Sawai Man Singh Medical College - Rajasthan

38288639 surgical and disposable item rate contact surgical and disposable item rate contact in pddu hospital, jaipur , 1 pcs trasnparent colostomy body fit 60mm kit , 1 pcs trasnparent colostomy body fit bag 60mm , 100% polysiloxane based scar management , 2 pcs convex base ostomy body fit 60 mm kit , 2 pcs convex base ostomy body fit 70 mm kit , 2 pcs convex base ostomy body fit bag 60 mm , 2 pcs convex base ostomy body fit bag 70 mm , 2 pcs flat base ostomy body fit 60 mm kit , 2 pcs flat base ostomy body fit 70 mm kit , 2 pcs flat base ostomy body fit bag 60 mm , 2 pcs flat base ostomy body fit bag 70 mm , 3 french diagnostic catheters for neonatal use 3 fr. , 3 way adopter , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements , 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) , 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) , 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) , 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) , 3 d mesh , 6,1/2 circle cutting 48 mm ccs,stainless steel 4 x 45 cm , 6,1/2 circle round body 44 mm blunt point stainless steel 2 x 75 cm , 6,1/2 circle round body 44 mm blunt point,stainless steel 4 x 45 cm , abdominal belt 14cm , abdominal binder 25cm , abdominal drain kit (with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 , abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 , abdominal support 9 , abdominal wound drain , abs wrap (neoprene) , absorbable 5 mm hernia mesh fixation device 15 screw shaped , absorbable 5 mm hernia mesh fixation device 30 screw shaped , absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1/2 circle taper point ct 1 40 mm needle 90 cm suture size 1 , absorbable antibacterial polydiaxonone monofilament taper point surgical suture, made up of polydiaxonone coated with triclosan voilet monofilament 1/2 circle taper point loop ct sgle armed 65 mm needle 122 cm suture size 1 , absorbable gelatin sponge 80 x 50x 10mm , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 , absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 , absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 2 0 rb ½ circle 30 mm 70 cm , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 3 0 cc 3/8 circle 16 mm 45 cm 2442 , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 4 0 cc 3/8 circle 16 mm 45 cm 2442 , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 5 0 cc 3/8 circle 16 mm 45 cm 2442 , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 5 0 rb oval 1/2 circle 16 mm 45 cm , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 6 0 rb micro point ¼ circle 8 mm 45 cm 2670 , absorbable surgical suture (synthetic )coated polyglactin/pga 910 voilet 6 0 rc micro point ¼ circle 8 mm 45 cm 2670 , absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm , absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm , absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm , absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) , absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) , absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) , absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm , absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm , absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm , absorbable surgical suture polyglyconate, monofilament sutures (1/2 circle oval rb contrast needle 20 26mm,suture length 70cm) , absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 11 mm needle length 90 cm , absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm , absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 11 mm needle length 90 cm , absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 17 mm needle length 90 cm , absorbable surgical suture sterilized surgical needled suture loop monofilament polydiaxanone violet no 1 40mm1/2 circle reverse cutting length 90 cm , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1/2 circle round bodied 30 mm needle, length 70cm size 3 0 , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1/2 circle round bodied 30 mm needle, length 70cm size 4 0 , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1/2 circle round bodied 30 mm needle, length 70cm size 5 0 , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 2 0 rb 30 mm needle length 75 cm , absorbable surgical suture sterilized surgical single armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm , absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm , absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm , absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed , absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm , absorbable surgical suture, sterilised surgical needled suture polyglyconate, monofilament sutures (1/2 circle oval rb needle 26 30mm needle, suture length of 70cm) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) , absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) , absorbable synthetic unidirectional dual cut angle barbed with welded loop end made up with polyglyconate 2 0 26 30 mm 30 cm 1/2 circle taper point , absorbarble fixation device all sizes secure strap 25 , absorbent cotton wool i.p. 200gm (non sterile) , absorbent cotton wool i.p. 75 gm (non sterile) , act tubes us fda + ce/ dgci approved· , actim partis rapid test , activated dialdehyde solution (cidex & others ) , adult conventional dual limb water trap , adult conventional single water trap , adult endotracheal sizes 10mm. , adult endotracheal sizes 5.5mm. , adult mask for tracheostomy , adult single heated wire breathing system , adult ventilator circuit single limb portable , adult ventilator circuit single water trap , advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length , advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide , advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide , advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , ahg (coombs) (1x10) , air mattress , alcohol swab , alice forceps 6 , aluminium foil , ambu bag mask (adult) (autoclavable)(silicon) , ambu bag mask (adult) (non autoclavable) , ambu bag mask (child/infant) (autoclavable)(silocon) , ambuaura no. 3 , ambuaura no. 4 , amplatz catheter amplatz left (al) 4fr , amplatz catheter amplatz left (al) 5fr , amplatz catheter amplatz left (al) 6fr , amplatz catheter amplatz left (al) 7fr , amplatz catheter amplatz left (al) 8fr , amplatz catheter amplatz right (ar) 4fr , amplatz catheter amplatz right (ar) 5fr , amplatz catheter amplatz right (ar) 6fr , amplatz catheter amplatz right (ar) 7fr , amplatz catheter amplatz right (ar) 8fr , amplatz wire ptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm , anatomical face mask sizes 0 , anatomical face mask sizes 0a , anatomical face mask sizes 2 , anatomical face mask sizes 3 , anatomical face mask sizes 4 , anatomical face mask sizes 5 , anatomical face mask sizes 6 , angio.kit/ptca kit (3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce/ approved , angiographic double leumen tracking catheter 4 french , angiographic double leumen tracking catheter 5 french , angiographic double leumen tracking catheter 6 french , angiographic sizing pigtail catheter 5fr , angiographic sizing pigtail catheter 6fr , angiographic sizing pigtail catheter 7fr , angiography catheter 4f 6f , angiography needle 18g , angiography needle 19g , angiography needle 20g , angiography needle 21g , angiography radial catheters 4 6f , angiography wire long length ptfe guidewire in .035, .038, , angiography wire ptfe guidewire in .035, .038, in regular length , ankle binder , ankle brace , ankle splint , ankle support (neoprene) , anklet (pair) , anklet comfeel (single) , anterior chamber iol , anti a.b.c. set (1x10) , anti bacterial liquid hand wash 250ml , anti bacterial liquid hand wash 500ml , anti h for bombay groping , anti microbial gloves 6 inches , anti microbial gloves 6.5 inches , anti microbial gloves 7 inches , anti microbial gloves 7.5 inches , anti microbial gloves 8 inches , antimicrobial silver dresssing sterile 15x20cm , antimicrobial silver dresssing sterile sizes:10x12cm , aortic punch 2.5 , aortic punch 3 , aortic punch 3.5 , aortic punch 3.6 , aortic punch 4 , aortic punch 4.5 , aortic punch 5 , aortic punch 5.5 , aprin plastic , apron cloth (white) , apron for paramedical staff , apron, plastic, disposable, adult size , arterial pressure monitor lines (100 cm long) , arterial pressure monitor lines (150 cm long) , arterial pressure monitor lines (200 cm long) , arthoscopy drape , articulating endo cutter 35mm white/blue , asepto pump , asepto syringe with transparent bulb sterile, 60 ml , ash brace (hyper extension brace) , auto clave lable , autoclave signal lock (indicator) , auxiliary crutch (pair) , av line , b p armlet cloth (adult & pead.) , b p armlet rubber (adult & pead.) , b p bulb with connector(adult & pead.) , b p cuff adult , b p cuff neonatal , b p cuff pediatric , b p instrument digitalpediatric & adult , b p instrument mercury(pediatric & adult) , b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 , b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 , b.p. bulb , baby care kit , baby diapers large , baby diapers medium , baby diapers small , back rest l , back rest m , bacterial filter , bain circuit (adult) , bain circuit (child) , bakri baloon , balloon inflation catheter , balloon tipped angiography catheter 5f , balloon tipped angiography catheter 6f , balloon tipped angiography catheter 7f , bandage cotton 3mtr*2 , bandage cotton 3mtr*3 , bandage cotton 3mtr*4 , bandage cotton 3mtr*6 , bandage suspensory , bare platinum coil complex shape, soft, electrolytic detachable 1 to 25mm , bare platinum coil complex shape, soft, mechanically detachable 1 to 25mm , bare platinum coil helical shape, soft, electrolytic detachable 1 to 25mm , bare platinum coil helical shape, soft, mechanically detachable 1 to 25mm , basin 40 cm , basx 11mm x 100mm trocar and stability sleeve , basx 12mm x 100mm trocar and stability sleeve , basx 5mm x 100mm trocar and stability sleeve , basx bladeless sleeve , battery operated 60mm articulating endo cutter with a disposable battery pack , below knee stockings , berman catheter 4 french , berman catheter 5 french , berman catheter 6 french , berman catheter 7 french , bio medical waste bags barcoded vergine grad 1 black (24x26)iso&ce(per 1 kg) , bio medical waste bags barcoded vergine grad 1 black (24x28)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 black (29x39)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 blue (24x26)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 blue (24x28)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 blue (29x39)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 green (24x26)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 green (24x28)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 green (29x39)iso&ce(per 1 kg) , bio medical waste bags barcoded vergine grad 1 red (24x26)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 red (24x28)iso&ce(per 1 kg) , bio medical waste bags barcoded vergine grad 1 red (29x39)iso&ce(per 1 kg) , bio medical waste bags barcoded vergine grad 1 yellow (24x26)iso&ce (per 1 kg) , bio medical waste bags barcoded vergine grad 1 yellow (24x28)iso&ce(per 1 kg) , bio medical waste bags barcoded vergine grad 1 yellow (29x39)iso&ce (per 1 kg) , biological glue with thrombin & aprotinin 1ml , biological glue with thrombin & aprotinin 2ml , biopsy guns 14g 10cm , biopsy guns 14g 16cm , biopsy guns 16g 10cm , biopsy guns 16g 16cm , biopsy guns 18g 10cm , biopsy guns 18g 16cm , biopsy guns 18g 20cm , biopsy guns 18g 25cm , biopsy guns 20g 10cm , biopsy guns 20g 16cm , bipsy gun with compitible co axial needle 12gx11cm , bipsy gun with compitible co axial needle 12gx15cm , bipsy gun with compitible co axial needle 12gx20cm , bipsy gun with compitible co axial needle 14gx11cm , bipsy gun with compitible co axial needle 14gx15cm , bipsy gun with compitible co axial needle 14gx20cm , bipsy gun with compitible co axial needle 16gx11cm , bipsy gun with compitible co axial needle 16gx15cm , bipsy gun with compitible co axial needle 16gx20cm , bipsy gun with compitible co axial needle 18gx11cm , bipsy gun with compitible co axial needle 18gx15cm , bipsy gun with compitible co axial needle 18gx20cm , bipsy gun with compitible co axial needle 20gx11cm , bipsy gun with compitible co axial needle 20gx15cm , bipsy gun with compitible co axial needle 20gx20cm , black goggles , block used in thyroplasty (sialestic and gortex) 70*50 mm with 20 mm thickness , blood administration set blood transfusion set , bmw plastic container small white (0.08 litre) , bmw plastic container small white (1.50 litre) , bmw plastic container small white (3.50 litre) , bmw plastic container small white (5.00 litre) , bmw sefety card box blue(05 litre) , bmw sefety card box blue(10 litre) , bmw sefety card box blue(20 litre) , bone cement , bone marrow biopsy needle 11g 4 & 6 , bone marrow biopsy needle 13g 3.5 , bone marrow biopsy needle 8g 4 & 6 , bone wax sterilised , bovine albumin (1x10) , bowl 12 cm , bp blade , braided e caprolactone coated lactomer 1 90cm gs 25,37 40mm1/2 circle reverse cutting , braided e caprolactone coated lactomer 1, 90cm gs 25,37 40mm1/2 circle taper point , braided e caprolactone coated lactomer 2 0 90cm gs 25,3omm1/2 circle taper point , braided e caprolactone coated lactomer 0 90cm gs 24 , violet 40mm 1/2 circle taper point , braided e caprolactone coated lactomer 1 90cm gs 25 , undyed 37 40mm 1/2 circle reverse cutting , braided e caprolactone coated lactomer 1, 90cm gs 24 , violet 40mm 1/2 circle taper point , braided e caprolactone coated lactomer 1 0 90cm gs 25 , undyed 37 40mm 1/2 circle reverse cutting , braided e caprolactone coated lactomer 2 0 90cm gs 21 , undyed 30mm 1/2 circle taper point , braided e caprolactone coated lactomer 3 0 75cm c 14 , undyed 24mm 3/8 circle reverse cutting , braided e caprolactone coated lactomer 3 0 75cm cv 25 , violet 20 22mm 1/2 circle taper point , braided polyester caoted with polybutylate 2, 26mm 1/2 circle rc 75cm , braided polyester caoted with polybutylate 2 0 10x75 2x plgt, blue & white 25mm 1/2 circle taper point oval pledget , braided polyester caoted with polybutylate 2 0 8x75cm 2x plgt , blue & white 16mm 1/2 circle tapercutting oval pledget , braided polyester caoted with polybutylate 5, 55mm 1/2 circle rc 75cm , braided polyester caoted with silicon 2, 26mm 1/2 circle rc 75cm , braided polyester caoted with silicon 2 0 10x75 2xcv 305 pgt , blue & white 25mm 1/2 circle taper point oval pledget , braided polyester caoted with silicon 2 0 8x75cm 2xy 31 plgt , blue & white 16mm 1/2 circle tapercutting oval pledget , braided polyester caoted with silicon 5, 55mm 1/2 circle rc 75cm , breast nodule localizationwire , breast pump , bubble cpap system with nasal cpap kitshould containneonatal 15mm inspiratory limb heated wire 1.6m , buffant clip cap , burr tips (70 mm length) cutting /0.8 mm , burr tips (70 mm length) cutting 0.5 mm , burr tips (70 mm length) cutting 0.6 mm , burr tips (70 mm length) cutting 1.6 mm , burr tips (70 mm length) cutting 2.3 mm , burr tips (70 mm length) cutting 2.8 mm , burr tips (70 mm length) cutting 3 mm , burr tips (70 mm length) cutting 3.5 mm , burr tips (70 mm length) cutting 4 mm , burr tips (70 mm length) cutting 5 mm , burr tips (70 mm length) diamond /0.8 mm , burr tips (70 mm length) diamond 0.5 mm , burr tips (70 mm length) diamond 0.6 mm , burr tips (70 mm length) diamond 1.6 mm , burr tips (70 mm length) diamond 2.3 mm , burr tips (70 mm length) diamond 2.8 mm , burr tips (70 mm length) diamond 3 mm , burr tips (70 mm length) diamond 3.5 mm , burr tips (70 mm length) diamond 4 mm , burr tips (70 mm length) diamond 5 mm , burr tips fissure burr 70 mm to 95 mm length 1 mm , burr tips fissure burr 70 mm to 95 mm length 3, mm , burr tips fissure burr 70 mm to 95 mm length 5 mm , by pass graft catheter 4fr , by pass graft catheter 5fr , by pass graft catheter 6fr , by pass graft catheter 7fr , by pass graft catheter 8fr , caeseream drap sheet sterile disposable , capillary tube glass , capsular tension ring , capsular tension ring 10 mm , capsular tension ring 11 mm , capsular tension ring 12 mm , carbolic acid (phenol) 400 ml , carreegated rubber drainage card/sheet , cast cover , cast shoe , casting tape synthetic , casting tape synthetic 12.5cm x 3.6 mtr , casting tape synthetic 15cm x 3.6 mtr , casting tape synthetic 7.5cm x 3.6 mtr , catheter mallecot , catheter mount , catheter plain rubber , catheter stabilization device sterile latex free sutureless , catheter suction , catheter supracath , catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material , cautery lead hand switch , cautery lean monopolar , cautery patient plate code 4 , cautry hand switch , ceasarian drape with funnel 35x15 , centella asiatica extract based skin moisturization and antiscar gel , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , central line triple lumen 8.5 fr with 16cm / 20cm catheter , central neck line double lumen (3 nobel metal coated (gold, silver, palladium)central lumen catheter, double lumen) , central venous catheter double lumen , central venous catheter double lumen (pead) , central venous catheter double lumen pro , central venous catheter single lumen , central venous catheter single lumen (pead) , central venous catheter single lumen pro , central venous catheter triple lumen , central venous catheter triple lumen (pead) , central venous catheter triple lumen pro , cervical collar hard adjustable , cervical collar soft , cervical collar soft with support , cervical collar with 12 sizes settings , cervical collar with 16 sizes settings , cervical orthosis (philadelphia) ethafoam , cervical orthosis (philadelphia) plastazote , cervical pillow regular , cervical traction head halter , cervical traction kit (sitting) , cervical traction kit (sitting) with weight bag , cervical traction kit (sleeping) , cervical traction spreader bar , chemotherapy port & non coring needles(pediatric) , chemotherapy port and non coring needles(adult) , chest binder , chest drainage catheter , chest drainage catheter with trocar insitu (set) , chlorhexidine gauze dressing 10cmx10cm tin , chlorhexidine gauze dressing 10cmx30cm pouch , chlorhexidine impregnated paraffin gauze 30x10 cm , chlorhexidine impregnated paraffin roll 15 cm x 1 , chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 , chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 , chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 , cidex tray with lid pvc , cineon cartidege , circular cartidege , circular stapler 33mm , clavicle brace with buckle , clavicle brace with velcro , close wound drainage device under negative pressure (closed wound suction unit) 10 no , close wound drainage device under negative pressure (closed wound suction unit) 8 no , close wound drainage device under negative pressure (closed wound suction unit) no. 12 , close wound drainage device under negative pressure (closed wound suction unit) no. 14 , close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 , close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 , close wound drainage set for major surgery , closed suction catheter for paediatrics 10fr , closed suction catheter for paediatrics 12fr , closed suction catheter for paediatrics 5fr , closed suction catheter for paediatrics 6fr , closed suction catheter for paediatrics 7fr , closed suction catheter for paediatrics 8fr , closed suction catheter has isolated turbo cleaning chamber 12 fr. , closed suction catheter has isolated turbo cleaning chamber14 fr. , closed suction catheter mdi port 12 fr. , closed suction catheter mdi port 14 fr. , clot retrieval sheath 16fr , clot retrieval sheath 20fr , clot retrieval sheath 24fr , coeliac axis catheter , collar soft (firm density) , colostomy bag, complete unit , combind spinal epidural kit big , combined dressing pad 10x10 , combined dressing pad 20x20 , commbs card for cross match (1x144 test) , compression stocking below knee , compression stocking mid thigh , connecting cable for ultrasonic harmonic scalpel for lap energy with ace plus shear hp054 , connecting cable for ultrasonic harmonic scalpel for open energy with focus plus shear hp blue , contoured l.s. support , cool bandage , core biopsy instrument with compatible co axial needle (automatic disposal) , cotton bandages (non sterile) , size 10 cm x 4m , cotton bandages (non sterile) , size 7.5 cm x 4m , cotton duret size : 12’x15’ , cotton duret size : 15’ x18’ , cotton roll400 grams , cotton roll 100 grams , cotton roll 200 grams , cournard catheter 4 french , cournard catheter 5 french , cournard catheter 6 french , cournard catheter 7 french , cournard catheter 8french , cover slip , crepe bandage b.p. 10 cm x 4 meter , crepe bandage b.p. 15 cm x 4 meter , crescent , crescent knife , curtain cloth cotton , curved cutter stapler 40 mm linear cutter , curved green cartridge having close staple height of 2.0 mm , curved tip & stepped cartridges face from inner to outer side 2.0,2.5 and 3.0 mm , curved tip & stepped cartridges face from inner to outer side 3.0,3.5 and 4.0 mm , cutting & coagulations device with with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. , cutting &coagulations device with tissue fusion ligasure technology , cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries , cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries , cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer , cutting &coagulations device with with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. , cvp manometer , dead body bag 7x3 ft size , diagnostic catheter ar 1 aka amplatz right 5fr , diagnostic catheter ar 1 aka amplatz right 6fr , diagnostic catheter h 1 aka headhunter 4fr , diagnostic catheter pigtail 5fr , diagnostic catheter sim 1 aka simmons 4fr , diagnostic catheter sim 1 aka simmons 5fr , diagnostic catheter sim 2 aka simmon 5fr , diagnostic catheter sim 3 aka simmon 5fr , diagnostic catheter vert angled tip 125cm , dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , diaper adult ext. large , digital thermometer , disposable 10 mm endoscopic clip applier large size , disposable 10 mm endoscopic clip applier medium/large size , disposable baby carryingsheet , disposable bed sheet (100*150cm) , disposable bed sheet (120*200cm) , disposable bone marrow biopsy needle , disposable c arm cover , disposable cesarean kit , disposable cesarean section drap sheet , disposable clip applier preloaded with 20 clips medium , disposable clip applier preloaded with 20 clips small , disposable delivery kit , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter , disposable laparoscopic clip applier with 16 clips, 5mm diameter , disposable mva syringe , disposable needle 16g x 1 inch , disposable needle no 26, 22 & 24 & all size , disposable non woven leminated eto sterile bed sheet 116x213 , disposable non woven leminated eto sterile bed sheet 130x250 , disposable non woven leminated eto sterile bed sheet 160x250 , disposable ot gowns 25 gsm , disposable ot gowns 40gsm , disposable pillow cover standard size , disposable ppe kit for hiv etc , disposable semi automatic core biopsy instrument , disposable sga anatomical curve sizes 1 , disposable sga anatomical curve sizes 1.5 , disposable sga anatomical curve sizes 2 , disposable sga anatomical curve sizes 2.5 , disposable sga anatomical curve sizes 3 , disposable sga anatomical curve sizes 4 , disposable sga anatomical curve sizes 5 , disposable sga anatomical curve sizes 6 , disposable skin drap sheet , disposable spo2 sensor , disposable sterile surgical rubber gloves size 8 inches,powder free , disposable sterile surgical rubber gloves size 8 inches,powdered , disposable sterilized ot gowns all types (male/femal)) , disposable sterilized ot towel sheet all types , disposable sterilized scrub suits all types , disposable surgical drap/trolly cover,all sizes , disposable surgical padsizes 10x10 cms , disposable surgical pad sizes 10x20 cms , disposable surgical sponge 25x25 cms , disposable surgical sponge 30 x 30 cms , disposable surgical sponge 40x40 cms , disposable surgical swabsizes 5x5 cms , disposable surgical swab sizes 10 x 10 cms , disposable surgical swab sizes 15x15 cms , disposable transducers , distal access catheter 5 , distal access catheter 6 , distance vision drum , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , double lumen catheter size 10 frx12 cm , double lumen catheter size 11.5 frx13.5 cm , double lumen catheter size 12 frx13 cm , double lumen catheter size 12 frx13 cm , double lumen catheter size 12 frx16 cm , double lumen catheter size 8 frx9 cm , double lumen closed suction set , double lumen endobronchial tube left: size 28fr , double lumen endobronchial tube left: size 32fr , double lumen endobronchial tube left: size 35fr , double lumen endobronchial tube left: size 37fr , double lumen endobronchial tube left: size 39fr , double lumen endobronchial tube left: size 41fr , double lumen endobronchial tube right: size 35fr , double lumen endobronchial tube right: size 37fr , double lumen endobronchial tube right: size 39fr , double wall resuscitator with peep valve in adult , double wall resuscitator with peep valve in paediatrics , drainable pouch 45mm, , drainable pouch 57mm, , drainable pouch 70mm , drape for i.v. catheter , drape sheet 90 x 140 cms disposable sterilized , draw sheetsize: 90 x 145 cm (coloured) , draw sheet white & coloured 70 x 70 , draw sheet white & coloured 90 x 90 , dressing drum 12x15 seamless , dropping bottle125 ml , dry lithium heparin pre filled abg syringe with air removal filter cap 1ml , dry lithium heparin pre filled abg syringe with air removal filter cap 3ml , duraplast: 1 & 1.5 , duster coarse (ponchha) size 60 x 60 cms , duster grey size 45 x 45 cms , dvt stockings , ear pack/wick (12*24 mm length) , ecg electrode , ecg electrode neonatal , ecg paper role for 8208/8408 , echelon flex 45mm endocutters 340mm shaft length , echelon stapler 45 mm blue reload , echelon stapler 45 mm green reload , echelon stapler 45 mm white reload , echelon stapler 60 mm blue reload , echelon stapler 60 mm gold reload , echelon stapler 60 mm green reload , echelon stapler 60 mm white reload , echelon stapler flex 60 mm endopath cutter , eco shield , eco shield solution 1 lit , edta vial , eea circular stapler purple colour medium thick , elastic adhesive bandage 2 , elastic adhesive bandage 3 , elastic adhesive bandage 4 , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property , elastic head strap cannulas pediatric , elastic knee support , elastic shoulder immobiliser , elastic wrist splint , elbow crutch adjustable , elbow o drape , elbow support , electric plaster cutter armature , element , elongated aerosol mask adult , elongated aerosol mask pediatric , elongated three in one adult mask , endo catch specimen removal kit: with 34.5 cm shaft length , endo liner cutter without integrated fresh knife cartridges in sizes of 30mm , endo liner cutter