RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34096934 supply of agriculture agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handlemedium size25 ltr. capacity , models related to various types of animal houses models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / pictures related to health hazards 3*2pictures binded with wood border , charts / pictures related to milk machine 3*2pictures binded with wood border , charts / pictures related to milking method 3*2pictures binded with wood border , charts / pictures related to clean milk production 3*2pictures binded with wood border , charts / pictures related to dairy records 3*2pictures binded with wood border , charts / pictures related to tincture iodine 3*2pictures binded with wood border , charts / pictures related to safety measure 3*2pictures binded with wood border , charts / pictures related to vaccination schedule toanimals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation 3*2pictures binded with wood border , charts / pictures related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

Sarva Shiksha Abhiyan Authority - Rajasthan

34031540 supply and installation of lab equipments and material for vocational education lab agriculture supply and installation of lab equipments and material for vocational education lab agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handlemedium size25 ltr. capacity , models related to various types of animal houses models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / pictures related to health hazards 3*2pictures binded with wood border , charts / pictures related to milk machine 3*2pictures binded with wood border , charts / pictures related to milking method 3*2pictures binded with wood border , charts / pictures related to clean milk production 3*2pictures binded with wood border , charts / pictures related to dairy records 3*2pictures binded with wood border , charts / pictures related to tincture iodine 3*2pictures binded with wood border , charts / pictures related to safety measure 3*2pictures binded with wood border , charts / pictures related to vaccination schedule toanimals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation 3*2pictures binded with wood border , charts / pictures related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

North Western Railway - Rajasthan

34005716 supply of synthetic brush paint & varnishsynthetic brush paint & varnish, synthetic filament oval ferrule bound brush for paint & varnish.size 6 / 0 mm. shape & design of brush shall be as per fig.1 of is:487 / 2012.filament of brush shall be manufacturing from golden / black colored, synthetic polymer nylon 612 of specific gravity 1.067+ 0.004 & melting point 209+ 8 degree c. the entire mass of the filaments shall be firmly set in the 0.8+ 0.2 mm mild steel ferrule with suitable non metallic wedge using epoxy polymer. wooden handle timber shall be free from pits, knots, cracks & straight grained along length and seasoned to a content of 15% max. for securing the bridle strip and the ferrule to the handle, four round headed steel nails of 1.40mm diameter and 12.5 mm length shall be used....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33977233 supply and installation tools, equpment furniture for agriculture 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 5 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 5 11 knapsack sprayer 2 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake,spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle/s lightly curved blade. 5 17 secateurs made of stainless steel,0 steel cutting blade 5 18 specialty spades suitable for garden ,made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 20 sprinklers medium size garden sprinklers fitted with water pipe 1/2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large (plastic/ gl sheet) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc (automatic temperature compensation) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm,bucket 20 litre,orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine,leg rings, colar,branding (hot and cold) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest (available in local market) 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 (230mm) 2 45 lactometer made of glass 2 46 teat siphon fine finish ,teat plug with syphon 2 47 charts/picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts/picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts/picture s related to milking methods 50 charts/picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts/picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts/picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts/picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts/picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts/ pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts/picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, (snf, fat , water test etc.) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl/gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight (lb.)= 1.62, product width (in): 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment (ppe) include gloves, foot and eye protection, protective hearing devices (earplugs, muffs) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 1 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 raw material list (recurring items list) 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea,dap,pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash 2 6 seeds of various agriculture crops (as per curriculum) healthy and good quality of seeds of various crops 10 7 fertilizers samples samples of different type of fertilizer packed in plastic jars 10 8 duster used to clean 5 9 ropes jute rope of 100 meter 2 10 tape measuring of land area 100 mtr standard tape 2 11 sprayers having capacity of 1 litre 5 12 sprayers fitted on every bottle made of plastic ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Sms Medical College - Rajasthan

33885210 supply of stationery items at hospital 1 acr form pad tic 2 age & sex book size: a 4 , 60gsm, one side printed, gumming sheet 50x2 perforated binding a 3 all pin pkt. — t shape only pt 4 attendance register — 20 pages 1c13 1 5 attendance register — 40 pages a 6 attendance register — 60 pages wl 7 attendance register — 80 pages 31 8 bill encashment register — 100 pages ‘i3 1 9 bill transit register — 100 pages !3 1 10 binder clip pkt. 32mm. 134 11 binder clip pkt. 41 mm. pi 12 budget control register — 100 pages e 13 calculator— 12 digits sharp / canon / casio lin 14 carbon paper pkt. pi 15 cash book — three col. 300 pages neelgagan e 16 cd re writable 17 cello tap 1 f 18 cello tap 2 f 19 chapdi pkt. ( pack of 10 pcs. ) f 20 color flag pkt. — different color f 21 computer cartridge — 80 column. i 23 computer paper — green, size:a4, 70 gsm p 22 computer paper — white, size:a4, 70gsm f 24 computer paper —single with back adhesive 3x4 f 25 computer ribbon i 26 consumption register — 200 pages 1 27 dak pad — good quality 1 28 dam pad 29 diet register — 100 pages 30 discharge ticket — blue card sheet ( 18x28cms. ) printed both side ( as per sample ) 31 dispatch register — 400 pages neelgagan 32 envelope — cloth 12x16 printed one side 33 envelope — cloth 18x14 34 envelope — paper size: 11x5 35 envelope — paper size: 9x4 36 envelope for x ray khaki color, size • 11x13, one side printed, hospital name with details envelope for x ray khaki color, size 12x15, one side printed, hospital name with details pc 17 envelope for x ray khaki color, size 9x1 i, one side printed, hospital name with details pc 39 fevi stick gum — 8 gms. iw 40 file cover — good quality pc 41 file lace — full length — good quality pt 42 file tag — good quality pc 43 fitness book — gazette iw 44 fitness book — non gazette lcu 45 ga 79, 80 deduction form pad p ( 46 gum bottle — 150m1 iw 47 high lighter pen 16 48 income tax calculation form pad — 100 nos. pt 49 indent book — 5 forms with paper binding pc 50 indoor ticket — 8 pages, 65 gsm, printed both side ( as per sample ) el 51 injury report form 60gsm, paper with binding from paper perforated, 21x35cms., 50x2 paper ( as per sample ) pc 52 investigation slip 60gsm, white / blue / green / red size:16x26 / 2 one side printed ( 50 slips pad ) p ( 73 jitteritefill [ li 1 53 , jssy registration register — 400 pages ( both size printed ) size: 16 ) ( 26 / 4 j 54 labor room register — 200 pages ( both side printed ) i 55 ledger book — 200 pages ( neelgagan / unique ) 57 legal paper — green — 70 gsm — 500 nos. p 56 legal paper white — 70gsm — 500 nos. p 58 lining register— 100 pages e 59 lining register — 200 pages e 60 lining register — 300 pages e 61 log book 62 lpc form pkt.of 100 nos. 63 marker pen — big 64 marker pen for laboratory purpose 65 note sheet pad —size a3, 70gsm ( both side lining ) 67 opd slip carbonless size: 8x10x2, 60gsm, white paper 500x2 with printed ( as per hospital opd slip ) 66 opd slip size: 8x10x1, 60gsm, white paper, 500x i with printed ( as per hospital opd slip ) 68 p.l. form — ga 45 69 paper weight plastic 70 pay posting register — 400 pages, 72 pen — gel — ( good quality ) 74 pen drive — 8gb — kingston / sendisk 75 plastic folder — good quality 76 poker — iron handle 77 poker — plastic handle 78 poker wooden handle, r 79 punching machine — big 80 punching machine — small 81 receipt register — 200 pages neelgagan 71 refill pen — flair — ezee click 82 refills for flair pen 94 ribbon for computer cartridge 83 stamp pad — big ( blue / red / green ) 85 stamp pad — ink — 100m1. 84 stamp pad — small ( blue / red / green ) 86 stamp postage register — 80 pages 87 stapler machine — big 88 stapler machine — small 89 stapler pin — big 90 stapler pin — small 91 stock register — 200 pages 92 voucher pad — 100 nos. ( as per sample ) 93 white correcting fluid pen....

Revenue Department - Rajasthan

33869588 purchase of stationary 01. plastic dori ( in per kg. ) 02. allpin ( 100gm ) packet 03. u pin plastic coated ( 100 ) pkt per unit 04. file lace 24 inch nukaa% inch 924 no. ( per bundle 100 pic. ) in per pkt. 05. stapler pin packet no 10 standard brand per packet 06. stapler pin packet no24 / 6 standard brand per packet 07. stapler pin packet no 17 / 23 standard brand per packet 08. blue carbon paper standard brand ( 100 carbon per pket ) 09. sketch pen ( per packet ) 10. self sticking page marker 1x3 ( 50x50 ) per pkt i i. t pin allpin packet ( 100gm ) per unit 12. file tag 8 inch length nukaa3 / 4 inch standard brand ( per bundle 100 pic.in per pkt. ) pc unit 13. stapler machine no i0 standard brand per unit 14. stapler machine 24 / 6 standard brand per unit 15. stapler machine 17 / 23 standard brand per unit 16. register — 100 page white paper 8.5 x 13 inch per unit 17. register — 200 page white paper 8.5 x 13 inch per unit 18. register 400 page white paper 8.5 x 13 inch 19. register — 400 page green paper 8.5 x 13 inch per unit 20. gum 150 m.l. standard brand per unit , 21. gum 700 m.l. standard brand per unit 22. simple pencil standard brand per unit 23. short hand pencil standard brand per unit 24. pencil sharpner standard brand per unit 25. simple eraser standard brand per unit 26. stamp pad standard brand 160 / 97 m.m. ( big ) per unit 27. stamp pad standard brand 110 / 70 m.m. ( small ) per unit 28. stamp pad ink standard brand 100 m.l. per unit 29. plastic folder f / s size ( strip ) ( per piece ) 30. plastic folder a 4 size ( strip ) ( per piece ) 31. spiral diary page 40 ( 51 / 2 x 81 / 2 inch ) ( per piece ) 32. white fluid pen ( per piece ) 33. magnetic pin container ( per piece ) 34. paper weight glass 100gm ( per piece ) 35. acrylic paper weight officer ( per piece ) 36. poker with wooden handle ( ice braker ) ( per piece ) 37. dora gitta 100 gm cotton ( per piece ) 38. cello tape ( big ) 60 meter x 1 / 2 inch ( per piece ) 39. cello tape ( big ) 60 meter x 11 / 2 inch ( per piece ) 40. scale 12 inch standard brand ( per piece ) 41. ball pen 42. gel pen ( per piece ) 43 gel refill ( per piece ) 44. highlighter ( per piece ) 45. marker pen ( per piece ) 46. paper cutter big ( per piece ) 47. sponge pot / damper ( per piece ) 48. short hand note book ( per piece ) 49. glue stick 15 gram ( per piece ) 50. simple dak pad standard brand ( per piece ) 51. big slip book 33 no ( per piece ) 52. cello tape / dispenser big standard brand ( per piece ) , 53. paper punching machine no.280 standard brand ( per piece ) 54. white board 04 x 03 feet standard brand ( per piece ) 55. pen drive 16 gb standard brand ( per piece ) 56. pen drive 32 gb standard brand ( per piece ) 57. c. d. r ( per piece ) 58. pension kulak ( per piece ) 59. table top 16 x 22 size ( per piece ) 60. pen container ( per piece ) 61. pen stand ( per piece ) 62. income tax form ( per thousand ) 63. file flap 24 x 4 inch rope of 3 feet ( per thousand ) 64. craft envelope ( thick cover ) 4x9 inch 90 gsm ( per thousand ) 65. craft envelope ( thick cover ) 5x11 inch 90 gsm ( per thousand ) 66. envelope 4x9 inch ( laminated ) 100 gsm ( per thousand ) 67. envelope 5x11 inch ( laminated ) 100 gsm ( per thousand ) 68. envelope 10x12 inch ( laminated ) 100 gsm ( per thousand ) 69. envelope 12x16 inch ( laminated ) 100 gsm ( per thousand ) 70. cloth envelope 12x16inch ( laminated ) 100 gsm ( per thousand ) 71. sarvarak sheet full size different colon ( per thousand ) as per office model 72. file cover ( handmade sheet ) 80 kg 10.6 inch x 14.6 inch , 200 gsm or more print with office name ( per thousand ) 73. file pad 10.6 inch x 14.6 inch with 03 feet rope with broad cloth patti print 36 ons or more with office name ( per thousand ) 74. single file cover ( handmade sheet ) 80 kg 11 inch x 15 inch , 200 gsm or more ( per thousand ) ....

Medical College - Rajasthan

33655219 stationary items for govt medical college kota paper pencil eraser 1. alpin pkt. 2. candle 10 3. carbon paper small l0 ( or 4. chalk white 2 5. cello tape big 6. cello tape small 7. envelope 11 x 5 8. envelope 9 x 4 9. envelope a 4 size laminated 10. envelope legel size cloth ii. eraser big 12. file lace ( 13. file cover set 14 file pad cloth cotted 15. gum bottle 300 mls. 16. gum stick, 8gm 17. lock medium 18. marker pen 19. note sheet pad green 100 pages 20. paper veight ( glass ) 21. pencil nhbu — 22. pencil cell ( aa ) 23. peon book 24. pin cushion im pocker wooden handle 26. punching machine big 27. register linedar 28. register despatch 29. register receipt 30. register attencence student 31. register attendence staff 32. scale ( ss ) 12 33. sharpner washing power 34. soap 36. stamp pad — big 37. stamp pad small 38. stapler machine and pin big 38. stapler big 39. stepler— 1edium 40. stepler—small 41. stepler pin big stapler pin small 42. 43, whitener pen 44. zerox rim a 4 size 45. zerox rim f / s size c d plain 46. 47. f.vc bili form? budget register bill register m 48. 49. 50. register linedar big size potract 51. calculator — 52. colourful flag pad 53. envelop a 3 size cloth coted 54. alpin pkt. ( t shape ) 55. binder clip midium size 56. dak marking pad plastic coted 57. service book 60 pages 58. pentioner kulak 59. plastic folder 60. strip file 61. drawing pin for board 62. u pin etc ...

Government Medical College - Rajasthan

33648621 stationary items for govt. medical college kota stationary items for govt. medical college kota , stationery items as per technical bids specification , alpin pkt. , candle , carbon papersmall , chalkwhite , cello tape big , cello tape small , envelope 11 x 5 , envelope 9 x 4 , envelope a 4 size laminated , envelopelegel size cloth , eraser big , file lace , file cover set , file pad cloth cotted , gum bottle 300 mls. , gum stick, 8gm , lock – medium , marker pen , note sheet padgreen 100 pages , paper weight ( glass ) , pencil hb , pencil cell ( aa ) , peon book , pin cushion , pocker wooden handle , punchingmachinebig , register linedar , register despatch , register receipt , register attencence student , register attendence staff , scale ( ss ) 12 , sharpner , washing power , soap , stamp pad – big , stamp pad – small , stepler – big , stepler – medium , stepler – small , stepler pin –big , stepler pin –small , whitner pen , zerox rim a 4 size , zerox rim f / s size , c d plain , f v c bill form , budget register , bill register , register linedar big size potract , calculator , colourful flag pad , envelop a 3 size cloth coted , alpin pkt. ( t shape ) , binder clip midium size , dak marking pad plastic coted , service book 60 pages , pentioner kulak , plastic folder , strip file , drawing pin for board , u pin...

