , ampules 0.1n hydrochloric acid of 6 , ampules 0.1n silver nitrate of 6 , iodine crystal , sodium potassium tartrate , di methyle amino banzaldehyde , copper sulphate , potassium sulphate , edta powder , sodium carbonate , copper acetate , bromine ampule , carbon di sulphide , phenol , methyl red indicator , phenol red indicator , phenolphthalien indicator , eriochrome black t indicator , di mehtyel yellow , bromothymol blue indicator , bromophenol indicator , di mehtyel yellow colour , caramel colour , rhodamin b , amaranth colour , erythrosine colour , acid yellow colour , sucrose pure , acid orange ( orange grade ) color , butter yellow color , methanol ms optima grade , acetonitrilms optima grade , ethyl acetate ms optima grade , acetic acid ms optima grade , aluminum ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , antimony ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , arsenic ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , barium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , bismuth ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , cadmium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , calcium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , chromium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , copper ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , germanium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , gold ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , iron ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , lead ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , magnesium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , manganese ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , mercury ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , nickel ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , potassium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , rhodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , scandium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , selenium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , silver ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , sodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tellurium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tin ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , vanadium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , zinc ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , customized gc pesticide mix nist certified crm ( compound list enclosed ) , customizedlc pesticide mix nist certified crm ( compound list enclosed ) , curcumin nist certified crm ( 1000 mg / l ) , 37 component fame mixcrmfor fatty acid , vitamin a ( 1000 mg / l ) , vitamin d ( 1000 mg / l ) , vitamin b12 ( 1000 mg / l ) , vitamin b3 ( 1000 mg / l ) , vitamin c ( 1000 mg / l ) , potassium hydrogen phthalate , sodium carbonate , mustard oil , ground nut oil , potassium di chromate , sodium chloride , sucrose , oryzonol , argemone oil reference standard , castor oil reference standard , mineral oilreference standard , cotton seed oilreference standard , turmeric with lead chrome reference standard , potassium di chromate reference standard , potassium hydrogen phtallatereference standard , sodium carbonatereference standard , sodium chloridereference standard , sand particle size pass through 500 micron is seive size and retained on 180 micron is seive , standard is seive set ofaperture size size 4 mm, 3.35 mm, 1.70 mm, 1.0 mm with solid bottom pan each , vitamin a reference standard , nutrient brothw / 1%peptone , nutrient agar , mac conkey broth w / nurtral red , mac conkeys agar , plate count agar ( pca ) , bairedparkes agar medium , yeast extract dextrose chloramphenicol agar medium , potato dextrose agar , m r vp medium , bismuth sulphide agar medium , thermometer 0 to 1000c , cedar wood oil / immersion , forcepsss , tray plastic , kovacsindole reagent , grams stain kit , steam indicator tape , dry heat chemical process strips , stereothermophilus ampoule , disposable shoe cover , ph paper strips , autoclavable disposable bags , brown paper , uv lamp for sterilization , autoclavable micropipette ( 1000 fixed volume, 500 5000 variable volume, 50 200 microlitre , micropipette tip box , scissors small , labels and taps , aluminum foil , butter paper , hand gloves ( small and large ) , slippers , liquid soup solution for glassware washing 5 ltr pack , lens paper , beaker , beaker , beaker , beaker , beaker , burret , burret , butyrometer tube for milk testing , dropping bottle plastic , dropping bottle plastic , dropping bottle plastic , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , cover slip , condenser for rmset , crusible quartz without lid , diamond pencil , flask conical , flask conical , flask conical , flask conical , flask iodine stopper , funnel glass , funnel plastic , separating funnel , glass rod all type , rubber bulb medium size , rubber bulb size big , pipettes graduated , pipettes graduated , pipettes graduated , pipettes volumetric , pipettes volumetric , pipettes volumetric , pipettes volumetric , test tube with stopper , petri dish pair ( glass ) , volumetric pipette , caplliry tube , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , density bottle , soxhlet flask , glass beads , glass slide for microscopy , heating mantal net for 250ml , heating mantal net for 500ml , automatic tilt with 250ml bottle , automatic tilt with 250ml bottle , soxhletcondensor medium , aluminium dishes , reagent bottle , reagent bottle , reagent bottle amber coloured , reagent bottle amber coloured , mojonnier fat extraction tube , pipette stand plastic verticle , air condenser with joint 100cm , dean & stark apparatus 10.0ml , auto pippete sucker , suction flask , colum chomrplaingl, stpk for colour estimation , thermometer zeel , lactometerzeel , centrifuge tube glass with stopper , butyrometer tube aluminium stand , volatile oil clanveger type , lighter thanwater , desicator with cap , toungue ss , soxhlet clamps , with boss head , asbestosed wire gauge , mortar & pestal , volumetric flask ( rm reciever ) , membrane filtration assemboly with pump & filters , beaker , beaker , iodine flask , butyrometer key , butyrometer tube cork , filter paper sheet 1 ( 46*57cm ) , filter paper no. 1 diameter 125mm , filter paper no. 2 diameter 125mm , filter paper no. 4 diameter 125mm , filter paper no. 42 dimeter 125mm , centrifuge tubes ( pp tubes ) 50mlpkt , centrifuge tubes ( pp tubes ) 15mlpkt , nylon syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , ptfe syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , nitril gloves ( medium size ) , nitril gloves ( small size ) , brush for butyrometr test tube brush , tong 12 ss , spatulla 8 ss , auto sampler vials with cap and septa 1x100 , 100 1000 micro litre tips universal graduated ( 1x1000 ) , 10 100 micro litre tips , 1 5 ml tips ( 1x100 ) , tissue rolls , lens paper , disposable lab coat , non absorbant cotton roll500gm , nitrogen gas cylinder 47 litre ( 99.999% purity ) , argon gas cylinder47 litre ( 99.999% purity ) , helium gas cylinder47 litre ( 99.999% purity ) , hydrogen gas cylinder47 litre ( 99.999% purity ) , zero air gas cylinder47 litre ( 99.999% purity ) , membrane filter ( 0.45 ) um ( millipore ) , aluminum foil food grade ( extra hygiene ) rolls , tlc plate aluminium ( 20x20 cm ) , coloumn for vitamin analysis c 18 1.8?m, 2.1x100mm , coloumn for vitamin analysis c 18 2.6?m, 2.1x100mm , gc coloum 105 mtr. capillary tg 5ms, 105mtr. lenth x0.25 pore size for fatty acid profile , alpha. amylase 100 gm , sodium acetate500 gm , ammonium formate 100 gm , di potassium hydrogen phosphate 500 gm...