without integrated fresh knife cartridges in sizes of 45mm , endo liner cutter without integrated fresh knife cartridges in sizes of 60mm , endohook , spatula tip w. 4mm con. foot controlled dispo , endohook l tip, handswitch cotrolled single use , endohook needle tip, handswitch controlled dispos. , endohook, needle tip 4mm con. foot controlled single use , endohook, spatula tip, handswitch controlled dispos , endoloop abs.sur.sut.usp. , endoloop ligature made with polyglactin suture length18 inch, narrow at one end and scored at other , endotracheal tube no. no.2 plain , endotracheal tube, cuff size 4.5 , endotracheal tube, cuff size 5 , endotracheal tube, cuff size 6 , endotracheal tube, cuff size 7 , endotracheal tube, cuff size 7.5 , endotracheal tube, cuff size 8 , endotracheal tube, cuff size 8.5 , endotracheal tube, cuff size 9 , endotracheal tube, cuff size 6.5 , endotracheal tube, cuffed size 4 , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal tube, plain size 5 , endotracheal tube, plain size 5.5 , endotracheal tube, plain size 6 , endotracheal tube, plain size 7 , endotracheal tube, plain size 7.5 , endotracheal tube, plain size 8 , endotracheal tube, plain size 8.5 , endotracheal tube, plain size 6.5 , epidural and spinal needle kit 16/18g , epidural kit , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , et tubeholder , et tube with yellow subglotic suction line , ethicon endopath echelon blue reload stapler , ethicon secure strap 25 , ethicon vicryl #6 0 absorbable violet braided suture2 30cm(w9575), 9.3mm 3/8 circle taper cut bv 1 needle , ethicon vicryl 8 0 absorbable violet braided suture1 30cm, 8mm 3/8 circle round body micro point needle , ethicon vicryl rapide synthetic absorbable suture 2 0 36mm 1/2 circle reverse cutting double needle 90cm , ett intubation stylet , examination gloves pvc disposable , exercising ball , extension line with 3 way stop cock 200cm , extension line with 3 way stop cock 25 cm , extra soft thoracic drainage catheter , eye pad, sterile , eye pressure shield , eye sphere implants implantable grade pmma sphere 14mm , eye sphere implants implantable grade pmma sphere 16mm , eye sphere implants implantable grade pmma sphere 18mm , eye sphere implants implantable grade pmma sphere 20mm , eye sphere implants implantable grade pmma sphere 22mm , eye sphere implants implantable grade silicone sphere 14mm , eye sphere implants implantable grade silicone sphere 16mm , eye sphere implants implantable grade silicone sphere 18mm , eye sphere implants implantable grade silicone sphere 20mm , eye sphere implants implantable grade silicone sphere 22mm , eyed needle (half circle) , eyed needle no. 10 (round body) , eyed needle no. 11 (round body) , eyed needle no. 5 (r.b.) , eyelid occlusion dressing , f. drop splint right/left , face mask (pedia) , face mask 2 ply (double layer) with certified bacterical filter efficency , face mask cotton white/green , face mask, disposable , facial closure device contain , feeding bag , femoral sheath including potts needle 5fr , femoral sheath including potts needle 6fr , femoral sheath including potts needle 7fr , femoral sheath including potts needle 8fr , femoral sheath including potts needle 9fr , femoral sheath with needle 5f to 8f , fenestrated tracheostomy tube cuffed with 2 inner cannula , fhme heat and moisture exchangers with bacteria viral filters , finger cot , finger ext. splint , finger splint , flexometlic tube 3 8.5 , flow regulator extension set flow rate 2ml to 350ml per hour , foldable hydrofobic intra ocular lense with injector 11 to 17.5 , foldable hydrofobic intra ocular lense with injector 18 to 24 , foldable hydrofobic intra ocular lense with injector 24.5 to 28.5 , foleys catheter new born no 5 , foleys catheter new born no 6 , foleys catheter no. 14 , folleys catheter fixation divice 18 to 24 fr , foot step double m.s. , forearm splint , formalin chamber 26 , frog splint , full gynae drape , functional knee support , functional knee support , gastrostomy feeding tube size 12 , gastrostomy feeding tube size 14 , gastrostomy feeding tube size 16 , gastrostomy feeding tube size 18 , gastrostomy feeding tube size 20 , gastrostomy feeding tube size 24 , gauge bandage , gauge unmedicated , gauze than , gel foam , gel for ecg & usg , gel pack for cold & heat therapy 10 x 25 , gel pack for cold & heat therapy 15 x 30 , glass slide , glaucoma drainage implant adult , glaucoma drainage implant paediatric , gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves) , gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves) , gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves) , gloves size 7 inches,powder free (disposable sterile surgical rubber gloves) , gloves size 7 inches,powdered (disposable sterile surgical rubber gloves) , gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves) , glucometer , glucometer (sugar) strip , gown isolation disposable , gown overlapping , green reload ethicon echelon , guedels airway , guide wire hydrophilic coated angled tip extra stiff , guide wire hydrophilic coated angled tip soft regular standard , guidewire (ptfe coated) , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes 10 , guiding catheter braided guiding catheter in various shapes 5 , guiding catheter braided guiding catheter in various shapes 6 , guiding catheter braided guiding catheter in various shapes 7 , guiding catheter braided guiding catheter in various shapes 8 , guiding catheter braided guiding catheter in various shapes 9 , haemo clip , haemostatic gelatine sponege , hand activated curved taper tip coagulating shears compatible focus 17 , hand activated curved taper tip coagulating shears compatible focus 9 , hb strips , heating pad , heating pad extre large , heating pad midium , heavy wire linear stapler 30 mm , heavy wire linear stapler 90 mm , heel cup silicon (pair) , heel cushion silicon (pair) , hemarrohid miph stapler , hemorrhoid proximate pph procedure set , hemorrhoidal stapler kit consists of 33mm , hernia belt , hernia kit , high concentration oxygen mask , high flow mask , high pressure tube 122,cm with braided , high pressure tube 183cm with braided , high pressure tube 25cm with braided , high pressure tube 51cm with braided , high pressure tube 76,cm with braided, , high presure injector lines 100 cm , high presure injector lines 150 cm , high presure injector lines 200 cm , hiv drape pack (large), set for doctor &patient , hme filter , hole sheet 70 x 70 cm disposable sterilized , hole sheet 90 x 145 cm disposable sterilized , hole sheet 90 x 90 cm disposable sterilized , hot & cold pack , hot & cold pack 15 x 30 , hot water bag , hot water bag (super delux) , hot water bottle , hydrophilic diagnostic guide wire radifocus tarumo type (regular length, regular stiffness) 0.032 inches , hydrophilic diagnostic guide wire radifocus tarumo type (regular length, regular stiffness) 0.035inches , hydrophilic diagnostic guide wire radifocus tarumo type (regular length, regular stiffness)0.025 inches , hydrophilic diagnostic guide wire radifocus tarumo type (regular length, regular stiffness)0.038 inches , hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm , hydrophilic wire long length hydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length , hydrophillic braided sheath 4f to 7f , hydrophobic ptfe syringe filters, nonsterile , i gel no. 3 , i gel no. 4 , i.d. belt baby & mother , i.v. dressing (canula fixation) , i.v. extension line with female luer lock needle free port , i.v. set with dial type flow controller with locking facility & y site, luer lock , ice bag , incentive spirometer , incentive spirometer , incise drape film extra large , incise drape film large 35cm*35cm , incise drape film midium 30cm*25cm , incise drape film small 10cm*20cm , infant feeding tube size 10fg , infant feeding tube size 5fg , infant feeding tube size 6fg , infant feeding tube size 8fg , infant nasal cannula 7 cm star lumen tubing , infant prong cpap cannula , inflation device in 30atm & 20ml , infrared thermometer , infusion set with microdrip,(i.v.)sterile disposable , infusion set moulded drip chamber , insole full silicon(pair) , inspiratory exerciser with 3 color coded balls , insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 , insulin syringe 100 part , intoducer sheath for adults (size 10 fr.) , intoducer sheath for adults (size 11 fr.) , intracranial support catheter 5 , intracranial support catheter 6 , introducer sheath with puncture needle for adults size 4 fr. , introducer sheath with puncture needle for adults size 9 fr. , introducer sheaths for pediatric use (size 4 fr.) , introducer sheaths for pediatric use (size 5 fr. , introducer sheaths for pediatric use (size 6 fr.) , ionic silver dressings for low to high exuding wounds 10 cms x 10 cms , ionic silver dressings for low to high exuding wounds 5 cms x 5 cms , ipom mesh , iris hooks /retractors , irrigation set for endoscopic t.u.r. , iv dressing 10cm*12cm , iv dressing 10cm14cm , iv dressing 5cm*6cm , iv dressing 7cm*9cm , jellonet , jhonson buds (cotton buds) , judkins catheter (jl) us fda + ce/ dgci approved 4fr , judkins catheter (jl) us fda + ce/ dgci approved 5fr , judkins catheter (jl) us fda + ce/ dgci approved 6fr , judkins catheter (jl) us fda + ce/ dgci approved 7fr , judkins catheter (jl) us fda + ce/ dgci approved 8fr , judkins catheter (jr) 4fr , judkins catheter (jr) 5fr , judkins catheter (jr) 6fr , judkins catheter (jr) 7fr , judkins catheter (jr) 8fr , judkins catheter (pediatric) 4 french , judkins catheter (pediatric) 5 french , judkins catheter (pediatric) 6 french , judkins catheter pigtail 4fr , judkins catheter pigtail 5fr , judkins catheter pigtail 6fr , judkins catheter pigtail 7fr , judkins catheter pigtail 8fr , jute / rubber matting for doors , k wire, length 375 mm; 1.6mm , k wire, length 375 mm; 1.8mm , k wire, length 375 mm; 1mm , keratome 2.8mm , keratome knife , keratone 5.2 mm , kimvent bal cath 13fr , kimvent bal cath 16fr , knee brace , knee cap (pair) , knee cap (with flexi hinge) pair , knee cap (with rigid hinge) pair , knee cap comfeel (single)pair , knee cap open patella (single) , knee immobilizer 14 , knee immobilizer 19 , knee immobilizer 22 , knee o drape , knee support hinged (neoprene) , knee support sportif (neoprene) , knee wrap (neoprene) , knife module , labour table sheet(90*140cm) disposable , lacrimal intubation set for dcr surgery , lamino spinal drape , laparoscopic cartridge for stapler 60 mm blue, 1.5 mm , laparoscopic cartridge for stapler 60 mm green, 2.0 mm , laparoscopic liner cutter with cartridges in sizes of 30mm , laparoscopic liner cutter with cartridges in sizes of 45mm , laparoscopic liner cutter with cartridges in sizes of 60mm , laparoscopic shears 5mm diameter,36cm long, 15mm curved coated blade , laparoscopic shears 5mm diameter,36cm long, 18mm curved coated blade , laparoscopic shears 5mm diameter,45cm long, 15mm curved coated blade , laparoscopy int drape , laproscopic hook , laproscopic knotless pga pcl bidirectional taper point surgical suture self fixation device with autolock mechanism made up of pga pcl bidirectional taper point 17 mm & 32 cm , laproscopic knotless pga pcl surgical suture self fixation device with autolock mechanism made up of pga pcl unidirectional taper point 26 mm & 20 cm size 2 0 , laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab reverse cutting 36 mm & 45 cm suture size 1 , laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab taper point 36 mm & 45 cm suture size 1 0 , laproscopic port with trocar , laryngeal mask (pvc) , laryngeal mask (silicone) , laryngoscopeadult) , laryngoscope blade(various size) , laryngoscope bulb(as per sumple) , laryngoscope pediatric , latex folley balloon catheter 12no , latex folley balloon catheter 6no , layngeal mask silken , lead apran (super deluxe) , lederflex 22 g/80 mm , leg bag (spare) disposable , leg bag set disposable , leg cover medium disposable sterilized , leg traction brace , lense tip , ligaclips large , ligaclips medium , ligaclips medium large , ligaclips small , light weight monofilament polypropylene mesh size extra large left 12.4cm * 17.3 /16*12 cm , light weight monofilament polypropylene mesh size extra large right 12.4cm * 17.3/16*12 cm , light weight monofilament polypropylene mesh size large left 10.8*16cm /15*10 cm , light weight monofilament polypropylene mesh size large right 10.8*16cm /15*10 cm , linear cutter 100 mm blue , linear cutter 55 mm blue , linear cutter 75 mm blue , linear cutter 55mm with six rows , linear cutter 75mm with six rows , linear cutter with varied staple height tri staple gia 60 mm , linear cutter with varied staple height tri staple gia 80 mm , linear stapler with blue reload 30mm , linear stapler with green reload 30mm , liss diluents (1x250ml) , lithotomy drap sheet sterile disposable , liver access and biopsy needle set , lma classic no. 4, 5 & others , loadable microsphere 100 300 micron , loadable microsphere 30 60 micorn , loadable microsphere 50 100micron , long braded contra lateral introducer sheath sizes 6fr , long braded contra lateral introducer sheath sizes 6fr , long braded contra lateral introducer sheath sizes 8fr , long braded contra lateral introducer sheath sizes 9fr , long braded introducer sheath sizes 8fr , long braded introducer sheath sizes 9fr , long braded introducer sheath sizes 6fr , long braded introducer sheath sizes 7fr , long introducer sheath (20 30 cm long) (size 10fr) , long introducer sheath (20 30 cm long) (size 11fr) , long introducer sheath (20 30 cm long) (size 5fr.) , long introducer sheath (20 30 cm long) (size 6fr.) , long introducer sheath (20 30 cm long) (size 7fr.) , long introducer sheath (20 30 cm long) (size 8fr) , long introducer sheath (20 30 cm long) (size 9fr) , long introducer sheath (30 50 cm long) (size 5fr..) , long introducer sheath (30 50 cm long) (size 6 fr..) , long introducer sheath (30 50 cm long) (size 7fr.) , long introducer sheath (30 50 cm long) (size 8fr.) , long introducer sheath (30 50 cm long) (size 8fr.) , long introducer sheath (30 50 cm long)(size 10fr..) , long introducer sheath (30 50 cm long)(size 11fr.) , long introducer sheath dedicated for transradial access size 4fr , long introducer sheath dedicated for transradial access size 5fr , long introducer sheath dedicated for transradial access size 6fr , long introducer sheath dedicated for transradial access size 7fr , long introducer sheath size 5fr , long introducer sheath size 6fr , long introducer sheath size 7fr , long introducer sheath size 8fr , long line pediatric no. 22g , long sheath for contra lateral iliac/ femoral access 4f , long sheath for contra lateral iliac/ femoral access 5f , long sheath for contra lateral iliac/ femoral access 6f , long sheath for contra lateral iliac/ femoral access 7f , long sheath for contra lateral iliac/ femoral access 8f , long sheath for contra lateral iliac/ femoral access 9f , long sheet 150 x 280 cm disposable sterilized , long sheet with impervious material 150 x 280 cm disposable sterilized , long sheet with impervious material 90 x 140 cm disposable sterilized , long term double lumen dialysis catheter size 14.5 frx19 cm , long term double lumen dialysis catheter size 14.5 frx23 cm , long term double lumen dialysis catheter size 15 fr x 19 cm , long term double lumen dialysis catheter size 15 fr x 23 cm , long60a echelon flex 60 long , ls belt lumbopore , lscs sheet disposable sterilized , lumbo sacral belt , lumbo support uni , makcaintosh sheet plastic(1x2)mtr , male cath , malecot catheter no. 8, 10, 16, 18, 20, 22, 24, 26 , mallet finger splint , manifold manifolds in 2, 3, 5 port , marryland dissector , maryland forcep , mask no. 1 , mask no. 2 , maternity belt all size , mattress for operation table in three sections (standard size) , mattress rubberised coir size 190 cm x 90 cm x 7.5 cm complete with cover , measured volume set 100 ml (latex free) , measured volume set 150 ml , medial arch orthosis (pair) adult , medial arch orthosis (pair) child , mesh 20x30 , metatarsal pad silicon (pair) , micro catheter 2.7 fwith 130 cm , micro catheter 2.7 fwith 150 cm , micro catheter 2.9 fwith 130 cm , micro catheter 2.9 fwith 130 cm , micro guide wire for microcatheter shapable distal end and with torque 0.014inch , micro infusion set with y injection site & luer lock , micro shield (all types) 100ml , micro shield (all types) 500ml , micro tips big blue (up to 200ul) , micro tips small yellow up to 1ml) , microcatheter flow dependent , microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment , microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch , microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers , mlcr 45 with gun , mlcr 60 with gun , mlcr 80 with gun , monocanalicular self retaining silicone stent for canalicular repair , monofilament glycomer 1, 90cm gs 21 , volet 37mm 1/2 crcle taper pont , monofilament glycomer 2 0 90cm gs 21 , volet 37mm 1/2 crcle taper pont , monofilament polybuetester coated with polytribiolate 2 0 90cm 2xv 20x36 , blue 26mm 1/2 circle taper point , monofilament polybuetester coated with polytribiolate 3 0 90cm 2xv 20x36 , blue 26mm 1/2 circle taper point , monofilament polybuetester coated with polytribiolate 4 0 90cm 2xcv 23x36 , blue 17mm 1/2 circle taper point , monofilament polybuetester coated with polytribiolate 6 0 75cm 2xcv 1x36 , blue 9mm 3/8 circle taper point , monofilament polybuetester coated with polytribiolate 7 0 60cm 2xmv 175 8 , blue 8mm 3/8 circle taper point , monofilament polyglyconate 1 150cm gs 25 loop, green 48mm 1/2 circle taper point , monofilament polyglyconate 2 0, 75cm green 26 30mm 1/2 circle taper point , monofilament polyglyconate 3 0, 75cm green 20 26mm 1/2 circle taper point , monofilament polyglyconate 4 0, 75cm green 17 20mm 1/2 circle taper point , monofilament polypropylene with peg additive 2 0 90cm 2xv 20 , blue 30mm 1/2 circle taper point , monofilament polypropylene with peg additive 3 0 90cm 2xvf 20 , blue 26mm 1/2 circle taper point , monofilament polypropylene with peg additive 4 0 90cm 2xcv 23 , blue 17mm 1/2 crcle taper cut , monofilament polypropylene with peg additive 5 0 90cm 2xcv 23 , blue 17mm 1/2 crcle taper pont , monofilament polypropylene with peg additive 6 0 75cm 2xcv 22 , blue 13mm 1/2 crcle taper pont , monofilament polypropylene with peg additive 7 0 60cm 2xkv 1 , blue 9mm 3/8 crcle tapercuttng , mopping three bucket , mother & child combination band for identification , mtp autoclavable cannula with adapter , mtp canula (karmans) all sizes , mucus extractor sterile , mullin?s sheath for special dilation 6fr , multi side port catheter , multifocal iol , multipurpose catheter 4fr , multipurpose catheter 5fr , multipurpose catheter 6fr , multipurpose catheter 7fr , multipurpose catheter 8fr , multirate elastomeric disposable infusion pump , multi vent mask pediatric, , murcury free sphgnomanometer , mv set 100 ml , mvr 21g , n.g tube no.6 , nasal haemostatic sponge pack (with airway) 10 inch , nasal haemostatic sponge pack (with airway) 8 inch , nasal haemostatic sponge pack with out airway 10 inch , nasal haemostatic sponge pack with out airway 8 inch , nasal oxygen cannula { set } , twin bore { accessory for compressed air breathing } all size { adult & pediatric } ,soft and kink resistant pvc tubing ,tube length 200 cm , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , nasal pronge child , nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube , nasogastric tube no. 6 , nebulization mask adult , nebulization mask paediatric , nebulizer chamber & neonatal mask , nebulizer chamber (large jet type) with mask & 2 mtr long multy channel tube , nebulizer chamber with t piece , nebulizer system , needle & syringe cum hub cutter (size 800ml) , needle 23g(sterile, single use, disposable, as per bis) , needle 26g half inch (sterile, single use, disposable, as per bis) , needle cutter , needle fitula , needle holder , needle surgical suture , nelaton catheter size 14 fg , nelton catheter size6 24 fg , neonatal close suction system 5,6,7 fr , neonatal high flow nasal cannula having 8 litre flow , neonatal high flow nasal cannulashould able to provide 8 litre flow. should have soft tip . , neonatal single heated wire breathing system , neonatal single heated wire breathing systemwith autofill humidification chambercomes in sterile pack and ce marked. should be compatible with our existing humidifier bubble cpap system with nasal cpap kitshould containneonatal 15mm inspiratory limb heated wire 1.6m , new born pic line no. 26 , new born pic line no. 28 , nih catheter 4fr , nih catheter 5fr , nih catheter 6fr , nih catheter 7fr , nih catheter 8fr , nitrous oxide tail pipe copper , niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent , niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent , niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent , niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent , niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support , no knife module , non absorbable 5 mm hernia mesh fixation device , non absorbable monofilament 3 0 reverse cutting 24mm needle , non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) , non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) , non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) , non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) , non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) , non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) , non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm) , non absorbable surgical suture, sterilized surical needled black braided silk with needle 1/2 circle round bodied 30 mm needle , length 70 cm size 2 0 , non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) , non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) , non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) , non absorbale surgical suture sterlised surgical needle suture (braided , coated polyglactin/ polyglycolic acid violet) 1/2 circle ct round bodied 40 mm gs needle suture length 90 cm 3 0 , non absorbale surgical suture sterlised surgical needle suture (braided , coated polyglactin/ polyglycolic acid violet) 1/2 circle ct round bodied 40 mm gs needle suture length 90 cm 4 0 , non absorbale surgical suture sterlised surgical needle suture (braided , coated polyglactin/ polyglycolic acid violet) 1/2 circle ct round bodied 40 mm gs needle suture length 90 cm 5 0 , non absorbale surgical suture sterlised surgical needle suture (braided , coated polyglactin/ polyglycolic acid violet) 1/2 circle ct round bodied 40 mm gs needle suture length 90 cm 6 0 , non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1/2 circle round body 13 mm needle length 75 cm 6 0 , non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1/2 circle round body 13 mm needle length 75 cm 7 0 , non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black (nylon) 3/8 conventional cutting needle 6mm length 70cm 5 0 , non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black (nylon) 3/8 conventional cutting needle 6mm length 70cm3 0 , non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black (nylon) 3/8 conventional cutting needle 6mm length 70cm4 0 , non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black (nylon)(3/8 cir micropoint royund body 6mm length 38 cm)10 0 , non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black (nylon)(3/8 cir micropoint royund body 6mm length 38 cm)9 0 , non absorbale surgical suture sterlised surgical needle suture polyglycaprone/ polyglyconate monofilament sutures 1/2 circle oval round body needle 26mm needle length 70 cm 5 0 , non absorbale surgical suture sterlised surgical needle suture polyglycaprone/ polyglyconate monofilament sutures 1/2 circle oval round body needle 26mm needle length 70 cm3 0 , non absorbale surgical suture sterlised surgical needle suture polyglycaprone/ polyglyconate monofilament sutures 1/2 circle oval round body needle 26mm needle length 70 cm4 0 , non return valve (brass) for nitrous oxide manifold , non return valve (brass) for oxygen , non woven surgical tape 5 meter , non woven surgical tape 9 meter , nonabsorbable helical fastener 5mm with 15 fasteners , nonabsorbable helical fastener 5mm with 30 fasteners , nonabsorbable polypropylene light weight macroporous mesh , non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm , non absorbable surgical suture black braided silk 1 0 rc 3/8 circle 45 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rb 3/8 circle 16 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rc 3/8 circle 12 mm 76 cm , non absorbable surgical suture black braided silk 6 0 rc mp 3/8 circle 8 mm , non absorbable synthetic unidrectional dual cut angle barb with welded loop end made up with polybeutester size 1, 37mm, 30cm, 1/2 circle, tp , non fibre optic single use adult scope , non fibre optic single use cysto scope for djr & diagnostic cystoscope , non fibre optic single use large scope , non fibre optic single use paediatrics scope , nternal mammary catheter 4fr , nternal mammary catheter 5fr , nternal mammary catheter 6fr , nternal mammary catheter 7fr , nternal mammary catheter 8fr , o drapewith iodine adhesive , oa knee support (neoprene) left varus / right valgus , oa knee support (neoprene) right varus / left valgus , offset connector cardio sensor electrodes sizes adult , offset connector cardio sensor electrodes sizes neonatal , offset connector cardio sensor electrodes sizes paediatrics , one loop & triple loop snare , optically guided bladeless trocar 12mm length 100mm , optically guided bladeless trocar 12mm length 150mm , oro pharyngeal airways , ortho stockinete 10 mt. 125 , ortho stockinete 10 mt. 50 , ortho stockinete 10 mt. 75 , ot dress disposable (female/male) , ot eye towel disposable small/medium/large , ot gown disposable sterilized with flap , over the ear nasal cannula 50 cm tubing , oxipulse meter , oxygen hood , oxygen mask (adult) , oxygen mask (pediatric) , oxygen mox regulator with bottle , oxygen regulator with flow meter and pressur meter , oxygen tail pipe , paed. single heated wire breathing system , paediatric endotracheal tube sizes are 3.5mm. , paediatric endotracheal tube sizes are 3mm. , paediatric endotracheal tube sizes are 5.5mm. , paediatric foley balloon catheter , paediatric urine collecting bag 200 ml , papain urea & silk protein based wound debriding ointment and cream 25gm , papain urea & silk protein based wound debriding ointment and cream 50gm , paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape , paper adhesive plaster 4 x 9.0 mts non woven adhesive tape , paraffin gauze dressing 20s tin , pardiatric mask for tracheostomy , patient indetification band green, blue, red , patient plate coutery cord , patient pre operative skin prepration solution 26 ml , patient suit (summer) disposable , patient suit (winter) disposable , pcd set puncture needle 18g 24fr , pct kit with griggs forceps , pct kit without griggs forceps , pds plus pdp305h no.3 violet pds plus