Department of Information Technology and Communication - Rajasthan

33538296 rate contract rfp for stationary, computer media, consumable and other office itmes 1 canon toner 320 2 canon toner 328 3 canon toner 337 4 canon toner 324 5 toner hp 6511a 6 toner hp ce 278a 7 toner hp cc388a 8 toner hp 05a 9 toner hp 230a 10 toner hp 287a 11 toner hp cf280a, 1 canon toner 328 2 canon toner 337 3 canon toner 324 4 toner hp 6511a 5 toner hp ce 278a 6 toner hp cc388a 7 toner hp 05a 8 toner hp 230a 9 toner hp 287a 10 toner hp cf280a, ( a ) cd / dvd 1 dvd r with cover ( frontech / samsung / moserbaer / hp / sony ) ( b ) usb pen drive ( 3.1 and above ) 1 32 gb ( kingston / sandisk / hp / moserbaer / transcend ) 2 64 gb ( kingston / sandisk / hp / moserbaer / transcend ) 3 128 gb ( kingston / sandisk / hp / moserbaer / transcend ) ( c ) external hard disk drive 1 1 tb sata usb powered ( seagate / wd / transcend ) 2 2 tb sata usb powered ( seagate / wd / transcend ) 3 4 tb usb powered ( seagate / dell / sony / wd / transcend ) 4 512 gb ssd usb powered ( seagate / wd / aarvex ) 5 1 tb ssd usb powered ( seagate / wd / aarvex ) 6 2 tb ssd usb powered ( seagate / wd / aarvex ) d internal hard disk drive 1 512 gb sata hdd 7200 rpm, ( seagate / wd / transcend / aaevex ) 2 1 tb sata hdd 7200 rpm ( seagate / wd / transcend / aaevex ) 3 512 gb ssd ( seagate / wd / transcend / aaevex ) 4 1 tb ssd ( seagate / wd / transcend / aaevex ) 5 512 gb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) 6 1 tb ssd nvme, m.2 port ( seagate / wd / transcend / aaevex ) ( e ) ram 1 desktop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 2 laptop ram ddr4 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 3 desktop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) 4 laptop ram ddr3 ( 8 gb ) ( hynix / samsung / transcend / kingston ) ( f ) other items 1 usb optical mouse ( logitech / iball / hp / dell ) 2 optical wireless mouse ( logitech / iball / hp / dell ) 3 usb keyboard ( logitech / iball / hp / dell ) 4 wireless keyboard ( logitech / iball / hp / dell ) 5 wireless keyboard & mouse combo ( logitech / iball / hp / dell ) 6 web camera ( logitech / iball ) ( minimum hd 720p 30fps 1280*720 resolution ) 7 vga cable standard size 1.5 meter 8 hdmi cable 1.5 meter 9 speaker set ( 2 nos. ) with usb power, 1.2 watt, 3.5 mm input 10 mechanical keyboard ( tvs gold ) , 1. all pin ( 26 mm, nw 70 gram ) 2. binder clip : a. 19 mm b. 25 mm c. 32 mm d. 41 mm 3. gem clip / u pin ( plastic cover ) 4. poker ( wooden handle ) 5. poker ( iron base ) 6. transparent adhesive tape ( scotch / cello / wonder ) , 7. brown packing tape ( scotch / cello / wonder ) a. 1, 55 meter b. 2, 55 meter 8. both side tape ( scotch / cello / 3m ) a. 1 wide both side tape thick b. 1 wide both side tape thin 9. cleaner ( colin / cleen ) ( 500 ml ) 10. gum ( camlin / kores ) a. 700 ml b. 150 ml 11. glue stick 15 gm ( kores / scotch / fevi stick ) 12. large paper cutter ( natraj or equivalent brand ) 13. hb pencil ( camlin / natraj / faber castel ) 14. non dust eraser ( camlin / natraj / faber castel ) 15. sharpener ( camlin / natraj / faber castel ) 16. scale plastic ( 12 ) ( natraj / camlin ) 17. scale iron ( 12” ) ( ajanta / camlin / natraj ) 18. stamp pad 110mm x 70mm ( ashoka ) 19. punching machine ( kangaroo or equivalent brand ) a. 14 page punching capacity ( dp 480 ) b. 22 page punching capacity ( dp 680 ) c. 60 page punching capacity ( dp 800 ) d. 1 hole punching no. 10 20. stapler ( kangaroo / max ) a. staples use :no. 10, stapling capacity upto 15 pages, loading capacity:50 staples b. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hp 45 equivalent ) c. staples no. 24 / 6, 26 / 6, stapling capacity upto 30 pages, loading capacity:50 staples ( 24 / 6 ) , 100 staples ( 26 / 6 ) ( kangroo hdz 45 equivalent ) 21. stapler pin ( kangaroo / max ) a. no. 10 1m ( 20x50=1000 staples ) b. no. 24 / 6 ( 20x50=1000 staples ) c. no. 26 / 6 ( 20x50=1000 staples ) 22. envelop ( cloth ) a4 size with min. 100 gsm paper 23. envelop ( cloth ) fs size with min. 100 gsm paper 24. cd / dvd permanent marker ( camlin / faber castel / luxor ) 25. paint marker ( golden color ) ( camlin / faber castel / luxor ) 26. white board marker ( camlin / luxor / faber castel / kores ) 27. correction fluid ( camlin / luxor / faber castel / kores / kangaro ) 28. peon book 100 sheets 29. slip pad 140mm x 225mm, 70 gsm inner paper with line, 1 mm card sheet on back, 30. spiral slip pad a. 140mm x 225mm, 70 gsm, multi color inner paper with line, card sheet on back and plastic cover 80 sheets ( 160 pages ) b. 140mm x 225mm, 70 gsm, inner paper with line, card sheet on back and front 80 sheets ( 160 pages ) 31. white board duster 32. white board duster ( magnate ) 33. a4 size photo paper 180 gsm ( 50 sheets per pkt ) ( desmat / novajet / epson / kodak ) 34. 75 gsm paper a4 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 35. 75 gsm paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 36. 75 gsm a3 size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 37. 75 gsm green pie paper fs size ( 500 sheets per ream ) ( jk / modi / xerox / tnpl ) 38. address label ( for laser printer a 4 size ) 100 sheet in a packet ( desmat or equivalent ) a. 16 label per page b. 24 label per page 39. basta ( cloth ) size 90*90 40. file pad – weight 32 ons, size 10*15, 36 ( dori 4*27 flap ) 41. file cover ( 31 kg cpm board ) with printing of deptt name 42. file lace best quality ( 100 nos. of laces in one bunch ) 43. file tag best quality ( 50 nos. of laces in one bunch ) 44. transparent l shape folder ( plastic ) ( solo / trio ) 45. ring binder, 1, 2 d, pvc folder a4 size, holds upto 250 sheets ( solo / trio or equivalent ) 46. index file ( box file ) 47. pen a. reynolds 0.45 b. cello fine grip c. flair writo meter d. flair ball pen e. uniball eye fine f. parker roller pen ( beta premium i. parker vector standard j. uniball gel impact k. uniball eye broad 48. duster ( cloth ) 2ft x 2ft. 49. post it ( 3m ) a. size 3” x 3” 100 sheets, 50. cell ( duracell ) a. pencil cell ( aa ) b. pencil cell ( aaa ) 51. pvc cards packet of 50 pvc cards ( 30 mil ) 52. dustbin plastic min 12 litr. ( poly propylene plastic ) without cover 53. dustbin min. 12 litr ( poly propylene plastic ) with cover 54. dustbin 15 ltr ( poly propylene plastic ) with cover 55. water jug plastic ( 2 ltr. or more ) ( poly propylene plastic ) – ( cello / prestige / orient / milton or equivalent ) 56. extension board ( make: belkin ) a. 4 socket b. 6 socket c. 8 socket 57. scissors ( kangaro munix ) stainless steel, 185 mm ( munix sl 1173 ) 58. electric kettle ( prestige, borosil ) , 1.5 litre 59. tea flask tuff insulated jug 1 litres ( cello / milton ) 60. best quality white window envelop ( 50 piece ) 11 x 5 80 gsm 61. towel 100% cotton, 75 cm x 150 cm ( bombay dyeing ) 62. refillable self inking stamp seal two line 63. refillable self inking stamp seal three line 64. refillable self inking stamp seal four line 65. refillable self inking stamp seal five line 66. refillable self inking stamp seal big size ( more than 5 line ) , 1. 9 u rack with pdu & cooling fan 2. installation charges for 9 u rack 3. i / o port set ( network keystone jack, gang box, face plate ( dlink / digisol / dax / amp / molex ) 4. cat 6 network cable box 305 mtr. ( d link / digisol / dax / amp / molex ) 5. laying of cat 6 cable 6. isi mark pvc casing 1 inch 7. laying of pvc casing 8. 5 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 9. 8 port switch 10 / 100 / 1000 mbps ( dlink / digisol / digilink ) 10. rj 45 connector ( dlink / digisol / digilink / molex ) ....

Sms Medical College - Rajasthan

33454927 stationery items supply at hospital paper acr form pad f age & sex book size: a 4 6ogsm, one side f printed. gumming sheet 50x2 perforated binding — aii pin pkt. — t shape only i attendance register —20 pages 1 attendance register —40 pages i attendance register —60 pages? — attendance register — 80 pages . bill encashment register — 100 pages bill transii register — 100 pages .. biider ciip pkt. 32mm. binderclippktr4lmfll. rdget control register — 100 pages calculatorr — 12 digits siarp / canon / casio carbon paper ikt. cash book — three col 300 pages neelgagan 15 16 cd re writable cello tap 1” cello tap 2” 17 18 19 chapdipkt. ( packofl0pcs. ) color flag pkt. — different color 20 21 — computer cartridge — 80 column. 23 computer paper green. size:a4, 70 gsm 22 computer paper — white, size:a4. 7ogsm 24 computer paper single with back adhesive 3x4” 25 — computer ribbon 26 consumption register — 200 pages 27 dakpad goodquality dam pad 28 29 diet register 100 pages 30 discharge ticket — blue card sheet ( 1 8x28cms. ) printed both side. ( as.per.sample ) envelope for x ray khaki color. size i ix 13, 31 32 dispatch register — 4i0 pages neelgagan i envelope — cioth i 2x 16” printed one side 33 envelope—cloth 18x14” 34 envelope — paper size: i 1x5” 35 envelope — paper size: 9x4” 36 / | one side printed. hospital name with details 38 fnvelope for x ray khaki color, size 12xl5, one side printed, 1ospital name with details 37 envelope for x ray khaki color, size 9x1 1. one side.printed._hospital.name.with.details 39 fevi stick gum 8 gms. m 40 filecover—goodquality 41 file lace — full length good quality 42 file tag good quality fitness book gazette fitness book non gazette ga 79. 80 deduction form pad gum bottle— 150m1 high lighter pen 43 44 income tax calculation form pad — 100 nos. indent book — 5 forms with paper binding indoor ticket 8 pages. 65 gsm. printed both side ( as per sample ) 51 injury report form 6ogsm. paper with binding from paper perforated. 21 x35cms., 50x2 paper 51 injury report form 6ogsm, paper with binding from paper perforated. 2lx35cms., 50x2 paper ( as per sample ) 52 investigation slip 6ogsm. white / blue / green / red size: i 6x262 one side printed ( 50 slips pad ) 73 jitter refill 53 jssy registration register 400 pages ( both ize printed ) size: 16x26’4 54 l:abor room register 20g pages ( both side printed ) 55 ledger book — 200 pages ( neelgagan / unique ) 57 legal paper green 70 gsm 500 nos. 56 legal paper white — 70gsm 500 nos. 58 lining register 100 pages 59 lining register — 200 pages s0 lining register — 300 pages 61 log book 62 lpc form pkt.of 100 nos. 62 lpc form pkt.of 100 nos. 63 marker pen—big marker pen for laboratory purpose 65 note sheet pad size al, 7ogsm ( both side lining ) 67 opd slip carbonless size: 8x10x2. 6ogsm white paper 500x2 with printed ( as per hospital _ opd slip ) opd slip size: 8xl0xl. 6ogsm. white paper, 500xl_with_printed_ ( as_per_hospital_opd_slip ) 68 p.lform ga 45 69 paper weight plastic 70 pay posting register 400 pages. 72 pen — gel — ( good qualiiy ) . 74 pen drive — 8gb kingston / sen [ ) isk 75 plastic folder — good quality 76 poker iron handle 77 poker plastic handle 78 poker wooden handle 79 punching machine — big .__.. 80 punching machine small 81 receipt register 200 pages neelgagan 71 refiil pen — flair ezee click 82 refilis for fiair pen . _ 94 ribbon for computer cartridge 83 stamp pad? — big (blue/red/green) 85 stamp pad — ink — i ooml. stamp padd — small (blue/red/green) 86 stamp postage register? — 8i pages 87 stapler machinee — big 88 stapler machine? — smail . 89 stapler pin—big 90 stapler pin — small . 91? — stock register — 200 pages 92 voucher pad 100 nos. (as per sample) 93 white correcting fluid pen etc ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

33126851 supply of equipment and articles for uch jodhpur i dissection set (complete) 2 electric saw for sectioning body & limbs electric, height 2o0mm, max. throat 2oomm, table size (lxw) 600x600mm, blade speed (mtr/min.) 20 100, blade size (lxwxt) 3 505x27x0.9mm, motor capacity 3 hp 0l j hand saw for sectioning body & limbs blade size (lxwxt) 3505x27x0.9mm; wooden handle 0l 4 skeleton (articulated) imported quality non toxic pvc bone like material; articulated on a stand with trollcy wheels. 0l 5 skeleton (non articulated) imported quality non toxic pvc bone like material; non articulated having 206 bones. 03 6 diagrams (region wise) embossed diagrams (lx2 ft.) on a ply board of the following: o lungs o heart r thorax o abdominal cavity o liver o kidneys with ureten & urinary bladder . male reproductive organs r female reproductive organs o parts of brain o eyes o oral cavity o parts of a tooth o cell division o developmentofface o formation of blastocyst . mammary glands (breast) . testis (l.s,) . ovary (l.s.) o extrahepatic biliary apparatus o pancreas 0l each (20 pcs.) 7 models (viscera) nontoxic pvc/plastic/pop models of the following: o heart r brain o lungs r eyes 0l each (15 pcs.) a. . r1 re s;24 sign & seal utl firms . ear o larynx . liver . pancreas . spleen o stomach . kidney r uterus o shoulderjoint . knee joint o elbow ioint 8 half torso (male) half body (3 ft.) pvc/plastic torsomale 0t 9 half torso (female) half body (3 ft.) pvc/plastic torsofemale 0l l0 full torso (male or female) full body (5 ft.) pvc/plastic torsofemale 0l ll histological slides with cabinet prepared glass slides of human body structures/ viscera with ground edge lx3 cabinet frame of mds fumished with laminated sheets, hinged door with lock of capacity 100 slides with 5 drawers (50 slides in 0l cabinet) 0l cabinet t2 class jars with lid lxw i x 1.5 05 pcs. lxw 1 x 1 05 pcs. l0 l3 projector with screen & speakers (audio visual aid) t4 refrigerator l5 computer with printer 6 surgical gloves (7 05 pkt. 7 dissection apron 02 pcs 8 formalin 100lts. 9 phenol 500 ml. 20 glycerol 2t distilled water 200lts. 22 scalpel blade (ss; 22 no.) 05 pkt. 23 syringe (20 ml.) l0 pcs 24 plastic trays ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33020793 supply of agriculture 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools handle made of plastic and head made of stainless steel 5 4 garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 11 knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body 2 12 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle / s lightly curved blade. 5 17 secateurs made of stainless steel, 0 steel cutting blade 5 18 specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 2 20 sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity 1 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height 5 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre ) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) 2 45 lactometer made of glass 2 46 teat siphon fine finish , teat plug with syphon 2 47 charts / picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts / picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts / picture s related to milking methods 3*2 pictures binded with wood border 2 50 charts / picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts / picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts / picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts / picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts / picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts / pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts / picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea, dap, pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash ...

Government Medical College - Rajasthan

32921721 supply of stationary and printing iteam in jk lon hospital kota supply of stationary and printing iteam in jk lon hospital kota , fofhkuu izdkj dh tkp fjikszv qkezl ,oa vu; qkeszl vksfj;uv ogkbzv isij@vu; isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z rfkk ljl lfgr 200 isij izfr ism ,d rjq nikbz izfr gtkj isij , size = 18 x22/12 , size = 18 x22/10 , size = 18 x22/08 , size = 18 x22/06 , size = 18 x22/05 , size = 18 x22/04 , size = 17 x27/12 , size = 17 x27/10 , size = 17 x27/08 , size = 17 x27/06 , size = 17 x27/05 , size = 17 x27/04 , fofhkuu izdkj dh tkp fjikszv qkezl ,oa vu; qkeszl vksfj;uv ogkbzv isij@vu; isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z rfkk ljl lfgr 200 isij izfr ism nksuksa rjq nikbz izfr gtkj isij , size = 18 x22/12 , size = 18 x22/10 , size = 18 x22/08 , size = 18 x22/06 , size = 18 x22/05 , size = 18 x22/04 , size = 17 x27/12 , size = 17 x27/10 , size = 17 x27/08 , size = 17 x27/06 , size = 17 x27/05 , size = 17 x27/04 , fofhkuu izdkj dh tkp fjikszv qkezl jaxhu isij 58 th ,l ,e e; isij ,oa fizfuvax dk;z rfkk ljl ckbzafmax lfgr 200 isij izfr ism ,d rjq nikbz izfr gtkj isij , size = 18x22/12 , size = 18x22/10 , size = 18x22/08 , size = 18x22/06 , size = 18x22/05 , size = 18x22/04 , fofhkuu izdkj dh tkp fjikszv qkezl jaxhu isij 58 th ,l ,e e; isij ,oa fizfuvax dk;z rfkk ljl ckbzafmax lfgr 200 isij izfr ism nksuksa rjq nikbz izfr gtkj isij , size = 18x22/12 , size = 18x22/10 , size = 18x22/08 , size = 18x22/06 , size = 18x22/05 , size = 18x22/04 , ,dljs fyqkqs e; fyqkqk ,oa fizfavax dk;z lfgr 80 th ,l ,e dsoy ,d rjq nikbz izfr gtkj , size = 10.5x12.5 , size = 8.5x10.5 , size = 11.5x14.5 , size = 12.5x17.5 , size = 14.5x17.5 , dkmz khv e; isij ,oa fizfuvax dk;z] 9 fdyksxkze , size = 22 x28/05 izfr gtkj , size = 22 x28/06 izfr gtkj , lelr izdkj ds jftlvj yky dimk okbzfmx 200 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz` , size = 17 x27/02 , size = 17 x27/04 , lelr izdkj ds jftlvj yky dimk okbzfmx 300 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz , size = 17 x27/02 , size = 17 x27/04 , lelr izdkj ds jftlvj yky dimk okbzfmx 500 isij izfr jftlvj vksfj;uv ogkbzv isij 58 th ,l ,e e; isij ,oa fizfuvx dk;z nksuksa rjq nikbz , size = 17 x27/02 , size = 17 x27/04 , lvhsdj lkbzt 10 lseh x4 9 lseh x 3 1000 lvhdj izfr isdsv ¼dv dsoy 3 uecj ij gksuk pkfg, , , ih ,y mk;jh okmz esa hkrhz ejhtks dks fu% kqyd nok gsrq ¼18x22@6 ,d rjq ldkbz cyw ,oa ,d rjq lqsn isij vksfj;uv isij 58 th ,l ,e dsoy ou lkbm fizuv 200 isij izfr ism e; ljl ckbzfmax ,oa uecjhx lfgra , , ih ,y mk;jh okmz es hkrhz ejhtks dks fu% kqyd nok gsrq ¼18x22@8 ,d rjq ldkbz cyw ,oa ,d rjq lqsn isij vksfj;uv isij 58 th ,l ,e dsoy ou lkbm fizuv 200 isij izfr ism e; ljl ckbzfmax ,oa uecjhx lfgra , bumksj fvfdv lkbzt 10x12x1 60 gsm nih gqbz 1000 isij izfr isdsv , vks ih mh fvfdv vkjksx; vkwu ykbzu lkbzt 8 x 10x2 60gsm dkczu dkwih lfgr ,oa fizuv lfgr 500 issij lsv izfr isdsv , uxn tek jlhn 08x10 x 1, 60gsm dkczu dkih jfgr rfkk fizuv lfgr 1000 isij izfr isfdv , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 2, 300 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 4, 300 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 2, 500 ist izfr jftlvj , ykbzunkj jftlvj e; vksfj;uv isij rfkk yky vwy ckbzfmx e; xrrk] fizuv jfgr lkbzt 17x27 / 4, 500 ist izfr jftlvj , discharge ticket 22 x 28x6, 9kg card sheet one side print per thousand , discharge ticket 22 x 28x6, 9kg card sheet two side print per thousand , discharge ticket 22 x 28x5, 9kg card sheet one side print per thousand , discharge ticket 22 x 28x5, 9kg card sheet two side print per thousand , discharge ticket a4 size, 9kg card sheet one side print per thousand , discharge ticket a4 size, 9kg card sheet two side print per thousand , bar code sticker roll size 50mmx25mm , adt/gate pass sticker – size 10x5 c.m. without print per thousand , fu%kqrd ¼qzh½ dsvsxjh mk;jh 18x22x8 double numbering (100+100) with binding , obstetric ultrasound report with new sonography registration certificate (1:2 ds vuqikr esa] igyk isij 90gsm sunshine paper o vu; nks isij 58gsm) – size 18x22/4 – 30 dk lsv izfr ism ¼dqy 90 isij izfr ism½ , i.p.d. slip – multicolor, 90 gsm, deo paper, size – 18x23/2 (12 inch x 19.5inch) izfr gtkj , lvskujh vkbzve~l dk fooj.k , mkd iqflrdk ¼peon book½ 50 ist , ,q oh lh qkezl~ izfr gtkj , dsk cqd & 200 ist , ,&4 lkbzt tsjksdl ogkbzv isij jhe 70 th ,l ,e 500 isij izfr jhe , ,&4 lkbzt tsjksdl ogkbzv isij jhe 75 th ,l ,e 500 isij izfr jhe , ,&4 lkbzt ;syks isij 70 th ,l ,e 500 isij izfr jhe , yhxy lkbzt isij fje 75 gsm 500 isij izfr jhe@isdsv , gydk cy;w isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , gydk xqykch isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , gydk gjk isij fje ,&4 lkbzt 70 gsm 500 isij izfr jhe@ isdsv , dot matrix printer paper rim 10 x 12x1 60gsm , lvsiyj fiu lekwy izfr isdsv 10 1m steel , lvsiyj fiu chx izfr isdsv 24@6 steel , qkbzy ism dyksfk dksvsm yky@uhyk izfr ux , qkby doj fon~ ysl 100 u mpp xq.koùkk izfr ux , qkbzy vsx 8 bap] thick, 90 degree izfr xzql , qkbzy ysl 24 bap] thick, cotton base izfr xzql , fjfliv jftlvj 100 ist 54 th ,l ,e izfr ux , fmlisp jftlvj 100 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 200 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk & lvwmsuv 200 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 100 ist 54 th ,l ,e izfr ux , miflfkfr iaftdk 50 ist 54 th ,l ,e izfr ux , jftlvj ykbunkj ,&4 lkbzzt 300 ist izfr ux , jftlvj ykbunkj ,&4 lkbzzt 200 ist izfr ux , jftlvj ykbunkj ,&4 lkbzzt 100 ist izfr ux , lfkkbz lvkd jftlvj lkbzt ,&4 100 ist izfr ux , vlfkkbz lvkd jftlvj lkbzt ,&4 100 ist izfr ux , absent statement register , pay posting register with binding & numbering – 100 pages , pay posting register with binding & numbering – 300 pages , notesheet pad green 100 pages 54 gsm , vehicle log book diary 200 pages 18x22x4 orient paper , color notes (stickey notes) – 25mmx75mm multicolour 3 sheet , scale (ss) – 12inch steel , calculator – 12 display digit big size , cello tape big (brown) – 3inch x 50mtr. (40 microns) , cello tape big (transparent) – 3inch x 50mtr. (40microns) , cello tape (small size) – 1inchx60mtr. transparent , whitener/correction fluid vial – 20ml. , whitener pen/correction pen , glue/gum stick – 8gms. , alpin(steel pins) packet (100 gms) , alpin(steel pins) packet (60 gms) , alpin t shape small packet – 50gms. , upin packet – 25gms, steel, plastic coated , pin container – magnet – small , envelop blue – legal size cloth, 90 gsm , envelop brown (a4 size),90gsm , envelop – 11x5 white , envelop – 9x4 white , envelop yellow (a4 size) laminated 90gsm , envelop a 3 size cloth coated , paper weight glass 50gm , paper weight glass 100gm , green pen(cello permanent o.h.p. pen) , red pen(cello permanent o.h.p. pen) , black pen(cello permanent o.h.p. pen) , dak marking pad – plastic coated, red/blue , sutli – 100gms. , box file(index file) , marker black(jumbo size) – 10mm tip refillable , marker blue(jumbo size) – 10mm tip refillable , stapler steel heavy duty – capacity of staple upto 200 pages , stapler (medium size) – in built reloader indicator half strip, pin support – 24/6 , stapler (small size) – iron base plastic cover – pin support 10 1m , stapler big – steel body long – pin capacity 24/6 , stamp pad – small 100mmx70mm blue , stamp pad – small 100mmx70mm red , stamp pad big (160mm x 97mm) blue , stamp pad ink (bottle) – 50 ml. blue , stamp pad ink (bottle) – 50 ml. red , carbon paper packet – rich blue 210mmx330mm 100 sheets per packet , carbon paper packet – black 210mmx330mm 100 sheets per packet , plastic folder – legal size , office paste (xksan) 500ml bottle , highlighter pen – chisel tip 3mm yellow , highlighter pen – chisel tip 3mm orange , scissor small , punch machine medium , punch machine big heavy duty capacity upto 50 pages , punch machine big heavy duty capacity upto 100 pages , punch machine big heavy duty capacity upto 200 pages , poker – wooden handle...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32481878 2_ supply of construction at govt. sr. sec. school bap block bap, district jodhpur. 2_ supply of construction at govt. sr. sec. school bap block bap, district jodhpur. , construction ( assistant mason ) list of non recurring tools & equipment’s : concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30 / min, weight 80 kg, size 80 ( mm ) x 50 ( mm ) , electric drill up to 10mm taparia / gadore / jhalani / pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg, drill spindle connecting thread 3 / 8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm , safety belt unisex adjustable safety belt ( full body harness and lanyards ) with hook options ( scaffolding ) and line attachments, made of high quality polyester, with alloy steel buckles, capacity up to 2000 kg , water tank water tank to store water ( must be with cover ) , trowel iron mason trowel with wooden handle ( 10 to 12 inches long and 6 inches wide ) , plumb rule and bob heavy iron plumb rule and bob with chord ( at least 3 meter ) approx. weight around 1 kg , spirit level taparia 300 mm spirit levellevel accuracy: 1 mm / m width ( mm ) : 50 mm weight ( kg ) : 0.165 kg length ( mm ) : 300 mm height ( mm ) : 20 mm material: aluminium frame and rubber moulding , try square stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pins large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line , brick bolster / brick chisel made of carbon steel with dual hand guard, size 4 x 8, 1 / 2 inch , brick hammer made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammer made of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axe one side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbar iron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel 6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boaster with carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammer large hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in size , scrabbling hammer one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spade spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beaters used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden float flat board with a handle to hold, made of hard wood for durability, size: 12? ( 300mm ) x 5? ( 125mm ) . , metal float smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? ( 300mm ) x 5? ( 125mm ) . , floating rule floating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcher scratcher trowel made of steel 16 x 4 1 / 2 with wood handle , trowel ( khurpi ) made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 meter measuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladder bamboo ladders of 10 / 12 feet , wooden pole ( balli ) wooden poles of 10 & 12 feet for making wooden decks , wooden sieve wooden sieve of large size , tasla galvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrow double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolley air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle standerd , hacking tool satnderd , list of recurring tools & equipment’s : bricks 9 in. x 4 in. x 3 in. each , stone basalt or granite stone, must be hard stone for construction pupose , sand river sand for construction purpose , concrete block 12 inch brick 12x7x5 inches , cement ordinary portland cement of any brand , water pipe 50 meter garden water hose pipe with sprayer and hose connector, material pvc , safety glasses scratch resistant polycarbonate transparent safety glasses, unisex , safety helmet polycarbonate / polymer unisex adjustable helmet with chin strap, size 28 cm x 20 cm x 15 cm , safety vests bright yellow safety construction vests with bright reflectors, made of polyester, unisex, size 11.81 x 10.98 x 6.3 inches ( large ) , safety gloves nylon chemical & cut resistant unisex safety gloves , safety boots steel toe safety shoes, lightweight & durable with good breathability , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., microporous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Central Organisation Railway Electrification - Rajasthan