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

National Institute Of Ayurveda - Rajasthan

33123875 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux / bd ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux / bd ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500gm , amikacin ( himedia / sigma / biomerieux / bd ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux / bd ) 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux / bd ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux / bd ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux / bd ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux / bd ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux / bd ) 50 ml , cefipime ( himedia / sigma / biomerieux / bd ) 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) 1 vial , cefoxiti ( himedia / sigma / biomerieux / bd ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux / bd ) 1 vial , citrate agar ( himedia / sigma / biomerieux / bd ) 500gm , cled agar ( himedia / sigma / biomerieux / bd ) 500gm , clindamycin ( himedia / sigma / biomerieux / bd ) 1 vial , colistin ( himedia / sigma / biomerieux / bd ) 1 vial , coplin jar ( himedia / sigma / biomerieux / bd ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux / bd ) 1 vial , cotton roll ( himedia / sigma / biomerieux / bd ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux / bd ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux / bd ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux / bd ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux / bd ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux / bd ) 5 litr , doxycline ( himedia / sigma / biomerieux / bd ) 1 vial , dpx mount ( himedia / sigma / biomerieux / bd ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux / bd ) 125 ml , erythromycin ( himedia / sigma / biomerieux / bd ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux / bd ) 500 gm , forceps ( himedia / sigma / biomerieux / bd ) 1 pc , fosfomycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) 1 strip , giemsa stain ( himedia / sigma / biomerieux / bd ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux / bd ) 5 litr , glass slides ( himedia / sigma / biomerieux / bd ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux / bd ) 500 ml , grams iodine ( himedia / sigma / biomerieux / bd ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux / bd ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux / bd ) 500 ml , imipenem ( himedia / sigma / biomerieux / bd ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux / bd ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux / bd ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux / bd ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux / bd ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux / bd ) 500 ml , levofloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , linezolid ( himedia / sigma / biomerieux / bd ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux / bd ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) 1 holder , methanol ( himedia / sigma / biomerieux / bd ) 500 ml , methylene blue ( himedia / sigma / biomerieux / bd ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux / bd ) 125 ml , mrvp media ( himedia / sigma / biomerieux / bd ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux / bd ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux / bd ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux / bd ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux / bd ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux / bd ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux / bd ) 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , novabiocin ( himedia / sigma / biomerieux / bd ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux / bd ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux / bd ) 500gm , optochin ( himedia / sigma / biomerieux / bd ) 1 vial , oxidase discs ( himedia / sigma / biomerieux / bd ) 1 vial , penicillin g ( himedia / sigma / biomerieux / bd ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux / bd ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux / bd ) 1 vial , piperacillin ( himedia / sigma / biomerieux / bd ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux / bd ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux / bd ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux / bd ) 100ml , ria vials ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux / bd ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux / bd ) 125 ml , sim media ( himedia / sigma / biomerieux / bd ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux / bd ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux / bd ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux / bd ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux / bd ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux / bd ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux / bd ) 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) 1 vial , tobramycin ( himedia / sigma / biomerieux / bd ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) 500gm , urea agar base ( himedia / sigma / biomerieux / bd ) 500gm , urea solution 40% ( himedia / sigma / biomerieux / bd ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux / bd ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux / bd ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux / bd ) 500 ml , xylene ( himedia / sigma / biomerieux / bd ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Medical Health And Family Welfare - Rajasthan

33105744 supply of lab and blood bank regents in govt bdm district hospital kotputli supply of lab and blood bank regents in govt bdm district hospital kotputli , list for laboratry & blood bank regents , elisa test kit for hiv 96 test ( 4th generation ) , elisa test kit for hiv 96 test ( 3rd generation ) , elisa test kit for hcv 96 test , elisa test kit for hbsag 96 test ( 4th generation ) , elisa test kit for hbsag 96 test ( 3rd generation ) , elisa test kit for dengue igm 96 test , elisa test kit for dengue igg 96 test , elisa test kit for scrub typhus 96 test , elisa test kit for chickengunia96 test , elisa test kit for hcv 96 test , rapid test card malaria pan ldh 1 piece , rapid test card malaria antigen 1 piece , rapid test card for dengue ns1 1 piece , rapid test card for dengue igm 1 piece , rapid test card for dengue ns1 + igm ( combo ) 1 piece , rapid test card for hiv ( 4th generation ) 1 piece , rapid test card for hiv 1 piece , rapid test card for hcv 1 piece , rapid test card for hcv ( 3rd generation ) 1 piece , rapid test card for hcv ( 4th generation ) 1 piece , rapid test card for hbsag 1 piece , rapid test card for scrub typhus 1 piece , rapid test card for chickengunia 1 piece , rapid test card for typhoid igm + igg 1 piece , rapid test card for syphilis ( rpr ) 1 piece , rapid test strip for syphilis ( rpr ) 1 piece , rapid test card for hiv & syphilis 1 piece , pregnency test strip 1 piece , pregnency test card 1 piece , antisera anti. a monoclonal 10 ml , antisera anti b monoclonal 10 ml , antisera anti ab monoclonal 10 ml , antisera anti d igm monoclonal 10 ml , antisera anti d ( igm + igg ) monoclonal 10 ml , lectin a1 monoclonal 10 ml , ahg monoclonal 10 ml , antisera anti h monoclonal 10 ml , blood grouping test kit ( abd kit ) ( monoclonal ) 10 ml each , bovine alumine 22% 10 ml , gel card ahg ( coomb gel card ) for cross match 1 piece , liss solution 500 ml ( ready ) , blood sample collection edta vial single cap5 ml 100 piece , blood sample collectionplainvial single cap 5 ml 100 piece , blood sample collectionpt vial single