antibacterial polydioxanone suture box, size: 17 mm , pds plus pdp359t no. 1 violet pds plus antibacterial polydioxanone suture box, size: 40 mm , pediatric dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , pediatric dialyzer (dialyzer should be synthetic membran(poly sulfon/poly ethresulfon) , pediatric nasal cannula 7 cm star lumen tubing , pelvic traction belt , pelvic traction kit , pelvic traction kit with weight bag , percutaneous endoscopic gastrostomy (peg) 14fr , percutaneous endoscopic gastrostomy (peg) 20fr , percutaneous endoscopic gastrostomy (peg) 24fr , percutaneous gastrostomy balloon , perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable , perfusion set with airway and needle,(adult use) sterile disposable , peripherally inserted central line for high flow/ power injection 4fr double , peripherally inserted central line for high flow/ power injection 4fr single , peripherally inserted central line for high flow/ power injection 5 fr double , peripherally inserted central line for high flow/ power injection 5 fr single , peripherally inserted central line for high flow/ power injection 5 fr triple , pillow rubberised coir foam size 63.5 cm x 41 cm x 11.5 cm with cotton cloth cover (100 % fiber) , pillow rubberised coir foam size 63.5 cm x 41 cm x 11.5 cm with cotton cloth cover (cotton) , piston teflon (ptfe) (0.4mm ) diameter 4.25 mm length , piston teflon (ptfe) (0.4mm ) diameter 4.5 mm length , piston teflon (ptfe) (0.4mm ) diameter 4.75 mm length , piston teflon (ptfe) (0.4mm ) diameter 5 mm length , piston teflon (ptfe) (0.6mm) diameter 4.25 mm length , piston teflon (ptfe) (0.6mm) diameter 4.5 mm length , piston teflon (ptfe) (0.6mm) diameter 4.75 mm length , piston teflon (ptfe) (0.6mm) diameter 5 mm length , piston titanium teflon mix (0.4mm ) diameter 4.25 mm length , piston titanium teflon mix (0.4mm ) diameter 4.5 mm length , piston titanium teflon mix (0.4mm ) diameter 4.75 mm length , piston titanium teflon mix (0.4mm ) diameter 5 mm length , piston titanium teflon mix (0.6mm) diameter 4.25 mm length , piston titanium teflon mix (0.6mm) diameter 4.5 mm length , piston titanium teflon mix (0.6mm) diameter 4.75 mm length , piston titanium teflon mix (0.6mm) diameter 5 mm length , piston titanium (0.4mm ) diameter 4.25 mm length , piston titanium (0.4mm ) diameter 4.5 mm length , piston titanium (0.4mm) diameter 4.75 mm length , piston titanium (0.4mm) diameter 5 mm length , piston titanium (0.6mm) diameter 4.25 mm length , piston titanium (0.6mm) diameter 4.5 mm length , piston titanium (0.6mm) diameter 4.75 mm length , piston titanium (0.6mm) diameter 5 mm length , plain vial with sticker &cap , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts/roll , plastic long gloves , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness (1*1 ) hole , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness (1*2 ) hole , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness (2*2 ) hole , platting for maxillary swing and mandibular fixation surgeries screw (1.5 mm ) , platting for maxillary swing and mandibular fixation surgeries screw (2 mm ) , platting for maxillary swing and mandibular fixation surgeries screw (2.5 mm ) , platting for maxillary swing and mandibular fixation surgeries screw (3 mm ) , pod crutch (22 mm) , pod quadri (15 mm) , pod walking stick (19mm) , poly safety adva. i.v cannula with inj port size 14,16,18,20,22g , polydioxanone monofilament (voilet), 5 0, 70 cm 1/2 circle round body double needle 13 mm , polydioxanone voilet monofilament, 3 0, 70 cm, 1/2 circle taper point rb 1, 17mm, , polydioxanone voilet monofilament, 4 0, 70 cm, 1/2 circle taper point rb 1, 17mm, , polyester ethylene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable,braided,sterile, surgical suture composed of poly (ethylene terephthalate.) , polyglactin 5 0 cc 3/8 circle 16 mm 45 cm , polyglactin 5 0 rb oval ½ circle 16 mm 45 cm , polyglactin 6 0 micro point ¼ circle 8 mm 45 cm , polyglactin 910 violet braided, 1, 35 cm 1/2 circle reverse cutting (heavy) 23 mm , polyglactin 910, braided coated with antibacterial 2/0, 70 cm undyed with ½ circle 25 mm rb , polypropylene blue monofilament, 2 0, 90 cm 1/2 circle round body double needle 26 mm , polypropylene blue monofilament, 3 0, 90 cm 1/2 circle round body double needle 26 mm , polypropylene blue monofilament, 4 0, 75 cm 1/2 circle round body double needle 17 mm , polypropylene blue monofilament, 5 0, 90 cm 1/2 circle round body double needle 17 mm , polypropylene blue monofilament, 6 0, 75 cm 3/8 circle round body (380 microns) double needle 13 mm , polypropylene blue monofilament,no. 7 0, 60 cm 3/8 circle round body, taper point double needle 9 mm , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , polythine/plastic gloves disposable all size , post operative surgical cover dressings hydrofiber dressings 9x25 cm , post operative surgical cover dressings hydrofiber dressings 9x30cm , post operative surgical cover dressings hydrofiber dressings 9x35 cm , pouch arm sling(tropical) , pouch arm sling (baggy) , pouch arm sling (oxypore) , powered circular stapler 29 mm , powered circular stapler 31mm , pre formed sga with gastric access & intubation sizes 1 , pre formed sga with gastric access & intubation sizes 1.5 , pre formed sga with gastric access & intubation sizes 2 , pre formed sga with gastric access & intubation sizes 2.5 , pre formed sga with gastric access & intubation sizes 3 , pre formed sga with gastric access & intubation sizes 4 , pre formed sga with gastric access & intubation sizes 5 , pre formed sga with gastric access & intubation sizes 6 , prepratery razor single edge comb style individualpacking , pressure monitoring line , pressure monitoring line / high pressure extension line , pressure monitoring line high 25,50,100,150,200cms , pressure monitoring line low 25,50,100,150,200cms , prolene soft , prox muti dir 35 pin stapler , ptca kit , ptfe coated diagnostic 0.032 inch guide wire (exchange length, extra stiff shaft strength) amplatz type , ptfe coated diagnostic 0.032 inch guide wire (exchange length, extra stiff shaft strength) amplatz type , ptfe coated diagnostic 0.032 inch guide wire (exchange length, extra stiff shaft strength) amplatz type , ptfe coated diagnostic guide wire (exchange length, regular stiffness) 0.025, inches , ptfe coated diagnostic guide wire (exchange length, regular stiffness) 0.032 inches , ptfe coated diagnostic guide wire (exchange length, regular stiffness) 0.035inches , ptfe coated diagnostic guide wire (exchange length, regular stiffness) 0.038 inches , ptfe coated diagnostic guide wire (regular length, regular stiffness) 0.025 inches size , ptfe coated diagnostic guide wire (regular length, regular stiffness) 0.032 inches size , ptfe coated diagnostic guide wire (regular length, regular stiffness) 0.035 inches size , ptfe coated diagnostic guide wire (regular length, regular stiffness) 0.038 inches size , pur xro catheter 20 cm , pur xro catheter 30 cm , r.o.m. knee brace , radial band radial hemostatis band in 24 cm , radial band radial hemostatis band in 29 cm , radiofocus miniplastic guidewire (regular stiffness) 0.025 inches , radiofocus miniplastic guidewire (regular stiffness) 0.025 inches , radiofocus miniplastic guidewire (regular stiffness) 0.032 inches , radiofocus miniplastic guidewire (regular stiffness) 0.032 inches , radiofocus miniplastic guidewire (regular stiffness) 0.035inches , radiofocus miniplastic guidewire (regular stiffness) 0.038 inches , radiofocus miniplastic guidewire (regular stiffness) 0.038 inches , rebreathing bag 1.5 ltr. , rebreathing bag 1/2 litre, 2 litre , rebreathing bag 1ltr. , regulator with pressure and flowmeter , reinforced et tube cuffed 5 10 mm , reloads 100 mm blue , reloads 100 mm green , reloads 55 mm blue , reloads 55 mm green , reloads 55 mm universal , reloads 75 mm blue , reloads 75 mm green , reloads 75 mm universal , reloads for tlh30 , reloads for tlh90 , reloads for tlv30 , reloads for tsw35/tsb35 blue , reloads for tsw35/tsb35 white , reloads for tx30b/tx30g blue , reloads for tx30b/tx30g green , reloads for tx30v , rem and non rem single use, corded patient return electrodes , renal double curve catheter , reusable anaesthetia face mask fo silicone size 0 , reusable anaesthetia face mask fo silicone size 1 , reusable anaesthetia face mask fo silicone size 2 , reusable anaesthetia face mask fo silicone size 3 , reusable anaesthetia face mask fo silicone size 4 , reusable anaesthetia face mask fo silicone size 5 , reusable anaesthetia face masksholud be silicone autoclavable & pure transparent. ce markedand size also be mention in product . size 0,1,2,3 , reverse berman catheter 4 french , reverse berman catheter 5 french , reverse berman catheter 6 french , reverse berman catheter 7 french , rhinolaryngo single patient use invtervention scope , rhinolaryngo single patient use slim scope , rib belt , ring biliary catheter usa/fda/ce approved catheter 8.5 f , room thermometer , rubber examination gloves made of natural rubber latex, non sterile, size large , rubber examination gloves, non sterile, extra small , rubber examination gloves,size medium , rubber examination gloves,size small , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , ryles tube / nasogastric tube size:14 , ryles tube 6no , ryles tube 8no , sanitary napkin beltless , sanitary napkin beltless with wings , sanitary napkins beltless in pulp cotton (1x10) , sanitary pad (10x1)delivery use , sanitary pads belt type , scalp vein set (disposable) size 18g , scalp vein set (disposable) size 20g , scalp vein set (disposable) size 22g , scalp vein set (disposable) size 24 g , scissiorsstraight (ss) , scissiors curved (ss) , scissor (dissecting) 7” , scissor (fine) metzenlaum 7” (curved) , scissor metzenlaum (straight) 7” , scleral fixiated intraoccular lense , self adherent moist wound dressing 10 cms x 10 cms , sharp conatiner 10 lat. blue , sharp conatiner 10 lat. white , sharp conatiner 5 lat. blue , sharp conatiner 5 lat. white , sharp safety box & conatiner 20 lat. blue , sharp safety box & conatiner 20 lat. white , sharp safety box & conatiner 800ml white , shepherd?s hook catheter , shoe cover disposable , shoulder support (neoprene) , sialestic sheet 55*75 mm and thickness 0.5 mm , silicon mask , silicone foley balloon catheter , silicone foleys catheter sizes 10fr , silicone foleys catheter sizes 12fr , silicone foleys catheter sizes 14fr , silicone foleys catheter sizes 16fr , silicone foleys catheter sizes 18fr , silicone foleys catheter sizes 20fr , silicone foleys catheter sizes 8fr , silicone manual resuscitator adult , silicone manual resuscitator child , silicone pre formed sga sizes 1 , silicone pre formed sga sizes 1.5 , silicone pre formed sga sizes 2 , silicone pre formed sga sizes 2.5 , silicone pre formed sga sizes 3 , silicone pre formed sga sizes 4 , silicone pre formed sga sizes 5 , silicone pre formed sga sizes 6 , silicone rod for ptosis repair , silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing , silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet , silk protein & antimicrobial silver based sterile surgical mesh wound dressing , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 10ml , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5ml , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*25cm , silk protein and nanosilver based microbicidal sterile surgical wound dressing , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*20cm , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*21.5cm , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*25cm , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*25cm , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 15*15cm , silk protein based sterile surgical particle wound dressing , silk protein based sterile surgical pu foam dressing non adhesive , silk protein based sterile surgical wound dressing sheet , silk protein based sterile surgical wound dressing sprinkling powder bottle , silk protein derived sterile surgical meshed wound dressing , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cm , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cm , silk reel 1 0 , silk reel 2 0 , silk reel 3 0 , silk reel 4 0 , simmons/ sidewinder catheter , single patient use sebs resuscitator (spur ii with peep valve in adult) , single patient use sebs resuscitator (spur ii with peep valve in neonatal) , single patient use sebs resuscitator (spur ii with peep valve in paed) , single rate elastomeric disposable infusion pump , skin grafting knife blade (sterile) , skin marker pen – sterile , skin shaving blade , skin stapler , skin stapler and remover , skin traction set (puf liner) , sodalime5 kg , sodium hypochlorite 5% (1x5 liter) , sp o2 probe (for adults) , special judkins coronary catheter 4 french , special judkins coronary catheter 5 french , special judkins coronary catheter 6 french , speech prosthesis for laryngectomy 17fr (10 mm) , speech prosthesis for laryngectomy 17fr (12.5 mm) , speech prosthesis for laryngectomy 17fr (4 mm) , speech prosthesis for laryngectomy 17fr (6 mm) , speech prosthesis for laryngectomy 17fr (8 mm) , speech prosthesis for laryngectomy 20fr (10 mm) , speech prosthesis for laryngectomy 20fr (12.5 mm) , speech prosthesis for laryngectomy 20fr (4 mm) , speech prosthesis for laryngectomy 20fr (6 mm) , speech prosthesis for laryngectomy 20fr (8 mm) , speech prosthesis for laryngectomy 22.5fr (10 mm) , speech prosthesis for laryngectomy 22.5fr (12.5 mm) , speech prosthesis for laryngectomy 22.5fr (4 mm) , speech prosthesis for laryngectomy 22.5fr (6 mm) , speech prosthesis for laryngectomy 22.5fr (8 mm) , spinal needle no. 20, 23, 24, & all size , spinal sheet 90x145 cm disposable sterilized , sponge 12 x 12 inch with tie 6 inch , sponge 15 x 15 inch with tie 6 inch , spongostan anal 0.3 x 8 cm , spongostan film 20 x 7 x 0.05 cm , spongostan special 7 x 5 x 0.1 cm , standard pama ac intra ocular lenses 11 to 17.5 , standard pama ac intra ocular lenses 18 to 24 , standard pama ac intra ocular lenses 24.5 to 28.5 , standard pama pc intra ocular lenses 11 to 17.5 , standard pama pc intra ocular lenses 18 to 24 , standard pama pc intra ocular lenses 24.5 to 28.5 , steerable introducer sheeths 10f , steerable introducer sheeths 11f , steerable introducer sheeths 12f , steerable introducer sheeths 5f , steerable introducer sheeths 6f , steerable introducer sheeths 7f , steerable introducer sheeths 8f , steerable introducer sheeths 9f , sterile bone wax 2.5 gm , sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g , sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g , sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g , sterile disposable hypodermic needle no. 18x1½ , sterile disposable hypodermic needle no. 21x1½ , sterile disposable hypodermic needle no. 23x1½ , sterile disposable spinal needle for single use. 22g x 3 1/2 inch , sterile disposable spinal needle for single use. 25g x 3 1/2 inch , sterile disposable syringe 1ml 100 parts , sterile hypodermic syringe 2ml , sterile hypodermic syringe 5ml , sterile hypodermic syringe with needle attached, 22g, single use 50 ml , sterile oxidized regenerated cellulose hemostating agent , sterile post op dresssing , sterile post op dresssing 20cmx10cm , sterile post op dresssing 25cmx10cm , sterile post op dresssing 30cmx10cm , sterile post op dresssing 35cmx10cm , sterile post op dresssing 6cmx8.3cm , sterile post op dresssing for compression , sterile self adherent with lipido colloid technology 10x25cm , sterile self adherent with lipido colloid technology 13x13cm , sterile self adherent with lipido colloid technology 15x20cm , sterile self adherent with lipido colloid technology 20x20cm, , sterile self adherent with lipido colloid technology 6.5x10cm, , sterile self adherent with lipido colloid technology 8 x15cm, , sterile self adherent with lipido colloid technology 8x8cm , sterilized umbilical cotton tape width 3 mm, length 75 cm , sterillium 500ml , stetho scope (adult & pead.) , stich bonded hydrofiber burns dresssings in gel form 23 x 100 cms , straight long introducer sheath with hydrophilic introducer guide wire 4 french , straight long introducer sheath with hydrophilic introducer guide wire 5 french , straight long introducer sheath with hydrophilic introducer guide wire 6 french , straight long introducer sheath with hydrophilic introducer guide wire 7 french , straight long introducer sheath with hydrophilic introducer guide wire 8 french , straight long introducer sheath with hydrophilic introducer guide wire 9 french , straight reinforced sheath with hydrophilic coating 10 french , straight reinforced sheath with hydrophilic coating 11 french , straight reinforced sheath with hydrophilic coating 12 french , straight reinforced sheath with hydrophilic coating 6 french , straight reinforced sheath with hydrophilic coating 7 french , straight reinforced sheath with hydrophilic coating 8 french , straight reinforced sheath with hydrophilic coating 9 french , strilizer 17 , sub glottic tube taper guard evac: sizes 6.5mm , sub glottic tube taper guard evac: sizes 6mm , sub glottic tube taper guard evac: sizes 7.5mm , sub glottic tube taper guard evac: sizes 7mm , sub glottic tube taper guard evac: sizes 8.5mm , sub glottic tube taper guard evac: sizes 8mm , sub glottic tube taper guard evac: sizes 9mm , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , suction catheter, sterile. size: f g 20 , suction catheter, sterile. size: f g 22 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile.size: fg 5 , suction jar , suction lrrigation set. , suction set within in built on off switch , sulu stepped cartridges 10mm , sulu stepped cartridges 8mm , surgeon gown splash resistant & abrasion water repellant fabric sterile , surgical blade sterile, size 11 , surgical blade sterile, size 15 , surgical blade sterile, size 22 , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 , surgical cap disposable (for surgeons) , surgical cap, disposable (for nurses) , surgical eye drape , surgical gloves (gama sterilized) varoius size(6 8) , surgical gloves 6.5 puncture indicator technology , surgical gloves 7 puncture indicator technology , surgical gloves 7.5 puncture indicator technology , surgicel 2 x 14 , surgicel 2 x 3 , surgicel 4 x 8 , surgicel fibrillar 1 x 2 , surgicel fibrillar 2 x 4 , surgicel fibrillar 4 x 4 , surgicel nu knit 1 x 3.5 , surgicel nu knit 3 x 4 , surgicel nu knit 6 x 9 , surgicel plain 2 x 14 , suthi , swan ganz catheter 6f , swan ganz catheter 7f , swine flu protection kit , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with glycomer blue size 2 0, 1/2 circle, 24mm, 30 45cm rc , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polybeutester blue size 2 0, 1/2 circle, 37mm, 30cm tp, , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 1 0, 1/2 circle, 37mm, 30cm tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 2 0, 1/2 circle, 26mm, 30cm tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 3 0, 1/2 circle, 26mm, 30cm tp , synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm , synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm , syringe 1 ml with needle 24 g(sterile, single use, disposable) , syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable , syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable , syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable , syringe 3 ml with needle 24 g(sterile, single use, disposable) , syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable , tacker , takker absorbent , takker non absorbent , taylors brace short / long , telescope 5mm , temporary cardiac pacing wire (electrode) sterile ½ cir,tapercut, 26 mm needle with self retaining system , tennis elbow support , thermal scanningthermometer (infrared) , thoracic drainage catheter with trocar , three ball breathing exerciser with different color balls , three dimensional monofilament polyester marking size 12 cm circular , three dimensional monofilament polyester marking size 15 cm circular , three dimensional monofilament polyester marking size 20x15 cm circular , thumb spica splint , titanium maxillofacial fracture fixation miniplate 1.5 mm 10 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm 15 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm 20 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm 5 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate 10 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate 15 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate 20 hole , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate 5 hole , titanium maxillofacial fracture fixation miniplate 2.0 mm 10 hole , titanium maxillofacial fracture fixation miniplate 2.0 mm 15 hole , titanium maxillofacial fracture fixation miniplate 2.0 mm 20 hole , titanium maxillofacial fracture fixation miniplate 2.0 mm 5 hole , titanium maxillofacial fracture fixation miniplate 2.0 mm l plate right and left side 6 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm 10 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm 15 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm 20 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm 5 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side 10 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side 15 hole , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side 5 hole , titanium maxillofacial fracture fixation screws 1.5 mm 6 hole , titanium maxillofacial fracture fixation screws 2.0 mm 6 mm , titanium maxillofacial fracture fixation screws 2.0 mm 8 mm , titanium maxillofacial fracture fixation screws 2.5 mm 10 mm , titanium maxillofacial fracture fixation screws 2.5 mm 6 mm , titanium maxillofacial fracture fixation screws 2.5 mm 8 mm , titanium total ossocular replacement prosthesis (torp) , titanium total ossocular replacement prosthesis (torp) , toe separator silicon (pair) , torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism , tourniquet , towelturkish dyed medium size (24x 48 ) , towelturkish full size (30x 60) , tracheostomy hme: , tracheostomy tube (cuffed) 100% silicon , tracheostomy tube (pvc material) double lumen 3.5 8mm all size , tracheostomy tube (pvc material) fenestrated 3.5 8mm all size , tracheostomy tube (pvc), cuffed all sizes , tracheostomy tube {pvc}, cuffed, sterile, single use .all size. ,soft flexible flange at for easy fixation ,15 mm connector at terminal end which can be rotated in 360 degree direction ,balloon with non return valve , tracheostomy tube {pvc}, plain ,sterile, single use all size ,soft flexible flange at for easy fixation ,15 mm connector at terminal end which can be rotated in 360 degree direction , tracheostomy tube cuffed , tracheostomy tube disposable with cuff , tracheostomy tube, plain all sizes , traction pulley bracket , traction weight bag , tran jugular intrahepatic porto sytemic , trans radial introducer sheeths 4f , trans radial introducer sheeths 5f , trans radial introducer sheeths 6f , transparent dressing with absorbent pad quotted with dacc 10x25 , transparent dressing with absorbent pad quotted with dacc 10x30 , transparent dressing with absorbent pad quotted with dacc 7.2x5 , transperant surgical wound dressing size 10x15 , transperant surgical wound dressing size 10x30 , transperant surgical wound dressing size 10x40 , transperant surgical wound dressing size 20x25 , transperant surgical wound dressing size 6x 7 , transradial diagnostic coronary catheter tiger type 4fr , transradial diagnostic coronary catheter tiger type 5fr , transradial diagnostic coronary catheter tiger type 6fr , transradial diagnostic coronary catheter tiger type 7fr , transradial diagnostic coronary catheter tiger type 8fr , triple hydrocolloid skin barrier where no cutting 45mm, , triple hydrocolloid skin barrier where no cutting 57mm, , triple hydrocolloid skin barrier where no cutting 70mm , trocar cannula 11 mm , trocar cannula 6 mm , trocar washer 10 mm , trocar washer 5 mm , tt tube with yellow sub glotic suction line , t tube (silicone) 9 mm length , t tube 12 , tummy trimmer/ abdominal belt 8 , tur set , turp set , twin bore with 2 mtr. long tube for nasal oxygen adult , twin bore with 2 mtr. long tube for nasal oxygen child, infant , typan blue (dye) , u hip drape , u shoulder drape , ultra clip disposable breast tissue marker , ultrasorbs ap disposable drypads , umbilical catheter for new born, all sizes , umbilical cord clamp , umbillical canulla no. 5, 6, 8 & others , under pad , universal linear cutter cartridge 55mm , universal linear cutter cartridge 75mm , universal shoulder immobiliser , urethral catheter , urethral catheter 90 (fg 14) made up of medical grade pvc , urethral catheter 91 (fg 10), made up of medical grade pvc , urine albumin sugar strip , urine bag with 150 cm long tubing large bore , urine collecting bag for new born / paediatric urine collecting bag should have suitability for both male and female patients ,capacity 100 ml ,sterile , urine collecting bag for new born /paediatric urine collection bag, capacity 100ml , urine collecting bag, disposable 2000 ml , urine collecting bag, disposable 2000 ml with uroflow meter , urine container, sterile70ml , urine container, sterile 30 ml , urometer , vaccum suction set, 2.5 meter length , varicose vein stockings all size , varied staple height reloads/cartridges for 60 mm gia , varied staple height reloads/cartridges for 60 mm gia instruments , varied staple height reloads/cartridges for 80 mm gia , vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) , vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) , vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) , vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) , vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) , vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) , vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) , vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) , venaseal closure system , ventilator circuit sterile , venturi mask , veress needle , vertebral catheter , vibratory pep therapy device , volumetric incentive spirometer (adult) , volumetric incentive spirometer (pediatric) , vtk diagnostic catheter , walker invalids front wheels all , walker invalids reciprocating all pods , walking stick (l type) , walking stick (soft top handle) , walking stick quadripod , wash bottle 500 ml , water mattress , weight cuff1 gk , weight cuff1/2kg , weight cuff2 kg , weight machine : digital neonatal , weight machine digital : pediatric & adult , weight machine manual adult , wound drainage vacuum set , wound protector large in size 9 14 cm usfda approved , wound protector medium 5 9 cm , wound protector small 2.5 6 cm usfda approved , wrist & forearm splint right/left , wrist brace with double lock , wrist brace with thumb (neoprene) , wrist wrap (neoprene) , xcel bladeless trocar 12x100 , xcel bladeless trocar 12x150 , xcel bladeless trocar 5x100 , xcel bladeless trocar 5x150 , yankaur suction with 2.5 mtr. long tube (suction catheter)...