32378475 supply of copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar]copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar],copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make:taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar...

Department Of Training And Technical Education - Rajasthan

32267828 supply of electrician trade tools and equipments measuring steel tape combination plier insulated 200 rrm ( 40 +2 ) nos. screr.r, driver lnsulated :lmnr x i 5c rnrr. i ) iamond head ( 40 +2 ) nos. 4. screr.vdriver insulated 6mm x 150 rnm ( 40 +2 ) nos. 5. electrician screwdriver thin stem insu lated hand le zlmm x 100 mm ( 10 +2 ) nos. 6. heavv duty screwdriver insu iated 5nrnr x 200 rnm ( 40 +2 ) nos7. h lectrician screwdriver thin stem insu lated hand le 4mnr x 250 rrnr ( 40 +2 ) nos8. punch flentre 9mrr x 150 mnr ( 40 +2 ) nos. 9. knife double bladed electrician i00 mm ( 40 +2 ) nos. 10. neon tester 500 v ( 40 +2 ) nos. lt steel rule graduated both in metric and english lrnit 300 innr u, ith precision of ii4ii, mm ( 40 +2 ) nos. t2. hammer, cross peen with handle 250 glams ( 40 +2 ) nos. b. shop tools & equipment fot 2 1+1 ) units no additional items are required li ) list of tools & accessories 13. hammer. ball peen with handle 500 granrs .i n os. 14. pincer 50 rrrr 4 nos. 15. c clamp 200 nrm and l0 ( ) rnrr 2 nos. each 16. spanner adjustable drop forged, ss 50 mrr & ioomnr 2 nos. each , l ) ] , .., ...; 11, , , , , r blou larnp brass ( lhisel cold 25 nrnr x 100 nlnl chisel tirmer r, ith wooden handle 6 mm x 200 ntnr allen key alloy steel l. 5 l0 mm ( setof 9 ) 0.5 ltr. capacity pull ) puller with 3 legs i 150 nrm & 300nrnr bearing puller linside and otttsjde t scissors blade. ss 150 rrnt 1.5 sq nrtr to 16 sq trtn crinrping lool 16 jq rrlrll to 95 sq rnm wire cutter and stripper iiil rn mallet hard wood 0.ril lill halnmer extractor type 250 grarns hacksaw tranre radjustable l00nrrr fixed 150 2 nos. each try square ll50 nrrl blade outside calliper ., il ] nt .p, inr.t t pd inside calliper i: r sorirts tr oe l 5l rrn spring i pe plicrs long nose insulated 15i rnrn 1 nos. pliers 4 n os llat nose insulated pliers round nose insulated l0ll nm treezers l5c mrn i 4 nos. snip straight and bent heavldut5 250 nirt d.e. metric spanner double ended 6 12 nrrn drill hand brace 0 l00rnm 1 nos. drill s.s. lwist block 2 nrm.5 ntnr and 6 rnrn set of 3 50 nm x 200mm 50 nrnr x 20 { ) mbl gauge. wire imperial stainlees steel wire ( ) atrgl metric maked in swg & mnr l0l ) rrnr lnd cut uilh handle { l nos. file half round l0l rrn lnd cut rvith handle i 4 nos. file round 20ll rn1 llnd cut r, ith handle file llat rough i : ( l lrn . iih handle .1 os. lil ir, irl u ith hrndle file flat smooth l: ir , rlx ith lirndlc file rasp, half round 20il !r1nr bastard rvith handle coppet bit soldering iron. 0.15 kg i leat ;rlor:rl nrrzzle. pvc type. 25itlrrrr 4 nos. de soldering gun plane cutters smoothing cutter file flat , file flat bastard grease gun bradawl pipe vice cast iron with hardened jaw open scissor blade 57. hand vice 50 mm jav, , l nos. 58. table vice 100 mm.jau, t lros. 59. oil can 250 ml i l, jos. 60 contactor & auxiliary contacts 3 phase. 415 vola. 25 amp u.ith 2 nos. each 2noandlnc 6t contactor & auxiliary contacts. 3 phasc. 4 1 5 volt. 32 anrp u, ith 2 l. os. each 2noand2nc 62. limit switch limit switch. l iver opetated 24 i nos. 500v 2 contacts 61, rotary switch 16 r i.140 i nos. 64. relay a. cut out relays b. reverse current c. over current d. [ jnder voltase a. 164. 1.10 i l.jo. each b. r6, 4. 440v c. 16a.4 10v d.360v 440v 65. pin type. shackle type, egg l, pe & suspension type insulators incjuding hardware fittin { r i nos. each 66. llydrometer i nl, s. 61. hand drill machine 0 6 rrrrrr c.rpel it1 i os. 68. portable electric drill machine 0 i2 mrr capacit ) 750rv.2, 10v i no. with chuck and ker 69. load bank ( larnp / heater t pe ) 6 k , . iph r no. 70. brake test arrangement with tu, o sorine balance ratinp 0 ro s ko i , .r. 71 laboratory t ) pe induction coil 1000 w i nos. 72. orrf side micrometer 0 25 nrm least counl 0.01mm 2 nos. 13. thermorneter digital 0c 150 c i no. 14. series test lamp 230v.60w , 1nos. 75. knife switch dpdt fitted with fuse terminals l6 arrp rtr nos. 16 knife switch tpdt fitted with fuse terminals l6 amp / 440 v 4 nos. 77. miniature breaker 16 amp i nos. eadh plate 60cm x 60cm x 3. i5mm copper plate 60cm x 60cru x 6mm gi plate leach 79. earth electrode primary electrode 2 i 00x28x3.25mm secondaq, cu strid 20x5mrn i no. 80. mccb l00a, nps. triple pole i no. 8r. fi.cb and rccb 25arrrps. double pole and 2 5r mps. double pole ian i0 ma i each fuses hrc glass re*ire t1 pe .1 f.ach 83. rheostat ( sliding type ) 0 0 25 ohm. 2 amp 300 ohm. 2 amp i ohm. 10amp l0 ohrn. 5 arnd 0 0 i no. each 84. capacitors various electronic component various lamps rubber mat plug socket piano switch lanrp holder llr v. i a cab les: twisted paii non metal lic sheathed cable underground feeder cable ribbon cable metallic sheathed cable multiconductor cable coaxial cable bus bar rvith brackets irrir cacl l 2x4x l electrician helmet yellorv colour rcc pole with accessories ( ms angle iron.cclamp, stal insulaior etc.t o ill and material. safety belt stanclald qualitl l 2 nos. list of eouidment ohm meter; series type & shunt 5012000 ohrn analog 2 nos. each tvne ooftable box digital multi meter a.c. voltmeter m.l. analog. poftable box type housed in bakelite case illlrlti range 75 v i50v rrl0 600v milli voltmeter centre zero analog. poftable box type housed in bakelite case i00 0 100 mv arrmeter mc analog. pofiable 0 i0 ( ) ria. 0 5 a. 0 25 a box type housed in bakelite case 2l os. each ac ammeter ml. analog. 0 i a. 0 5 a 0 25 a 2 nos. each porrable bor type housed in bakelite case kilo wattmeter analog name of the tools and specification 0 1.5 ikw. pressure coil raring 1.101 r i.10v, current iat ing lia / i 0aanaloge. porrabie t1, pe housecl in llaiiclite case 2 nos. i i digital wattmeter a.c. energy meter a c e*.gy m.t* poner factor meter digital f =, f*r. ) , m.t.t isingte phase. j 0 .l.. 240v l4lilll , vp. .fhrce phase. i 5a ..!40v llqry4ry!. i440v.20a, three pnase portu h le bo tlpe 145 to 5i i l:z f nos. l , ) s. 102. r03. 104. i05. 106. lvagrtetic flur metcr 0 j, , u rc., la : , . __ i u rneler lu.r. n, e ter i ( lj read ( lrrt 0.0 ; _ , rs. , lo 700 ( r lurncns ill . i attcr_v. ] t, ffiejoc ceroooorpm ._ln;__ i t0 { ) c0 rlm tongtester / ctu.pmffi 2 ns : ryanjos 5oov l , i, * 3 point d.c. starter f or 2.5 kw dc r;otoi :. t07. 108. i l 109. i t0. l i 12. i i3. j po int d.c. starrer for 2.5 k l, dc motor j no. i i 4. ] whrt stone bridge r.r ith i galvanotneter and batterv i nos. i 15. single phase variable auto franst ormer cooled ) i 16. phase sequence indicator i phase..ll5 v i nos. 117 . crowler ac starters: a. resistance type slarter b. direct online starter c. star delta starter manual d. star delta stafter semi automatic e. star delta starter fully automatic f. star delta starter soti stafter g. auto transformer type tachometer 9. oscilloscope dual trace 20 mhz i no. 120. function generator 2 to 200 kilz. sine, square triangular 220 v 50 llz. single phase !no. 121 soldering lron temperature controlled soldering l50 , i an. li.l voir discrete component trainer discrete component ( for diode and trarrsislol circuill rr ith 2 itos. regulated pou er !:upplv +5, 5 v.+12.9 12 y linear l.c. lrainer [ . ireal lc. trainer u, ith reglilated pou er slrppll, i .2v i to i5v t } lc socket i6pin and 20 pins with bread boaril ] digital l.c. trainer digital i.c. trainer 7 se, :rren1 d isp lav , and bread board domestic appliances a. 1500 wa11. 2.10v i no. each b. e lectric kerlle b. i 500 ?ttr 2 10 / c. e iectric lron c. automatic 750 . 240 d. immersion heater , d l50f u, a1i. l 10v 126. ie. a.c. ceiling fan and ac c. f, e , .rrr ii0 v table fan 1 . geyser ( storage type ) t. l0 iitrc i g. mixture & grinder h. washing machine serniautomatic i. motor pump set oiltesting kit electric induction plate inverter with battery i kya wirh l2 v barterv lnplrt l2 r, olt dc. outputi no. voltage stabilizer 1ntr vi ac output 110v.i0a dc power supply 0 , 30 v 5 a 12 nos. battery charger i0 potential transformer 4 current transformer i solar panel w ith battery pentium iv computer or latest . ink jet/ laser printer c, shop machinery d.c. shunt generator with control pane motor generator ( ac to dc) d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motor d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motordc compound motor u,ith !itarter and sw itch l. j l. :r .::/.) i,l1s i ll 143. motor cenerator(dc to ac) set lshnnt motor rating: 5 hp. consisting of shunt motor with 440v ac generator rating : starling cornpen5ator and su itch j phase. .1 rvi::. :. j kva. directll coupled lo ac generalor 4lr(, ll0 volls. 0.8 pl. with exciter and switch board 50rr ,: i:s mounted with regulator, breaker. ammeter, voltmeter fieq uency meter. knile hlade su itch arrd lure. e1g. set cotnplete r.l ith ca:t irorr bed plate. lixing holts. [oundat ion bolt. arrd llexible coupling. lno. 144. ac squirel cage motor with 5 iip.3 i)hase.4l5v.50 hz star delta starter and triple pole ir,rn clad u itch lirc u ith mrchanical lord. i no. t45. ac phase wound slip ring motor 5 ilp440 v.i phase.s0 hz urith stafier su itch i no. 146. universal motor with 2+,.1 v. 50 t{2. 1 iip i no. stafter/s,,,itch 147 . synchronous motor with 3 l)hase. 3 iip. 4rt[)v. 50h2. ] i no. accessories like starter. ercitation ,1 poie aflangemen t.. 148. thyristor /lgbtcontrolled d.c motor drive with tachogenelator feedback arrangement i ii) lno. 149. thyristor/igbt controlled a.c. vryf uor,!r()l .l ?nase. i i o. motor drive with llp r 50. single phase llansfonrer. corc i kva.240141 5 v. 50 hz 3 nos. t1,pe. ail cooled l5t three phase transformer. shell t1pe oil cooled with delta/ star 3 ri va.,ll 5/2,10 v. 50 hz 2 r os. 152. electrical machine trainer diesel cenerator set with changeover switch. over current hreaker and uater/ air cooled with armature. star deita connections ac 3 phase 7.5 i{va. .i: 5 rar;tg v t,, l ,, hi 1,.,, r. ,. ,. insi tirie 154. ljsed dc generators seriesshunt and compound type lor overhau ling practice i i o ilach 155. pillar e lectric drill machine motorized i 2 ll) rnrr (.:rp:ic rt. i i i ;. r 1l:. 44() ,. 1 phae. irrdrrr l;o h4rtor with d(ll starter. bencir tvde 156. motorised bench grinder i hp. 3 phase. 440v with . o doi starter. ifo,,rhie sidc xi.h sn]oot;i and iougir ni;ee i ,vi1ir iool ilase 157 . a.c. selies type motor i tit 140 .50 ilz , nir i 58. single phase capacitor motor with starter switch i hi.2,10 i0 117 159. manual motor coil winding machine with srep arbor no. 160. ceiling tan coil winding machine 250v. i0 i{7:. i q.,. ith spced contr0i o i l6l primary current injection set 220i. i0 l1z. i t!. olrtpirl current 20(r a (nriri) t ir[r iinr er | 62. stepper moror with digital controller ino. t6t. shaded poie motor fractional t ip.2,l0t/.50 llz ,o. d.shonfloorfurnitureandmaterials for2(l+lliilit::trr,;dditrinli .tctns are required 164. working bench l,5.rx 1.21) * x11.75 :rl , :rs. t65. wiring board : n]etcr i :;,elcir^ith0.j llio. incter projectr,rii (,rr lh. top t 66. lnstn rctors table lo. 167. instnrctors chair .. ,)s. 168. metal rack l00cm x i 50crr x..l ictn 169. [ ockers with dralvers 2.5 nr r 1.20 rn r 0. 5 rn { lc dra,r,er*10 tirauer) i lil f.acir l iainee 170. almirah 2. i rn r 1.2[t m x 0.5 nr ] ,lr o. 171 black board/white board lrninirnurn 46 lect, , t fo. 112. fire extinguisher co2 ,./ k( i i n rs. t7 3. fire bucket slselof six) etc ...