cap 5 ml 100 piece , blood sample vial5ml ( edta ) double cap 100 piece , blood sample vial 5ml ( plain ) double cap 100 piece , blood sample collectionclot activater vial single cap 5 ml 100 piece , blood collecting bag cpda 1 paed 100ml 1 piece , blood collecting bag cpda 1 350ml single 1 piece , aslo test kit 5ml ( latex ) , aslo test kit 50ml ( quantitative ) , analyser paper roll for horiba 3 part cbc 1 piece , analyzer paper roll for semi biochemistry analyzer 1 piece , analyzer paper roll for lura urineanalyzer 1 piece , pasture pippett ( plastic ) volume 5 ml 1 piece , wash bottel 2 ltr , wash bottel 5 ltr , wash bottel 10 ltr , throat swab ( cotton ) 100 piece , throat swab ( nylon ) 100 piece , throat swab ( dacron ) 100 piece , plastic zip lock pocket 100 piece , blood sugar test strip with acquachek with glucometer ( 50 strip ) , blood urea test kit , blood sugar accusure insci glucometer strip ( 50 strip ) , crp test kit5ml ( latex ) , crp test kit50ml ( quantitative ) , crp titration test kit5ml , cover slip for neubar chamber 100 piece , cover slip for glass slide 100 piece , counting chamber ( neubar ) 1 piece , capilary tube 1.5 mm diameter x 10 15 cm length ( 50 piece ) , cbc roll ( pos 555 tl ) ( 55mm×15 mtr ) 1 roll , ckmb trop t test card ( 1 piece ) , ckmb trop i card ( 1 piece ) , cknac trop t test card ( 1 piece ) , ck mb solution 1x25 ml , ck nac solution 1x25 ml , disposal droper ( 100 piece ) , plastic test tube with screw cap 10ml ( 100 piece ) , plastic test tube with screw cap 5ml ( 100 piece ) , disposal plastic test tube 5ml ( 100 piece ) , disposal plastic test tube 10ml ( 100 piece ) , disposable face mask ( 100 piece ) , disposal cap ( 100 piece ) , edta solution 500ml bottel , drabkin solution 5 ltr. pack , dettol liquid ( 500ml ) , esr standwestergen blood test pipet ( 5 test stand ) 1 piece , esr tube glass for westergen mathod 1 piece , disposable plastic esr pippet 100 piece , esr pippet cuff 100 piece , elicote vial 100 piece , floride vacutainor vial 100 piece , glass slide 76mmx26mm 100 piece , haemoglobinometer ( german made ) top 1 piece , hb tube square haemometer mesauring tube ( top ) 10 piece , giemsa stain 500 ml , methylene blue stain500 ml , gention violet stain 500 ml , jsb i ( solution ) 500ml , jsb ii ( solution ) 500 ml , leishman stain 500ml , lense cleaning paper packet ( 50 page ) , lable chips ( paper ) 1000 piece , liquid parafin 500ml , micro tips 1000 micro ltr 1000 piece , micro tips 200 micro ltr 1000 piece , micro tips 50 micro ltr 1000 piece , micro tips 20 micro ltr 1000 piece , micro scope blub isi 1 piece , microscope lense ( made in german, japan, poland ) 1 piece , micro pippet10 to 100 micro 1 piece , micro pippet100 to1000 micro 1 piece , multichannel micropippet for elisa 1 piece , n / 10 hcl 500ml , n95 mask with respirator 1 piece , n95 mask without respirator 1 piece , mask tripple layer 100 piece , p.p. e.kit for swine flue 1 piece , p.p. e.kit sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit 100 gsm sitra approved, 90 gsmwith ( n 95 mask with respirator, triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit for corona with ( triple layer mask, googles, face shield, shoe cover of same fabric of gown, gloves, head cap, waste disposable bag, plain polythin sheet 1.5 x 2, ) 1 kit , ppe kit googles 1 piece , face shield 1 piece , surgical sterile gloves 6 no 1 pair , surgical sterile gloves 6.5 no 1 pair , surgical sterile gloves 7 no 1 pair , surgical sterile gloves 7.5 no 1 pair , disposal rubber gloves large size 1 piece , disposal rubber gloves medium size 1 piece , infrared thermometer 1 piece , multi surface disinfectant liquid 500 ml , foot press sanitizer stand 1 piece , uv disinfection sanitizres 1 piece , pulse oxymeter finger tip 1 piece , r.a. test kit 5ml ( latex ) , r.a. test kit 50ml ( quantitative ) , test tube stand 100 test tube ( steel ) 1 stand , sodium citrate solution 500ml , sterile water 5 l packing , semen dilutingfluid 100 ml , spinal niddle 26 g 1 piece , triplefilterd disttled water5 l packing , test tube stand steel 24 test tube , test tube stand steel 12 test tube , test tube stand plastic12 test tube , test tube stand plastic24 test tube , test tube stand plastic48 test tube , test tube stand plastic50 test tube , tissue paper roll 1 piece , arm tourniquites for blood sampling 1 piece , urine test strip for albumine, sugar & ketone body 100 piece , urine test strip ( albumine sugar ) 100 piece , urine container ( disposable ) 30ml , vtmvial forswine flu & corona 1 piece , vial 5 ml ( open mouth ) for cross match ( plastic ) 100 piece , vial 5 ml ( open mouth ) for cross match ( glass ) 100 piece , vacutainor plain vial 5 ml 100 piece , vacutainor edta k3 vial 5 ml 100 piece , vacutainor holder and niddlemulti sample 100 piece , vacume test tube edta ( with niddle ) 2ml 100 piece , vacume test tube edta ( with niddle ) 5ml 100 piece , vacume test tube plain ( with niddle ) 2ml 100 piece , vacume test tube plain ( with niddle ) 5ml 100 piece , widal test kit 4 x 5 ( to, th, ah, bh ) 1 kit rate , dettol hand wash 500ml , phenyle 5 ltr. , vacutainor sodium citrate test tube 100 piece , cuso4 solution for hemoglobine estimation 100 piece , wintrobs tube 100 piece , disposable esr test tube 100 piece , swine flu vaccine 0.5 ml , sodium hypochloride 6% 5 ltr. , sodium hypochloride 5% 5 ltr. , sodium hypochloride 4% 5 ltr. , xylene 100ml , coplin staining jar 100 ml , coplinstainingjar 200 ml , staining jar 250 ml , gram staning regent ( readymade ) 100 ml , sticker roll for computer ( 4 x 4 size ) 1 roll , culture bottle 100 ml , culture bottle 200 ml , culture bottle 500 ml , gluteraldehyde 5 ltr. , vial for calcium test 100 piece , prolyle control ( for electrolite machine ) , multi control for semi auto biochemistry analyzer , bar code sticker l x w ( 2x1 ) 5000 piece , wax ribbon roll forbar code sticker l x w ( 2x1 ) 5000 piece , digital dlc counter machine 1 piece , regents forsemi auto analyser machine , serum calcium test kit liquid , serum creatinine test kit liquid , serum cholestrol test kit liquid , serum bilirubin test kit liquid , serum sgot test kit , spirit 5 ltr. ( methylated ) , serum sgpt test kit , s. alk. phosphate kit liquid 30 x 10ml , s. protein total liquid , s. albumin kit liquid , s. ldh liquid , s. amylase liquid , s. uric acid liquid , p.p.e kit for hiv 1 piece , serum ldh test kit liquid , blood sugar test kit , cpkmm trop ttest kit 1x25ml , cpkmb trop t test kit 1x25ml , hdl chloresterol test kit ( erba, span ) , triglyceride test kit , regents for culture media , nutrient agar plate 1 piece , sheep blood agar plate 1 piece , macconkey agar plate 1 piece , triple sugar iron agar 1 piece , urea agar base ( christensen ) ( autoclavable ) 1 piece , citrate agar , oxidase discs ( 50 discs / vl ) , gram stains kit 50 ml , grams crystal violet , kovacs indole regent , whatman filter paper no 1 100 piece , gention violet staning 100 ml , crystal violet stain100 ml , grams iodine 100 ml , lugol iodine 100 ml , aluminium slide tray for 10 slide 1 piece , potassium iodide 200 gm , safranin counter stain 100 ml , acetone solution 100 ml , absolute ethyl alcohol 100 ml , 95 % ethyl alcohol100 ml , methyl alcohol 100 ml , phosphate buffer solutions ( ph 7.2 ) 500 ml , vial 50 ml 1 piece , folken tube 1 piece , autoclave strip 1 piece , powder sucrose 75 gm , lancet with guard 100 piece , niddle 26 g 100 piece , niddle 23 g 100 piece , draining rack , measuring cylinder 100 ml , measuring cylinder 200 ml , slide staining rack 1 piece , nicrome loop 1 piece , pt vial for pt inr 100 piece , plastic gown ( disposable ) 1 piece , plastic gown ( washable ) 1 piece...