Department Of Agriculture - Rajasthan

34839224 supply of lab chemicals & accessories from manufacturers / distributors / dealers / retailers for use in gprtl, durgapura, jaipur through open offline two envelop bidding procedure 1 dieldrin ( as no 60 57 l malathion cas no 121 75 5 3 fenpropathrin cas no 3951s 41 8 4 6 primary secondary amine ( psa bonded suicaj for use in quenchers analvsis or pr spherical c18 bonded flash silicn for use in quenchers analksis of pr gcb ( graphite carbon black ) 200 400 mesh for use in quenchers analvsis of pr 7 ph meter h conduictk’it meter 9 weight bo f2 class std calibration weights ( sets ) with nabl calibration report isith rneasuremcnt uncertainty 1o laboratory licliuni gas rcfill ( supplied sith certificate ) ( instrumental grade ) , micro pipette ( 200 1000 ul ) 12 micro pipette r20 200 ul ) 13 niicroplpette stand 14 ptff syringe filter 50 plece / pk 1s amb storage vials! capcombinat1o with tenlon lined storage cap pk 200 no / packet 16 glass culture tube 17 amber colour volumetrie nlask a grade i 8 amber colour volumetric nlnsk a grade 19 gas chromatograph auto sampler ( ;lass vials with screw cap & septa....

Department of Agricultural Research and Education - Rajasthan

34798183 bids are invited for cdh brand only supply sulphuric acid , sodium hydroxide pellets , petroleum benzine , methyl red , bromocresol green , boric acid , lebolene , sodium hypocloride , blotting paper , potassium hydrogen phosphate , triton x 100 , sodium ascorbate , bovine serum albumine , acetonitrile hplc grade , cuvette , syringe filters , filter paper total quantity : 31...