Rajasthan High Court - Rajasthan

32159938 tender for rate contract for the supply of office stationery items at rajasthan high court jodhpur tender for rate contract for the supply of office stationery items at rajasthan high court jodhpur , office stationery items , globe brand “t” all pin pkt. ( 70 gram. ) , u pinclips coated globe ( @100 pc pkt ) , all pin cusionpremier / vekon / polo , wooden handle ice peaker national ( superior quality ) , address sticker desmat ( 1, 10, 12 & 16a4 size ) ( 100 sheet per packet ) , cello tape big 2 wonder 65mtr length , cello tape small ½ wonder 65mtr , brown tape 2 wonder 65mtr. , pen pot ( as per office sample ) , eraser apsara / fabar castle , sharpner apsara / fabar castle , highlighter 5 pen set ( faber castle / camlin ) , whitener pen ( 7ml ) camlin / other , marker pen ( camlin / other ) , cd marker pen luxer / camlin / other , sketch pen luxar ( sign pen ) , add gel pen achiver , uniball eye pen ( fine ) ub157 , uniball gel impact pen ( in all available color ) , pilot v5 hi tecpoint pen , pilot v7 hi tecpoint pen ( refillable ) , classmaate ( insta glide / oct gel ) pen , reynold trimex pen , reynolds 045 fine carbure pen , butter flow ball pen , reynolds liquiflo pen , refill add gel achiver pen , refill gel ( classmate ) , refill jotter pen , cartridge / refill pilot v7 / v5 hi tecpoint pen ( 02 pc. per pkt ) , permanent marker ink bottle 15 ml camel ( as per sample ) , apsara black beauty pencil hb , red pencil packet ( apsara / other ) , three colour desmat past it flag 3x1x3x80 , yellow colour desmat flag 3x1x60 ( as per office sample ) , plastic flag 5 colour , stamp pad medium ashoka ( as per sample ) , stamp pad bigashoka ( as per sample ) , stamp pad ink 30 mlashoka , paper cutter medium ( natraj ) , paper cutterbig size ( natraj ) , lesses packetno. 924 ( as per office sample ) , water dumper small ( as per office sample ) , water dumper big ( as per office sample ) , rubber band small , rubber band big , file pad legal size ( as per office sample ) , file flaps 5” red color ( as per office sample ) , kores clear gum stick transparent ( 15gm ) 5 yrs non drying guarantee , scale steel 12 , scale plastic 12 , box of binder clip black kent no. 8032s 32mm , plastic lock ( 10 inch nylon zip cable ties organiser ) ( as per office sample ) , lahi , pocket diary luxer / other , short hand note book neel gagan ( 200 page ) , conference pad lodha brand ( 15 leaves ) , conference pad plane ( without line as per office sample ) , slip book no.22 desmat / neelgagan / other ( as per office sample ) , slip book desmatno.33 desmat / neelgagan / other ( as per office sample ) , lodha slip pad no. 1 a4 size slip pad , stapler small hd10d. kangroo ( blue packing ) , stapler big hp 45 kangroo ( blue packing ) , kangaro hd 23s13 heavy duty stapler , stapler pin small no.10 kangroo ( blue packing ) , stapler pin big 24 / 6 kangroo ( blue packing ) , stapler pinno. 23 / 20 kangroo , stapler pinno. 23 / 24 kangroo , stapler pinno. 23 / 15 kangroo , stapler pinno. 23 / 10 kangroo , stapler pinno. 23 / 17 kangroo , stapler pinno. 23 / 13 kangroo , punching machine kangroo dp 280 ( blue packing ) , punching machine big kangroo dp500 ( blue packing ) , secissor big 210mm ( kangroo munix sl 1183 ) , secissor medium 152mm ( kangroo munix sl 1160 ) , secissor small 128mm ( kangroo munix sl 1150 ) , calculator casio / citizen medium , calculator casio / citizen big , 32 gb pen drive usb 3.0 steel body , 64 gb pen drive usb 3.0 steel body , 128 gb pen drive usb 3.0 steel body , plastic l folder with pocket f / ssize ( as per office sample ) , cause listplastic folder f / ssize ( as per office sample ) , plastic f / s size spring file ankita ( as per sample ) , plastic f / s size clip file ankita ( as per sample ) , index / box f / s file shubham brand ( as per sample ) , legal size springflat file ( gatta ) ( as per office sample ) , self inking ruber seal , ruber seal wooden base per line upto 2.5 ( for office ) , coloured sheets 90 gsm ( yellow / pink / etc. ) , envelops cloths 10x12 ( as per sample available in store section ) , envelops cloths 16x12 ( as per sample ) , craft enevelope ( brown ) 16x12 100 gsm with printing star quality , craft enevelope ( brown ) 9x4 100 gsm with printing star quality , craft enevelope ( brown ) 11x5 100 gsm with printing star quality , craft envelope size ( 12*18 ) a grade, 100 gsm with printing , envelops white 9*4 100 gsm ( as per sample ) , envelops white 11*5100 gsm ( as per sample ) , yellow envelope big size ( 18*12 ) cloth coated , yellow envelop size ( 16x12 ) laminated ( as per office sample ) , plastic envelop ( tearless ) 16x12 size ( as per office sample ) , plastic envelop ( tearless ) a4 size ( as per office sample ) , register 96 page with cover page printing ( 70 gsm page ) ( as per office sample ) , register 192 page with cover page printing ( 70 gsm page ) ( as per office sample ) , register 288page with cover page printing ( 70 gsm page ) ( as per office sample ) horizontal line , handmade paper made administrative file cover set with printing & cloth striping on edge ( quality, colour & printing must be as per office sample ) , handmade paper made judicial file cover set with printing and lamination required in red, green, yellow color ( quality, colour & printing must be as per office sample ) , plastic dori ( in kg ) , plastic bora / katta ( size 40*40 ) ( as per sample ) , lock small 40 mm 5 lever ( harison / other ) , lock medium50 mm 6 lever ( harison / other ) , lock big 65 mm 8 lever ( harison / other ) , basic telephone plane ( beetel c 11 ) , telephone caller id ( beetel c 51 ) , telephone ( 01+01 ) ( beetel m 78 ) , wall clock ( ajanta 397 / equivalent standard ) , wall clock ( ajanta 5077 / equivalent standard ) , remote bell electric ( cona original genuine, product code no. 2866, range up to 50 meters, 32 assorted tunes, product code no. 2866, dimension 165x85x178 ( mm ) , remote bell cordless ( cona silver 3221 ) , power extension cord of 4 plug having 10 ft. 1mm wire bottom covered wooden hand made board ( by use vinay / anchor / or any branded 3 pin top socket with individual swtich ) , power extension cordwith spike control for use of computer systems with minimum 5 mtr. cable ( as per sample ) , canvas bag big with zip ( 15x12x16= h*w*l in inch ) ( as per office sample ) , canvas bag small with zip ( 9x12x16= h*w*l in inch ) ( as per office sample ) , water camper 5 ltr. ( milton / cello ) , water camper 10 ltr. ( milton / cello ) ...

Rajasthan Council Of Secondary Education - Rajasthan

32083145 bids are invited for agriculturelab ( q3 ) total quantity : 1 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools handle made of plastic and head made of stainless steel 5 4 garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 11 knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body 2 12 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle / s lightly curved blade. 5 17 secateurs made of stainless steel, 0 steel cutting blade 5 18 specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 2 20 sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity 1 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height 5 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre ) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) 2 45 lactometer made of glass 2 46 teat siphon fine finish , teat plug with syphon 2 47 charts / picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts / picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts / picture s related to milking methods 3*2 pictures binded with wood border 2 50 charts / picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts / picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts / picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts / picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts / picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts / pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts / picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box with all necessary first aid material 1 bio fertilizer made of green vegetables and crop residue 2 2 farmyard manure made of animal dung or crop residue 2 3 fertilizer urea, dap, pottash etc. 2 4 gunny bags made of jute 5 5 sanitizers suitable for hand wash 2 raw material list ( recurring items list ) 6 seeds of various agriculture crops ( as per curriculum ) healthy and good quality of seeds of various crops 10 7 fertilizers samples samples of different type of fertilizer packed in plastic jars 10 8 duster used to clean 5 9 ropes jute rope of 100 meter 2 10 tape measuring of land area 100 mtr standard tape 2 11 sprayers having capacity of 1 litre 5 12 sprayers fitted on every bottle made of plastic...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040953 supply of equipments, articles and chemicals for dept. of pharmacy list of articles/equipments (consumable) 1 dropping bottles 5 2 dropper 100 3 sieves (stainless steel, size 10,20,40,60 meshes) 03 each 4 chopping board 05 5 chopping knife 05 6 burettes 10 7 pipette 10 8 graduated dropping pipette 05 9 graduated conical testing flask 05 10 beakers (50 ml to 1000 ml) 25 11 stand with ring clamp 05 12 distillation apparatus with liebig chamber 02 13 graduated flask round bottom (different size) 10 14 spirit lamp 20 15 weighing box (chemical) 10 16 tripod stand with wire gauge 15 17 temperature thermometer 10 18 leather pad for succussion 05 19 test tube holder 25 20 test tube 200 21 retort with stopper 05 22 desiccator with silica plate 05 23 amber glass bottles (50 & 100 ml) with cork and cap 100 24 pycnometer (specific gravity bottle) 02 25 litmus paper 10 packs 26 filter paper 10 packs list of articles/equipments (other) 27 spatula (stainless steel) 30 28 spatula (wooden handle) 10 29 stop watch (racer) 15 30 botanical slides (medicinal plants slides) a) diatoms (w.m.) b) spirogyra (w.m.) c) stem tip d) aspergillus e) valvox (w.m.) f) rhizhopus sporangium g) penicillium (w.m.) h) yeast (w. m.) i) lichen rons j) mushroom k) spirogyra conju. 01 each 31 hot plate 01 32 laboratory press 02 animal specimens 33 spider (karoliyo) 1 6 25 sign & seal of firms 34 flea (fly) 1 35 snail (gokal gay) 1 36 cockroch 1 37 ant (kidi) 1 38 honey bee (madh makhi) 1 plant specimens 39 alum (fatakadi) 1 40 naphthelin (damar goli) 1 41 red phosphorus (match sticks) 1 42 boric acid 1 43 camphor(kapur) 1 44 salt 1 45 iron 1 46 aluminium 1 47 pencil lead 1 48 copper sulphate powder 1 49 calcium carbaid powder 1 50 hydrocloride acid 1 51 silver nitraite 1 52 barium cloride 1 53 lithium 1 54 glycerin 1 55 formalin 1 56 vinegar 1 57 lemon juice 1 58 copper 1 59 backing soda 1 60 sand 1 61 egg shell 1 62 sea shell 1 63 bryophyllum (elcho) 1 64 male fern (rhizome) 1 65 river fish 1 66 sea salt 1 67 magnet 1 68 x ray 1 69 amoxycillin 1 70 b.c.g. vaccine 1 71 aspirin 1 72 radium 1 73 diazepam 1 74 deriphylin 1 75 gentamysin 1 76 salbutamol 1 77 crab 1 78 dye indigo 1 79 crude rock oil 1 80 sponge 1 81 bili patra 1 82 galo (giloy) 1 83 jelly fish 1 84 animal charcoal 1 7 25 sign & seal of firms list of chemicals 85 hydrochloric acid (hcl) 500 ml. 86 nitric acid (hno3) 500 ml. 87 solu. of potassium bicarbonate 500 ml. 88 concentrated h2so4 500 ml. 89 iodine solution 500 ml. 90 distil water 5 litres 91 naoh solution 500 ml. 92 potassium ferrocyanide 500 ml. 93 agno3 500 ml. 94 cuso4 powder 500 gm. 95 agno3 solution 500 ml. 96 dilute hn03 500 ml. 97 ammonium oxalate solution 500 ml. 98 dilute acetic acid 500 ml. 99 barium chloride solution 500 ml. 100 dilute hcl 500 ml. 101 ammonium chloride solution (nessler’s reagent alkaline k2hgi4) 500 ml. 102 alcohol 1000 ml 103 anhydrous cuso4 500 gm 104 calcium carbide cac2 500 gm 105 salicylic acid/ sodium salicylate 500 ml. 106 potassium hydrogen sulphate (khno3) 500 ml. 107 potassium cupric tartrate 500 gm. 108 mercuric sulphate solution 500 ml. 109 solution of lime 500 ml. 110 chcl3 chloroform 500 ml. 111 phynophathaline solution 500 ml. 112 hydrogen sulphied h2s 500 ml. 113 potassium permagnate solution 500 ml. 114 potassium mercuric iodide 500 ml. 115 k2co3 potassium carbonate 500 ml. 116 calcium hydroxide 500 ml. 117 cupric hydroxyide 500 ml. 118 borax solution 500 ml. 119 carban dissulphide 500 gm. 120 sugar of milk 5 kg. 121 cane sugar 1 kg. 122 globules(size 10, 20, 30, 40, 50, 60) 1 kg each 123 tablets 500 gm 124 oils (almond, sandalwood, olive, sesame, lavender, rosemary, chaulmoogra) 500 ml each 125 paraffin (vaseline) 500gm 126 yellow bee wax 500 gm 127 starch (semisolid) 500 gm 128 sulphur powder ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040940 supply and installation of lab furnitures 1 lab table with shelves for pharmacy dept. size: as per drawing · gate – wooden, handle with lock. · outer boarder with polish · inside – white color (oil paint) · granite stone top with molding water proof ply 19mm 01 2 lab table with shelves for anatomy dept. size: as per drawing · gate – wooden, handle with lock. · outer boarder with polish · inside – white color (oil paint) · granite stone top with molding water proof ply 19mm 01 3 lab table with shelves for biochemistry dept ...

North Western Railway - Rajasthan

31788707 supply of copper hammer with wooden handlecopper hammer with wooden handle,copper hammer with wooden handle 2 kg as per sketch no. re/umb/elect/ohe/sk/32 make: taparia, hitronics, power equipments, modern engg, international motors,hmh/ie/sdu/sst or similar....

Indian Army - Rajasthan

31732534 bids are invited for ball pen blue , ball pen black , drinking glass borosil , duster cloth , fevicol tube , file cover , glue stick , binder clips , binder clips big size , broom coconut , broom soft as per sample , glass cleaner , complaint cell register big size , complaint cell register small size , calculator , highliter pen , color sketch pen , page marker stick flag , paper cutter , paper u clip , parcel cloth , pencil cell , permannent marker pen , pilot pen blue , pilot pen green , pilot pen red , register six coir , pencil cell aaa , scale plastic , poker with wooden handle , register three coir , stamp pad , staplermachine pin ten nos , stapler machine , pilot pen vfive blue, store ledger register , harpic toilet cleaner , lizol roomcleaner , dettol liquid handwash , register two coir ,register four coir , stamp pad ink colour blue , staplermachine pin , correcting fluid , tap brown , ultra paste ,eraser , sharpner , tape transparent , envelope , cartridgefor color printer , dustbin , pencil , sutli plastic , tag , clipboard total quantity : 9347...