National Institute Of Ayurveda - Rajasthan

33078537 tender for supply of laboratory chemicals for rrdr project tender for supply of laboratory chemicals for rrdr project , 1 naphthol ( gr ) ( merck ) 100 gm , acetic acid glacil ( gr ) ( merck ) 500 ml , acetone ( ar ) ( merck ) 2.5 ltr , ammonia solution 25% ( gr ) ( merck ) 2.5 ltr , benedicts reagent ( qc ) ( merck ) 500 ml , buffer capsules ph 4.00±0.05 10 ( std. ) ( merck ) 10 tb , buffer capsules ph 7.00±0.05 10 ( std. ) ( merck ) 10 tb , chloroform ( gr ) ( merck ) 2.5 ltr , copper sulfate ( gr ) ( merck ) 500 gm , cyclohexane ( gr ) ( merck ) 2.5 ltr , dextrose ( gr ) ( merck ) 500 gm , diethyl ether ( gr ) ( merck ) 500 ml , ethyl acetate ( gr ) ( merck ) 2.5 ltr , fast green ( merck ) 5 gm , fehlings solution a ( merck ) 500 ml , fehlings solution b ( merck ) 500 ml , ferric chlorideanhydrous emplura ( merck ) 500 gm , formic acid 100% ( gr ) ( merck ) 500 ml , hydrochloric acid ( 37% ) ( gr ) ( merck ) 2.5 ltr , hydrogen peroxide 30% ( gr ) ( merck ) 500 ml , iodine resublimed ( gr ) ( merck ) 100 gm , lead acetate trihydrate ( gr ) ( merck ) 500 gm , mercuric chloride ( gr ) ( merck ) 100 gm , methanol ( gr ) ( merck ) 2.5 ltr , methyl red ( merck ) 25 gm , methylene blue alk. lofflers ( merck ) 125 ml , ninhydrin ( gr ) ( merck ) 25 gm , nitric acid ( 69% ) ( gr ) ( merck ) 500 ml , perchloric acid ( 60% ) ( gr ) ( merck ) 500 ml , phenol ( gr ) ( merck ) 500 gm , phenolphthalein ( merck ) 50 gm , phloroglucinol ( gr ) ( merck ) 25 gm , polyethylene glycol ( merck ) 500 ml , potassium chlorate ( merck ) 500 gm , potassium dichromate ( acs ) ( merck ) 500 gm , potassium iodide ( ar ) ( merck ) 500 gm , potassium permanganate ( gr ) ( merck ) 500 gm , pyridine solution ( gr ) ( merck ) 500 ml , rochelle salt ( gr ) ( merck ) 500 gm , ruthenium red 99% ( merck ) 250 mg , sodium bic ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium c ( ar ) bonate ( gr ) ( merck ) 500 gm , sodium chloride ( gr ) ( merck ) 500 gm , sodium diethyldithioc ( ar ) bamate ( gr ) ( merck ) 100 gm , sodium hydroxide ( gr ) ( merck ) 500 gm , sodium phospate monobasic ( merck ) 500 gm , sodium phosphate dibasic ( merck ) 500 gm , sodium sulfate ( gr ) ( merck ) 500 gm , sodium thiosulfate ( gr ) ( merck ) 500 gm , st ( ar ) ch ( gr ) ( merck ) 500 gm , sudan red 3 ( 85% ) ( merck ) 25 gm , sulfuric acid ( gr ) ( merck ) 500 ml , terti ( ar ) y butyl alcohol ( ar ) ( merck ) 500 ml , tetramethylammonium hydroxide ( merck ) 250 ml , thioglycollic acid ( 80% ) ( merck ) 500 ml , toluene ( gr ) ( merck ) 2.5 ltr , trichloroacetic acid ( merck ) 500 gm , zinc acetate ( ar ) ( merck ) 500 gm , aluminium chloride ( ar ) ( cdh ) 250 gm , amberlite ira 400 exchange resin ( cdh ) 500 gm , ammonium oxalate ( ar ) ( cdh ) 500 gm , ammonium sulphate ( ar ) ( cdh ) 500 ml , ( ar ) senic solution std. ( cdh ) 100 ml , benzene ( ar ) ( cdh ) 2.5 ltr , blue tetrazolium ( ar ) ( cdh ) 1 gm , bromine water ( ar ) ( cdh ) 100 ml , camphor 95% std. ( cdh ) 100 gm , canada balsam ( synthetic ) ( cdh ) 500 ml , c ( ar ) bon tetrachloride 99.5% ( ar ) ( cdh ) 500 ml , citric acid ( ar ) ( cdh ) 500 gm , diphenylthioc ( ar ) bazone ( ar ) ( cdh ) 25 gm , dpx ( cdh ) 250 ml , eosin ( cdh ) 125 ml , ethanol 99% ( cdh ) 5 ltr , folin ciocalteus phenol reagent ( cdh ) 100 ml , formaldehyde ( ar ) ( cdh ) 2.5 ltr , gelatin ( cdh ) 500 gm , glycerin ( ar ) ( cdh ) 2.5ltr , glucose ( cdh ) 500 gm , hydroxylamine hydrochloride ( ar ) ( cdh ) 100 gm , indigo c ( ar ) mine ( ar ) ( cdh ) 25 gm , lead solution stand ( ar ) d ( cdh ) 100 ml , magnesium metal ( cdh ) 500 gm , mercuric nitrate ( ar ) ( cdh ) 100 gm , millons’ reagent ( cdh ) 500 ml , n hexane ( er ) ( cdh ) 2.5 ltr , p anisaldehyde ( cdh ) 250 ml , p ( ar ) affin wax ( cdh ) 2 kg , petroleum ether ( ar ) ( cdh ) 2.5 ltr , phenol red ( ar ) ( cdh ) 5 gm , phosphomolybdic acid ( cdh ) 25 gm , picric acid ( ar ) ( cdh ) 500 gm , potassium hydroxide ( ar ) ( cdh ) 500 gm , potassium mercuri iodide ( ar ) ( cdh ) 100 gm , safranine 90% ( cdh ) 25 gm , sodium ( ar ) senate ( ar ) ( cdh ) 250 gm , sucrose ( ar ) ( cdh ) 500 gm , thymol blue ( cdh ) 125 ml , vanillin ( ar ) ( cdh ) 100 gm , xylene ( ar ) ( cdh ) 500 ml , zinc metal ( ar ) ( cdh ) 500 gm , chloral hydrate ( ar / lr ) ( reidel ) 500 gm...