University of Rajasthan - Rajasthan

34398433 supply of chemicals, reagents, lab accessories, glassware supply of chemicals, reagents, lab accessories, glassware and plasticware at department of zoology, university of rajasthan, jaipur , chemical items : , ( ± ) jasmonic acid, analytical standard , ( ± ) ? lipoic acid , ( bcl2 ) mouse monoclonal ab , ( cad ) mouse monoclonal ab , ( caspase 3 ) mouse monoclonal ab , ( caspase 7 ) mouse monoclonal ab , ( gaad45 ) mouse monoclonal ab , ( icad ) mouse monoclonal ab , ( nfk betap65 ) mouse monoclonal ab , ( parp ) mouse monoclonal ab , 0.02m iodine / h2o / pyr / thf, , 0.25% trypsin edta solution 1x , 1 chloro 2, 4 dinitrobenzene , 1 chloro 2, 4 dinitrobenzene , 1 kb dna ladder , 1 naphthyl acetate , 1, 1, 3, 3 tetramethoxypropane , 1, 2 dichloro 4 nitrobenzene , 1, 2 dichloroethane ( anhydrous, 99.8% ) , 1, 2 epoxy 3 ( p nitrophenoxy ) propane , 10 mm dntps , 10 x phosphate buffered saline tween 20 ( pbst ) , 100 bp dna ladder , 10x pcr buffer ( optimized for routine pcr with mgcl2 included ) , 10x phosphate buffered saline ( pbs ) , 10x tae , 10x tbe , 10x tbs , 1 methyl 2 phenylindole , 1 nitroso naphthol reagent ( 1 nitroso 2 naphthol ) , 2 naphthol , 2 naphthyl acetate , 2 nessler reagent , 2, 4dinitrophenyl hydrazine ( dnph ) , 2, 2 azino bis ( 3 ethylbenzothiazoline 6 sulfonic acid ) diammonium salt , 2, 2 diphenyl 1 picryl hydrazyl hydrate , 2, 4 dichloro 1 nitrobenzene , 2, 4 dinitrophenol , 2 amino 2 hydroxymethyl propane 1, 3 diol ( tris ) , 2 deoxy d ribose , 2 mercaptoethanol , 2 thiobarbituric acid ( tba ) , 3, 3, 5, 5 tetramethyl benzidine ( tmb ) , 3, 6 dimethyle 1, 4 dioxane 2, 5 dione ( lactide ) , 4 ( trifluoromethyl ) styrene , 4, 6 diamidino 2 phenylindole dihydrochloride ( dapi ) , 5, 5 dithiobis ( 2 nitro benzoic acid ) extrapure ( dtnb ) , 6e10 anti amyloid plaque ( mouse monoclonal ) , 6ohda , 70% bleach , 7fb anti hsp 70 ( rat monoclonal ) , 8ohdg standard , absolute alcohol , absolute ethanol , abts ( 2, 2’ azino bis ( 3 ethyl benzo thiazoline 6 sulfonic acid ) , acetic acid , acetic acid glacial , acetic anhydride , acetone for hplc & uv spectroscopy, , acetonitrile ( acn ) , acetyl acetone , acetyl thiocholine iodide , ache ( acetylcholinesterase human ) , acid phosphatases , acid red 66 / biebrich scarlet dye , acridine orange , acrylamide , active charcoal , adenosine triphosphate , agar powder, bacteriological grade , agar agar , agarose , agarose gel elution kit , agarose low eeo , aif mouse monoclonal ab , alarmar blue hs , alexa fluor plus dye conjugates of phalloidin , alkaline and acid phosphatases kits , alkaline copper solution , alkaline copper sulphate solution ( lowry reagent ) , alloxan monohydrate , alpha keto glutaric acid , alpha naphthol , alpha naphthylamine solution , aluminium ammonium sulphate dodecahydrate , aluminium chloride hexahydrate , aluminium potassium sulphate dodecahydrate , amarnath ( acid red 27 ) , ammonia buffer solution , ammonium 1 anilionaphthalene 8 sulphonate , ammonium acetate , ammonium alum , ammonium buffer solution , ammonium chloride , ammonium ferrous sulphate hexahydrate , ammonium hydrogen difluoride , ammonium hydroxide 30% , ammonium molybdate , ammonium molybdate tetrahydrate , ammonium oxalate , ammonium per chlorate , ammonium persulphate , ammonium purpurate , ammonium sulphate , amoxycillin , aniline blue ( water soluble ) ( methyl blue ) , aniline citrate , annexin v : fitc apoptosis detection kit , ansa , anthrone , anti bcl 2 , anti caspase 8 , anti caspase 9 , anti catalase ( h 9 ) ( mouse monoclonal ) , anti cd3e ( clone 145 2c11 ) , percp cy5.5 , anti cyclin antibody , anti gapdh , anti heamagglutinin ( rabbit polyclonal ) , anti ly 6g / ly 6c gr1 ( clone rb6 8c5 ) , v450 , anti poly qib , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 2 ( a 2 ) ( mouse monoclonal ) , anti ? amyloid 1 42 ( mouse monoclonal ) , anti caspase 3 , anti caspase 3 , anti cd19 ( clone 1d3 ) , bb515 , anti chk1 antibody , anti p53 , anti sod 1 ( b 1 ) ( mouse monoclonal ) , anti sod 1 ( a 2 ) ( mouse monoclonal ) , anti tyrosine hydroxylase , anti tyrptophan hydroxylase , anti gamma h2ax ( phospho ser139 ) , aripiprazole , arsenomolybdic acid , ascorbic acid , atropine , aurum chloride , bacillus selective supplement , bacoside a , bacterial dna extraction kit , barium chloride , bax mouse monoclonal ab , bca kit , bche ( butyrylcholinesterase ) , bcip red / nbt solution b ( nbt solution ) , bees wax pure , benedicts reagent , benzene , benzene , benzoic acid , benzyl alcohol , beta actin monoclonal antibody ( 15g5a11 / e2 ) , beta naphthol , beta tubulin , beta cyfluthrin , beta tubulin ( f1 ) , mouse monoclonal , bibasic potassium phosphate ( anhydrous ) , bibasic potassium phosphate ( tri hydrate ) , bibasic sodium phosphate ( anhydrous ) , bicinchoninic acid bca , biebrich scarlet , bifenthrin , bird seed agar ( staib’s media ) , bis acrylamide , bismark brown , blood agar , borate buffer ( 20x ) ( amine free ) , borate buffer reagent , boric acid , bouvin’s fixative , bovine serum albumin , bovine serum albumin ( heat shock fraction ) , bradford reagent , brewers yeast powder , bromelain from pineapple stem , bromocresol green ( bcg ) , bromophenol blue , buffer tablets ph – 4 , buffer tablets ph – 6 , buffer tablets ph – 7 , buffer tablets ph 9.2 , butanol , butyl carbitol acetate , butylatedhydroxytoluene ( bht ) , butyrylthiocholine iodide , bw284c51 1, 5 bis ( 4 allyldimethylammoniumphenyl ) pentan 3 one dibromide , ca and mg free phosphate buffer , ca and mg free phosphate buffered saline ( pbs ) , cacl2 , cacl2•2h2o , cacodylic acid , cadmium chloride monohydrate, , caffeic acid , caffeine anhydrous powder , calcium carbonate , calcium chloride dihydrate , calcium citrate tribasic tetrahydrate , calcium hydroxide , calcium sulphate dihydate , caprylic acid , carbolfuschin , carbon tetrachloride , carboxyfluroscein diacetate , carboxymethyl cellulose sodium salt, medium viscosity ( cmc ) , carrageenan , catalase assay kit , catechol , cdk 2 mouse monoclonal ab , c dna kit , c dna synthesis kit , cedar wood oil , cefotexine , cefoxitin , cellulose powder , cereium chloride , cerium oxide nanopowder , cerium sulphate , cesium carbonate , cetyltrimethyl ammonium bromide ( ctab ) , chickpea , chitosan , chloramphenicol , chloramphenicol antibiotics strips , chloro 2, 4 dinitrobenzene , chloroform , chlorogenic acid , cholesterol , ciprofolxacin , citrate buffer ( ph 4.5 ) , citric acid , citric acid anhydrous , citric acid monohydrate , coenzyme a hydrate , colchicine , collagenase type i , collagenase type iv , comasssie brilliant blue g 250 , comasssie brilliant blue r 250 , comet assay kit , congo red acs , copper sulphate ( anhydrous ) , copper ( ii ) sulfate pentahydrate , coumarin , creatinine anhydrous, , croton oil , cupric sulphate pentahydrate , curcumin , cuso4.5h2o , cyclin a mouse monoclonal ab , cyclophosphamide ( cp ) , cytochrome c , czapek dox agar , czapek –malt agar , d fructose , d ( + ) xylose , dab ( 3, 3 diaminobenzidine ) , d aspartic acid , dcf da dichlorodihydro fluorescein diacetate , dcip stock dye solution ( 2, 6 dichloroindophenol sodium salt hydrate ) , deoxy d ribose , deoxynucleotide set, 100 mm , deuterium oxide , developer , dextrose anhy. , d glucose , di ethyl ether stabilized , di methyl sulphoxide , di sodium tartarate ( purified ) , di thiothritol ( dtt ) , dichloromethane ( dcm ) , dichlorvos , diethyl ether , diethyl p nitrophenyl phosphate ( paraoxon ) , diethyl pyrocarbonate ( depc ) , diethylenetriaminepentaacetic acid ( dtpa ) , dimethyl sulphoxide ( dmso ) , dinitrophenyl hydrazine , diosgenin , diosmin , diphenylamine indicator , direct blue 6 , disodium hydrogen phosphate ( anhydrous ) , disodium hydroxide , dithiobis 2 nitrobenzoic acid , dl dithiothreitol ( dtt ) , d limonene , dmba ( 7, 12 diethylbenz anthracene ) , dmem hg , dna gel loading dye ( 6x ) , dna isolation kit , dnase i , dntp solutions set, contains 100 mm each of datp, dctp, dgtp, dttp , dodecane , dog biscuits , dopamine , doxorubicine , dpph ( 2, 2 diphenyl 1 picryl hydrazyl hydrate ) , dpx , drabkins solution , dragendorft reagent , dry yeast powder , ecl western blotting substrate , ecori and hindiii double digest , ecori / hind iii double digest ladder , ecorii and hindiii double digest , ecosanei , edta , edta anticoagulase human plasma , edta disodium salt dihydrate , egta , eicosane , ellman’s reagent , emb agar , emb broth , eosin , eosin b , eosin yellow ( water soluble ) , eosinophilic diluting fluid , epichlorhydrin , epirubicin hydrochloride , eriochrome black t , eriochrome black t ( practical grade ) , erythromycine , escherichia coli atcc 25922 , escherichia coli atcc 35218 , etbr solution , ethanol , ethidium bromide , ethyl acetate , ethyl alcohol , ethyl methanesulfonate , ethylene diamine , ethylene glycol , eudragit l 100 ( poly ( methacrylic acid co methyl methacrylate ) ) , eugenol , ezassay tbars estimation kit for lipid peroxidation , ezcountmtt cell assay kit , fast blue b salt , fecl3 , fehling solution a , fehling solution b , ferric alum indicator , ferric chloride , ferric oxide ( gamma ) nanopowder ( iron ( iii ) oxide ( gamma ) , ferric sulfate hydrate , ferric thiocynite , ferrous ( ironii ) sulphate heptahydrate , ferrous amonium sulphate , ferrous chloride tetrahydrate , ferrous sulphate dried , ferrous sulphate , ferrozine monosodium , ferrozine , ferulic acid , fetal bovine serum , fish food , fixer , folin & ciocalteus phenol reagent , folin denis reagent for the determination of phenols , follicle stimulating hormone ( fsh ) , formaldehyde , formalin solution, neutral buffered, 10% , formic acid , fructose –d ( ) bacteriology , fungal broth w / low ph , g3272 100g , gaba ( g amino butyric acid ) , gabase from pseudomonas fluorescens , galangin , gallic acid , gel extraction kit , gene ruler tm 100 bp dna ladder , gene ruler tm 50 bp dna ladder , gentamycine , giemsa stain , giemsa stain, modified solution , glacial acetic acid , glucose , dextrose , glutamic acid , glutaraldehyde , glutaraldehyde ( em grade ) , glutathione oxidized ( gssg ) , glutathione peroxidase cellular activity assay kit , glutathione reduced ( gsh ) , glutathione reductase , gluthione peroxidase , gluthione s transferase , glycerin , glycerol , glycogen , goat anti mouse igg hrp conjugated , goat anti rabbit igg hrp congugated , goat anti mouse igg ( h+l ) cross adsorbed secondary antibody, biotin , goat anti mouse igg ( h+l ) secondary antibody, hrpconjugated , goat anti mouse igg antobody, hrp conjugate , gold chloride hydrate ( tetrachloroauric acid ) , gold nanoparticles , gram staining kit , grams iodine, stabilized , graphite , gries reagent , griess reagent , gst , guanidine hydrochloride , haematoxylin , hayemis solution , hba1c diagnosis kit , hematoxylin monohydrate , heneicosana , hentriacontanol , hepes buffer , hepes sodium salt , heptachlor, analytical standard, 1, 4, 5, 6, 7, 8, 8 heptachloro 3a, 4, 7, 7a tetrahydro 4, 7 methanoindene , heptane , hesperidin , hexadacane , hexane , high molecular weight protein marker ( 10–250 kd ) , high salt nutrient agar , hind iii , miniprepplasmid extraction kit , pcr productpurification kit , histosec pastilles , hoechst dye , honey , anti rabbit hrp conjugated igg concentrate , hsp 70 mouse monoclonal ab , hstf 1mouse monoclonal ab , human butyrylcholinesterase , human butyrylcholinesterase , hydrazine hydrate solution , hydrochloric acid concentrate , hydrochloric acid 1n aq. solution , hydrochloric acid 4n aq. solution , hydrochloric acid sq , hydrogen peroxide , hydroxyl amine hydrochloride , hygromycin b , il 1 beta polyclonal antibody , il 6 polyclonal antibody , imidazole sq , mitochondrial superoxide indicator, for live cell imaging , iodine monochloride , iron nanoparticles , iron chloride anhydrous , iron oxide ( ii and iii ) nanoparticle , iron–dextran , isoamyl alcohol , isopropanol ( ipa ) , isopropyl ? d 1 thiogalactopyranoside , i ?ß mouse monoclonal ab , kampferol , kanamycin , kanamycin sulfate , kcl , kh2po4 , klebsiella pneumoniae subsp. pneumoniae atcc700603 , koh , kovac reagent , l ascorbic acid , laccase enzyme from agaricusbisporus , lb growth media with nacl , l citrulline , ldh kit , lead ( ii ) acetate trihydrate , lead nitrate , lead ( ii ) nitrate , l glutathione reduced ( g l glutamyl l cysteinyl glycine, gsh ) , lh elisa kit ( rat ) 1 , lindane , linoleic acid , linolenic acid , lipopolysaccharides from escherichia coli o111:b4 , lippopolysaccharide e coli o55: b5 , liquid nitrogen , lithium chloride , lithium citrate tribasic tetrahydrate , l malate dehydrogenase ( l mdh ) , l methionine , low molecular weight protein marker ( 14–97 kd ) , lowry reagent , ludox hs 40 colloidal silica , luminal , luria bertani agar, modified , luteinizing hormone ( lh ) elisa kit ( rat ) , luteolin , lysozyme , l ? phosphatidylcholine , mab 22c10 anti neuronal , macconkey agar , magnesium acetate tetrahydrate , magnesium carbonate , magnesium chloride anhydrous , magnesium chloride hexahydrate ( mgcl2•6h2o ) , magnesium sulphate ( anhydrous ) , magnesium sulphate heptahydrate , malachite green , malaoxon , malic acid , malon di aldehyde tetra buty lammonium salt , malt extract powder , manganese ( ii ) sulphate monohydrate , manganous sulphate monohydrate , mannitol salt agar , mayer’s reagent , melamine , mercuric chloride , mercuric oxide red , mercuric sulphate , metformin hydrochloride ( analytical standard ) , methanol , methyl methanesulfonate ( mms ) , methyl orange indicator , methyl para hydroxyl benzoate , methyl red indicator powder , methyl red solution , mgcl2 ( 25 mm ) , mgcl2 anhydrous , mgso4•7h2o , middlebrook 7h10 agar base , middlebrook 7h9 agar base , middlebrook 7h9 broth base , minimum essential medium ( with earles salts, neaa l glutamine without nahco3 ) , modified skim milk agar , molisch reagent , molybdic acid , monbasic potassium phosphate , mono sodium phosphate , monobasic sodium phosphate , monoclonal ab ( mapk2 ) , monoclonal anti caspase 7 , monoclonal anti ? actinantibody produced in mouse , m phosphoric acid , mptp , mr vp broth ( methyl red voges proskauer ) , mr vp medium , mtt cell assay kit , mueller hinton agar , mueller hinton broth , mueller hinton hiveg™ agar , mueller hinton hiveg™ broth , multivitaplex , muroxide indicator , n acetyl neuraminic acid , n heptane , n, n, n, n tetramethyl ethylenediamine ( temed ) , n, n methylene bisacrylamide ( bis acrylamide ) , na2hpo4; sodium phosphate dibasic ( na2hpo4 ) / disodium hydrogen phosphate , n acetyl 5 hydroxytryptamine , nad , nadh ( nicotinamide adenine dinucleotide ) , nadp , nadph , naringin , nbt , n butyl alcohol , nde i restriction enz , nde i restriction enzyme , neophytadiene , n ethyl n nitrosourea ( enu ) , n hexane , nigrosin , nile red , ninhydrin , nipagin ( methyl p hydroxy benzoate ) , nitric acid concentrated , nitro blue tetrazolium chloride ( nitro bt ) ( nbt ) , nitrocellulose blotting membrane , nitrotetrazolium blue chloride , nitrous acid , n nitrosodimethylamine , nonide p 40 , nuclease free water , nucleospintriprep, mini kit, for dna, rna and protein purification kit , nutrient agar , nutrient broth , nystatin , octacosanol , octadecane , octopamine , o dianisidine tetrazotized , oil immersion , oleic acid , olive oil , ongp broth , orange g , orthophosphoric acid , osmium tetroxide 4% solution , oxalic acid , oxaloacetic acid , p21 mouse monoclonal ab , p53 mouse monoclonal ab , palladium acetate , papaya seed , paraffin wax pellets ( type 1 56 58 ) , paraffin wax white soft pure , paraffin wax ( 60 62o c ) , para formaldehyde , para nitrophenyl acetate , paraquat dichloride or methyl viologen , pca ( protocatechulic acid ) , pcna mouse monoclonal ab , p coumaric acid , pcr core kit , pcr kit , pcr purification kit , peg , penicillin / streptomycin / amphotericin b solution , pentacosane , pentobarbital ( anesthesia ) , peptone water , perchloric acid ( about 60% ) , petroleum ether , phenazine methosulphate=90% ( uv ) , phenol , phenol crystalline , phenol red , phenol:chloroform:isoamyl alcohol mixture , phenoldisulphonic acid , phenolpthalein indicator , phenylmethane sulphonyl fluoride ( pmsf ) , phosphate buffer ( ph 7.4 ) , phosphate buffer ph 7.0 , phosphate buffer saline , phosphate buffer, ph 8.0 , phospholipid kit , phosphoric acid , phosphotungstic acid hydrate , phusion polymerase , phytol , picric acid , piperine , plasmid dna miniprep purification kit , platinum direct pcr universal master mix , poly ( ethylene glycol ) ( mn 400 ) , poly vinyl alcohol , polyacrylamide , polyethyleneglycol , polypeptide 22 amino acid , polyvinylpolypyrrolidone ( pvpp ) , polyvinylpyrrolidone commercial ( pvp k 30 ) , ponceau 2r, certified / acid red 26 , ponceau s staining solution , potassium acetate , potassium bromide , potassium chloride , potassium citrate , potassium dichromate , potassium di hydrogen phosphate , potassium ferricyanide , potassium hexacyanoferrate ( k2fe ( cn6 ) ( rt ) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium oxalate , potassium permanganate , potassium persulphate , potassium persulphate ( potassium peroxodisulfate ) , potassium phosphate buffer ( 7.2 ) , potassium phosphate dibasic ( k2hpo4 ) , potassium phosphate monobasic anhydrous , potassium sulphate , potassium tungstate , potato dextrose agar , potato dextrose broth , pre stained molecular weight protein marker , primer 18 25 nucleiotide , propidium iodide , propionic acid , protease inhibitor , protease inhibitor cocktail , protein carbonyl content assay kit , protein estimation kit , protein extraction kit , protein marker , proteinase k solution ( 20 mg / ml ) , pthalic anhydrite , pvdf ( 0.45 pore size ) , pvdf hydrophilic membrane diameter: 47mm, pore size: 0.45 ?m, individuall , pyrene , pyridine , pyrithiamine hydrobromide , pyrogallol , pyrophosphate buffer , quechers kit , quercitin , rapamycin antibiotic strips , ras gap mouse monoclonal ab , rat anti cd11b ( clone m1 / 70 ) , apc , reduced glutathione , resazurin dye , resorcinol , restore western blot stripping buffer , riboflavin , rifampicin , rifamycin solution , ripa lysis and extraction buffer , rivastigmine , rna isolation kit , rna zap , rnase ( ribonuclease a from bovine pancreas ) , rnase a solution ( 20 mg / ml ) , rnase inhibitor , rpmi 1640 , rt pcr kit , rutin trihydrate , sabouraud dextrose agar , sabouraud dextrose broth , safranin , salicylic acid , saponin , saponin quillaja sp. , sds , secondary antibody , serotonin , sgot kit , sgpt kit , silica coloumn grade , silica gel , silica gel 60 120 mesh ( 125 250 mm ) , silicon dioxide , silver nanoparticles 10 nm , silver nitrate , silver nanoparticles powder type ii , silver sulphate , silver sulphate , silver nanoparticles, 10 nm , simmon citrate agar , sinapic acid , sperm processing media , skim milk powder , sm agar , sod assay kit , sodim octyl sulfphate , sodium acetate , sodium acetate buffer ( 5.0 ) , sodium alginate , sodium arsenate , sodium arsenate heptahydrate , sodium azide , sodium beta glycerophosphate , sodium bicarbonate , sodium bisulphate , sodium carbonate anhydrous , sodium chloride , sodium citrate ( anhydrous ) , sodium citrate tribasic dihydrate , sodium carbonate , sodium diethyl dithiocarbamate , sodium dihydrogen phosphate anhydrous , sodium fluride , sodium glycerophosphate , sodium hydrogen phosphate , sodium hydrogen sulphate , sodium hydroxide pellets , sodium hypochlorite solution , sodium lauryl sulphate , sodium meta bisulphate , sodium meta periodate , sodium metaperiodic acid , sodium nitrate , sodium nitrite ( nano2 ) , sodium nitro prusside dihydrate , sodium nitropruside , sodium octane sulphate , sodium perchlorate , sodium phosphate buffer , sodium phosphate buffer ( 7.2 ) , sodium phosphate dibasic ( dihydrate ) , sodium phosphate dibasic anhydrous , sodium phosphate monobasic , sodium phosphate monobasic anhydrous , sodium potassium tartarate , sodium potassium tartarate tetrahydrate , sodium pyruvate , sodium sulphate , sodium sulphite , sodium tartrate , sodium tetrahydridoborate , sodium thiosulphate , sodium tripolyphosphate ( tpp ) , sodium tungstate , soya lecithin ( 30% ) , sperm morphology test hitech solutions pack size 50 test kit 2 , spirit , ss agar ( salmonella shigella agar ) , standard laccase enzyme ( sigma laccase from rhus vernicifera or trametes versicolor ) , stannous chloride dihydrate , starch hydrolysed molecular grade ( potato starch pure ) , streptavidine horse radish peroxidase conjugate , streptomycin , streptomycin sulphate , streptozotocin , styrene oxide , succinate , succinate dehydrogenase assay kit , sucrose , sulfuric acid , sulfuric acid pure , sulphanilic acid, 0.8% , superoxide dismutase ( sod ) , sybr green dye , sybr green master mix , t4 dna ligase , tannic acid , taq dna polymerase , taqman fast advanced master mix, no ung , taqman fast advanced master mix, no ung , tartaric acid , tba ( 2 thiobarbituric acid ) , temed , terrific broth ( tb media ) , testosterone elisa kit , tetra decane , tetra ethyl ortho silicate , tetracontane 1, 40 diol , tetracycline , tetracycline hydrochloride , tetraethyl orthosilicate , tetrahydrofuran , tetraisopropylpyrophosphoramide , tetramethylethylenediamine ( temed ) , tetra n butylammonium decatungstate , tetrasodium pyrophosphate anhydrous ( tspp anhydrous ) , thiamine hydrochloride ( b1 ) , thiamine pyrophosphate , thiodiglycol solution , thiourea , thymoquinone , tin ( ii ) 2 ethylehexanoate ( stannous octoate ) , titan one tube rt pcr kit , tnf alpha polyclonal antibody , tofacitinib , toluene dried , toluene for hplc & uv spectroscopy, , tptz ( 2, 4, 6 tripyridyl s triazine ) 2, 4, 6 tris ( 2 pyridyl ) s triazine , trehalose , tri reagent , tri sodium citrate dihydrate , tributyrin , trichloro acetic acid ( tca ) , , trichloro silane , trichloroacetic acid , triethylamine , trigonelline hydrochloride ( analytical standard ) , triple sugar iron agar ( tsi ) , triple sugar iron agar suitable for microbiology, nutriselect plus , tris acetate salt , tris base , tris sds buffer ( ph 6.5 ) , tris borate , tris buffer, 1.0 m, ph 8.0, , tris buffer, 100 mm, ph 7.4 , tris hcl , tris hcl buffer , tris edta buffer solution , tris hcl , tritonx 100 , tritrack dna loading dye ( 6x ) , trizol reagent , trolox ( 6 hydroxy 2, 5, 7, 8 tetramethylchroman 2 carboxylic acid ) , trypan blue , trypsin 2x , trypton broth , tryptophan deaminase activity reagent , tunel assay kit , tween 20 , tween 80 , tyramine , urea , urea agar base ( christensen ) , urea agar , vancomycin , vancomycin antibiotic strips , vanillin , victoria blue b dye , victoria blue dye , vitamin e , water, pcr grade , x gal ( 5 bromo 4 chloro 3 indolyl ? d galactopyranoside , xantphos , xylan from beechwood , xylene , xylene cyanol ff , xylene rectified , yeast ( dry granules ) , yeast extract powder , zinc sulphate heptahydrate , ? ketoglutaric acid , ? mercapto ethanol , ? asarone , ? carotene , ? nicotinamide adenine dinucleotide disodium salt ( reduced ) ( ? nadh.na2, dpnh.na2 ) , ? tubulin ( f1 ) , mouse monoclonal , glassware items : , b.o.d. bottles ( 300ml ) , b.o.d. bottles ( 60ml ) , beaker ( 500ml ) , beaker ( 600ml ) , beaker 10ml , beaker 250ml , beaker 50ml , beaker 5ml , beaker 1000ml , beaker 100ml , beaker low formwith spout ( 1000ml ) , beaker low formwith spout ( 100ml ) , beaker low form with spout ( 250ml ) , beaker low formwith spout ( 500ml ) , beaker low formwith spout ( 50ml ) , blood collection vials ( pink ) , blood collection vials edta , blood collection vials plain , blood collection vials ( dark green ) , blood collection vials ( grey, sodiumfluoride ) , boiling tube ( 10ml ) , boiling tube ( 20ml ) , brown reagent bottles with lid 100 ml , brown reagent bottles with lid 1000ml , brown reagent bottles with lid 250 ml , brown reagent bottles with lid 500 ml , brown reagent bottles with lid 50ml , transparent reagent bottles with lid 100 ml , transparent reagent bottles with lid 1000ml , transparent reagent bottles with lid 250 ml , transparent reagent bottles with lid 500 ml , transparent reagent bottles with lid 50ml , burette stand with finger clamp , burettes 10 ml , burettes 100 ml , burettes 25 ml , burettes 50ml , burettes ( 1000ml ) , centrifuge tubes, sturdy tip 50ml , centrifuge tubes, sturdy tip 15ml , cod bottle , conical flask, transparent ( 1000ml ) , conical flask, transparent ( 100ml ) , conical flask, transparent ( 500ml ) , conical flask, transparent ( 250ml ) , conical flask, amber ( 250ml ) , conical flask with screw cap 1000 ml , conical flask with screw cap 250ml , conical flask with screw cap 500 ml , cover slips 22x22 , cover slips 22x50 , culture petri dish ( 80mm* 15mm ) , culture petri dish ( 50mm*12mm ) , culture petri dish ( 150mm* 20mm ) , culture tube with cap ( 10ml ) , culture tube with cap ( 30ml ) , culture tube with cap ( 5ml ) , cuvette ( glass ) 1 ml , cuvette ( glass ) 2ml , cuvette ( glass ) 3ml , cuvette ( glass ) 3.5ml , cuvette ( quartz ) 1 ml , cuvette ( quartz ) 2ml , cuvette ( quartz ) 3 ml , desiccator vacuum 200ml , desiccators ( glass ) , 300mmx344mm , desiccators ( amber ) , distillation unit , dropping bottles with dropper & rubber teat 60 ml , dropping bottles with dropper & rubber teat 30 ml , dropping bottles with dropper & rubber teat amber 60 ml , dropping bottles with dropper & rubber teat amber 30 ml , drying trays 404 x 257 x 61 , durham tube , erlenmeyerconical narrow mouth flask 100 ml , erlenmeyerconical narrow mouth flask 500 ml , erlenmeyerconical narrow mouth flask 250 ml , erlenmeyerconical wide mouth flask 1000 ml , erlenmeyerconical wide mouth flask 250 ml , erlenmeyerconical wide mouth flask 500 ml , erlenmeyerconical flask with screw cap 500 ml , erlenmeyerconical flask with screw cap 250 ml , erlenmeyer conical flask 100 ml , evaporating dish ( 1500ml ) , evaporating dish ( 165 ml ) , evaporating dish ( 3000ml ) , extraction apparatus ( soxhlet apparatus ) 250ml , flask ( cell culture t 25 ) , flask ( cell culture t 75 ) , conical flask 250ml , flask ( volumetric flask 50ml ) , flask ( volumetric flask 100ml ) , flask ( volumetric flask 200ml ) , flask ( volumetric flask 250ml ) , flask ( volumetric flask 500ml ) , flask ( volumetric flask 1000ml ) , flask ( volumetric flask 10ml ) , flask ( volumetric flask 25ml ) , flat bottom flask 100ml , flat bottom flask 250ml , flat bottom flask 500ml , flat bottom flask 50ml , gel staining dish , glass dropper 25cm , glass funnel25mm , glass funnel35mm , glass funnel 50mm , glass funnel 75mm , glass funnel100mm , funnel, powder, 60mm diameter , glass dropping funnel 250ml , glass filtration assembly , glass l shaped spreader , glass mortar and pestle , glass slides , glass soxhlet apparatus5000 ml , glass soxhlet apparatus3000 ml , glass soxhlet apparatus1000 ml , glass soxhlet apparatus500 ml , glass soxhlet apparatus250 ml , glass soxhlet apparatus200 ml , glass stirrer , glass vials borosil with cork ( 25 mm×100 mm ) , insect killing jars 500ml , low form beaker without spout50 ml , low form beaker without spout 100 ml , low form beaker without spout 1000 ml , low form beaker without spout 25 ml , low form beaker without spout 250 ml , low form beaker without spout 500 ml , measuring cylinder 25ml , measuring cylinder 5ml , measuring cylinder 100ml , measuring cylinder 10ml , measuring cylinder 250ml , measuring cylinder 500ml , measuring cylinder 50ml , measuring cylinder 1000ml , measuring cylinders with i / c stopper ( 10 ml ) , measuring cylinders with i / c stopper ( 100 ml ) , measuring cylinders with i / c stopper ( 25 ml ) , measuring cylinders with i / c stopper ( 250 ml ) , measuring cylinders with i / c stopper ( 50 ml ) , microscope glass slide 75x26x1 , microscopic glass slide ( double frosted ) , microscopic glass slide ( plain ) , mortar pestle 250ml , mortar pestle 500ml , mortar pestle agate , neubauer chamber , petri dish size 150x20mm , petri dish size 200x15 mm , petri dish size 80x17mm , petriplates 50 x 17mm , petriplates 150 x 20mm , petriplates 200 x 20mm , petriplates 80x 17mm , petriplates 100x 15mm , petriplates 53x 15mm , petriplates 83x 15mm , serological pipettes 1ml , serological pipettes 5ml , serological pipettes – 10 ml , serological pipettes – 15 ml , serological pipettes – 25 ml , pipettes volumetric ( 10 ml ) , pipettes volumetric ( 15 ml ) , pipettes volumetric ( 25 ml ) , plates with cavities ( 105 x 55 x 5mm ) , reagent bottle 100ml , reagent bottle 50ml , reagent bottle 1000 ml , reagent bottle 250 ml , reagent bottle 500 ml , round bottom flask 100ml , round bottom flask 250ml , round bottom flask500ml , round bottom flask 50ml , reagent bottle amber 500 ml , reagent bottle amber 1000 ml , separating funnel stand holder , separating funnel with glass stopcock, 50ml , separating funnel with glass stopcock, 100ml , microscopic slides with frosted double side , slide staining jars ( glass coplin ) , specimen tube ( glass ) size 50x15mm , specimen tube ( glass ) size 75x25mm , syringes 1 ml , test tube 25x200mm ( 70ml ) , test tube 15x150mm ( 15ml ) , test tube 16x150mm ( 20ml ) , test tube30ml , test tube ( 13 ml ) , test tube ( 20 ml ) , test tube ( 8 ml ) , test tube with rim 15 ml , test tube with screw cap ( 30 ml ) , test tubes without rim 25 ml , thermometer , thermometer with case , tooled necked bottle 250ml , tooled necked bottle 500ml , tooled necked bottle amber 250 ml , tooled necked bottle amber 500 ml , tube for culture collection, 16*75mm, 5ml , vials ( 10 ml, amber & clear ) , vials ( 10 ml, normal glass ) , vials injection ( 2.0 ml ) , watch glass 100 mm , watch glass 125 mm , watch glass 150 mm , watch glass 75 mm , lab accessories and plasticware , 5 ml facs tube , 96 well plates , absorbent paper / blotting paper , agarose gel casting tray , agate mortar and pestle set ( 500g ) , aluminium foil , aluminium seal ( 65mm ) , apron ( medium size ) , autoclavable bags 19”x24” , autoclavable bags 24”x36” , autoclavable bags 8”x12 , autoclavable disposable bags , autoclave tape , beaker tongs , biohazard bags , blood collection tubes 3ml , blotting sheets , blunt forceps 130mm , bottle top dispenser ( 1.0 10 ml ) , brushes ( think and thick both ) , burette clamps double , burette clamps single , burette stand , burette stand ( plastic ) , butter paper , carboy with stop cock ( 20 lit ) , cell culture dish 100x20 mm , cell culture dish 60x50mm , cell culture flask 25cm2 , cell strainer , centrifuge tube rack , centrifuge tubes 15ml , centrifuge tubes 50ml , centrifuge tubes 20ml , co2 anesthetizing pad , co2 cylinder 4 litres , co2 mice sacrifice chamber , conical bottom amber centrifuge tube , conical bottom tube , conical centrifuge tube rack 50ml , conical centrifuge tube rack for 15ml centrifuge tubes , coplin jar , cork no. 8 , corks no. 10 , corks no. 11 , corks no. 9 , cotton roll absorbent cotton , cotton roll non absorbent , cryo box ( 1.5 & 2.0 ml ) , cryo preservation vials , cryo tags , cryo tubes , cryogenic storage box , cryovial box , culture petri dish 150mm×20mm ( diameter*height ) , culture petri dish size : 50 x 12 mm ( diameter*height ) thickness : 1.2 mm , culture petri dish size 80mm×15mm ( diameter*height ) , curved forceps130mm , curved needle ( 130mm ) , curved needle ( 43mm ) , dialysis bag , disposable lab coatsmall , disposable lab coat large , disposable lab coat medium , disposable pipettes 1 ml , disposable pipettes 10 ml , disposable pipettes 5 ml , disposable steel surgical blade , syringe 20 ml , dissecting scissors 4.5 , dissecting scissors 5 , dissecting tray with wax 30x25x5 , dissection kit , draining tray , dropper , dropping bottle 120 ml , dropping bottle 60 ml , drosophila culture tubes , drosophila culture vials , drying rack ( 20 pegs ) , dust bin 12 lit. , edta blood collection tube 3 ml , electronic pipette controller , embryo collection cage , enamel bowl , enamel bowl 6.75 x 6.75 x 3.25 , enamel bowl 8.5 x 8.5 x 5 , enamel tray , enamel tray 30 x 35 , enamel tray 60 x 45 , falcon tubes ( 15ml ) , falcon tubes ( 50ml ) , filter paper , filter units 0.2 micron , flip cap centrifuge tube volume : 15ml , flip cap centrifuge tube volume : 50ml , floating microtube rack , forceps pointed forceps, pointed dissecting, 5”, , forceps pointed forceps, pointed dissecting, 6” , forceps ptfe blunt forceps, ptfe, blunt end, 4”, , funnel , glass / teflon potter homogenizers ( 15 ml capacity ) , gloves ( nitrile ) m ( 8 9 ) , gloves ( nitrile ) s ( 7 8 ) , gloves ( nitrile ) xs ( 6 7 ) , gloves nitrile ambi powder free s ( 6 7 ) 3 gm; , glovesnitrile ambi powder free s ( 6 7 ) 3 gm; , goggles & spectacles anti fog pk12 , hand pipette aid , hazardous waste bags ( red bags ) , hazardous waste bags ( yellow bags ) , ice bucket 4.5 l , ice cold pack , ice tray laboratory 500 ml , incubation tray , inoculating loop ( 10?lx 70mm ) , insulin syringe volume: 1.0 ml , l shaped spreader , lab retort stand 50cm lab retort stand holder laboratory flask condenser glassware support ring & clamp set , ldpe plastic wash bottles 500 ml , lens cleaning oil , lens cleaning paper , magnetic beads , magnetic stirrer bar : 6 x10 mm , magnetic stirrer bar 8× 14 mm , magnetic stirrer bar 8× 22mm , magnetic stirrer bar 9.5× 14 mm , magnetic stirrer rod , measuring cylinders ( plastic ) 100 ml , measuring cylinders ( plastic ) 1000 ml , measuring cylinders ( plastic ) 500 ml , medical syringe 5 ml , metal wire loop , mice restrainers , micro centrifuge tube –1.5ml , micro centrifuge tube ( 0.5 ml ) , micro centrifuge tube 1.5 ml , micro centrifuge tube 2 ml , micro centrifuge tubes2.7 ml , micro pestle , micro spoon and spatula weighing set , micro spoon and spatula weighing set 130mm , micro tip box ( 1000?l ) , micro tip box ( 100?l ) , micro tip box ( 10?l ) , micro tip box ( 200?l ) , micro tip box 250?l , micro tip box 500?l , micro tips ( 0.2?l 10?l ) , micro tips ( 200?l ) , micro tips ( 200?l 1000?l ) , micro tips 0.2 10 micro litre ( pcr ) , micro tube box ( 0.2 ml ) , fast optical 96 well reaction plate, 0.1 ml , optical 8 cap strips , micropestle , micropipette ( 0.2 2 ?l ) , micropipette ( 100 1000 ?l ) , micropipette ( 10 100 ?l ) , micropipette ( 1 10 ?l ) , micropipette 0.5 10?l , micropipette 0.5 2 micro litre ( pcr ) , micropipette 2 20 micro litre , micropipette stand with drawer , micropipettes stand for 12 micropipette , micropipettes stand for 5 micropipette, , micropipettes stand for 6 micropipette, , micropipettes stand for 3 micropipet , microwave gloves , mini cooler ( 20°c ) , mini cooler ( 0°c ) , mortar and pestle , multi dispenser pipettes 1 ml , multi dispenser pipettes 10 ml , multi dispenser pipettes 25 ml , multi dispenser pipettes 5ml , multiple purpose stand , muslin cloth , needles 18g*1 inch , needles 18g*1.5 inch , needles 21g*1.5 inch , needles 22g*1.5 inch , needles 16g*1.5 inch , needles 24g*1 inch , needles 26g*0.5 inch , nichrome loop , nichrome loop holder , one end flat and one end spoon spatula 6 inch , one end flat and one end spoon spatula 8 inch , oral gavage 304 grade, 1 inch. , oral gavage for mice , oral gavage for mice ( 16 size ) , oral gavage for mice ( 22 size ) , ordinary filter paper 46x56 , para film dispenser , para film roll m size , para film roll 125 lx4w , para film stand , pcr mini cooler , pcr tube 0.5 ml , pcr tube box , pcr tube tray , pcr tubes ( 0.2ml ) , pcr tubes ( 0.5ml ) , ph meter ( pen ) , ph strips , ph test strips ( paper ) 1 5 , ph test strips ( paper ) 4 5 , ph test strips ( paper ) 6 14 , ph test strips ( paper ) 7 9, 11 , pin vice 60mm , pin vice steel, approximately 90 mm, to hold insect pin with dia 0 0.40mm , pipette bulb up to 100 ml , pipette mate , pipette pumps 100 5000?l , pipette pumps 10ml , pipette pumps 25ml , pipette pumps 2ml , pipette stand for 12 pipettes ( horizontal ) , pipette suction gun , plastic boxes l × w × h 129 mm × 75 mm × 59 mm , plastic clear transparent box 100 ml , plastic clear transparent box 200ml, , plastic clear transparent box 50 ml, , plastic clear transparent box 500 ml , plastic clear transparent box 5kg , plastic clear transparent box 1kg , plastic clear transparent box 2kg , plastic conical flask 250 ml , pointed forceps 130mm 5 inch , pointed forceps 130mm 6 inch , pointed scissors 130mm 4.5 inch , polymethylpentene beaker 10 ml , polymethylpentene beaker 100 ml , polymethylpentene beaker 1000 ml , polymethylpentene beaker 250 ml , polymethylpentene beaker 50 ml , polymethylpentene beaker 500 ml , polypropylene cages for mice ( 290 x 220 x 140mm ) , polypropylene cages for rat ( 410 x 282 x 150mm ) , powder funnel 60mm , powder funnel 70mm , powder funnel 80mm , powder funnel 90mm , powder funnel 100mm , puncture proof container for disposing hazardous bag , rack for micro tube , real time pcr tubes , real time pcr tubes ( 0.2ml ) , round magnetic stirrer bar with pivot ring ( assorted ) , safety mask ply mask premium blend meltblown filter , safety maskn95 mask ( ffp2 ) with 6 layer filtration; , sample bags 12x17cm pocket:12x15x4 , sample bags size: 4”*6” , sample bags size: 6”*13” , sample bags size:9”*18” , sample bottle 10 ml , sample bottle 50 ml , sample container 60 ml , sample vials ( 3ml ) , scalpel 6 inch , scalpel 10 inch , scientific dissecting kit , sealing tape for 96 well plates , self standing centrifuge tube ( 50ml ) , serological pipettes 10 ml , serological pipettes 5 ml , shed net size 30x50 feet , six well cell culture plate , slide boxes , slide stands , spatulaointment spatula , spatula chattaway , spatula micro chattaway , spatula one end flat and one end spoon ( 8inch and 6 inch ) , spatula pointer spatula , spatula spoon , stainless steel stackable electro polished top grill for rat cage410 x 282 x 150mm , stand for centrifuge tubes , stand for drying tubes , sterilization syringe filter ( 0.2?m ) , straight needle 130mm , surgical blade , surgical gloves , surgical mask , surgical needles , synthetic polymer fibre thread , syringe , syringe 1ml tb , syringe 2ml , syringe 5ml , syringe filter 0.45?m , syringe filter 0.22?m , syringe filter ( 25mm ) , syringe filter ( 47mm ) , syringe filter blue colour , syringe filter red colour , syringe filter yellow colour , teasing needle bent , teasing needle straight , test tube holder stainless steel cross pattern small, , test tube holder large , test tube holder medium , test tube peg rack , test tube sponges , test tube stand 60 hole for 16mm tube , test tube stand 25x200mm test tube , test tube stands , tissue culture flask with filter cap sterile ( t 25 ) , tissue culture flask with filter cap sterile ( t 75 ) , tissue culture petri dish sterile ( 35mm ) , tissue culture pipette controller , tissue roll , tongs for beakers & flasks12 inches , tongs for beakers & flasks stainless steel, 10 inches , toothpick , trays , triangular tripod 210x150mm , tubes culture round bottom, reusable10ml , tubes culture round bottom, reusable20ml , tubes culture round bottom, reusable5ml , tubes rack , tubes, amber culture media, round bottom, reusable10ml , tubes, amber culture media, round bottom, reusable5ml , tubes, culture media, flat bottom10ml , tubes, culture media, flat bottom20ml , tubes, culture media, flat bottom5ml x50 , n66 nylon 6, 6 membrane ( 0.2?m filter ) 25mm , n66 nylon 6, 6 membrane ( 0.2?m filter ) 47mm , utility tray 360 x 310 x 130 , utility tray 540 x 435 x 130 , utility tray ( 320x260x70 ) , uv safety goggles , vertical pipette rack , wash bottle ( 150ml ) , wash bottle 250ml , wash bottle 500ml , waste bin medium , waste bin small , water bottle for rats and mice, 150 ml capacity , water drinking bottle for rat cages 250ml , wax dissection tray , whatman filter papers 46x56 , whatman filter paper no. 42 , whatmann filter paper 110mm , wide mouth bottle 30 ml , wide mouth bottle 60 ml , wire gauze ( w=12.5cm, l=12.5cm ) , zero size net...