Indian Army - Rajasthan

31525634 bids are invited for seat frame for chair steel of best quality as per sample , back frame for chair steel of best quality as per sample , wooden handle for chair steel of best quality total quantity : 1597...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

31454386 supply of sanitary , hardware equipment material cleaning items 1 558 chromium plated brass mortice latch and lock 100x65 mm with6_levers_and_a_pair_of_brass_lever_handles 2 592 chromium plated brass curtain rod 25 mm dia 1.25mm thick 3 701 anodised aluminium tower bolt ( barrel type ) 150x10 mm 4 702 anodised aluminium tower bolt ( barrel type ) 1oox1o mm 1309 cj.!bracket for wash basin and sinks 6 1392 miiror of superior make glass 60x45 cm 7 1545 g.i. pipes 15 mm dia ( b class ) 8 1546 g.i. pipes 20 mm dia ( b class ) g.i. pipes 2s mm dia ( b class ) g.i. pipes 32 mm dia ( b class ) g.i. pipes 40 mm dian ( b class ) g.i. pipes 5o mm dia ( b class ) 9 1547 10 1548 11 1549 12 1550 13 1608 g.i. tees ( equal ) 25 mm . 14 1641 1641 g.i. union 15 mm nominal bore . 15 1642 1642 g.i. union 20 mm nominal bore 16 1643 1643 g.i. union 25 mm nominal bore . 17 1644 1644 g.i. union 32 mm nominal bore 1645 g.i. union 40 mm nominal bore 1646 g.i. union 5o mm nominal bore c.p.brass toilet paper holder of standard size c.p. brass waste coupling 40 mm 18 1645 19 20 1646 1889 21 1952 22 1953 vitreous china indian type w.c. pan size 580 mm 23 1965 white vitreous china dual purpose closet ( anglo indian w.c. ) suitable for use as sequatting pan or european type water closet as per manufacturers specifications solvent 24 2914 25 7004 vitreous china flat back wash basin 450x300 mm 26 7107 coloured ( other than black ) solid p.v.c. seat in european w.c. pan 27 7119 flexible ( coil shaped ) pvc waste pipe for sink and wash basin 32 mm dia with length not less than 700 mm i / c pvc waste fittings c.p. brass long nose bibcock 15 mm ....._ cjp. brass long body bibcock 15 mm 28 7258 29 7259 30 7261 c.p. brass angle valve 15 mm 31 7358 flushing cistern p.v.c. 10 its capacity ( .low level ) ( white ) ( with rittings, accessories and flush pipe ) 32 7379 white vitreous china clay half stall urinal flat back 580x380x350 mm or angle back 450x375x350 mm with waste fittings as per is: 2556 33 7508 ptmt urinal spreader 15mm 34 7863 15 mm nominal bore and 45 cm length pvc connection pipe with — p.t.m.t. nuts 35 8637 chlorinated polyvinyl? chloride ( cpvc ) pipe 20 mm outer dia. 36 8638 chlorinated polyvinyl? ehloride ( cpvc ) pipe 25 mm outer dia. — 37 9023 5 mm thick float glass isi make 38 provideing of bevelled edge mirror / mirror with teak wood tipping around of special glass of approved make as per direction of engineer in charge complete with 6mm thick commercial ply base fixed to wooden screws & washers. s 1 .44.1 size 600 x 450mm x 4 mm thick 39 h / 1.5.1 spade weighing 1.5 kg. with handle. 40 h / 1.5.7 pick .axe. spendal brasss cp tube cistern valve set ballset handle , sifonse pvc visor , cp grill mesh trape pvc cp nipple valve brass , paper roll , valve plug , pillar cock , jet set spray , cp brass soap dish tray , towel rig brass revolving , two way bib cock , elbow , t gi urinal , socket , elbow , nipple , elbow gi socket gi elbow gi , pvc pipe , socket band , pvc pipe , trape upvc nipple gi nipple 46 stain less steel floor door stopper ( 75mm ) 47 hydraulic heavy door closer m.s. body with necessary _ accessories and.screws.complete 48 steel bolts 2.5” long 5mm thick 49 iron bolts & with nuts 150mm x 6mm 5o brass door handle 150mm __...... 51 stain less steel door handle 150mm 52 8 inch stain less steel door latch a1t’r 53 10 inch stain less steel door latch anmr 54 aluminium window handle 100 mm 55 plier 56 steel door bolt 6” size long wooden door ricr stu 57 steel door bolt 12” size long wooden door tfcetn 58 wooden board 8’ x 4 size x 3 / 4 inch thickness 59 khurpi with wooden handle 60 parat pvc 450 mm size 61 datali with wooden handle 62 wooden flush door ( water proof ) , 84 x 30” ( 1.25 thickness ) 63 dantli measurement tap , m seal , room freshner , duster for cleaning floor table , colin , odonil , urine cube , naphathiilion cube goli , nirma surf phenyl , acid , etc harpik t oile brsuh leaner lyzol , pvc tape almirah lock , tape lon , cpvc elbow union socket tee cpvc solvent , gi nozzle urinal brass complete set , urinal tank mbt bras fbt brass socket inch tap iron lock , wiper , foil broom , liquid soap , gi elbow pvc band tee hand jet cpvc valve uinon , mabt brass cpvc socket union socket elbow cpvc mabt brass show , socket pvc tee socket bend pipe , gi pipe flanch cpvc tee hand cap cpvc valve brass , valve nut bolt flanch boring pipe rubber sheet seat gi flange boring pipe etc...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

31439738 agriculter vocational tender in barmer dist agriculter vocational tender in barmer dist , auger : for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1/2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake,spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle/s lightly curved blade. , secateurs made of stainless steel,0 steel cutting blade , specialty spades suitable for garden ,made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1/2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large (plastic/ gl sheet) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc (automatic temperature compensation) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm,bucket 20 litre,orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine,leg rings, colar,branding (hot and cold) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest (available in local market) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffelowsmall models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 (230mm) , lactometer made of glass , teat siphon fine finish ,teat plug with syphon , charts/picture s related to health hazards 3*2pictures binded with wood border , charts/picture s related to milk machine 3*2pictures binded with wood border , charts/picture s related to milking methods 3*2pictures binded with wood border , charts/picture s related to clean milk production 3*2pictures binded with wood border , charts/picture s related to dairy records 3*2pictures binded with wood border , charts/picture s related to tincture iodine 3*2pictures binded with wood border , charts/picture s related to safety measure 3*2pictures binded with wood border , charts/picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts/ pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts/picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, (snf, fat , water test etc.) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl/gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight (lb.)= 1.62, product width (in): 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment (ppe) include gloves, foot and eye protection, protective hearing devices (earplugs, muffs) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

31439735 construction vocational lab tender in barmer dist construction vocational lab tender in barmer dist , concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30/min, weight 80 kg, size 80 (mm) x 50 (mm) , electric drill up to 10mm taparia /gadore/jhalani/pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg,drill spindle connecting thread 3/8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm , safety beltunisex adjustable safety belt (full body harness and lanyards) with hook options (scaffolding) and line attachments, made of high quality polyester, with alloy steel buckles, capacity up to 2000 kg , water tankwater tank to store water(must be with cover) as per need , troweliron mason trowel with wooden handle(10 to 12 inches long and 6 inches wide) , plumb rule and bobheavy iron plumb rule and bob with chord (at least 3 meter ) approx. weight around 1 kg , spirit leveltaparia 300 mm spirit level level accuracy: 1 mm/m width (mm): 50 mm weight (kg): 0.165 kg length (mm): 300 mm height (mm): 20 mm material: aluminium frame and rubber moulding , try squarestailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pinslarge headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line , brick bolster / brick chiselmade of carbon steel with dual hand guard, size 4 x 8, 1/2 inch , brick hammermade of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammermade of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axeone side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbariron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boasterwith carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammerlarge hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in , scrabbling hammerone side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spadespade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beatersused for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden floatflat board with a handle to hold, made of hard wood for durability, size: 12? (300mm) x 5? (125mm). , metal floatsmooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? (300mm) x 5? (125mm). , floating rulefloating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcherscratcher trowel made of steel 16 x 4 1/2 with wood handle , trowel (khurpi)made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 metermeasuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladderbamboo ladders of 10 / 12 feet , wooden pole (balli)wooden poles of 10 & 12 feet for making wooden decks(12 dozzen in different size) , wooden sievewooden sieve of large size , taslagalvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrowdouble wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolleyair wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle , hacking tool...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

31377118 supply of agriculture equipment vo. general items 1 auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece. working area 3x2x2 size of hepa 3x2x6 2 2 dutch hand hoe short handle , wide blade 2 3 garden hand tools handle made of plastic and head made of stainless steel 5 4 garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood 5 5 garden knife extra sharp, made of stainless steel 5 6 garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. 2 7 garden fork long handle made of wood, tynes made of stainless steel 2 8 garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm 5 9 hand sieves made of stainless steel of standard size 5 10 hoe long handle made of wood , short sharp blade made of stainless steel 5 11 knapsack sprayer spray pump for insecticides 1/2 ltr capacity standard spray pump with plastic body 2 12 leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake,spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use 5 13 levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood 2 14 pruning saw handel made of plastic or wood folding or fixed, 2 15 pruners length of 200mm steel hndle pvc grip 2 16 pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm. knife stainless steel with wood handle/s lightly curved blade. 5 17 secateurs made of stainless steel,0 steel cutting blade 5 18 specialty spades suitable for garden ,made of stainless steel, 3.5 ft long handel made of wood 3 19 soil scoop pointed tip, unique shape , solid birch handele made of stainless steel 2 20 sprinklers medium size garden sprinklers fitted with water pipe 1/2 inch with 100 ft long pvc pipe 2 21 trowels elongated triangular shaped blade 3 22 watering can small and large (plastic/ gl sheet) 5ltr capacity standard gl material 5 23 ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc (automatic temperature compensation) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs 1 24 power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox: 1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable 1 25 wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity 1 26 milking machine .25 hp single phase motor, vaccum pump 200 lpm,bucket 20 litre,orbitor 300 cc, brush set 1 27 identification equipement for animals no. tags , tatooing machine,leg rings, colar,branding (hot and cold) 5 28 khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle 2 29 soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests 2 30 models of implements used in crops smaal model made of plastic which are used in agriculture practice 10 31 bucket knapsack plastic body 15 ltr capacity 2 32 hand automizer sprayer having capacity of 500 ml 3 33 pheromone trap for major insect pest (available in local market) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height 5 34 models related to breeds of cow and buffalo small models made of plastic 2 35 models related to animal teeth small models made of plastic 2 36 rotation drum made of steel drum with handle medium size 25 ltr. capacity 1 37 models related to various types of animal houses small models made of plastic 2 38 charts related to fodder crop 3*2 pictures binded with wood border 2 39 charts related to animal feed 3*2 pictures binded with wood border 2 40 charts to related breeds of cow and buffalo 3*2 pictures binded with wood border 2 41 charts related to animal houses 3*2 pictures binded with wood border 2 42 charts related to chaff cutter made of steel or plastic 2 43 rope ( plastic rope of 20 metre) 2 44 headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 (230mm) 2 45 lactometer made of glass 2 46 teat siphon fine finish ,teat plug with syphon 2 47 charts/picture s related to health hazards 3*2 pictures binded with wood border 2 48 charts/picture s related to milk machine 3*2 pictures binded with wood border 2 49 charts/picture s related to milking methods 3*2 pictures binded with wood border 2 50 charts/picture s related to clean milk production 3*2 pictures binded with wood border 2 51 charts/picture s related to dairy records 3*2 pictures binded with wood border 2 52 charts/picture s related to tincture iodine 3*2 pictures binded with wood border 2 53 charts/picture s related to safety measure 3*2 pictures binded with wood border 2 54 charts/picture s related to vaccination schedule to animals 3*2 pictures binded with wood border 2 55 charts/ pictures related to dairy animals welfare legislation. 3*2 pictures binded with wood border 2 56 charts/picture s related to health hazards. 3*2 pictures binded with wood border 2 57 germination test equipment made of plastic of standard size 10 58 milk analytic instruments capable of doing all test automatically all test of milk, (snf, fat , water test etc.) 1 59 electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method 1 60 models of sprinklers irrigation made with steel and plastic 2 61 modele of drip irrigation made with steel and plastic 2 62 tagadi tasla made from premium quality 0.6mm cr and gl/gp sheets. size 14 inches to 22 inches with flat & round edge. 2 63 shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material wood product depth = 2.13 inch, product height = 25 inch, product weight (lb.)= 1.62, product width (in): 5.75 2 64 seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm 2 65 personal protective equipment (ppe) include gloves, foot and eye protection, protective hearing devices (earplugs, muffs) hard hats, respirators and fully boday suits. 2 66 grass cutting machine manually operated, made of stainless steel, wheel operated 1 67 duster related to agriculture having capacity of 10 litre 1 68 first aid box w ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

31376614 supply of construction ( assistant mason) vo. general items concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30/min, weight 80 kg, size 80 (mm) x 50 (mm) 1 2 electric drill up to 10mm taparia /gadore/jhalani/pie or any other good quality brand, rated power input 500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg, drill spindle connecting thread 3/8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm 2 3 safety belt unisex adjustable safety belt (full body harness and lanyards) with hook options (scaffolding) and line attachments, made of high quality polyester, with alloy steel buckles, capacity up to 2000 kg 20 4 water tank water tank to store water(must be with cover) as per need 5 trowel iron mason trowel with wooden handle (10 to 12 inches long and 6 inches wide) 20 6 arp 6 plumb rule and bob heavy iron plumb rule and bob with chord (at least 3 meter ) approx. weight around 1 kg 20 7 spirit level taparia 300 mm spirit level 20 level accuracy: 1 mm/m width (mm): 50 mm weight (kg): 0.165 kg length (mm): 300 mm height (mm): 20 mm material: aluminium frame and rubber moulding 8 try square stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight 10 9 line and pins large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line 10 ( or as per need) 10 brick bolster / brick chisel made of carbon steel with dual hand guard, size 4 x 8, 1/2 inch 10 11 brick hammer made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg 20 7 arp 12 scutch hammer made of iron with comb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg 10 13 pick axe one side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point 5 14 crowbar iron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg 10 15 chisel 6 inch iron chisel with thickness of 20mm at front and 18mm at back 20 16 mash hammer 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle 20 17 boaster with carbide tips made of heavy carbon steel. available with or without rubber grip. 10 18 spall hammer large hammer with a flat face and straight peen for breaking and roughdressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in 10 19 scrabbling hammer one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight 10 8 arp 20 bevel 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm 10 21 spade spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg 10 22 picks and beaters used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg 5 23 wooden float flat board with a handle to hold, made of hard wood for durability, size: 12″ (300mm) x 5″ (125mm). 20 24 metal float smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12″ (300mm) x 5″ (125mm). 10 25 floating rule floating rule made of aluminium, at least 4 meter long weight up to 2 kg 10 26 scratcher scratcher trowel made of steel 16 x 4 1/2 with wood handle 10 27 trowel (khurpi) made of hard iron with a wooden handle, 10 to 12 inch in size 10 28 measuring tape 5 meter wooden ladder bamboo ladders of 10 / 12 feet 30 wooden pole (balli) wooden poles of 10 & 12 feet for making wooden decks 31 wooden sieve wooden sieve of large size 32 tasla galvanized iron tasla for construction, size 20 inch, hardness 50 hrc, thickness 1mm approx. 33 double wheel barrow double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. 34 air wheel hand trolley air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch 35 racking needle 36 hacking tool ...

North Western Railway - Rajasthan

31367970 supply of light weight prefabricated water prooflight weight prefabricated water proof,light weight prefabricated water proof synthetic tent. specification 1) material of the synthetic tent must be water proof nylon/parachute cloth with double layer. 2) size of the tent: 16ft x 10ft x 8ft x 6ft (l x b x h x wall), 3) minimum weight of tent along with accessories: 30kg. 4) colour: military/salety . 5) structure & support: heavy gauge aluminum pipe of 30mm dia, for main structure and for side supports, aluminum pipe of 25mm dia & nylon ropes with pegs. 6) doors: 02nos. with net and must be operated by heavy duty zipper chain. 7) window: 04nos. with net and must be operated by velcro. 8) ground sheet: must be of heavy duty water proof hdpe sheet of 16 feet x 10 feet (l x b) size. 9) accessories: there must be m.s. peg & 02 no. hammer of 1.5 kg with wooden handle supplied with the tent for erection of the tent. 10) packing: the unit must be packed in roll luggage bag for easy handling. make: prabha or equivalent....

Medical And Health Services - Rajasthan

31320717 tender for stationery and printing work 1 acr form gazetted per piece 2 acr form non gazetted per piece 3 all pin kushion per piece 4 attendance register double column 30 page per piece 5 attendance register double column 50 page per piece 6 attendance register single column 30 page per piece 7 attendance register single column 50 page per piece 8 bill form per piece 9 bill register 160 page per book 10 bill transaction register 160 page per book 11 calculater 12 digit per piece 12 canvas bag for storage of records per piece 13 canvas cash book double column (cash and bank) per piece 14 canvas ledger per piece 15 carbon paper per packet 16 cash book all type per piece 17 cd with cover per piece 18 cello tape 1 inch per piece 19 cello tape 2 inch per piece 20 cello tape 3 inch per piece 21 chapdi per paket 22 cheque/money order record book 160 page per piece 23 clip board per piece 24 computer paper rim 10x12x1 (60gsm) per rim 25 computer paper rim 10x12x2 (60gsm) per rim 26 computer paper rim per rim 27 computer paper rim 10x15x1 (60gsm) per rim 28 correction pen per piece 29 dispatch register 192 page per piece 30 dora gitta per piece 31 dot matrix ribbon (various colour) per piece 32 driver log book 160 page per piece 33 encashment register per piece 34 envelope a4 size (100 envelope) per packet 35 envelope big polythene covered (100 envelope) per packet 36 envelope brown (khakhi) 7” *4” (100 envelope) per packet 37 envelop white 9” * 4” (100 envelepe) per packet 38 envelope white 7” * 4” (100 envelope) per packet 39 envelop white 9” * 4” (100 envelepe) per packet 40 eraser per piece 41 fevicol tube 50 gm per piece 42 fevistick 15 gm per piece 43 fevistick 8 gm per piece 44 file cover plastic coated good quality with less per piece 45 file fo 1der plastic per piece 46 file pad good quality per piece 47 file lace (100) per packet 48 fluid ink per piece 49 for cover per piece 50 for cover plastic per piece 51 fvc bill per 100 fr. 52 fvc bill register per piece 53 govt. cash book 200 page per piece 54 gpf book 80 page per piece 55 gpf loan form per 100 fr. 56 gum bottle 300 ml per piece 57 gum bottle 700 ml per piece 58 gum tube 200 ml per piece 59 income tax calculation form per packet 60 lace good quality per packet 61 marker pen ink per piece 62 marker pen thick per piece 63 marker pen thick (permanent) per piece 64 marker pen thin 0.5 mm (permanent) per piece 65 mtc bill form per 100 fr. 66 paper punching machine (kangaroo 600 dp) per piece 67 pay posting register per piece 68 pencil per piece 69 peon book 160 page per piece 70 photostate paper rim a3 per rim 71 photostate paper rim a4 (70gsm) per rim 72 photostate paper rim legal (70gsm) per rim 73 pocker iron handle per piece 74 pocker wooden handle per piece 75 register (100 page) per piece 76 register (150 page) per piece 77 register (200 page) per piece 78 register (300 page) per piece 79 register (400 page) per piece 80 register (50 page) per piece 81 salary bill form outer/inter per piece 82 saral form no.16 per 100 fr. 83 scale per piece 84 sharpner per piece 85 si loan form per 100 fr. 86 si pass book 80 page per piece 87 sketch pen per piece 88 stamp pad big per piece 89 stamp pad ink 50 ml per piece 90 stamp pad medium per piece 91 stamp pad small per piece 92 stapler no.10 per piece 93 stapler no. 45 per piece 94 stapler pin no.10 per packet 95 stapler pin no. 24/6 per packet 96 stock register 260 page (consumable type ) per piece 97 stock register 260 page (permanent article type) dsr per piece 98 stock register 320 page (permanent article type) dsr per piece 99 stock register 320 page (consumable type ) per piece 100 stock register 360 page (consumable type ) per piece 101 stock register 360 page (permanent article type) dsr per piece 102 ta bill form per 100 fr. 103 tags (100) per packet 104 tailoring sccisor (iron) per piece 105 t all pin per packet 106 tupe paper rim per rim 107 u clip per packet 108 vehicle log book 160 page per piece 109 water demper 1 gate pass free/cash with number on casd sheet per pc 2 injury report book in duplicate with no. (200 pages per book) per book 3 form on a4 size single side ( 100 pages per bundle ) per 1000 4 form on a4 size double side ( 100 pages per bundle ) per 1000 5 form on legal size single side ( 100 pages per bundle ) per 1000 6 form on legal size single side ( 100 pages per bundle ) per 1000 7 form on legal size double side ( 100 pages per bundle ) per 1000 8 form on legal size double side ( 100 pages per bundle ) per 1000 9 form on a3 size single side ( 100 pages per bundle ) per 1000 10 form on a3 size double side ( 100 pages per bundle ) per 1000 11 form on a4 size single side on color page ( 100 pages per bundle ) per 1000 12 form on a4 size double side on color pages ( 100 pages per bundle ) per 1000 13 form on legal size single side on color page ( 100 pages per bundle ) per 1000 14 form on legal size double side on color page ( 100 pages per bundle ) per 1000 15 rasid book in duplicate 6/4 size with no. (200 page per book) per book 16 ihms opd slip computerised with carbon and no. 10/8 per 1000 17 rsidslip computerised with carbon and no.10/8 per 1000 18 register a4 size with binding (100 pages) per pc 19 register a4 size with binding (200 pages) per pc 20 register a4 size with no. and binding (100 pages) per pc 21 register a4 size with no. and binding (200 pages) per pc 22 register legal size with binding 16/26/4 (100 pages) per pc 23 register legal size with binding 16/26/4 (200 pages) per pc 24 register legal size with no. and binding 16/26/4 (100 pages) per pc 25 register legal size with binding 16/24/4 per pc 26 register big size with binding 20/30/2 (200 pages) per pc 27 form big size ( 4 page) 16/26/2 double side print per 1000 28 dishcharge card on card sheet per 1000 29 refral card on card sheet per 1000 30 numbering on forms per 1000 31 numbering on forms per 1000 32 xray envelop 8x10 per 1000 33 xrayenvelop 10x12 per 1000 34 xrayenvelop 12x15 per 1000 35 flaxi banner size 5x4 per pc 36 flaxibanner size 4x3 per pc 37 flaxibanner size 3x2 per pc 38 a3 size page register per pc 39 bht folder per pc 40 indent book duplicate with number (50 no. one book) per book 41 ipd drug demand book size a4 paper in duplicate with number ( 50 no.one book) per book 42 jssy admission ticket 4page both side print (good quality) per pc 43 issue voucher book triplate with number (50 no. one book) per book 44 blood groop label sticker different color per pc 45 gatta binding a4 size per pc 46 gatta binding legal size per pc 47 gatta binding a3 or larger size per pc 48 flax banner size 10x4 per pc 49 flax banner size 10x5 ...