Indian Army - Rajasthan

33027012 supply of consumables and expendable medical stores supply of consumables and expendable medical stores , 1.6 dihydroxy, 2 5 dioxahexane 11.2 g, glutaradahyde 5.0 g, benzaconium chloride 5.0 gm ( bott of 500 ml ) , ab gel ( gelatin sponge ) , abdominal binder large , abdominal binder medium , abdominal drain size22 fr , abdominal drain size26 fr , abdominal drain size30 fr , abg calibration gas bottle , abg cassette ( pkt of 25 ) , absolute alchohol bott of 500ml ) , acarbose 25 mg tab , accucheck active glucostrips bott of 50 , acetazolamide 250 mg tab , acetone ( 500 ml ) , actime ( 6x5 ml ) , acyclovir skin5% oint , adhesive tape 10 cm , adrenaline tartrate ( 1:1000 ) , 1 ml inj , afb kit ( ready to use ) , alendronate sodium70 mg tab , alkaline phospate test kit ( 5 x 20ml ) , allopurinol 100 mg tab , amisulpride 200 mg tab , amlodipine5 mg + losartan 50 mg tab , amlodipine besylate 10 mg tab , amlodipine besylate 2.5 mg tab , ammonium alum , amytriptilline 10 mg tab , analgesic spray , antacid gel each 5ml containing dried aluminium hyroxide gel ip 250mg, magn esium hydroxide nf 250mg and methyl polysiloxane 50mg bott of 200 ml syp , anti phlebitis cream tube of 15g / 20g oint , anti d ( rho ) immunoglobulin ( monoclonal ) 300 mcg inj , antispasmodic cap containing dicyclomine hcl 10mg, dextroprop oxyphen hcl 65mg acetaminophen ip 400mg , antispasmodic drop bott of 15ml , apixaban 2.5 mg tab , aso titre estimation kit ( kit of 50 test ) , atenolol 50mg + amlodipine 5 mg tab , atropine0.6 mg / ml, 1 ml amp inj , azithromycin syp bott of 15 ml , b 12, 500 mcg / ml inj , bacillus ciausli 2 billion spores / 5ml , baclofen 10 mg tab , bandage `t` shaped , bandage triangular , beclomethasone + phenylpherine + lignocaine tube of 20 gm ( no pile ) oint , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcgper m , beclomethasonedipropionate nasal apray50 mcgperdose metereddose150 units , benzocaine 20%, pecatin based , oral ointment tube of 5 gm , benzoyl peroxide 2.5% tube of 20 gm , betahistine sustained release 24 mg tab , betamethasone 4mg 1ml inj , bilirubin total and direct estimation test kit ( 4x60 ) ml , biphasic isophane insulin 30 / 70 vial of 10 ml inj , bisacodyl tab 5 mg ( perpn:tab ) , bisoprolol 2.5 mg tab , blood glucose test kit ( 2 x 200ml ) , bone wax , bromocriptine 2.5 mg tab , budesonide 200 mcg + formetrol 6mcg autohaler inhelar , bupivacaine 0.5% 20ml vial inj , bupivacaine heavy 0.5% 4 ml amp inj , buspirone hcl 10 mg tab , c reactive protein , caffeine 20 mg / 1ml1ml inj , calcium chloride ( 10x10 ) , calcium gluconate 10% in 10 ml amp inj , carbidopa 25mg+levodopa 100mg tab , carbolic acid 400 gm bott ( phenol ) , carboxy methyl cellulose 1% eye drop bott of 5 ml eye drop , carvedilol 6.25 mg tab , chest drainage size26 fr , chest drainage size30 fr , chloramphenicol5% w / vclotrimazole 1% w / vbetamethasone 0.25 % w / vlignocaine hcl 2%w / vin bott of 5 ml ear drop , chlordiaxapoxide 10 mg tab , chloroform ar ( analytical grade ) 500ml bottle , chloroquine phosphate ( containing 50 gm base per 5 ml ) bottle syrup , chloroquine phosphate 250 mg tab , chloroxylenol, terpineol & absolute alcohol liquid jar of 5 ltr , chlorzoxazone 500mg+ diclofen sodium 50 mg+ paracetamol 325 mg tab , cholesterol estimation test kit ( 5x20 ml ) , cilnidipine 5 mg tab , ciprofloxacin +dexamethasone eye / ear drop , ciprofloxacin 200 mg / 100 ml inj , ciprofloxacin ear drop , ck ( 2x80ml ) ( 2x2ml ) , ck mb kit , clarithromycin 500 mg inj , clindamycin 100mg+clotrimazole 100mg vaginal pessary , clobetasol propionate cream + gentaycin +miconazole tube of 20 gm oint , clomipramine hcl 25 mg tab , clonazepam 0.5 mg tab , clonazepam 2 mg tab , common cold tab ( antihistiminics + paracetamol 500 mg without pseudoephedrine ) , condom catheter , conjugated estrogen 0.625 mg ( premarin ) tab , control ddimer n+p 5x1 ml , 5x1ml , corn cap pkt of 4 , cover slips ( 22x40mm ) ( 20 pkt of 10gm each ) , cover slips ( 22x50mm ) ( 20 pkt of 10gm each ) , covid 19 rapid antigen point of care test with sample collection swab individually packed ( kit of 25 tests ) , cream luliconazole, tube of 15gm , creem silver sulphadiazine 1% ( sterilic ) tube of 25 g , cremaffin white each 15 ml containing milk of magnesia 11.25 ml, liq paraffin 3.75ml bottle of 170 ml , csf protein , cyclopentolate hcl 1% opth soln bottle of 5 ml , cyclophosphamide 50 mg tab , cyproheptadine 4 mg tab , d dimer r, 1x7 ml , daflon 500 mg tab , dapagliflozin 10 mg , ddimer calibrator 1x1 ml , deflazacort 6mg, tab , dengue ( ns1, igg & igm ) , dental needle 25 , dental needle 26 , dental syringe , desonide lotion0.05% bott of 30 ml , desvenalafaxine 50 mg tab , dexamethasone 0.5 mg tab , dexmedetomidine 100 mcg / ml, 1 ml amp inj , diclofenac patch , diclofenac sodium suppository 100 mg , digoxin 0.25 mg tab , digoxin 0.5 mg, 2 ml inj , dilator trachea with spring 12.5 cm long ss , diltiazem 5mg / ml inj , dinoprostone gel 0.5 mg ( in 3 gm / 2.5 ml ) , dinoprostone vaginal insert , disodium citrate syp ( bott of 100ml ) , disposable blade for microtom ( ( high