University of Rajasthan - Rajasthan

34054037 supply of chemicals, laboratory accessories and outsourcing servicing supply of chemicals, laboratory accessories and outsourcing servicing at botany department, uor, jaipur , chemical items : , 2(4 iodophenyl) 3 (4 nitrophenyl) 5 phenyl 2h tetrazolium chloride (int) 98% , 1 kb dna ladder , 1,10 phenanthroline , 1,2 dichloroethane, hi lr , 100 bp dna ladder , 10x mops buffer , 1 amine 2 napthol 4 sulfonic acid , 1n hydrochloric acid , 1 naphthaleneacetic acid; , 2,3,5 triphenyl tetrazolium chloride , 2,4 dichlorophenoxyacetic acid , 2,4 dinitrophenylhydrazine, hi ar , 20 bp dna ladder(50 ?g) , 2 mercaptoethanol , 2 oxoglutarate , 2 thiobarbituric acid , 3,3’ diaminobenzidine , 3,3 diaminobenzidine tetrahydrochloride (dab hcl) , 5,5 dithiobis (2 nitrobenzoic acid) (dtnb) , 50 bp dna ladder 50ln (150?l) , 50 x tae buffer , 500 bp dna ladder , 5 bromo 4 chloro 3 indolyl phosphate disodium salt (bcip) extrapure, 98% , 5 bromo 4 chloro 3 indolyl ? d galactopyranoside(x gal) 98% , 6 benzylaminopurine , 6x gel loading buffer , 6x orange gel loading buffer , abscisic acid , acetic acid glacialextrapure, 99.5% , acetic acid glacial, hi ar™ , acetone hplc grade 99.9% , acetone pure 99% , acetone, hi ar , acrylamide , adenosine 5 triphosphate , adonitol (ad, sugar discs , agar powder, bacteriological , agarose special, low eeo (nuclease and protease free) , amikacin (ak 10mcg), antibiotic discs , ammonium acetate for hplc, 99% , ammonium dihydrogen phosphate , ammonium ferrous sulphate hexahydrate extrapure, 98% , ammonium molybdate tetrahydrate , ammonium molybedate tetrahydrate extrapure ar, 99% , ammonium persulfate(aps) , ammonium sulphate , amoxyclav (amc 30mcg), antibiotic discs , a napthylamine , andrade’s indicator , aniline blue , anisaldehyde , arabinose (ar), sugar discs , arsenic acid sodium salt heptahydrate , ascorbate oxidase , atp , barium chloride , beef extract powder , betaine , biscrylamide , boric acid , boric acid extrapure, 99.5% , bovine serum albumin , bovine serum albumin ph 7.0 , bromo thymol blue , bromocresol green sodium salt (water soluble) acs (3,3”,5,5 tetrabromo mcresolsulfonphthalein sodium salt) dye content — 90% , buffer capsule ph 4 , buffer capsule ph 7 , buffer capsule ph 9 , butanol extra pure , calcium carbonate extrapure 98% , calcium chloride anhydrous , calcium chloride dihydrate , calcium chloride dihydrate extrapure ar,99.5% , calcium nitrate tetrahydrate , calcium phytate , carbenicillin (cb 100mcg), antibiotic discs , carboxy methyl cellulose sodium , carboxymethyl cellulose , casein enzyme hydrolysate, type i (tryptone type i) , casein hydrolysate , catechol , ceftriaxone (ctr 30mcg), antibiotic discs , cellobiose (ce), sugar discs , chaps buffer extrapure, 99% , chitosan (high mw) , chitosan (low mw) , chitosan (medium mw) , chloroform : isoamyl alcohol (24:1) , chloroform extrapure , cholorodinitrobenzene , ciprofloxacin (cip 10mcg), antibiotic discs , citric acid anhydrous extrapure, 99% , cobalt chloride hexahydrate , colloidal chitin , congo red , coomassie® brilliant blue g 250 , coomassie® brilliant blue r 250 , copper (ii) chloride anhydrous , copper (ii) sulphate pentahydrate , copper(ii) sulfate (cuso4) , cotrimazine (cm 30mcg), antibiotic discs , cotrimoxazole (cot 25mcg), antibiotic discs , ctab , cu nanopowder , cycloheximide , cysteine , d (+) glucose anhydrous , d biotin , deacetylated chitin (high mw extrapure,90% da) , deacetylated chitin (low mw extrapure10 150m.pas, 90% da) , deacetylated chitin (medium mw extrapure, 150 500m.pas, 90% da) , dextrose (de), sugar discs , diethyl pyrocarbonate , diethylpyrocarbonate (depc) , diphenylamine , diphenylamineextrapure ar, 99% , di potassium hydrogen ortho phosphate , di sodium hydrogen phosphate dihydrate, hi ar , disodium phosphate (na2h po4) , disodium phosphate (na2h po4) , dithio nitrobenzoic acid , dithiothretiol (dtt), molecular biology grade , dl dopa , d mannitol, for molecular biology , dnase i, rnase free , dntp mix, 10 mm (2.5 mm each) , dpph , dpta , dulcitol (du), sugar discs , ecori, 5000 units , edta , electrophorsis kitone kit , ethanol (absolute) 500ml , ethidium bromide , ethyl acetate , evans blue dye , ferric chloride anhydrous , ferrous ammonium sulphate , ferrous sulphate heptahydrate, hi ar/acs , ferrric chloride (fecl3) , first strand cdna synthesis kit , fluorescein diacetate , folin ciocalteu reagent , formaldehyde sol 37 41%, hi ar , formamide 500ml , formic acid , fructose (fc), sugar discs , galactose (ga), sugar discs , gallic acid , gelatin bacteriological , gentamicin (gen 10mcg), antibiotic discs , gibberellic acid , glucosinolate , glutathione , glutathione oxidized , glutathione reduced , glutathione reductase , glycerol , glycine , guaicol , h2so4 , hemocytometer , hexane , hi pure a soil dna extraction kit , hydrogen peroxide , hydroxyl amine , hydroxylamine hydrochloride (nh2oh.hcl) , imidazole , indole 3 acetic acid (iaa); , indole 3 butyric acid(iba); , inositol (is), sugar discs , inulin (in), sugar discs , iodine , iodine resublimed , isopropyl alcohol extrapure , kanamycin (k 30mcg), antibiotic discs , kinetin , kovac’s indole reagent , l glutamic acid , l glutamine , l (+) tartaric acid, , labolene phosphate free , lactophenol , lactose (la), sugar discs , l ascorbic acid, a.r , levofloxacin (le 5mcg), antibiotic discs , lithium chloride 100gm , litmus milk , l methionine , l phenylalanine , l tryptophan , magnesium chloride anhydrous500 gm , magnesium sulphate 500gm , magnesium sulphate. 7h2o , maleic acid , maltose (ma), sugar discs , manganese (ii) sulfate tetrahydrate (500gm) , manganese (ii) sulphate monohydrate, hi ar™/acs , mannitol 500gm , mannitol, sugar discs , mannose (mo), sugar discs , melibiose (mb), sugar discs , mercuric chlorideextrapure ar, acs, exiplus, multi compendial, 98% , mercury(ii) oxide (hgo) , mesitylene extrapure, 98% (1,3,5 trimethyl benzene) , methanol , methanol extrapure , methanol pure 99% , methoxyamine hydrochloride , methyl jasmonate , methyl red sodium salt (water soluble) acs, 95% , methyl viologen , mo nanopowder , monosodium phosphate (nah2po4) , m phosphoric acid sticks, hi ar™/acs , ms medium w/cacl2& vitamine , mspi (hpaii), 3000 units , murashige and skoog (m.s) media 5lt , n(1 napthyl) ethylene diaminedihydrochloride , nadh , nadph , nano2 , naoh , napthyl etylene diamine dihydrochloride , nessler’s reagent , netillin (net 30mcg), antibiotic discs , nicotinic acid , ninhydrin , nitrobluetetrazolium chloride (nbt) , nitrofurantoin (nit 300mcg), antibiotic discs , n methyl n (trimethylsilyl) trifluoroacetamide (mstfa) , nuclease free water , nutrient agar , o dianisidine (25 g) , ofloxacin (of 5mcg), antibiotic discs , orthophosphoric acid , orthophosphoric acid extrapure, 85% (phosphoric acid) , oxalic acid , oxidase discs , p amino benzoic acid , pcr master mix 100r (2.5ml) , pda , pectin pure , peptone bacteriological grade , perchloric acid , phenol crystals 100gm , phenol saturated with 10mm tris hcl ph8.0, 1mm edta , phenol, saturated w/10% water500ml , phenol: chloroform: isoamyl alcohol mixture , phenylmethanesulphonyl fluoride , phosphate bufferph 7.2 (apha) , phytase agar media , picloram , picric acid , pikovskaya’s agar , p nitrophenol , p nitrophenyl phosphate disodium , polyethylene glycol mw6000 , polyvinyl pyrrolidone (pvp) k 30 , potassium biphosphate, hi ar , potassium chloride , potassium chloride 99.5% , potassium chromate, , potassium dichromate pure, 99.5% , potassium dihydrogen orthophosphate extrapure ar, 99.5% , potassium dihydrogen phosphate (kh2po4) , potassium hydrogen phosphate (k2h po4) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium permanganate extrapure, 99% , potassium sulfate (k2so4) , prestained protein ladder , proline 99% , protein loading dye , psti, 3000 units , putrescine dihydrochloride , pvpp , pyridine, hi ar/acs , pyridoxal 5’ phosphate anhydrous, hi lr , pyrogallol , quercetin , raffinose (rf), sugar discs , restriction digestion kit , revertaid reverse transcriptase, 10,000 u , rhamnose (rh), sugar discs , ribitol , riboflavin , rna gel loading dye (0.25ml) , rnase100mg , rnase inhibitor (20 u/?l) 2500 units , rnasezap , rochelle salt(na k tartrate) , salicin (sa), sugar discs , salicylic acid , schffs reagent , selenium dioxide (seo2) , silver nitrate, hi lr , silver sulphate pure, 98.5% , simmons citrate agar , sio2 powder , skim milk powder , sodium acetate 100g , sodium acetate 3m , ph 5.2 5.4 , sodium acetate anhydrousfor hplc & uv spectroscopy, 99% , sodium acetate trihydrate , sodium acetate trihydrate , sodium azide (nan3) , sodium bicarbonate , sodium bisulphite , sodium carbonate anhydrous, hi ar/acs , sodium chloride , sodium chloride extrapure ar, 99.9% , sodium citrate anhydrous , sodium citrate tribasic dihydrate extrapure ar, 99% , sodium citrate, 3.8% w/v , sodium dithionite , sodium dodecyl sulphate, ultrapure , sodium fluoride , sodium fluoride pure, 98% , sodium hydrogen sulphite, hi ar/acs , sodium hydroxide pellet , sodium hydroxide pellets extrapure ar, 98% , sodium hypochlorite , sodium hypochlorite, hi ar™/acs(4% w/v solution) , sodium molybdate dihydrate, hi ar™/acs , sodium phenolate , sodium phosphate dibasic anhydrous extrapure ar, 99% , sodium phosphate monobasic anhydrous extrapure ar, 99% , sodium sulfite, hi ar/acs , sodium sulphite , sodium tetraborate , sorbitol (sb), sugar discs , spermidine , spermine , stannous chloride dihydrate dihydrate pure, 97% , starch soluble , streptomycin (s 10mcg), antibiotic discs , sucrose (su), sugar discs , sulfosalicylic acid , sulphanilic acid, purified , sulphosalicylic acid (3%) , taq dna polymerase (3 u/?l) (includes enzyme: 1 vial; 10x taq buffera : 4 vials; 25 mm mgcl2: 4 vials), 1000units , taq polymerase (5 units/?l) , temed , tetra chloroacetic acid , tetracycline (te 30mcg), antibiotic discs , thiamine hydrochloride , thiobarbituric acid (tba) , thiourea, hi ar/acs , titanium (?) oxysulfate hydrate , tlc silica gel 60 f254 , toluene , toluene extrapure ar, 99.5% , toluene, rectified, l.r. , trehalose (te), sugar discs , trichloroacetic acid extrapure ar, acs, 99.5% , triclogel , triclogel dispenser bottle , trimethylsilane (tms) , tris (hydroxylmethyl) aminomethane , tris base , tris buffer ar, acs for molecular biology, 99.9% , tris hydrochloride , tris hydrochloride (tris hcl) extrapure ar, 99% , triton x 100 , trizol reagent® , trypan blue dye , tryptone, certified (casein enzyme hydrolysate) , turbo dna freetm kit , tween 20 , urea extrapure ar, 99.5% , urea extrapure, 99% , xylose (xy), sugar discs , yeast extract 500gm , yeast mannitol broth , zeatin , zinc chloride 500gm , zinc dust , zinc oxide, hi ar™500gm , zinc sulphate heptahydrate , zn nanopowder , glassware items : , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , beaker, glassware , beaker, glassware , beaker, glassware , beaker, glassware , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim,amber, glassware , cover glass, square, glassware , funnel, glassware , funnel, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , microscopic glass slides, plain, ground edges, glassware , petri plats glass, 90mm, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , stirring rod, glassware , test tubes with rim, glassware , watch glasses, borosil s line, 150 ml, glassware , plasticware items : , applied biosystems™ microamp™ optical fast well reaction plate with barcode & optical adhesive films , art™ gel loading pipette tips (20 ?l) , carboy with stopcock ( liquid storage container), 10li , centrifuge tube conical bottom sterile 15 ml (pack of 500) , centrifuge tube conical bottom sterile 50 ml (pack of 500) , conical centrifuge tube rack , draining tray , drying rack , eppendorf tubes (1.5) (pack of 500) , eppendorf tubes (2 ml) (pack of 500) , funnel, 100 mm , funnel, 50 mm , ice bucket , ice tray (1 l) , ice tray (4 l) , junior 4 way tube rack , measuring cylinder class b, material: pp autoclavable 10 ml , pcr rack with cover (pack of 6) , pcr tubes (0.2 ml) (pack of 1000) , pcr tubes box for 0.2 ml , petri plates 100 mm (pack of 12) , pipette tips 0.2 10 ?l(pack of 1000) , pipette tips200 1000 ?l(pack of 500) , pipette tips2 200 ?l (pack of 1000) , plastic pots , polygrid test tube stand , rack for micro tube , test tube basket with cover 180x170x160 , tip box for 200 1000 ?l(pack of 10) , tip box for 5000 ?l (pack of 2) , tip box of 2 200 ?l (pack of 10) , utility tray, material: pp autoclavable; 320x260x100 , utility tray, material: pp autoclavable; 320x260x70 , utility tray, material: pp autoclavable; 360x310x130 , wash bottle new type (750 ml) , wash bottles plastic, 250ml; , wash bottles plastic, 500ml; , other items : , 1kg gross aluminium silver kitchen foil roll paper , 3 step interlocking micro tube rack (24x0.2 ml,14x0.5 ml and 12x1.5 ml tubes) (pack of 6) , autoclavable bags (pack of 100) , casting tray , cheese cloth , comb set (pack of 2) , conical centrifuge tube rack (pack of 4) , cryo cube box , cryo tags , cryocan ba 11 liquid nitrogen container (20l capacity) , cryo cube box1.8ml (pack of 8) , falcon tubes (15 ml) (pack of 500) , falcon tubes (50 ml) (pack of 500) , hand protector grip , hands on™ nitrile examination gloves , hijama surgical blades size 11 , liquid nitrogen flask , magnetic stirrer bar (round) 8x30 mm (pack of 10) , magnetic stirrer bar (round) 8x50 mm (pack of 10) , microcentrifuge tubes box for 1.5 ml(pack of 4) , microchattaway spatula , mortar and pestle (suitable for crushing of plant sample in liquid nitrogen) , multipurpose labelling tape , nitrile gloves powder free large , nitrile gloves powder free medium , non absorbent cotton , nylon membrane filter , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , parafilm tape (size in inches 4 x 125) , pcr rack with cover; 96 well , pipette rack horizontal , pointer spatula (6) , purple nitrile gloves (medium size) , qualitative filter paper grade 1: 11um 150 mm 100/pk , quartz cuvette; capasity; 1.0 ml;190 nm to 2500nm , quartz cuvette; capasity; 3.5 ml;190 nm to 2500nm , romino® silicone heat resistant cooking pinch mitts , round magnetic stirrer bar 8x30 mm , round magnetic stirrer bar 8x50 mm , spatula; 200mm , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , sterial scalpel blade no.22 , syringe filter 4 mm, 0.2 micron (sterile) 100/pack , syringe filter holder, pc (reusable), 13 mm , test tube stand 12 tubes(pack of 4) , tissue roll , tough tags , vertical gel casting system, 18 x 18 cm (glass plates dimension) , whatman® qualitative filter paper, grade 2 , out sourcingservicingitems : , mrna sequencing , small rna/ micro rna sequencing , sequencing of pcr products...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical College - Rajasthan