Rajasthan Olive Cultivation Limited - Rajasthan

31068502 tender form for supply of farm tools & equipment various olive farms & coe, bassi i power weeder / tiller 2 offset rotovator for mini tractor 3 2 x gear lopper pro 4 2x gear lopper blades pruning secateurs professional with steel handle pvc grip 6 ruchi rose cutter 7 ruchi rose cutter spring 8 hedge shear with wooden handle 9 lawn mower manual 10 battery operated knapsack sprayer 11 hand rotary duster etc...

Department Of Training And Technical Education - Rajasthan

30995525 supply of tools & equipments for fitter trade a. trainees tool kit (2o • 1) tr.noos toolkit sl. 1 18 is required additionally) — 1 steel rule with metrk & rreiish graduation 2 try scuare.i 3 caliper inside sp ing type. 1 4 caliper hermaphrodite spring type 1 s caliper outside spring type 1 6 divider spring type 1 7 scriber 1 8 centre punch i 9 screwdriver 1 10 chsel cold flat 2 4 2 2 2 1 3 11 hammer ball peen with handle 12 hrmmer bal peen with fhandie — 13 file flat.. second cut 14 file flat smooth 15 filehairoundsecondcut 16 hacksaw frame fixed type 17 safety goggles. 18 dotpunch 1 b. unstruments and general shop outfmt. for z (1.1) urnl instruments 9 steel pule graduated both in metric and english unit 3 20 straightedgesteel 3 21 spirit tevel metal rype 2 3 22 stud extractor eti out s 23 combnation set 3 24 micrometer outside 0 25 micrometer outside. 1 26 micrometer outside. 27 micrometer inside with extern ion rods. 28 vernier caliper 29 vernier height gauges 30 vernier bevel protractor blade with acute angle 31 screw pitch gauge metric 32 were gauge, metric standard. general shop outfit 33 surface plate ci/granite with stand and cover 34 marking table (mild steel) 35 universal scribing block, 36 v block pair with clamps 37 angle plate 38 punch letter set. 39 punch number set. 40 portable hand drill (electric) drill twist straight shank 3 mm to 12 mm by 0.5 mm h.5.5. 2 sets 41 42 drill twist taper shank 43 taps and dies complete set in box________.________ 44 taps and dies complete set 45 file knife edge smooth 46 file feather edge smooth 47 file triangular smooth 48 file round second cut 49 file square second cut 50 feeler gauge 51 file triangular second cut 52 file flat second cut safe dge. 53 file flat bastard 54 file flat bastard. 55 file swiss type needle 55 file swiss type needle sc 56 file half round second cut. 25 si file half round bastard, 58 file round bastard. 59 file hand second cut. 60 fllecard. 61 oilcan 62 pliers combination insulated 63 wooden handle forged soldering iron copper bit. 64 blow lamp 65 spanner double ended 66 spanner adjustable 67 interchangeable ratchet socket set 0, inflei l.r1ai1idu1 i alljiel ubkel l bouble ended tubular box spanner set with tommy bar. glass maenifying1 69 70 clamp toolmaker clamp c clamp c hand reamer set (taper pin straght flute) 71 72 73 74 machine reamer parallel (helical flute) scraper flat 75 76 scraper triangular 77 scraper halt round chisel cold crosscut& diamond point. chisel cold flat chisel cold round nose drill chuck with key pipe wrench 78 79 8o 81 82 83 pipe vice 84 adjustable pipe die set bsp 85 wheel dresser (one for 4 units)star/dresser with holder 86 machine vice 5wivel base 87 machine vice swivel base 88 sleeve drill morse 89 vice bench 99 machine vice. 100 wing compass. 101 hand hammer with handle. 102 torque wrench (standard/ratchet type) 1o3 power tools for fastening different profile gauges (plate type) ror _ _ demonstration 1o5 knurllng tool (diamond, straight & diagonal) 1o6 indexable boring bar with inserts 1o7 machine maintenance manual for iathe, pedestal __e__ rinder,_drill_machine,_power_saw 108 temperature gauge 109 dowel pin (straight) standard tap screws 111 lapping plate medium carbon heat treated alloy steel metric 112 studs and bolts along with nuts (for display) of standard length (may be manufactured in house) 113 caps screws 114 drill gauges 115 cast iron globe valve (flanged type) 116 cii sluice / gate valve (flanged type) 117 stopcock 118 ms. pipe 119 g.l. pipe 12o slip on forged steel flange 121 bolt & nut with washer (may be manufactured in house) . 122 pipe threading die with handle 122 pipe thread i, die with handle — 123 ji€s & fixture (sample) for demonstration (may be manufactured in house) 124 pulleys (for v belt or flat belt) 125 steel keys (maw be manufactured in house) 126 — damaied old spur gear 127 v belt and flat belt 128 packing gasket 129 washer, dutch, keys, jib, cotter &circlip 130 hollow punch 131 drill drift (may be manufactured in house) 132 bearing different types 133 lifting sling 134 bearing extractor i 35 pulley extractor c. tools for allied trade sheet metal worker additional items are to be provided for the allied trade train 136 trammel 137 pocker 138 prick punch 139 mallet. 140 aviation snips straight cut 141 flat headed hammers with handle. 142 planeshing hammer. 143 snip bent left cut 144 stake hatchet with leg. 145 stake grooving. d.woifi[dustoftools ror t2teatf ror r4f!r1 wistrument 146 slip gauge as johnson metric set. 147 gauge snap go and not go gauge plug 148 149 gauge telescopic set. 150 dial test indicator on stand 151 sine bar 152 dial vemnier caliper. (universal type) screw thread micrometer with interchangeable. pitch anvils for checking metric threads 60. 153 153 screw thread micrometer with interchangeable. pitch anvils for checking metric threads 6o. depth micrometer. 0 25 mm 155 digital vermer caliper. 156 digital micrometer outside. 157 comparators gauge dial indication with stand bracket a eiwineers try souare knife edge ti .9 surface roughness comparison plite.. jn 0 digital vernier caliper jo 1 vernier bevel protector eral shop outfit 2 carbide wear block. 1 3 lathe tools h.s.s. tipped set. — 4 lathetools bit. 5 lathe tools bit. . 6 lathe tools bit. 1i 167 arm strong type tool bit hoder. 168 arm strong type tool bit holder. 169 arm strong type tool bit holder. 170 siiicon wrenches 171 pipe cutter wheel type. 172 pipe bender machine spool type with stand 173 adjustible pipe chain tonge to take pipes adjuut.ibie spanner 174 e. general machinery installamion 175 ss and sc centre lathe (all geared) with minwnum specificatiomi pillar type dfllhng machine drilling macháne bench 176 177 178 d.e. peaestal gnnding machine withwheels rough and smooth $6. list of tools & accessories for pneumatics and h 197 compressor unit pneumatic trainer kit, each consisting of the following matching components and accessories: i. single acting cylinder ii. double acting cylinder ili. 3/2 way valve iv, 3/2 way valve v. one way flow control valve vl. 5/2 way valve vii. 5/2 way valve viii. 5/2 way pneumatic actuated valve ix. 3/2 way roller lever valve x. shuttle valve (or) xl. two pressure valve (and) 98 pressure gauge xiii. manifold with self closing xiv. pushbutton station for electrical signal input xv. relay station xvi. 3/2 way single solenoid valve xvii. 5/2 way single solenoid valve xviii. 5/2 way double solenoid valve xix. power supply unit, xx. profile plate, anodised aluminium pneumatic workstation with 40 square mm aluminium profile legs, wooden work surface, and 199 one pedestal drawer unit having 5 drawers, each with handles and individual locks, on metallic full panel drawer slide: 200 carrier for mounting components, such as pe & relay boxes. 201 cut section model for pneumatic components 202 hyaraulic trainer kit, each consisting of the ollowing matching components and accessories: i. hydraulic power pack li. pressure relief valve ill. drip tray, steel iv. pressure gauge v. four way distributor vi. double acting hydraulic cylinder i 200 vii. viil. suitable wei€ht mounting kit for weight for fori ix. 3/2 way directional control valve x. 4/2 way directional control valve xl. 4/3 way directional control valve xii. non return valve. e e xiil. pilot operated check valve xiv. one way flow contrd valve xv. t connector with self sealing coupling nipples (2 nos.) and quick coupling socket (1 no.). xvi. profile plate, hydraulic woikstation with 40 square mm aluminium profile legs, wooden work surface, and i one pedestal drawer unit having s drawers, each c with handles and individual locks, on metallic full a 203 panel drawer slide: e 204 cut section models for hydraulic components ...

Police Department - Rajasthan

30968650 supply of stationary item pen , refill , register , 7 c.lregiqcr 164 page cip fl.tiid phaiic ( vooden ) j j cornputcrpnpcr l0g12x2c pws ceramic golden line _ 1 j l. ) nk pad superior quality regzin 2 dhayn ( kg ) dust bin ( plastic ) dust bin ( with dhakkan ) duster or erasable markar pen 6 envelope size i 8”x 12” cloth cotted envelope size white / yellow i lx5 fevistick 15gm 19 file foldcr plastic coned f / s size file lace 9 / 24 inch ( ln packet ) filepad file tag pkt ) ( 800pcs. ) flag adheshive colour 40 sect 24 glossy printing paper ( skeet ) 25 gum bottle 150 ml camel 26 gum bottle 700 ml camel 27 14igb lighter pen 28 nirma powder ( kg ) 29 note book ( dairy ) 100 page 30 permanent marker pen i paper cutter iron wilh wooden handle 32 33 paper counting sponge paper wipht glass 34 pen marker black 35 penmarkerblue 36 pen montex mepa top m 37 pen stand with two pen superior l iuni jnii ii u1jcinu? 38 i pen urni ball impact black 39 pen uni ball impact black refill 40 pen uni ball impact blue 41 pen uni 13al1 impact blue refill 42 pencil ord.h.b. natraj / apsara beauty 43 pencil rubber nalraj 44 pencil shurpner natraj 45 pin cushion pin sleet zebra 100gm per pkt 47 plastic folder l with pocket brown color 48 poker 49 punching machine 2 hole 50 rulled register 60 gsm 240pages 51 scale plastic 12 inch 52 scissors small / mediun ( soya 0sno. ) 53 short hand note book 54 sketch colour 55 slp pad no. 22 56 ni lifcbouy 75gm 57 plux 100gm 58 59 60 kin 240 gm pial note book no.67 j!i1i sheet a4 ( set ) ( ‘l 62 iniiul!.! 160x97mm stnliflppflll lnk 6‘3 stnmp pad smnll 110 x70 64 staple machine no. t0 65 nplc mnchine iio. 24x6 66 sinple pin no. 24x6 pkt ( knngroo ) 67 staple pin no. i0 ( knngroo ) 69 towel big size ( bombay dying ) 70 towel small size ( bombay dyflg ) 71 transparent tape roll i inch 72 transparent tape roll 2 inch 73 transparent tape roil 2 inch brown 74 type carbon blue kores multi copy ( rim ) 75 u pin plastic cotted ( pkt. ) 76 vim powder ( pkt ) 77 water glass borosil ( sei 6pcs. ) 78 vater jug ( plastic ) 79 water tray big ( plastic ) 80 white board erasable marker pen black dry ( pit ) 81 vhite boand erasable marker pen red dry ( pkt ) 82 white board erasable marker pen dreen dry ( ptt ) 83 whiie board erasable marker pen ink ( black ) 84 white fluid ink pen 85 offset paper rim 17x27 — 84 white fluid ink pen 85 offset paper rim 17x27 86 photo paper a.4 ( rim ) 80 gsm 87 binder clip ( pkt. ) 1w’ 88 binder clip ( pkt.. medium etc...

Rajasthan Olive Cultivation Limited - Rajasthan

30898511 tender form for supply of farm tools & equipment various olive farms & coe, bassi, jaipur i power weeder / tiller . . 2 offset rotovator for mini tractor 3 — 2 x gear lopper pro 4 2 x gear lopper blades 5 pruning secateurs professional with steel handle and pvc grip 6 ruchi rose cutter 7 ruchi rose cutter spring 8 hedge shear with wooden handle 9 manual lawn mower 10 battery operated knapsack sprayer 11 hand rotary duster...

Sarva Shiksha Abhiyan Authority - Rajasthan

30725569 vocational agriculture lab tools equipments vocational agriculture lab tools equipments , agriculture , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1 / 2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake, spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle / s lightly curved blade. , secateurs made of stainless steel, 0 steel cutting blade , specialty spades suitable for garden , made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1 / 2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large ( plastic / gl sheet ) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc ( automatic temperature compensation ) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm, bucket 20 litre, orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine, leg rings, colar, branding ( hot and cold ) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest ( available in local market ) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre ) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 ( 230mm ) , lactometer made of glass , teat siphon fine finish , teat plug with syphon , charts / picture s related to health hazards 3*2pictures binded with wood border , charts / picture s related to milk machine 3*2pictures binded with wood border , charts / picture s related to milking methods 3*2pictures binded with wood border , charts / picture s related to clean milk production 3*2pictures binded with wood border , charts / picture s related to dairy records 3*2pictures binded with wood border , charts / picture s related to tincture iodine 3*2pictures binded with wood border , charts / picture s related to safety measure 3*2pictures binded with wood border , charts / picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts / pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts / picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, ( snf, fat , water test etc. ) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl / gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight ( lb. ) = 1.62, product width ( in ) : 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment ( ppe ) include gloves, foot and eye protection, protective hearing devices ( earplugs, muffs ) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

30642676 3_ supply of construction at govt. sr. sec. school bap block bap, distt jodhpur. 3_ supply of construction at govt. sr. sec. school bap block bap, distt jodhpur. , construction ( assistant mason)list of non recurring tools & equipment’s : concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30/min, weight 80 kg, size 80 (mm) x 50 (mm) , electric drill up to 10mm taparia /gadore/jhalani/pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg,drill spindle connecting thread 3/8 24 unf, chuck capacity 1 10 mm,impact are at no load speed 0 41600 bpm , safety belt unisex adjustable safety belt (full body harness and lanyards) with hook options (scaffolding) and line attachments, made of high quality polyester, with alloy steel buckles, capacity up to 2000 kg , water tank water tank to store water (must be with cover) , trowel iron mason trowel with wooden handle(10 to 12 inches long and 6 inches wide) , plumb rule and bob heavy iron plumb rule and bob with chord (at least 3 meter ) approx. weight around 1 kg , spirit level taparia 300 mm spirit levellevel accuracy: 1 mm/m width (mm): 50 mm weight (kg): 0.165 kg length (mm): 300 mm height (mm): 20 mm material: aluminium frame and rubber moulding , try square stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pins large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line , brick bolster / brick chisel made of carbon steel with dual hand guard, size 4 x 8, 1/2 inch , brick hammer made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammer made of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axe one side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbar iron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel 6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boaster with carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammer large hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in size , scrabbling hammer one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spade spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beaters used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden float flat board with a handle to hold, made of hard wood for durability, size: 12? (300mm) x 5? (125mm). , metal float smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? (300mm) x 5? (125mm). , floating rule floating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcher scratcher trowel made of steel 16 x 4 1/2 with wood handle , trowel (khurpi) made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 meter measuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladder bamboo ladders of 10 / 12 feet , wooden pole (balli) wooden poles of 10 & 12 feet for making wooden decks , wooden sieve wooden sieve of large size , tasla galvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrow double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolley air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle standerd , hacking tool satnderd , list of recurring tools & equipment’s : bricks 9 in. x 4 in. x 3 in. each , stone basalt or granite stone, must be hard stone for construction pupose , sand river sand for construction purpose , concrete block 12 inch brick 12x7x5 inches , cement ordinary portland cement of any brand , water pipe 50 meter garden water hose pipe with sprayer and hose connector, material pvc , safety glasses scratch resistant polycarbonate transparent safety glasses, unisex , safety helmet polycarbonate / polymer unisex adjustable helmet with chin strap, size 28 cm x 20 cm x 15 cm , safety vests bright yellow safety construction vests with bright reflectors, made of polyester, unisex, size 11.81 x 10.98 x 6.3 inches (large) , safety gloves nylon chemical & cut resistant unisex safety gloves , safety boots steel toe safety shoes, lightweight & durable with good breathability , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., microporous surgical tape, paracip/parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Rajasthan Council Of Secondary Education - Rajasthan