profile ) , disposable drapes sheet , disposable embedding plastic ring ( pack of 100 ) large size , disposable embedding plastic ring ( pack of 100 ) medium size , disposable embedding plastic ring ( pack of 100 ) small size , disposable port 10mm , disposable port 5mm , disposable port 7mm for laparoscopic surgery , disposable sterile ot pack , disposal esr westerngreen tube , divalproate sodium 500mg tab , dopamine hcl40 mg / ml, 5ml inj , doxepin 25 mg cap , doxepin hcl 75 mg cap , doxycyclline 100 mg tab , drotaverine hcl 1%, 20 mg / ml, 2 ml inj , drotaverine hcl 80 mg tab , duloxetine 20 mg tab , duolin 2.5 ml respule , dura protector , ear bud bott of 100 , ear wick , ecosprin 150 mg tab , entecavir 0.5 mg tab , ergotamine 1 m+caffine 100 mg +paracetamol 250 mg and prochlorpramazine 25 mg tab , erythropoitein 2000 iu epo inj , estrogen cream , ethamsylate 250 mg, tab , ether solvent 500 ml , ethinyal estradiol+drosperinone tab , ethinyl estradiol 0.035 mg, cyproterone acetate 2 mg ( pack of 21 or 28 t , etoricoxib 120 mg tab , etrocoxib 60 mg tab , ett flexometallic size 4.0 , ett flexometallic size 4.5 , ett flexometallic size 5.0 , ett flexometallic size 5.5 , ett flexometallic size 6.0 , ett flexometallic size 6.5 , ett flexometallic size 7.5 , ett flexometallic size 8.0 , ett flexometallic size 8.5 , ett flexometallic size7.0 , eye drop moxifloxacin 0.5% , eye drop moxifloxacin 0.5% +prednisolone acetate 1% , eye drop nepafenac suspension 0.1% , eye drop olopatadine 0.1% bott of 5ml , eye drop tobramycin 0.3% + flouromethalone acetate 1% bak 0.01% 5ml , eye drops dorzolamide 2% , eye ointment moxifloxacian 0.5% , fallopian rings ( pkt of 200 ) , febuxostat 40 mg tab , fexofenadine hydrochloride tab 120 mg , fluconazole 150 mg + azithromycin 1 gm + secnidazole 1 gm tab , fluconazole infusion inj 2 mg / ml 100 ml bottle , fluoromethalone 0.1% eye drop bott of 5 ml , fluoxetine hcl 20 mg cap , flurbiprofen sodiumophthalmic solution0.03%vial of 5 ml , fluvoxamine 50 mg cap , foleys balloon catherer, silicon, size fr 8 , framycetin sulphate 1% cream, tube of 100 gms , fsh 75 iu inj , g6pd test kit ( pack of 10 test ) , gauze surgical, open wove, unmedicated: 60 cm wide , glass cuvette for pt , glossy paper for colposcopy machine , glucosamine 250mg+ chondroitin sulphate 200 mg cap , glucose powder ( dextrose monohydrate for oral use in pack of 100 gm ) , glucose strip one touch strips ( suger check advance ) , gluteraldehyde ( 2% ) 5 ltr bott , glycerin bott of 200 ml , grommet , haematinic tab / cap containing ferrous fumarate, vit b 12 , folic acidan ( autrin ) , haemorrhoidal rings ( pkt of 25 ) , haloperidol 5 mg inj , haloperidol 5 mg tab , haloperidol dispersible 10 mg tab , hbs ag elisa kit of 96 test , hbsag rapid kit of 50 test , hcv elisa kit of 96 test , hcv rapid kit of 50 test , hepattitis b vaccine ( adult dose 10 ml ) , hiv elisa kit of 96 test ( 4 th generation ) , hiv rapid kit of 50 test , homatropine hydrochloride, sol 2% , hpv 9 vaccine inj , human chorionic gonadotrophin 2000 iu inj , human chorionic gonadotrophin 5000 iu inj , human rabies immunoglobulin 2 ml ( 300 iu ) , hydrochlorothiazide 25 mg , hydroxyprogestrone caporate 500 mg / 2 ml inj , hydroxyprophyl methylcellulose usp 2% w / v ( max visc ) for intra ocular use , hydroxyprophyl methylcellulose ( hypermellous ) solution uspeye drop , i gel size 1.0 , i gel size 1.5 , i gel size 2.0 , i gel size 2.5 , i gel size 4.0 , i gel size 5.0 , ibuprofen + paracetamol bott of 60 ml syp , imipramine 25 mg tab , indicator soda lime , indomethacin 75 mg sr tab , inj isoxsuprine hydrochloride 10mg amp of 2ml , inj ketamine hcl 50 mg / ml vial of 2 ml , inj metoclopramide hcl ( 5mg / ml ) inj amp of 2 ml. , inj morphine 15 mgin 1 ml amp , inj pheniramine maleate 22.75 mg per ml amp of 2ml ( avil ) , inj phenobarbitone sodium 200 mg in ampoule of 1ml , inj propofol 1% n or 10mg / ml, 20 ml vial / amp , inj succinylcholine cholride 50mg / ml vial of 2 ml , inj thiopentone ampoule of 0.5g without water for injection , inj vasopressin 20 units / ml ( perpn: inj ) , inj verapamil 5mg, 2ml inj , inj.glycopyrrolate 0.2 mg / ml ampl of 1 ml , inj.metoprolol1mg / ml amp of 5 ml. , inj.multi vitamin iv infusion amp of 10ml , inj.vecuronium bromide 4mg / ml amp of 1 ml. , insulin lispro 100 iu / ml 3 ml inj , introducer for gigle wire , iohexol 50 ml inj , ipratropium bromide respiratory solution 250 mcg / ml vial of 15 ml , iron drops paediatric containing ferrous fumerate 25mg / ml. vit b 12 12. , iron sucrose 20 mg / 5 ml inj , isetrol level 1, 2, 3 ( 3x10x1.0 ml ) , isonized300 mg tab , isotretinion 20 mg tab , ketoconazole shampoo bott of 75 ml , kit estimation ofproteinkit ( 8x50 ml ) , kit estimation of micro protein , kit estimation of triglyceride test kit ( 5 x 20ml ) , kit for estimation of albumin ( 5x 10ml liquixx ) , kit for estimation of amylase ( 12x5 ml ) , kit for estimation of creatinine ( 4x50 ml ) , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12x5 ml ) , kit for estimation of ldh ( 12x5 ml ) , kit for estimation of sgot ( 4 x 24ml ) ( liquixx ) , kit