33634349 rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department rate contract for disposable and glassware and consumable and miscellaneous items for microbiology department , a. disposable items , aluminium foil , autoclavable borosil screw capped tubes 5ml , autoclavable borosil screw capped tubes 10ml , autoclavable petridish sample required , disposable gloves ( non sterile in pack of 25 to 50 pairs ) , a ) size 6.5 , b ) size 7 , c ) size 7.5 , d ) size 8 , centrifuge plastic test tubes with cap sterile4” , coplin jar with lid ( rectangular pvc ) , sterile disposable, polystyrene, optically clear, petridishes 90mm x15mm ( 4 ) sterilized by gamma radiation, individually packed with date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab sticks individual packed size ( 150 mmx 12mm ) , sterilized by gamma radiationwith date of manufacture & expiry sample required to be supplied in installment , sterile disposable swab stick wth test tubes individually packed size ( 150 mmx 12mm ) , sterilized by gamma radiation with date of manufacture & expiry sample required , sample racks ( 96 slots / rack ) 12x75 mm tube , disposable stool sample container with spatula , plastic discard container with lid and sieve , disposable autoclave bag , a ) red30 l , b ) yellow 30 l , transparent bag 30l , a ) red15 l , b ) yellow 15 l , c ) transparent bag 15 l , disposable bag , a. ) black 30l , plastic basket ( jali ) autoclavable—small , a ) medium 7”x7”x7” , b ) large 9”x9”x9” , plastic pipe for water supply ½ inch , plastic trays 1 ½’ x1 ½’x 6” , plastic trays for reagent bottles , plastic dropper , a ) small , b ) big , tissue paper rolls 100 meter , tie 8” long for lying plastic bags , syringe needle sterile disposable , a ) 10 ml , b ) 2 ml , c ) 5 ml , disposable test tube with screw cap and label, individually packed , sterilized by gamma radiationwith date of manufacture & expiry sample required , a ) 10 ml , b ) 5 ml , steriledisposable container wide mouth individually packedsupplied in installment ( for sputum, urine ) without spoon 30 ml self standing, sterilized by gamma radiation , test tube stand , a ) 6” , b ) 4” , microtitre polystyrene plate of 96 round bottom wells with lid , individually packedsterilized by gamma radiationwith date of manufacture & expiry sample required , nasopharyngeal two individually packed sterile nylon flocked ( nasal and oral ) swab with plastic shaft with breakable point about 15 cm long , plain vial for blood collection 5ml , microcentrifuge tube ( 1.8 ml molecular biology grade ) , tooth pick , b. glassware items , borosilicate glass cover slips, size 22x22mm no.0 10gms x 26100pkt , durhams tube ( 2cm ) , dark brown reagent dropping bottle with glass deopper and rubber treat 125ml borosil , dark brown reagent bottle with screwcap 250ml , dark brown reagent bottle with screwcap 1 liter , flask conical flat bottom ( long neck ) with graduation ( borosilicate ) , a ) 5000ml , b ) 2000ml , c ) 3000ml , d ) 1000ml , e ) 500 ml , f ) 250 ml , g ) 100ml , cell culture flasks ( 25 ml ) , ( treated, sterile, vented ) with filter cap 25cm , glass funnel8” , glass funnel 3” , glass rods , glass sheet , glass slides , thermometer digital with probe ( 0 100° c ) , ( 0 200° c ) , ( 20° to 10° ) , ( 80° ) , glass beakerborosilicate , a ) 500 ml , b ) 250 ml , reagent storage bottle borosilicate , a ) 2 ltr , b ) 1 ltr. , c ) 500ml , blue cap glass bottles autoclavable borosilicate , a. ) 1000ml , b. ) 500 ml , c. ) 250 ml , d. ) 100 ml , test tube glass round bottom without rim borosilicate , a ) 18x150mm , b ) 15x125mm , c ) 12x100mm , d ) 12x75mm , e ) 150x15mm , test tube glass 10 ml screw capped , glass measuring cylinder borosilicate , a ) 500ml , b ) 1000 ml , c ) 250 ml , d ) 100 ml , e ) 50 ml , glass beads , glass beads , borosilicate screw cap glass bottle , borosilicate screw cap glass bottle , glass petridish 90mm borosilicate , c. consumable items , micropipette tips with filter , a. ) 10?l ( 96×10 ) , b. ) 20 ?l ( 96×10 ) , c. ) 100 ?l ( 96×10 ) , d. ) 200 ?l ( 96×10 ) , e. ) 300 ?l ( 96×10 ) , f. ) 1000 ?l ( 96×10 ) , disposablemicropipette tips without filter 100 ?l , sterile micropipette tips without filter 10 ?l , bar code stickers fot bactrology , eppendorf tubes 0.6 ml , eppendorf tubes 1.5 ml , eppendorf tubes 2 ml , 0.2 ml 8 pcr tube strips with cap , n 95 mask niosh certified , surgical triple layer mask , bamboo stick , wipes , ppe kit , gown , a. ) small , b. ) medium , c. ) large , d. ) xl , disposable gowns back open blue , disposable gowns back open white , disposable plastic lab coat ( m ) , disposable plastic lab coat ( l ) , disposable plastic lab coat ( xl ) , plastic disposable forceps , forceps ss 5 inch. , gloves nitrile powder free small , gloves medium nitrile powder free 6.5 size , gloves large nitrile powder free 7 size , shoe cover knee length , head cap , indicator tapesteam autoclavable , b. stearothermophilus ( no. of spores per strip 10 6 ) for steam sterilization at 1150c indicator tape ( autoclave ) , b. atrophaeus ( no.of spores indicator tape ( hot air oven ) , sanitizer ( 500ml ) with dispenser , falcon tube 50ml sterile , falcon tube 15mlsterile , screw capped cryo vial 1.5ml , screw capped cryo vial 2ml , screw capped cryo vial 1.8ml , screw cap storage vials 1.8ml , screw cap plain tube ( 12x75 mm ) , plain tube ( riya tube ) for sample dilution , plain sample collection tube 5ml double cap with clot activator , edta tube 5ml double cap , assay cups , assay tips , assay samplecups , gauze than , vaccutainerclot / edta / flouride / citrate / heparin , vaccutainer needle , parasep solvent free faecal parasitic concentrator , vtm with two swabs , zip lockbags size 8x4 , barcode sticker for hbv & hcv viral load and bacteriology , wash reagent , spray bottles , manualmicropipette variable volume autoclavable , a. ) 1 10 ?l , b. ) 0.5 10 ?l single channel , c. ) 10 100 ?l single channel , d. ) 5 50 ?l single channel , e. ) 50 200 2 200 ?l single channel , f. ) 100 1000 ?l single channel , g. ) 2 20 ?l multi channel 8 channel , h. ) 10 100 ?l multi channel 8 channel , discarding jars , abi real time pcr fastrctn tubes ( 8 tubes / strips ) each 0.1 ml , abi real time pcrfast rctn tubes ( 8 tubes / strips ) each 0.2 ml , abi fg optical caps for rtpcr ( 8 caps / strips ) each , pcr rack with cover , plastic racks ( 24 tubes racks ) , plastic racks ( 48 tubes racks ) , tough tags for ampoules 1.5 ml , cell culture plates ( 6 well ) ( tissue culture treated, sterile ) , abi sequencing plates ( 10 plates / pk ) , , abi adhesive covers for pcr plate ( 100 pcs ) , , ppe ( jump suits ) , serological pipette 5ml ( filter, sterile ) , u bottom microtitter plates , coolbox , pippette stands , mini coooler 20° for 1.5 ml tube ( 12 place ) , mini coooler 20° for 1.5 ml tube ( 48 place ) 32place , d. miscellaneous items , cotton roll 500 gms , cryovials racks , cryovial boxes , cryovial labels , gas burner, labortary vertical withcontrol knob , match box , washing brush for cleaning test tube , a ) 4 , b ) 6 , c ) 8 , regulator for gas , dustbin with lid and foot operated , a ) black colour , b ) blue colour , c. ) red colour , d. ) yellow colour , e. ) green colour , gas lighter , teasing needle , surgical blades no 22 sterile packed , scalpel & blade , thread rolls , flit pump , waste paper basket , nichrome wire 18 gauge , nichrome wire 21 gauge , aluminium tray with partition 12x18x4inch , jute thread for tying bundle , nichrome wire loop diameter 1.3 mm, double wound, caliberated to 1 ul ( .001 ml ) ( pack of 10 loop each ) , wire loop holder , readymade assorted loops 5 pack x 10 loops each , dustbin with perforated basket inside with lid ( 2 liter ) , dustbin with perforated basket inside with lid ( 15 liter ) , antibioticc zone measuring scale370x65 mm , spirit lamp cotton wick , spirit lamps , spotting sheet ( white paper ) , thermometer 0 to 1000c ( digital ) , thermometer 0 to 2000c ( digital ) , thermometer 200 c to 100 c ( digital ) , thermometer 800 c to 100 c ( digital ) , plastic slide box 4”x12” , slide tray ( metal ) , syringe filter 33 mm , syringe filter 10 ( 25mm diameter ) himedia 0.2mm filter for cell culture , falcon racks 50ml , falcon racks 15ml , parafilm roll...

Medical And Health Services - Rajasthan

33440985 supply of consumables items 1. chemicals ( ar / excel grade or equivalent ) 2 chemicals ms optima grade / internal standards consuma bles 3. 4. s. 6.s 7. micro biological chemkaisa glassware plastic ware rilter paper_ syringe filter 8. gases ( 99.999 % purity ) 9. nistcrm...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Medical And Health Services - Rajasthan

31879801 supply of medicine, iv fluid, surgical item tablet injection syrup eye ear drops cream ointment , wash bottle plastic fitted stoppers and delivery tube , mentol alchol distilatien arseric test aooratees , clear hplc vial neck amber hpcl vial neck , clear gc headspace vial , multi port hpcl cap , plastic aspirator bottle , plastic wash bottle , plastic measuring cylinder , plastic beaker , retort stand , burette clamp single plastic funnel , membrance filter holder , pipette bulb plastic pipette stand , vortex mixture , test tube stand , bench protector , flask stand , utility tray , burner for lab tlc silica gel aluminium sheet , membrance disc filter , nylon syringe filter , filter paper circle ...

Medical And Health Services - Rajasthan

31878365 rate contract supply of laboratory glassware plastic ware reagents at drugs testing laboratory beaker with spout volumetric flask with glass stopper volumetric flask with glass stopper , volumetric flask with glass stopper, conical flask , measuring cylinder hexagonal base , measuring cylinder with stopper , measuring cylinder hexagonal base , pipette pipette volumetric bulb type , burette , iodine flask , flat bottom flask , separating funnel pear shape with stopcock , funnels , dessicator plain with plane flange , 17 dessicatorvaccunie with plane flanges 18 ivacunidessicatrwithpiafle flanges 19 plane glass dessicator 20 reagent bottie piain ( wide mouth ) screw cap with pouring ring 21 reagent bottle piain ( narrow mouth ) with pouring ring 22 filtration flask 23 goouch crucible 24 round bottom flask 25 test tube 29 test tubes 30 tet tubes without rim 31 capiiiury tube 32 petmi dish 33 jpetridishs line 34 mortal &pestel 3s pipetir tukr ( natural rubber ) 36 drainrng tray 37 aspircdor bottle with swpcuck 38 ttility carrier 39 wash kottle ( l’labtw ) fitted l 1btupperr*nd deiveytuben wash bottle plastic fitted stoppers and delivery tube , mentol alchol distilatien arseric test aooratees , clear hplc vial neck amber hpcl vial neck , clear gc headspace vial , multi port hpcl cap , plastic aspirator bottle , plastic wash bottle , plastic measuring cylinder , plastic beaker , retort stand , burette clamp single plastic funnel , membrance filter holder , pipette bulb plastic pipette stand , vortex mixture , test tube stand , bench protector , flask stand , utility tray , burner for lab tlc silica gel aluminium sheet , membrance disc filter , nylon syringe filter , filter paper circle etc ...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Rajasthan University Of Health Science - Rajasthan

30859312 nit for supply of various chemicals, reagents, glasswares and other items at ruhs college of medical sciences, jaipur t acetone roll 3 tidehyde? solution 4. glycerol 5. methanol 6. ethanol 7. sodium oxalate 8. turpentine oil 9. disposable gloves 10. disposable gloves ini.e disposable gloves dept. of bioc hemistry 12. 1, 2, 4 amino napthol suiphonic acid 13. acetone 14. ammonium molybdate 15. ammonium oxalate 16. a naphthol. 17. ammomnium sulphate arsenic pentaodide_ 18. 19. ammonium carbonate 20. bile salt 21. bilirubin 22. bromocresol green indicator ijiuivalu1? 23. bovine albumin 24. carbon tetra chloride 25. casein 26. chloroform 27. cholesterol powder ec 28. copper sulphate (crystalline) 29. copper acetate 30. calcium carbonate 31. chlorophenol red indicator dextrose di acetyl monoxime 32. 33. 34. diethyl ether 35. disodium hydrogen phosphate__________ 36. ethanol (95 %) 37. ferric chloride — 38. formaldehyde 39. glacial acetic acid 40. 41. hydrochloric acid lithium carbonate labolene lead acetate 42. 43. 44. mercuric sulphate 45. nitric acid 46. mercuric iodide 47. 48. methanol 0 phosphoric acid 49. phenol crystals 50. phenol red indicator 5|. phenolphthalein indicator 52. picric acid (saturated solution) 53. picric acid powder 54. potassium dihydrogen ortho phosphate 55. potassium lodide 56. resorcinol 57. silver nitrate 58. sodium bisulphite 59. sodium carbonate 60. sodium hydroxide pelietes 61. sodium chloride 62. sodium nitrite 63. sodium n itropniside 64. • socium sulphate 65. ______ sodium sulphile anhydrousd 66. soyabean meal 67. sulphuric acid (h2so4) 68. sulphanilic acid 69. ., sulphur powder 70. sodmum tungstate 71. thiosemicarbazide 72. trichloro acetic acid 73. tungstic acid 74. sodium citrate 75. nesslers reagent 76... serum total cholesterol estimation kit 77. serum triglyceride estimation kit 78. serum sgot estimation kit 79. serum sgpt estimation kit 80. alkaline phosphates estimation kit 81. blood glucose estimation kit 82. , serum calcium estimation kit 83. serum csf protein estimation kit 84. serum alb estimation kit 85. serum cpk estimation kit 86. serum glucose estimation kit 87. serum hdl estimation kit 88. serum ldh estimation kit 89. serum cretinine estimation kit 90. serum ck mb estimation kit 91. serum bilirubin 92. serum urea estimation kit 93. filter paper i pkt 94. tissue paper 95. — permanent marker pen 96. absorbent cotton 97. tips 500ul 1000w glass marking pencil 98. 99. gloves 6.5 • 100. serum vial (plastic with cap) l0l. oil 102. glass slide 103. cover slip dept. of physiology 104. leishmans stain (repdy to use) 105. eosinophil count fluid (ready to use) 106. platelets count fluid . (ready to use) 107. reticulocyte count fluid (ready to use) 108. rbc fluid 109. antisera a+b+d (rh) monoclonal 1m10.l covcr slipe (22x22 mm) ill. lancetblood 112. surgical spirit 113. glass slides 1l14.s cotton roll big 115. surgical disposable gloves — 116. paper roll for single channel 117. xylem *1ltj 118. . paper roll for three channel 1m19.e conducting jelly 120. conducting paste 121.. . surgace adhesive electrode for digital for physiography 122. ecg paper roll dept. of microbiology 123. koh pellets 124. .... sda with chloramphenical 125. dermatophyte test medium slant 126. chrom agar for candida 127. lpcb 128. skirted plate 96 well x0.2m1 (autoclavable) 129. l lysine ‘| aeearboxylasebnoth4 l ornithine decarboxylase broth 130. 131. l arginine dihydrolase broth 132. wash bottle 500 ml capacity 133. syringe filter 25hmmr 134. mannitol salt agar 135. odifiedhugh& leifson 0/f test 136. loeffler serum medium base 137. cled 138. robertson cooked meat medium 139. andrede’s indicator 140. bromocresol purple 141. glucose phosphate broth (mr vp medium) nvici.iiuiil i 142. methyl red indicator 143. alpha naphthol 144. simmon citrate agar — 145. christensen urease agar 146. triple sugar iron agar 147. peptone type i bacteriological 148. n acetyl l cysteine 149. gelatin 150. crystal violet 151. lodine resublimed 152. potassium iodide 153. absolute ethanol °%o ‘l 154. acetone 155. sairanine 156. carbol fuchsin conc. sulphuric acid 157. 158. methylene blue 159. sodium taurocholate 160. blood agarbase 161. bhlbroth 162. corn meal agar 163. coverslipbox(ix 20 small box) 164 . glass slide 75x25x1.33mm 165. petridish glass (100 mm) 166. petridish glass (75 mm) 167. petridish (disposable) individually packed 168. deionized water 169. dca 170. xld 171. wilson and blair medium 172. ferric chloride anhydrous phenol crystals 173. fluid thioglycollate broth (anaerobic) with indicator 174. filter paper sheet whartman no. i 175. immersion oil for microscopy 176. kovcks indole reagents 177. macconkey agar 178. nutrient agar 179. muller hinton agar 180. n,n.n’.n’tetra methyl pp hhenyeenedimmine dihydrochioride 181. boronic acid n,n,n’,ntetra methyl pp hhenyeenedimmine dihydrochloride |. phenol crystals 82. 183. boronic acid phenylalanine agar 84. 185. 186. plasticin selenitefbroth bacteriological simagar ,‘ 187. tcbs 188. 189. 190. thick cotton thread urea (40%) koh pellets 191. sda with chloramphenical 192. dermatophyte test medium slant 193. chromagarfor cand ida 194. lpcb 195. skirted plate 96 well x0.2ml (autoclavable) 196. l lysine decarboxylase broth 197. 198. l ornithine decarboxylase broth l arginine dihydrolase broth 199. 200. wash bottle 500 ml pacity syringe filter 25 mm 201. mann ito! salt agar 202. modified hugh& leifson o/f test 203. loeffler serum medium base dept. of pathology 204. benedict’s reagents 1 205. n/iohcl ammonia solution 206. 207. sulphur powder 208. sodium n itroprusside crystals 209. ammonium sulphate powder 210. acetic acid 211. dextrose anhydrous ‘. purified 212. distilled water 213. r.b.c. diluting fluid (hayerns) 214. w.b.c. diluting fluid (turk’s) 215. oilimmersion for microscopy 216. sulphosalicylic acid 3% 217. leishman stain 218. bariumchloride 10% 219. sodiumcitrate 3.8% 220. spirit for spirit lamp 221. buffer for leishman stain fh6.s dept. of pathology 2. glass test tube 18mm x 50mm without rim 1 glass test tube 75mm x 12mm without rim 4. test tube holder 5. 6. heniocytometer sahli hemoglobinometer ...

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical And Health Services - Rajasthan

30664466 limited bidding supply of chemical and glassware s items i beaker 50ml 2 beaker i 0oml 3 centrifuge tube (p.p.tube) 1 5ml 4 centrifuge tube (p.p.tube) 50ml 5 cotton roll 6 m crussible quartz somi 7 diamond pencil 8 — glass rod large glass beads % mm glass slides 9 10 11 filter paper sheet nol (46x57m) 12 filter paper no 1 13 s____ filter paper no4 14 flask vol. 1 mkd “a” 250ml flask holder 15 16 nitrile gloves 9.5 medium 17 pipette rubber bulb small sibe pipette graduated “a” 1oml 18 19 çygiirbertubecap 2o petri dish c cover aluminium 70x30 mm — 21 test tube graduated stopper 30/25ml 22 t.l.c sheet aluminium (20x20) 23 wire 4 gauge 24 tilt loml — 25 — burette 50ml “a” class 26 ptfe syringe fther (dia 22 mm, pore size 0.25 micron) 27 flask volumetric wt stopper “a” (1 000ml)) 28 flask vol. wt. 250m1 29 flask vol wt stopper 500ml irf? a f droping glass bottle (looml) silicon wax 50 100gm . 33 volumetric flask sugnr estimation without stopper (100/1 loml) 34 sox let extractor (1 0oml) 40/3 8 35 soxiet condensor (medium) joint 40/38 36 nylon syringe filter fiiter (dia 25mm, pore size 0.22 micron) 37 plastic funnel (100 mm) 38 tips 100 i000 micro liter graduated (without filter) 30 aprating funnel c ptfe stoplork 39 tips i0 100 micro iiter graduated (without filter) 40 tips 1 5m1 graduated (without filter) 41 nitrogen gas cylinder 47 litre (99.99% purity) 42 aigon gns cylinder 47 litre (99.99% purity) 43 helium gas 47 litre (9999% purity) 44 hydrogen gns cylinder 47 litre (99.99x purity) 45 zero air gas cylinder 47 iitre (99.99% purity) etc ...