30631590 bids are invited for applicator brush applicator brush , arm chair arm chair , blackhead remover 2 set blackhead remover 2 set , body massage bed body massage bed , bowles 5 set bowles 5 set , curling iron curling iron , cuticle knife, buffers, pedicure rasp (hard skin removal), nail scissors, clippers , hard skin remover, nipper (for pedicure), cuticle knife, buffers, pedicure rasp (hard skin removal), nail scissors, clippers , hard skin remover, nipper (for pedicure), , cutting scissors 2 set cutting scissors 2 set , decorative pins boxes decorative pins boxes , double wax heater double wax heater , dustbin dustbin , exfoliation machine exfoliation machine , eyebrow pencil sharpener eyebrow pencil sharpener , facial steamer facial steamer , foot scraper 2 set foot scraper 2 set , foot spa foot spa , hair brush 5 pieces hair brush 5 pieces , hair connector hair connector , hair dresses chairƒstool hair dresses chairƒstool , hair dryer hair dryer , hair steamer hair steamer , hand mirrors hand mirrors , hydraulic chair 5 hydraulic chair 5 , infrared lamp infrared lamp , jumbo rollers set jumbo rollers set , large stools large stools , magnifying glass magnifying glass , make up palate make up palate , manicureƒpedicure set manicureƒpedicure set , manicure table manicure table , measuring cup sets measuring cup sets , measuring glass sets measuring glass sets , measuring spoon sets measuring spoon sets , modular mirrors modular mirrors , paraffin heater paraffin heater , perming cap perming cap , pin curl clips boxes 2 set pin curl clips boxes 2 set , razor with blade razor with blade , roller brush set 5 in 1 roller brush set 5 in 1 , shampoo unit shampoo unit , small scissors small scissors , small stools small stools , spatula spatula , spray bottle spray bottle , sterilizer sterilizer , straightening iron straightening iron , tinting brush with comb tinting brush with comb , tweezer tweezer , working and facial trolleys working and facial trolleys , auger for taking out soil samples standard of two sizes. augers screw type 100mm, extension rod 1 meter length with threading at both ends couplings. set for two spanners and tee piece.working area 3x2x2 size of hepa 3x2x6 , dutch hand hoe short handle , wide blade , garden hand tools handle made of plastic and head made of stainless steel , garden hoes 3 tooth tynes made of stainless steel triangular furrow long handle made of wood , garden knife extra sharp, made of stainless steel , garden rakes a conventional style garden rake fitted with a light weight aluminium handle 54 aluminium shaft carbon steel blade metal head. , garden fork long handle made of wood, tynes made of stainless steel , garden spade description: designed for digging unprepared ground. features: ideal for digging or loosening soil wooden handle : 900mm hardened & tempered steel blade with rust preventive coating blade head : 140mm , hand sieves made of stainless steel of standard size , hoe long handle made of wood , short sharp blade made of stainless steel , knapsack sprayer spray pump for insecticides 1/2 ltr capacity standard spray pump with plastic body , leaf rake description: multipurpose tool for break up compacted ground, raking and leveling beds. features: used as rake,spade & hoe wooden handle hardenend and tempered steel blades light weight easy to use , levelers leveling of soil, before planting 4ft x 1 ft x 4 inch made by wood , pruning saw handel made of plastic or wood folding or fixed, , pruners length of 200mm steel hndle pvc grip , pruning knife medium weight, length 109m, width: 29mm, height 19mm, net weight 85.9gm.knife stainless steel with wood handle/s lightly curved blade. , secateurs made of stainless steel,0 steel cutting blade , specialty spades suitable for garden ,made of stainless steel, 3.5 ft long handel made of wood , soil scoop pointed tip, unique shape , solid birch handele made of stainless steel , sprinklers medium size garden sprinklers fitted with water pipe 1/2 inch with 100 ft long pvc pipe , trowels elongated triangular shaped blade , watering can small and large (plastic/ gl sheet) 5ltr capacity standard gl material , ph meter ph pen tester, thzy high accuracy pocket size ph meter with atc (automatic temperature compensation) backlit light lcd 0 14 ph measurement range, 0.01 resolution handheld ph, pen tester, model sz thzx 1042085, shipping weight 124 lbs , power tiller description: designed for vegetable and flower gardens or small holdings. compact and lightweight, allow problem free tillage even in confined spaces or around low vegetation.features: power : 5.5 hp 4kw gearbox:1 forward & reverse speed rotor 3+3 blades 80cm with protection discs handle bars: adjustable , wheel borough made of steel fitted with wheels can hold and move goods in small distnances standard steel body of 30 kg capacity , milking machine .25 hp single phase motor, vaccum pump 200 lpm,bucket 20 litre,orbitor 300 cc, brush set , identification equipement for animals no. tags , tatooing machine,leg rings, colar,branding (hot and cold) , khudali description: multipurpose tool for digging and aerating jobs. features: hardened & tempered steel blade with rust preventive coating handy for digging in camps and sports ground wooden handle , soil testing kit capable of doing test of availability of nutrients in soil, perform 100 tests , models of implements used in crops smaal model made of plastic which are used in agriculture practice , bucket knapsack plastic body 15 ltr capacity , hand automizer sprayer having capacity of 500 ml , pheromone trap for major insect pest (available in local market) a pheromone trap is a type of insect trap that uses pheromones to lure insects. control of white grub. dimensions : 118mm diameter x 50mm height , models related to breeds of cow and buffalo small models made of plastic , models related to animal teeth small models made of plastic , rotation drum made of steel drum with handle medium size25 ltr. capacity , models related to various types of animal houses small models made of plastic , charts related to fodder crop 3*2pictures binded with wood border , charts related to animal feed 3*2pictures binded with wood border , charts to related breeds of cow and buffalo 3*2pictures binded with wood border , charts related to animal houses 3*2pictures binded with wood border , charts related to chaff cutter made of steel or plastic , rope ( plastic rope of 20 metre) , headge cutting scissor cutting and pruning 16 inches standard with wooden handles blade length 9 (230mm) , lactometer made of glass , teat siphon fine finish ,teat plug with syphon , charts/picture s related to health hazards 3*2pictures binded with wood border , charts/picture s related to milk machine 3*2pictures binded with wood border , charts/picture s related to milking methods 3*2pictures binded with wood border , charts/picture s related to clean milk production 3*2pictures binded with wood border , charts/picture s related to dairy records 3*2pictures binded with wood border , charts/picture s related to tincture iodine 3*2pictures binded with wood border , charts/picture s related to safety measure 3*2pictures binded with wood border , charts/picture s related to vaccination schedule to animals 3*2pictures binded with wood border , charts/ pictures related to dairy animals welfare legislation. 3*2pictures binded with wood border , charts/picture s related to health hazards. 3*2pictures binded with wood border , germination test equipment made of plastic of standard size , milk analytic instruments capable of doing all test automatically all test of milk, (snf, fat , water test etc.) , electronic milk fat test milk fat testing machine operated with electricity , testing done with centrifugal method , models of sprinklers irrigation made with steel and plastic , modele of drip irrigation made with steel and plastic , tagadi tasla made from premium quality 0.6mm cr and gl/gp sheets. size 14 inches to 22 inches with flat & round edge. , shovels specfications: blade length = 7.75, blade material = steel, blade width = 5.875 in coated blades yes, d grip handle yes, handle material woodproduct depth = 2.13 inch, product height = 25 inch, product weight (lb.)= 1.62, product width (in): 5.75 , seedbed preparation spade handle yes, handle made of wood or steel, blade head 100 mm , personal protective equipment (ppe) include gloves, foot and eye protection, protective hearing devices (earplugs, muffs) hard hats, respirators and fully boday suits. , grass cutting machine manually operated, made of stainless steel, wheel operated , duster related to agriculture having capacity of 10 litre , first aid box with all necessary first aid material total quantity : 1...

Indian Army - Rajasthan

30610043 bids are invited for barber chair barberpub heavy duty metal vintage barber chair all purpose hydraulic recline salon beauty spa chair styling equipment 3849 , led 42 lg 42 inch led full hd tv (42la6620) · display 42.00 inch · screen type led · dimensions 957 mm x 574 mm x 35 mm · smart tv , barber tray barber clipper tray, segbeauty clipper rack anti slip black salon clippers organizer razor case with 5 notches professional hair trimmer holder hairdresser stylists barber tools box , hair cutting machine corded ultra trim clipper gives you the power of precision with complete versatility for all of your grooming needs. this is one of the most powerful corded clippers used by hairdressers and barbers. it is designed to take care of your beard and shape it effortlessly. , neck duster brush holics neck duster brush for hair cutting, soft neck cleaning brush professional barber natural nylon wooden handle , scissors parts of nail cutting shears. terminology of scissors. manicure and pedicure care tools. vector illustration , massager machine vdnsi 8 in 1 full body magic massager machine with weight loss function handheld body massager machine with weight loss function , water spray bottle branded and good quality water sprayer.used mainly to water / shower , straight razor light weight professional straight edge razor barber shaving haircut knife , barber bag cosmetology supplies bag professional travel barber bag customizable interior hair salon equipment organize shoulder bag , barber apron confidence barber hair cutting sheet apron hairdressing salon , barber hand towel terri towelling black hair towels salon hairdressing towels beauty barber hand towel 50 x 85 cm , barber towel medium towel white/black barber 120x100 cm , steel dustbin with lid stainless steel plain pedal dustbin with lid and bucket| trash can for home, barbar shop office with lid , barber comb dark stag’s barber combs are made of a carbon fibre mix to ensure extreme s...

Indian Army - Rajasthan

30573941 bids are invited for barber chair barberpub heavy duty metal vintage barber chair all purpose hydraulic recline salon beauty spa chair styling equipment 3849 , led 42 lg 42 inch led full hd tv (42la6620) · display 42.00 inch · screen type led · dimensions 957 mm x 574 mm x 35 mm · smart tv , barber tray barber clipper tray, segbeauty clipper rack anti slip black salon clippers organizer razor case with 5 notches professional hair trimmer holder hairdresser stylists barber tools box , hair cutting machine corded ultra trim clipper gives you the power of precision with complete versatility for all of your grooming needs. this is one of the most powerful corded clippers used by hairdressers and barbers. it is designed to take care of your beard and shape it effortlessly. , neck duster brush holics neck duster brush for hair cutting, soft neck cleaning brush professional barber natural nylon wooden handle , scissors parts of nail cutting shears. terminology of scissors. manicure and pedicure care tools. vector illustration , massager machine vdnsi 8 in 1 full body magic massager machine with weight loss function handheld body massager machine with weight loss function , water spray bottle branded and good quality water sprayer.used mainly to water / shower , straight razor light weight professional straight edge razor barber shaving haircut knife , barber bag cosmetology supplies bag professional travel barber bag customizable interior hair salon equipment organize shoulder bag , barber apron confidence barber hair cutting sheet apron hairdressing salon , barber hand towel terri towelling black hair towels salon hairdressing towels beauty barber hand towel 50 x 85 cm , barber towel medium towel white/black barber 120x100 cm , steel dustbin with lid stainless steel plain pedal dustbin with lid and bucket| trash can for home, barbar shop office with lid , barber comb dark stag’s barber combs are made of a carbon fibre mix to ensure extreme s...

Department Of Training And Technical Education - Rajasthan

30506158 open tenders are invited for supply of tools and equipments for diesel mechanic trade 1 mr blow gun with standard accessories fluid compressed air, max. working pressure 150 psi, temperature range o 609ca ammeter dc with external shunt rated output 5omv, loomv, custom, votage tolerancex 0.1%, operating temp. 3orc to 7oc, storage temp. 55rcg to 80c, resistance element: manganln, termlnal block rsn: brass, base: bakelite 2 3 air ratchet with standard accessories max. torque: 1s0 ft.ib/20s nm in reverse; speed : 240o rpm 3/8 inch anvil with ring retainer performance frameless motor durability aluminium clutch housing with rubber dampers convenlence 1 hand fw/rev & full tea5ing trigger 4 air impact wrench with standard accessories voltage:220 240v 50/60hz input power:105ow 5 battery –charger vehicle compatibility: petrol car, diesel car, suv, mpv, sedan, pick up van, tempo, truck, bus, tractor,taxi, rickshaw, bike, motorcycle suitable for use in workshop, garage, battery shop. applicable for 12v & 6v lead acid battery of all types like agm, wet, gel, vrla, etc. fully automatic 9 stages charger and maintainer controlled by an internal mcu (micro computer unit). trickle charging for optimum battery care. user selectable operations. power backup and restore (regeneration) functions. engine jump start and alternator test facility. led display for voltage, current, charge robust metal housing with carrying handle & recessed control panel for safe operation. product doesn’t work on dead or defective batteries. product will only charge the battery. charge holding will solely depend on battery quality / life. 5 meter flexible in case 1 6 belt tensioner gauge with metric and imperial conversion. * auto switch off and manual shutdown. * with average value calculation function. * with low battery alarm indicator & with maximum value stored. * provide “bluetooth data output” choice. 1 7 chain pulley block capacity with tripod stand greater adjusting range due to telescopic legs than standard lifting tripods. only 54kg self weight! fully collapsible which can reduce the overall length (e p. fqr transportation) to 2000mm for easy storage. the tripod feet are fitted with non slip rubber metal linings, guaranteeing stability. optional with a hand cha 8 compression testing gauge suitable for diesel engine with standard accessories the gauge has a range of 0 70 bar/0 1000 psi. comes with 9 different glow plugs and 4 injector adaptors. features a built in resetter and all adapters have a shortcut 1 9 connecting rod alignment fixture product typeconnecting rod alignment gaugelift designfour post lift lifting height10 50 inch (in)width5 10 millimeter (mm) working voltage110 440 volt 1 10 cylinder bore gauge capacitytype of product : bore gauge set range (mm) : 20 160 mm repeatability : 0.003 mm accuracy : ±0.018 mm measuring ranges : 18 35 mm 35 60 mm 50 160 mm dial indicator range 10mm, graduation 0.01mm accuracy: ±0.015 mm for range 18 35 mm , ±0.018 mm for range 35 60 mm , ±0.018 mm for range 50 160 mm 4 11 cylinder liner dry & wet liner, press fit & slidefit liner (1 each) material cast iron corrosion resistance yes 2 12 depth micrometer 0 25 mm resolution: 0.001mm/0.00005 micrometer head accuracy: +/ 3μm rod accuracy: / (2 l/75)μm, l is the measuring range in mm rods with flat end ratchet stop optional accessory: data output system product details: coderangerods3540 500 50mm/0 22pcs3540 1500 150mm/0 66pcs3540 3000 300mm/0 1212pcs 4 page 4 of 13 13 different type of engine bearing model(1 set) material stainless steel usage/application automobiles condition new is it rust proof yes material grade ss 304 1 14 electric soldering iron reachat type soldering iron kit electronics, 60w adjustable temperature welding tool 5 pieces soldering tips, desoldering pump, soldering iron stand, tweezers colour: multicolour 230 v60 watts 230v25 watts 2 15 engineers stethoscope stainless steel material, rust and corrosion resistant, durable. applicable to the diagnosis of engine abnormal noise. simple and efficient, can be used to monitor engines, bearings, motors, chassis, gearboxes, etc. 1 16 glow plug suitable for steel and ceramic glow plugs lcd display short circuit protection & reverse charging protection auto power off: 110 seconds 9v battery*1 (included) 2 17 granite surface plate with stand and cove surface finish precision lapped surface finish thickness 200 mm material granite size 1600 x 1000 x 200 mm product type surface plate 1 18 grease gun capacity : 1 kg 19 grease gun heavy duty trolley type 10 kg capacity pump has steel construction with cast head and solid steel pump chamber. high pressure hand operated portable pump. comes complete with 2.2 meter of high pressure hose fitted with accessories. 1 20 growler technical specification: • input voltage: 230v ac. • input current: 0.65a • testable armature dia: 85 mm to 160mm. • growler arms: adjustable type. • output voltage: 12v dc. 2 21 hammer copper with handle weight: 1 kg head material: copper 3 22 hand reamers adjustable 10.5 to11.25 mm,11.25 to 12.75mm 12.75 to 14.25mm and 14.25to 15.75 mm material: white metal package contents: 7 piece adjustable hand reamers (8/a to 2/a) each set is supplied in fine finished wooden box each box is clearly marked with different reamer sizes to facilitate convenient storages reamers are used for light cut, repair work, removing stock or simply for enlarging holes 1 23 hand shear universal 250mm size 8 inch (blade size) material medium carbon steel usage/application metal sheet shearing packaging type box 2 24 hand vice up to 37 mm 1 25 injector – multi hole type, pintle type(4 each)exterior metallic finish high speed steel 4 26 lifting jack screw(1 each) max height: 100 cm material: steel 1each page 6 of 13 lifting capacity: 2000 kg,3000kg,5000kg individual weight: 3 kg 27 multimeter digital digital display type lcd material plastic primary functions current measurement, voltage measurement, resistance measurement, diode test, continuity measurement, ncv check number of counts 2000 power features other power features jaw size: 50 millimeter or 2.0 inch tests ac or dc voltage, ac current and resistance diode check and continuity test data hold salient features: ac 1000 amp. clamp meter ac 750 volt & dc 1000 volt resistance & continuity buzzer 2000 count display & jaw size 50 mm data hold & manual range selection 1 x 9v. battery 4 28 oil pump for dismantling and assembling motor speed 1000 rpm, 2000 rpm, 3000 rpm, 4000 rpm, 5000 rpm type of pump internal gear pump(gerotor), external gear pump 2 set 29 oil stone precisely designed high durability provides smooth finish 1 30 piston ring expander and remover material: steel work with piston rings of 120mm 160mm diameter opening width: 19 cm / 7.5 inch opening length: 25 cm / 9.8 inch handle width: 135 mm / 5.3 please allow 1 2 mm inaccuracy due to manual measurement. 1 31 piston ring groove cleaner comes with three easy to set cutter wheels for quick cleaning of groove cleaner/cutter metric sizes of 1. 2mm, 1. 5mm, 1. 8mm, 2mm, 2. 5mm, 2. 8mm, 3mm, 4mm, 4. 5mm, 5mm, 5. 1 page 7 of 13 5mm cleaner/cutter standard english sizes of 1/16, 5/64, 3/32, 1/8, 5/32, 3/16, 1/4 handles pistons 2 3/4 to 5 diameter adjustable cut angle 32 portable electric drill machine drilling diameter: 10 millimeters ; drill spindleconnecting thread: 43 ; chuck capacity, min./max.: 1.5 – 10 mm color: blue material: ms and plastic operating power: 500 watts used for minor plumbing or repairing tasks and mounting photo frame or paintings easy to use package contents: impact drill, claw hammer, pliers and knife, spirit level, wrench, drill bit for wood, steel and concrete, screws, wall plugs, screw driving bits and nut 1 33 punch letter 4mm product dimensions 18 x 10 x 10 cm; 1.53 kilograms included components 1 letter and number punch set made from carbon steel, hardened to give a solid impression. shiny black oxidised finish. letters consists of 27 pieces a to z and &. number consists of 0 to 9. 1 34 radiator cut section cross flow material aluminium coolant used synthetic liquid, water type customised usage/application automobiles packaging type box condition new 1 35 radiator cut section down flow material aluminium coolant used synthetic liquid, water type customised usage/application automobiles packaging type box condition new 1 36 radiator pressure cap material is stainless steel 1 page 8 of 13 open pressure: 90kpa (13psi) ,product sizes: 65x28mm a faulty radiator cap can cause your car to boil over at a lower temperature designed to function on open cooling systems and overflow reservoir type systems this design allows the cap to be installed and removed much easier than conventional radiator caps 37 tinnman’s shear feature: simple and safe to use knife material: stainless steel metals studs: up to 14 gauge 2 38 soldering copper handle material wooden handle type of tool solder size 500 gms material copper 2 39 straight edge gauge 2 ft. material: steel length:610 mm 2 40 straight edge gauge 4 ft. material: medium carbon steel length:1220mm 2 41 stud extractor set of 3 stanley 5 pc screw extractor set 94 171 (3,6,8,11,14 mm) 1 42 stud remover with socket handle 3/4 stud puller (tool for removing studs) william type made of best hardened and tempered 1 43 surface gauge with dial test indicator plunger type type of product: dial gaugeaccuracy: 0.013 mmrange (mm): 10 mmresolution (mm): 0.01 mm 4 44 tandem master cylinder with booster lighter weight to help increase fuel economy and reduce emissions optimized packaging solutions through smaller component dimensions reduced noise and smooth brake applies to enhance driver comfort available with dual rate or mechanical brake assist functions for enhanced performance easy integration of brake light switch or pedal travel sensor 4 page 9 of 13 compatible with start/stop systems and all esc variants 45 telescope gauge 5/16 6 (8mm to 150mm), stainless steel construction. gage expands in a hole to be measured , locks in place and then removed to determine final hole size using a micrometer or calipers. includes 6 sets, with vinyl case the contact point is hardened tool steel and is fine ground within the final measuring radius the spring is equipped with a knurled locking knob and a knurled fixing area. 4 46 temperature gauge with sensor this dial thermometer is mainly used to measure the temperature of water. the measuring range is 0 120c.features:the measuring range is 0 120c.designed for measuring liquid mainly measuring water temperature.remote reading with capillary tube.the sensor is made of brass material better temperature conductivity than iron or steel.marked temperature scale on the dial clear and convenient for reading.notice:the sensor surface may show slight difference due to the oxidization not quality effect. please in kind prevail.specifications:measuring range: 0 120cgraduation: 2cmeasuring accuracy: (+/ )2%capillary length: 1msensor head size: lenght: 34mm diameter: 6mmthermometer size: dia.: 5.5cm / 2.16inthermometer weight: 50g / 1.78ozpackage size: 6.8 * 6.8 * 7.2cm / 2.67 * 2.67 * 2.83inpackage weight: 71g / 2.5ozpackage list:1 * dial thermometer 2 47 thermostat comes with 50 300 degree thermostat controller it is useful for controlling temperature 2 48 timing lighter measurement and memory of advance, rpm, dwell in degrees, percentage and milliseconds, direct and peak voltage. three digital displays for measurements on 2 or 4 stroke engines up to 2 sparks per rev, top plug coil and dis systems 2 49 torque wrenches (1 each ) drive size: 1/2 inch 1 page 10 of 13 torque range in nm: 5 35, least count for nm range: 2 range in lb ft.: 8 50 least count for lb ft. range: 2 range capacity in kgf. mts: 1 7 least count for kgf mts range: 0.2 range in lbf. ins: 100 600 least count for lbf. ins: 20 torque wrench, torque: 12 68 nm is a premium quality product 1/2 inch torque wrench, torque: 12 68 nm are manufactured by using quality assured material and advanced techniques, which make them up to the standard in this highly challenging field. the materials utilized to manufacture torque range in nm : 50 225 nm drive size : 1/2 inch overall length at min. capacity : 597 mm 50 turbocharger cut sectional view material mild steel condition new weight approx 12.5 kg 1 51 tyre pressure gauge with holding nipple inflation range: 0 250 psi accuracy: ±1% display resolution: 0.1 psi display type: backlit lcd measurement units: psi, kpa, bar, kgf/cm2 2 52 vacuum gauge display type analog accuracy 2.5 % diameter 1.5 inch 1 53 valve spring compressor universal universal engine overhead valve spring compressor valve removal installer toolfeatures:1.designed to remove valve spring quickly without removing cylinder head.2.universal design fits most cars and light trucks.3.offset jaws easily grip and compress valve springs.4.dial adjustment for fast accurate setup.5.zinc and black oxide finish to resist rust.specification:size: 14cm*7.5cm*4cmpackage weight:387gcolor:as shownpackage list:1 pcs valve spring compressor valve removal installer tool 1 page 11 of 13 54 vernier calliper graduation laser engraving not easy to wear, the number is clear, item weight 395 grams, material stainless steel, carbon steel 3 55 water pump for dismantling and assembling power source petrol,diesel, cng engine type hcv,lcv vehicles engine horsepower 20 hp 150hp 4 56 wire gauge (metric ) made from high quality thickness steel. the general tools wire gage is designed to accurately determine the thickness of non ferrous wire and metals such as copper, brass, and aluminum. used on non ferrous metals and wires. featuring a satin finished, this wire gage is made from hardened and tempered heavy gage steel. easy to use. 2 57 automotive exhaust 5 gas analyser (petrol & diesel) or diesel smokemeter usage/application puc product type analyzer power supply 230 features lcd analysis time 3sec warm up time 5mins color cream automation grade automatic display type lcd phase single response time 4~5 sec. (more than 90%) weight 5kg power 230 temperature 55 fast warming up less than 5 min operational temperature 0 40 degree c frequency 50/60hz 1 58 bench lever shears 250 mm blade * 30 mm blade material medium carbun steel 1 59 discrete component trainer / basic electronics trainer 60 dual magnetization yoke capacity 5 kg frequency 50 60 hz phase single phase voltage 220 440 v yoke weight 4 kg material ms,ss etc 1 61 grinding machine (general purpose) d.e. pedestal with 300 mm dia. wheels rough and smooth material steel surface treatment painted feature corrosion resistance 2 62 bench vice heavy duty fully body and spendle made by closed grain grey cast iron, box nut made up of phosphorous bronze, 125 m.m. size ...