for estimation of sgpt ( 4 x 24ml ) ( liquixx ) , kit for estimation of urea ( kinetic method ) , kit for estimation of uric acid ( 5x 10ml liquixx ) , kit lipase , kit occult blood , kits for estimation of albumin , labetalol hcl 100mg tab , labetalol hcl 4 ml amp inj , lactocalamine lotion bott of 120 ml , lamotrigine 25 mg tab , lamotrigine 50 mg tab , lancet sterile size 10 , laproscopic fallope ring applicator , laryngeal mask airway size 1.0 , laryngeal mask airway size 1.5 , laryngeal mask airway size 2.0 , laryngeal mask airway size 2.5 , laryngeal mask airway size 3.0 , laryngeal mask airway size 4.0 , laryngeal mask airway size 5.0 , lectin for sub groups sera a1 , leflunomide 10 mg tab , leflunomide 20mg tab , leishmans stain ready to use ( 500ml ) , letrazole 2.5 mg tab , leveteracetam 500 mg tab , levetiraceram ext release 500 mg tab , levo salbutamol 50 mcg + ipratropium 20 mcg metered dose inhaler, 200 dose units , levonorgestrel iu system , levosalbutamol aerosol inhalation pack of100 200 doses ( each metere , levosulpride 50 mg tab , lignocainehcl 2% with adrenaline ( 1:80000 ) inj vial of 30 ml , lignocaine 10% spray , lignocaine hci 2% ( without adrenaline ) 30ml inj ( suitable for ophthalmic use also ) , lignocaine hcl solution 2% for iv use, vial of 50 ml , lignocaine hydrochloride4% topical solution bottle of 30ml , lignocaine hydrochloride gel 0.2% 30gm , lignocaine with adrenaline dental catridge 1:80000 iu , lina retractor , linezolid infusion 200 mg to 300mg / 100 ml , lint absorbent, cotton , liquor formaldehyde 40% w / v , lopinavir 200mg + ritonavir 50mg tab , lorazepam 1 mg tab , lorazepam 2 mg / ml amp of 2 ml inj ( prepn:inj ) , magnesium sulphate 50% inj , may grunwald giemsa stain ( mgg stain ) ready to use , meclizine 25 mg tab , mefemenic acid 250 mg + dicyclomine 10 mg tab , mefenemic acid 500mg cap , memantine 10mg tab , mephentermine 30 mg / ml, 10 ml vial inj , merocel nasal pack with string 10 cm , merocel nasal pack with string 8 cm , mersilk non absorbable braided suture black no 1 cutting bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 1 round bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 1.0cutting bodied 76 cm ( pkt of 12 foils ) , mersilk non absorbable braided suture black no 2.0cutting bodied 76 cm ( pkt of 12 nos , mersilk non absorbable braided suture black no 2.0round bodied 76 cm ( pkt of 12 foils ) , mesalamine suppository 500 mg , mesalmine 1.2 gm tab , metformin 1000 mg + glimipride 1 mg tab , metformin 500mg+ vildagliptin 50mg , methyl alcohol bott of 500 ml , methylergometrine maleate 0.2mg, 1 ml inj , methylprednisolone 16mg, tab , metoprolol tartarate 25mg xl tab. , metronidazole inj for iv usel containning 500mg per bott of 100mll , miconazole nitrate 2% creamskin tube of 15 gm , micro tips 1000 ul , micro tips 10 200 ul , microlyte cal a ( 280 ml ) , microlyte cal b ( 280 ml ) , microlyte deproteinizer , micropore size 10cm , micropore size 6.0cm , microscope focus lens 300 mm ( labomed ) , microscope focus lens 400 mm ( labomed ) , midazolam 1 mg / ml 10 ml vial inj , mifepristone 200 mcg+ misoprostal 200 mcg ( combikit ) tab , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0cutting bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 2.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 3.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglecaprone 25, undyed ) no 4.0round bodied 70 cm ( pkt of 12 foils ) , monocrylabsorbable suture synthetic ( monofilament poliglycaprone 25, undyed ) no 4.0cutting bodied 70 cm ( pkt of 12 foils ) , mouth ulcer gel tube of 10 gm , moxifloxacin 0.5 % w / v ear drop , multistix of 10 parameters ( dekhaphan laura ) 100 strips , multivitamin bott of 200 ml syp , n acetylcystene 200 mg / ml amp of 2 ml inj , n acetylcystine 600 mg tab , nasal spray buffered hypertonic saline spray 100ml , nasal spray buffered isotonic solution 135ml , nasal spray mometasonefuroate 0.05%benzalkonium chloride 100 metered dose nasal spray , nasal spray oxymetazoline hydrochloride 0.05%, benzalkonium chloride 0.01% 10 ml , nasal spray oxymetazoline hydrochloride 0.1%, benzalkonium chloride 0.01% 10 ml , nasal spray solspry saline 100 ml / 100gm per 100 metered dose , nasal spray xylometazoline 0.14 mg / 0.14 ml preservative free , natamycin 5% eye drop , nitrocontine 2.6 mg tab , nitrofurantion 100 mg tab , nitroglycerine 2.6mg tab , nitroglycerine 5 mg / ml, 5 ml inj , nor ethisterone 5 mg tab , normal saline nasal drops 20ml, sodium chloride 0.65% , oral solution sodium valporoate 200 mg / 5ml bottle of 100 ml. , oxcarbazepine 150 mg tab , oxytocin 5 units per 1.0ml amp inj , pantoprazole 40mg+ domeperidone 20mg tab , paracetamol 10 mg / ml infusion in 100 ml bottle , paracetamol 150 mg / ml amp of 2 ml iv inj , paracetamol 650 mg tab , paradichlorobenzene, benzocaine, chlorbutol&terpentine oil ear drops 10ml , paraffin wax ( 56 degree c ) , paraformaldehyde tab , pds no 1 round body heavy , pentoxyphyllin400 mg tab , petri disk disposable ( pack of 100 dick ) , pheniramine maleate of 25 mg tab , phenobarbitone 20 mg / 5ml bott of 60 ml syp , phenobarbitone 30 mgtab , phenytoin sodium vial of 100 mg ( sodium dilentin ) inj , piroxicam tab 20mg , pointed needle , poly ethelyne glycol 400 nf 0.4% propyline glycol 0.3%, sorbitol, hp guar, borate, polyquqad 0.001% 10 ml eye drop , potassium chloride 15% inj ( intravenous ) ampoule of 10ml ( 1.5g ) , povidone iodine 2% gargles bottle 100ml , pregabalin 75mg cap , pregablin 75 mg+ methylcobalamine 1500 mcg tab , primapore size20cmx10cm , primapore size25cmx10cm , primapore size 15cmx8cm , primapore size 8.3cmx6cm , printer roll ( sysmex ) 57mm x 20mtr , prochlorperazine maleate 5 mg tab , prolene non absorbable suture ( monofilament polypropylene blue ) no 1 cutting bodied 70 cm ( pkt of 12 foils ) , prolene non absorbable suture ( monofilament polypropylene blue ) no 1 round bodied 70 cm , promethazine syp 5mg / 5ml bott of 6 ml , promethazine+pholcodine bott of 60 ml , proparcaiane 0.5% eye drop , prothrombin test kit ( 1x5 ml ) ( isi value 1.0 ) , protime ls 50 ( 10x5 ml ) , pttk test kit , pyrazinamide 1500 mg tab ( perpn:tab ) , quinine dihydrochloride 300mg / ml, 2 ml inj , ra factor test , rabies immunoglobulin 300 iuinj , rabies vaccine rabipur 1 ml inj , rabiprazole +levosulpridetab , raney clip applicator with clips , rapid test for malaria pan / pf antigen ( 50test kit ) , rasagaline 0.5 mg , redivac suction drain size 12 fr , ribbon gauze , rifampicin 150 mg cap , rifampicin 600 mg + inh 300 mg tab , rifaximin 550 mg tab , roller bandage 6cm , roller bandage10cm , rosuvastatin 20 mg tab , rotacaps formetrol6 mcg+budesonide 200 mcg bott of 30 , salbutamol sulphate respirator solution 5 mg / ml, vial 0f 10 ml , salmetrol + fluticasone 250 mdi inhaler , saw gigle wire for bur hole , serratiopeptidase 5mg tab , serum anti d igg , serum anti d igm , serum anti h , serum anti haemoglobuline , serum anti haemoglobuline gp a , serum anti haemoglobuline gp ab , serum anti haemoglobuline gp b , silk non absorbable braided suture 06 reelx 25mtr size no 1 , silodosin 8 mg tab , sinus pack 3.5mm with string , sodium bicarbonate 7.5% solution ampoule of 10ml inj , sodium chloride eye drops 5% 5ml bottle , sodium cromoglycate eye drops 2% bottle of 5 ml. , spironolactone 25 mg tab , strips `albumin` and glucose bottle of 100 strips , sulphamethoxazole 200mg and trimethoprim 40 mg per 5ml bott. of 50m , sumatriptan 50 mg tab , suspension pyrantel pamoate 250 mg / 5 ml. , syp oesteocalcium , syp zinc 20 mg / 5ml, bottle of 100 ml , syrup terbutaline sulphate 1.25 mg + bromhexine hcll 4 mg + guaiphh , sysmex xp cell clean , sysmex xp 100eightcheck trilevel3 wp ( lxnxh ) 3x1.5ml , sysmex xp 100 dil 20ltr , sysmex xp 100 stromatolyser wh 3x500ml , tab colchicine 0.5 mg , tab dehydrogestron 10 mg , tab methimazole 10 mg , tab methotrexate 5mg , tab methyldopa tab 250 mg , tab primaquine ( 7.5 mg base ) , tab promethazinehcl 25 mg , tab septran ds , tab sertraline 50mg , tab sodium valporoate 200 mg , tab thyroxin sodium 75 mcg , tab triamterene ip 50 mg and benzthiazide nfc ( us ) 25 mg , tab venlafaxine 37.5 mg , tab.propranolol hcl 40 mg , tab.pyrazinamide 0.5 gm , tab.trihexyphenidyl hcl 2 mg , tacrolimus 0.03% to 0.1% ( w / w cream 10g ) , cream , tamoxifen citrate 20 mg tab , telmesartan 20mg tab , telmisartan 40 mg + hydrochlorthiazide 6.25 mg tab , tennis elbow support , terbinafine 1% cream tube of 10 gm , terbinafine hcl tab of 250gm , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses , ticagrelor 90 mg tab , tissue paper roll , trache dresssing , trache hold , tracheostomy tube double lumen size 8.5 id , tracheostomy tube double lumen size 9.0 id , tracheostomy tube single lumen size 2.5 id , tracheostomy tube single lumen size 3.0 id , tracheostomy tube single lumen size 3.5 id , tracheostomy tube single lumen size 4.0 id , tracheostomy tube single lumen size 4.5 id , tracheostomy tube single lumen size 5.0 id , tracheostomy tube single lumen size 5.5 id , tracheostomy tube single lumen size 6.0 id , tracheostomy tube single lumen size 6.5 id , tracheostomy tube single lumen size 7.0 id , tracheostomy tube single lumen size 7.5 id , tracheostomy tube single lumen size 8.0 id , tracheostomy tube single lumen size 8.5 id , tracheostomy tube single lumen size 9.0 id , tramadol hcl 50 mg cap / tab ( prepn:cap ) , tropicamide 1% with 5% phenylephrine eye drop bott of 5 ml , trypsin chymotrypsin tab , tube test, 12 x 75 mm rimless , tube, test, 100 mm x 12 mm, rimless , typhi igg & igm card , typhoid vaccine injectable , urine collecting bag with volume meter , urine strips glucose+ketone bodies bott of 100 strips , ursodexycholic acid udca tab 150 mg , vdrl syphill’s rapid kit of 50 , vildagliptin 50 mg tab , vitamin d3 oral drops 800 iu bott of 30 ml , vitamin e 400mg cap , walking aid monopod assist , whatmen filter paper ( round ) , widal test kit ( 4x5ml ) , woundclot surgical ( wc s 44 c ) 10x10 cm / 4*4 inch , woundclot trauma ( wc jsr 820 ) 8x20 cm / 3.2*8 inch , xylene ( xyol pure ) bott of 500 ml , xylometazoline hcl 0.05% w / v nosal solution for paed use bottle of 10 , zidovudine 300mg+ lamivudine 150mg tab , zidovudine tab 300 mg...