Department Of Training And Technical Education - Rajasthan

30505900 open tenders are invited for supply of tools and equipments for fitter trade vernier caliper surface plate file square second cut , file flat second cut safe edge , file flat bastared , file round bastard , file hand second cut , wooden handle forged soldering iron copper bit wooden handle forged soldering iron copper bit. 350 gm 4 9 hand reamer set (tapar pin straight flute) nominal dia 6, 8, 10, 12, 16mm high speed steel 2 10 fire extinguisher (for 4 units) co2 type, foam type 3 kg capacity 2 each 11 torque wrench (standard/ratchet type) 14 to 68 nm drawi size 12mm length 476mm 2 12 power tools for fastening capacity 10 18mm voltage 18v,battery capacity 5.0 ah,max.torque 447 nm,breakaway torque 813 nm,no load speed 0 900/2000 rpm,impacts per minute 0 3100ipm,max bolt dia m18,tool holder 13mm, weight 2.12 kg,with 2 batteries variable speed trigger help to provide speed control,led light to help illuminate dimly lit areas 2 13 different profile gauges (plate type) for demonstration metric standard working length 190 mm,max. profile depth 81 mm,needle diameter 1.0 mm 8 14 temperature gauge range 0 150°c temperature element : gas inmetal,stem diamater : 8 mm,stem length : 80 to 250 mm,ranges available : ( 20 to 80)(0 to 60)(0 to 100)(0 to 160)deg. c,case : stainless steel,window : safety glass,dial : white aluminium,pointer : adjustable pointer,accuracy : 1 % of fs,connection : 1/2 bsp 2 15 dowel pin ( straight) dia. 1 length 4 (mat: stainless steel) 2 16 standard tap screws m3, m4, m5, m6, m8, m10, m1 lapping plate dia. 6 hand scrapped finish 4 18 caps screws m6, m8, m10, m12 4 19 drill gauges letter drill gauge (a to z) , number drill gauge (1 to 60) , metric drill gauge (1.5mm to 12.5mm, 30 holes) titanium_grade_5 4 20 cast iron globe valve (flanged type) 150nb, class# 150 flange:ansi125 b16.1 4 21 c.i. sluice / gate valve (flanged type) 150nb, class# 150 flange:ansi125 b16.1 4 22 stop cock 25nb (2 way, threaded end) casting: 100% virgin brass ingots certified for 63% copper to ensure flawless casting, chrome plated 4 23 slip on forged steel flange 150nb, ansi b16.5, class#150 8 24 bolt & nut with washer m20 x 2.5 x 90 long (part thread hex. head) 32 25 pipe threading die with handle ratchet type die head of 1/2 , 3/4 and 1 4 26 pulleys (for v belt or flat belt) to fit on 50mm dia. shaft with key slot cast iron 2 27 v belt and flat belt to fit on pulley 2 page 4 of 10 28 packing gasket ptfe gasket roll small size 2 29 washer, clutch, keys, jib, cotter & circlip minimum 25mm size, carbon steel material 4 30 bearing different types each type of diameter 25mm (min.) 2 set 31 lifting sling 8mm nominal dia. single leg sling up to 800kg capacity 3 variations available: soft eyes each end, thimble eyes each end, masterlink c/w sling hook & catch 2m height of lift as standard up to 10m available bs en13414 1:2003 4 32 bearing extractor universal gear puller 2 or 3 jaws adjustable chrome plating to provide a reliable and effective rust and corrosion protection. drive screw is covered by black phosphating, which provides maximum strength and longevity to the gear puller, puller jaws allow for easy gripping and access to tight spaces. 2 33 pulley extractor universal gear puller 2 or 3 jaws adjustable chrome plating to provide a reliable and effective rust and corrosion protection. drive screw is covered by black phosphating, which provides maximum strength and longevity to the gear puller, puller jaws allow for easy gripping and access to tight spaces. 2 34 stake hatchet with leg. 300 x 200 x 20 mm material ss 4 35 stake grooving. 100 x 100 x 300 mm material ss 4 36 depth micrometer. 0 25 mm accuracy 0.01 mm with standard set of extension rods upto 200 mm measuring faces: carbide. 2 page 5 of 10 37 digital micrometer outside. 0 25 mm l.c. 0.001 mm.. • measuring faces: carbide. • supplied with a ratchet stop for constant measuring force. 2 38 digital vernier caliper 0 200 mm l.c. 0.01 mm (optional)• resolution*1 : 0.01 mm or 0.0005 in/0.01 mm • display*1 : lcd • scale type*1 : absolute electromagnetic induction linear encoder • max. response speed*1 : unlimited • battery: sr44 (1 pc), 938882, for initial operational checks (standard accessory) • battery life*1 : approx. 5 years under normal use • dust/water protection level*1 : ip67 (iec 60529)*3 *1 digimatic models *2 analog models *3 rustproofing shall be applied after use if caliper was in contact with coolant. 2 39 compressor unit suitable for pressure: 30 liter horizontal tank and 0.36 cfm @ 90 psi. 110 max psi provides plenty of power to tackle diy projects. operates on 220 volt single phase electricity.oiled pump for maintenance free ownership and strong, reliable motor output conveniently placed gauges are easy to read and this compressors compact design makes it easily portable suitable for tire and ball inflation, its also perfect for powering air brushes, air/ brad nailers, upholstery projects and more power : 2 hp, cylinder : 48x1 mm, speed : 2850 r/min, pressure : 8 bar, weight : 30 kg 2 40 pneumatic trainer kit, each consisting of the following matching components and accessories: 2 i. single acting cylinder max. stroke length 50 mm, bore dia 20 mm 2 ii. double acting cylinder max. stroke length 100 mm, bore dia 20 mm, magnetic type 2 iii. 3/2 way valve manually actuated, normally closed 2 page 6 of 10 iv. 3/2 way valve pneumatically actuated, spring return 4 v. one way flow control valve 2 vi. 5/2 way valve with manually operated switch 4 vii. 5/2 way valve pneumatically actuated, spring return 2 viii. 5/2 way pneumatic actuated valve double pilot 2 ix. 3/2 way roller lever valve direct actuation normally closed 4 x. shuttle valve 2 xi. two pressure valve 2 xii. pressure gauge 0 16 bar 2 xiii. manifold with self closing nrv, 6 way 2 xiv. pushbutton station for electrical signal input with 3 illuminated momentary contact switches (1 no + 1 nc) and 1 illuminated maintained contact switch (1 no + 1 nc), contact load 2a xv. relay station with 3 relays each with 4 contact sets (3no+1nc or change over type), 5 a 2 xvi. 3/2 way single solenoid valve with led 2 xvii. 5/2 way single solenoid valve with manual override and led 2 xviii. 5/2 way double solenoid valve with manual override and led 2 xix. power supply unit, input voltage 85 – 265 v ac, output voltage: 24 v dc, output current: max. 4.5 a, short circuit proof. 2 xx. profile plate anodised aluminium 1100x700 mm, with carriers, mounting frames and mounting accessories (to be fitted onto the pneumatic workstation) 2 41 pneumatic workstation with 40 square mm aluminium profile legs, wooden work surface, and one pedestal drawer unit having 5 drawers, each with handles and individual locks, on metallic full panel drawer slide: 1) work table – size(approx.) l1200mmxw900mmxh900mm, with four castor wheels including two lockable wheels at the front side, (2) drawer – size (approx.) – l460mmxw495mm xh158mm each, and overall size of drawer unit (approx.) l470mmxw495mmxh825mm and (3) drawer slide height (approx.) 85mm. 2 42 carrier for mounting components, such as pb & relay boxes. 2 43 cut section model for pneumatic components 2 44 hydraulic trainer kit, each consisting of the following matching components and accessories: 2 page 8 of 10 i. hydraulic power pack with (1) external gear pump having a delivery rate of 2.5 lpm, (approx.) @ 1400 rpm operating pressure 60 bar, coupled to a single phase ac motor (230 v ac) having start capacitor and on/off switch and overload protection, (2) pressure relief valve adjustable from 0 – 60 bar, (3) oil reservoir, ≥5 litres capacity having sight glass, drain screw, air filter, and p and t ports. 2 ii. pressure relief valve pilot operated 2 iii. drip tray, steel size 1160 mm x 760 mm. 2 iv. pressure gauge glycerin damped, indication range of: 0 – 100 bar 2 v. four way distributor with five ports, equipped with a pressure gauge 2 vi. double acting hydraulic cylinder with a control cam, piston diameter16 mm, piston rod diameter10 mm, stroke length 200 mm. 2 vii. suitable weight for vertical loading of hydraulic cylinder 2 viii. mounting kit for weight for realizing pulling and pushing load. 2 ix. 3/2 way directional control valve with hand lever actuation. 2 x. 4/2 way directional control valve with hand lever actuation. 2 page 9 of 10 xi. 4/3 way directional control valve closed centre position, with hand lever actuation. 2 xii. non return valve. 2 xiii. pilot operated check valve pilot to open. 2 xiv. one way flow control valve with integrated check valve. 2 xv. t connector with self sealing coupling nipples (2 nos.) and quick coupling socket (1 no.). 4 xvi. profile plate, anodised aluminium, 1100x700 mm, with carriers, mounting frames and mounting accessories (to be fitted onto the hydraulic workstation) 2 45 hydraulic workstation with 40 square mm aluminium profile legs, wooden work surface, and one pedestal drawer unit having 5 drawers, each with handles and individual locks, on metallic full panel drawer slide: 1) work table – size(approx.) l1200mmxw900mmxh900mm, with four castor wheels including two lockable wheels at the front side, (2) drawer – size (approx.) – l460mmxw495mm xh158mm each, and overall size of drawer unit (approx.) l470mmxw495mmxh825mm and (3) drawer slide height (approx.) 85mm. 2 46 cut section models for hydraulic components etc ...

Sarva Shiksha Abhiyan Authority - Rajasthan

30474853 supply and installation of construction supply and installation of construction ( assistant mason ) , concrete mixer half bag concrete mixer 220 ltr, 230v 50 hz, 900 w s6 30%, drum opening 400mm, drum capacity 220 litre, drum speed 30 / min, weight 80 kg, size 80 ( mm ) x 50 ( mm ) , electric drill up to 10mm taparia / gadore / jhalani / pie or any other good quality brand, rated power input500 w, no load speed 0 2600 rpm, power output 250 w, weight without cable 1.5 kg, drill spindle connecting thread 3 / 8 24 unf, chuck capacity 1 10 mm, impact are at no load speed 0 41600 bpm , safety belt plastic drums platic water drums with lock ring to lock and seal, must have strong handles on side to easy carry / transport. capacity 200 ltr. , water tank water tank to store water ( must be with cover ) , troweliron mason trowel with wooden handle ( 10 to 12 inches long and 6 inches wide ) , plumb rule and bob heavy iron plumb rule and bob with chord ( at least 3 meter ) approx. weight around 1 kg , spirit level taparia 300 mm spirit level level accuracy: 1 mm / m width ( mm ) : 50 mm weight ( kg ) : 0.165 kg length ( mm ) : 300 mm height ( mm ) : 20 mm material: aluminium frame and rubber moulding , try square stailness ateel, 12 x 24 inch, 2mm thickness, approx 1 kg in weight , line and pins large headed line pins with zinc coating size 2mm , depth 12cm, along with 18 meters of builders line ( or as per need ) , brick bolster / brick chisel made of carbon steel with dual hand guard, size 4 x 8, 1 / 2 inch , brick hammer made of iron with a hardened striking face and an opposing end with a roughing and shaping chisel blade attached with a wooden handle, size 12 inch, weight approx. 1 kg , scutch hammer made of iron withcomb slots at both ends to fit replaceable one inch scutch combs or chisel attached with a wooden handle, size 12 inch, weight approx. 1 kg , pick axeone side pointy plus one side chisel oval eye pick axe made of high quality iron, 10mm in thickness at widest point & 5mm at the narrowest point , crowbari ron bar with a flattened end, used as a lever, diameter 25.4, length 1meter, weight approx. up to 3 kg , chisel 6 inch iron chisel with thickness of 20mm at front and 18mm at back , mash hammer 18 mash hammer hammer forged from a single piece of hard iron with approx. 2 kg in weight, round eye, attached with a wooden handle , boaster with carbide tips made of heavy carbon steel. available with or without rubber grip. , spall hammer large hammer with a flat face and straight peen for breaking and rough dressing stone. the head is made of hard iron with wooden handle attached to it, weight approx. 2 kg, around 15 inches in size , scrabbling hammer one side flat plus one side claw, high carbon steel hammer to dress stone and bricks approx. half kg in weight , bevel 32mm bevel edge chisel brick stone masonry tool made of high grade steel, width 25mm, length 280mm , spade spade with sharper tips of metal made of hard iron, round eye with a wooden handle attached, weight approx. 3 to 4 kg , picks and beaters used for track maintenance, made of hard iron, length 1.5 feet, weight approx. 3 to 4 kg , wooden float flat board with a handle to hold, made of hard wood for durability, size: 12? ( 300mm ) x 5? ( 125mm ) . , metal float smooth metallic plain that is applied on flattened layers of mortar and concrete during surface finishing, made of steel with a plastic or wooden handle, size 12? ( 300mm ) x 5? ( 125mm ) . , floating rule floating rule made of aluminium, at least 4 meter long weight up to 2 kg , scratcher scratcher trowel made of steel 16 x 4 1 / 2 with wood handle , trowel khurpi ) made of hard iron with a wooden handle, 10 to 12 inch in size , measuring tape 5 meter measuring tape of 5 meter of industrial type, made of steel, thickness 1 mm, length 5 meter. , wooden ladderb amboo ladders of 10 / 12 feet , wooden pole ( balli ) wooden poles of 10 & 12 feet for making wooden decks dozen of diifrent size , wooden sieve wooden sieve of large size , tasla galvanized iron tasla for construction, size 20 inch, hardness 50 7 hrc, thickness 1mm approx. , double wheel barrow double wheel barrow with rubber wheels, capacity 200 kg, length, width & depth 34x24x12, tapper depth 15 inch. , air wheel hand trolley air wheel hand trolley with 250 weight capacity, made of hard iron, toe plate width 240 mm, weight approx. 16.5 kg, size: 1249x650x578 mm, wheel size: 10x3.5 inch , racking needle standerd ( as per need ) , hacking tool satnderd ( as per need ) ...