Medical And Health Services - Rajasthan

30657894 supply of laboratory reagents kits and other items 2 iiicullure tmansport swahs w / dcy engky neutrul broth 3 allahne saline pcplanc waler ( asi’w ) akernalive thioglyeollate medium ( nih thioglwllate broth ) ( thioglyeollatc broth, ahernaive ) s amies transport medium w / chircoal 6 apr medium m ( triple sugar. h on apr ) columbia blood apr base cooked meat medium ( revised as cooked m medium ) ( r c. medium ) reagan lwe medium hoyle medium base potassium telturite 3 s% ( i ml per vial ) loet!lcr medium base horse serum donor herd gamma irradiated sterile macconkey hli vegt apr wf cv, naci, 0 inj ls%agar s.no. items 1 i i,cuhuretn tranpcel swan wfamies medium (13) 2 llicuhure’ transmwt swan wil)cy lnpky neutralizitig broth 3 allalinc saline pq’ionc waler (aspw) 4 akernatnc thioglycolla*e jimkdpuin (nih nhiooiycollate broth) (thioiplycollate broth, akeriative) s aniies tmansport mediun wi charcoal 6 agar medium m (triple sugar, iron agtir) 7 cokumbia blood agar base j 8 cooled meal medium (revised as cooked m medium) (r c.medium) i 9 reagan lwemedium 10 hoy)e medium base i f 11 potassium tellurite 35%(t ml per vial) i f i f h f h fi 12 loefiler medium base 13 horse serum donoc herd (jamrna irradiated sterile filtered 14 macconkey hiveg agar wi cv,naci, 0003% nr and i5%agar 15 mycoplasma agar base (pplo agar base) 16 mycoplasma enrichment supplement h ii 17 nutrient broth wi 1% pcptone hi fi 18 nutrient agar wi 1% pep(onc iii fi — li i 19 nureni ajar, i 5% 20 peptone watcr 21 ryra7inam.dase apr 22 sckmnle f flrod (twin pack) medium 1 1(in accoedance with ip 20o7) 23 sluarn transporl medium w/o methykiw fliue iih charcoal 24 tellurile blood ajar base 25 ilaemoglobin powder 26 vitanerso growth supplement (twin pack) 27 potassium tellurite 1% (i ml per vial) 28 transport charcoal medium 29 transponl.quidmcdium 3o stuart tmansport medium (tmansport medium. sluarl) 31 tryptic soya agar 32 field’s tiyptic digest broth (tryptic digest broth) 33 tryptone tellurite agar base 34 potassium tellurite 1% (i ml per vial) 3s autoclavable petri plates polycarbonatc, clear, transparent and unbreakable, size 90 mm, diamcter x 1s mm. 36 makarthy tube, aluminium cap wih silicon rubber gasket, flat boitom vol. 20m1, dpm. : r 28x85mn, 1.0. 1.2mm, thick wall 37 wash bottle; capacity soomi 38 metaloop sl 39 sterile cotton swab / ieelcl in 10o ml hwilc ili :lil 41 s;eriswmipu l)i niectani vires si,c 7” 7” 42 lfnc1rvt1m i’lu il 1:i ii 1’l ii el 43 ixilcs. icngcni. li,niimlcm1 ‘iih sgrc cqp mnd l1iiriiig ring. looml 44 seir tle lure ‘iws’e swnh’ 45 mill. i!sbl. — 46 itsul multi ii i:, ii 47 48 49 ii f stes,n inndicatcr 1’are i iivibrjôthi identi(jcatio,i kit i iisalii1rm ib” idcinilication kit ii i: f f i:i 5o iiim(qilityl)4 flmcticmscii ku toe sgimone1ia iii 51 geobacilius ssoemmpl ft 5 anacro i3o s tr nspireni untwcakablc iolycarbonac lli boil. suie 19 ncms z i 3.7cmi z9cms. cajxuciiy: 2.s fu litre. acceswncs requird but not piovided. anserses pack 1.5 litrc (l.eoo2f) 1 no & anacro indieator tablet (t.e065) 53 anaerobic system mark v il’ ri 54 ilisalmoneibtu late,i test kit ili fi 55 mccwtnry bc*tk wi aluminiun cap neutral glass. i l autoclavable fi 56 sterile pure viscose swab ii fi 57 nasco sampling bag ii fi 58 thumb prenn l)espcnsing l)ropmri pasteur pipetics. stcrilc ii toual volune upto 3 m$ avaibble in individual iielile iil pock 59 iestiube nhoutkim.glasscap 3ss2oonrnc3oipia ii r 6o l,alwlcnv ncutrai p11 ii — 7iii dy. ii i | 61 plasticine i lw) mountant (tiw m.crmcopy) i 63 sq potassium ilydroude peliets 64 sq iiydropcn peroiude aolution 3o% w/ (100 volume,) 6s sq charcoal powcr activatcd 250 md 66 sçore strips (25 mnps’wck)) 67 sterule membrane syringe filters au. size 68 lugols lodme 69 grams iodine, siabdized 70 mcthyleine blue (aqueous) 71 safranin 05% w/v 72 grams crystal violet 73 albertva slain a kline concavity slides 8 concaviiies thickness: 3 mm, size 75 x 56 mm 74 alberts stain 13 75 gram’s decolourizer 76 conical flask erlenmeyer cap. 2soml 77 120 mi, capacity glass bottle witi i all(jmjniijt,4 cap 78 felix tube 79 dreyirs tuuber 80 pointed focei’s 6o/4i 81 ...

Department of Agricultural Research and Education - Rajasthan

30290439 bids are invited for tri reagent (trizol) 25 ml , single spin rna cleanup kit 50 rxn , dl lactic acid 500 ml , trypan blue 5 gm , phenol solution (equilibrated with te) 100 ml , phenol:chloroform:isoamyl alcohol 100 ml , nuclease free water 1 ltr , diaminobenzidine (hplc) 1 gm , ultrasonicators (4 ltr) 300x150x100 mm , qualitative filter papers 125 mm , ptfe syringe filters (0.2 µm) 25 mm , seed germination paper 460 x 285 mm , tissue culture bottle 400 ml , dry bath incubator led display , block for 20 micro centrifuge tubes 1.5 ml tubes , self sealing polybags. 3 x 4 inch , self sealing polybags, 4 x 6 inch , laboratory spatula. 6 polypropylene , laboratory spatula, 6 one side spoun , laboratory spatula 8 one side arrow , tissue culture bottle jar 400 ml , magenta box 65 x 65 x 100 mm , plastic storage box 3400 ml , measuring beaker (jug) 500 ml , measuring beaker (jug), 1000 ml , measuring beaker (jug). 2000 ml , moisture proof storage bottle, 500 ml , moisture proof storage bottle 1000 ml , drying rack 20 pegs , pestel and mortar 100 mm , self sealing polybags 6 x 8 inch , staining box 225 x 225 x 50 mm , mechanical timer 1 pcs , tissue paper 200 x 205 mm , aluminium foil 1 kg , acrylic seed displayer small , acrylic seed displayer, big , tissue roll 25 meter , vermiculite 25 kg , cryo box with hinged cap 4 pcs , digital thermohygrometer 2 pcs , test sieves 1.18 mm , test sieves, 1.70 mm , test sieves. 2.00 mm , test sieves,. 2.80 mm , grain moisture meter 1 , test sieves., 3.35 mm total quantity : 1...

State Forensic Science Laboratory - Rajasthan

30031014 chemical rate contract chemical , item no. 4 (a): consumables for instruments , hplc sample vials , hplc column, rp 18/ods , auto sampler vials for hplc precast with ptfe/red rubber/white silicone septa. , deuterium (d2)lamp for hplc (make : thermo) , tungsten halogen lamp for hplc(make : thermo) , micro litre syringe , micro litre syringe , syringe for gc ms for manual injection on spilt and splitless injectors /liners , syringe for gc ms for manual injection on spilt and splitless injectors /liners , syringe for gc ms for manual injection on spilt and splitless injectors /liners , syringe gas tight , graphite ferrules for gc capillary column , graphite ferrules for gc capillary column , liners for gc,split straight liner , liners for gc,split straight liner , liners for gc, split less straight liner. , liners for gc, split less straight liner , graphite sealing ring for inletliners , septa bto (low bleed silicone for inj. ssl) compatible with thermoscientific instrument (trace gc and ultra gc) , head space crimp vial , aluminium caps for 20mm hs vials headspace cap ,locquvered with w/high persepta 350 a h6/ 281ads , filament assembly for gc mass spectrometer, make: thermo, model: dsq , filament assembly for gc mass spectrometer, make: agilent , gc capillary column, tg 5 ms , gc capillary column, tr 35 , gc capillary column, trace tr 8095 ( gc column for explosives) , gccapillary column, tr 5 ms , gc capillary column, tr v1 , gc capillary column, ec 5, econo cap , gc capillary column, ec 1, econo cap , gc capillary column, at 1, heliflex , gc capillary column, ec –wax,econo cap , gc capillary column, bpx 5 , capillary tube /column cutter , trace ssl , trace ssl , trace ssl , trace ssl , o.d. liners graphite ring , trace , trace , trace , trace ssl, ms side ferrule , trace ssl, ms side ferrule , trace ssl, ms side ferrule , split/split less bto , packed bto , large volume sl bto , transfer line o ring , sample assay cups for dip(model dsq make thermo mass spectrometer) , s.s. gas tubing , s.s nuts ( for fitting of gas tubing 1/8 inches) , ss retaining ring (front & back ferrule) for 1/8 inches gas tubing , microparticulate filters for helium , microparticulate filters for hydrogen , microparticulate filters for nitrogen , microparticulate filters for air , double stage gas regulator for helium/ air/nitrogen , double stage gas regulator for hydrogen , gas purification panel for he, air, hydrogen and nitrogen gases , manifold for two cylinders with bracket , pigtail , vacuum pump oil , gas control box for helium gas , gc column, carbowax(for nucon glc) , gc column, se 30(for nucon glc) , gc column, porapak q(for nucon glc) , silicone rubber septum (for injector port of packed column ofnucon glc) , platinum sensor for fid temperature , platinum sensor for injector temperature , fid control module , injector cap for gc , fid base body blocks s.s. with jet and gas connection , injector liner for packed column , gas purifier / filter purifier / moisture trap , oxy trap , gas panel for operating one gc system , gas panel for operating two gc system , double stage s.s. diaphragm chrome plated pressure regulators , graduated glass soap bubble flow meter , gas connectingtubing: copper , gas connectingtubing: stainless steel , cuvette (quartz make) for uv visible spectrometer , cuvette (glass make) for uv visible spectrometer , deuterium lamp for uv visible spectrometer (make : lab india, model 3092) , filter wheel for uv visible spectrometer (make : lab india, model 3092) , tungsten lamp for uv visible spectrometer (make : lab india, model 3092) , m 1 lamp mirrorfor uv visible spectrometer (make : lab india, model 3092) , deuterium lamp for uv visible spectrometer (make : lab india, model 3200) , deuterium lamp for uv visible spectrometer (make : lab india, model 3000+) , m 1 lamp mirrorfor uv visible spectrometer (make : lab india, model 3000+) , filter wheel for uv visible spectrometer (make : lab india, model 3000+) , tungsten lamp for uv visible spectrometer (make : lab india, model 3000+) , microlitre dosing syringe for hptlc , microlitre dosing syringe for hptlc , microlitre filling syringe for hptlc , microlitre filling syringe for hptlc , deuterium lamp for hptlc , tungsten lamp for hptlc , mercury lamp for hptlc , deuterium (d2)lamp for hptlc , tungsten lamp for hptlc , mercury (hg) vapour for hptlc , dessicant cartridges for ftir , ss die set for sampling in ftir( kbr pellet formation) , gd/x syringe filters(three layer pre filter) for hplc, gc ms, glc, uv etc. sample preparation. , gd/x syringe filters(three layer pre filter) for hplc, gc ms, glc, uv etc. sample preparation. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter) for sample preparation for hplc, gc ms, glc, uv etc. , gd/x syringe filters(three layer pre filter for sample preparation for hplc, gc ms, glc, uv etc. , syringe less filter (mini uni prep) , syringe less filter (mini uni prep) , syringe less filter (mini uni prep) , syringe less filter (mini uni prep) , syringe less filter (mini uni prep) , syringe less filter (mini uni prep) , membrane filters , membrane filters , membrane filters , membrane filters , tlc developing tank , rectangular,glass tank with lid , dual slot tlc developing chamber for 20x20 cm plates , twin trough chamber for tlc plates , twin trough chamber for tlc plates , twin trough chamber for tlc plates , tlc spray box , spray unit, prival , tlc sprayer, 125 ml , flask type sprayer 250ml, , tlc silica gel 60 f254aluminum , tlc silica gel 60 f254aluminium , tlc silica gel 60 f254 glassbacked layer , tlc silica gel 60 f254 glassbacked layer , tlc silica gel 60 aluminum , tlc silica gel 60 aluminum , tlc silica gel 60 glassbacked layer , tlc silica gel 60 glassbacked layer , hptlcplates, silica gel 60 , hptlcplates, silica gel 60 , hptlcplates, silica gel 60 , hptlcplates, silica gel 60 , hptlcplates, silica gel 60 f254 , hptlcplates, silica gel 60 f254 , hptlcplates, silica gel 60 f254 , immersion oil forolympus bx 50 microscope [viscosity 135mm 2/s, refractive index ne=1.518(230c) ] , immersion oil for leica dm 2500 microscope [viscosity 825 mm 2/s at 230c, optical characteristics ne (546,1 nm) 1,5180,iso 8036] , immersion oil for microscopy [viscosity (20°c) 1000 2000 mpa’s , refractive index n=1.515 1.516(200/d)] , ashless filter paper circles , ashless filter paper circles , ashlessfilter paper circles , ashless filter paper sheet , ashless filter paper sheet , ashless filter paper sheet , stainless steel filter holder , stainless steel filter holder , snake venomdetection kit, elisa based 96 test kit , bio chip array analyser kit, doa i , bio chip array analyser kit, doa ii , bio chip array analyser kit, doa iii , bio chip array analyser kit, doa iv , bio chip array analyser kit, doa ultra/duid , bio chip array analyser kit, doa i+ , bio chip array analyser kit, doa evolution , glass insert oci/liners , glass insert spl2010/liners , glass insert sless/wvi/liners , polystrene vials (for alcohol analyser) , caps for polystrene vials of 50 ml capacity(for alcohol analyser) , jet opener for fid , triple filter(o2/h20/hc) , crimper , piston oil for diesel analyzer , filling membrane for diesel analyzer , metallic filter for diesel analyzer...

Department Of Agriculture - Rajasthan

29389261 rate contract for supply of laboratory items from distributors / dealers / suppliers for use in “government pesticide residue testing laboratory, durgapura, jaipur under department of agriculture, government of rajasthan crms ( certified reference material ) 1 blytox crm 100 mg 01 8000 8000 2 chlothianidin crm 250 mg 01 8500 8500 3 carfentrazone crm 50 mg 01 11000 11000 4 difenaconazole crm 250 mg 01 8500 8500 5 ddvp ( dichlorovos ) crm 100 mg 01 6500 6500 6 difenthruon crm 100 mg 01 8000 8000 7 dinocap crm 100 mg 01 7500 7500 8 endosulfan sulphate crm 100 mg 01 11000 11000 9 fluchloralin crm 250 mg 01 6500 6500 10 flunicramide crm 100 mg 01 11000 11000 11 emmamactin benzoate crm 250 mg 01 11000 11000 12 malathion crm 100 mg 01 6000 6000 13 mancozeb crm 250 mg 01 4500 4500 14 methyl demeton crm 100mg 01 15000 15000 15 methabenzthiazuro n crm 100 mg 01 6500 6500 16 metsulfuron methyle crm 100 mg 01 8000 8000 17 propagite crm 100 mg 01 6300 6300 18 thiram crm 250 mg 01 6000 6000 19 tabuconazole crm 250 mg 01 8500 8500 20 trifluralin crm 50 mg 01 8000 8000 21 tridemorph crm 50 mg 01 15000 15000 22 thiodicarb crm 100 mg 01 7000 7000 23 ziram crm 250 mg 01 5000 5000 24 zineb crm 250 mg 01 5500 5500 rate contract tender for gprtl page 41 of 70 25 peraquat crm 100 mg 01 8400 8400 26 propineb crm 250 mg 01 4500 4500 27 qzalofop ethyl crm 100 mg 01 10000 10000 28 aldrin crm 250 mg 01 8000 8000 29 dieldrin crm 100 mg 01 14000 14000 30 diazinon crm 100 mg 01 7500 7500 31 alpha endosulfan crm 100 mg 01 9500 9500 32 heptachlor crm 100 mg 01 15500 15500 33 phorate crm 100 mg 01 9000 9000 34 captafol crm 100 mg 01 8900 8900 35 trizophos crm 100 mg 01 9000 9000 total group a 3, 03, 100 / group b chemicals 1 acetone ar 2.5 lt 40 700 28000 2 acetonitrile hplc 1.0 lt 12 800 9600 3 acetonitrile hplc 2.5 lt 4 1300 5200 4 acetonitrile ar 2.5 lt 12 900 10800 5 ammonia ( liquid ) ar 500 ml 2 260 520 6 acetic acid glacial ar 1.0 lt 2 430 860 7 benzene ar 500 ml 2 480 960 8 carbon disulphide ar 500 ml 2 550 1100 9 cellitte 545 ar 500 gm 4 450 1800 10 copper acetate ar 500 gm 1 900 900 11 ethanol 500 ml 15 225 3375 12 glycerol ar 500 ml 4 560 2240 13 hydrochloric acid ar 2.5 lt 4 960 3840 14 hydrochloric acid icp 1.0 lt 2 15000 30000 15 magnesium sulphate pr 500 gm 1 830 830 16 methyl orange indicator 125 ml 10 120 1200 17 methanol ar 2.5 lt 4 750 3000 18 methanol hplc 1.0 lt 2 580 1160 19 nitric acid ar 2.5 lt 4 800 3200 20 nitric acid icp 1.0 lt 4 18000 72000 21 hexane ar 2.5 lt 4 650 2600 22 n hexane hplc 1.0 lt 10 800 8000 23 potassium dichromate ar 500 gm 20 400 8000 24 sodium sulphate ar 500 gm 10 400 4000 25 sulphuric acid ar 2.5 lt 20 700 14000 26 stannous chloride ar 100 gm 4 650 2600 27 sodium chloride ar 500 gm 20 150 3000 total group b 2, 22, 785 / group c glassware’s 1 beaker b 1000 ml 6 230 1380 2 beaker b 500 ml 6 110 660 3 beaker b 50 ml 6 60 360 rate contract tender for gprtl page 42 of 70 4 beaker b 5 ml 15 60 900 5 measuring cylinder b 1000 ml 2 1300 2600 6 measuring cylinder b 500 ml 2 900 1800 7 measuring cylinder b 100 ml 4 380 1520 8 measuring cylinder b 10 ml 4 250 1000 9 volumetric flask a 1000 ml 6 1600 9600 10 volumetric flask a 500 ml 6 1100 6600 11 volumetric flask a 250 ml 6 800 4800 12 volumetric flask a 100 ml 6 600 3600 13 volumetric flask a 50 ml 6 600 3600 14 volumetric flask a 25 ml 30 600 18000 15 volumetric flask a 10 ml 50 650 32500 16 separating funnel b 1000 ml 12 900 10800 17 watch glass b 125 mm 18 90 1620 total group c 1, 01, 340 / group d filter papers 1 ordinary rim normal rim of 350 paper size 20 800 16000 2 what man no.1 no.1 125 mm ( pack of 100 paper 20 270 5400 total group d 21, 400 / group e laboratory gases 1 nitrogen iolar instr umental / 9 9.9998 % 07 cubic meter 6 2100 12600 2 helium instrument al / 99.9998 % 07 cubic meter 2 20000 40000 3 argon spectra / 99.9998% 07 cubic meter 08 3300 26400 4 air 99.9995% 07 cubic meter 1 2800 2800 5 hydrogen 99.9995% 07 cubic meter 1 2800 2800 total group e 84, 600 / group f micro syringe 1 hamilton micro syringe 10 ul 6 2000 12000 total group f 12, 000 / group g syringe filter 1 syringe filter pvdf filter media with polypropyl ene housing 25 mm dia, 0.45 um, pack of 50 piece 4 pk 9300 37200 rate contract tender for gprtl page 43 of 70 2 syringe filter ptfe filter media with polypropyl ene housing 25 mm dia, 0.45 um, pack of 50 piece 1 pk 7000 7000 total group f 44, 200 / group h capillary column 1 capillary column db 5 or equivalent 30 m, 0.250 mm id, 0.25 um film single 02 40000 80000 2 capillary column sh rxi 5sil ms, l 30 m, id 0.25, df 0.25 or equivalent single 02 40000 80000 total group h 1, 60, 000 / group i micro pipette 1 micro pipette 100 1000 ul single 01 8500 8500 2 micro pipette 10 100 ul single 01 8500 8500 3 micro pipette 0.5 10 ul single 01 8500 8500 total group i 25, 500 / group j quechers kit 1 quechers kit 15ml q sep dspe 900mg mgso4, 300 mg psa , 300 c18 , 45 mg gcb pack of 50 tubes 02 pk 22500 45000 2 quechers kit 15ml q sep dspe 1200mg mgso4, 400 mg psa pack of 50 tubes 02pk 22500 45000 3 quechers kit 15ml q sep dspe 1200mg mgso4, 400 mg psa, 400 c18 pack of 50 tubes 02 pk 22500 45000 total group j 1, 35, 000 / group k gas manifold s.s.single stage single 02 8000 16000 total group k 16, 000 / group l gas purification refill 1 nitrogen moisture trap single 02 3300 6600 2 nitrogen oxy trap single 02 3700 7400 3 helium moisture trap single 02 3300 6600 rate contract tender for gprtl page 44 of 70 4 helium oxy trap single 02 3700 7400 5 argon moisture trap single 02 3300 6600 6 argon oxy trap single 02 3700 7400 total group l 42, 000 / group m battery for on line ups including installation in present ups smf battery 100 ah, 12 vdc single 60 8500 510000 total group m...

Department Of Agriculture - Rajasthan

29379911 supply of laboratory items from manufacturers or their authorised distributors dealers suppliers for use in government pesticide residue testing laboratory durgapura jaipur under department of agriculture gor , group a crms ( certified reference material ) 1 blytox crm 100 mg 01 8000 8000 2 chlothianidin crm 250 mg 01 8500 8500 3 carfentrazone crm 50 mg 01 11000 11000 4 difenaconazole crm 250 mg 01 8500 8500 5 ddvp ( dichlorovos ) crm 100 mg 01 6500 6500 6 difenthruon crm 100 mg 01 8000 8000 7 dinocap crm 100 mg 01 7500 7500 8 endosulfan sulphate crm 100 mg 01 11000 11000 9 fluchloralin crm 250 mg 01 6500 6500 10 flunicramide crm 100 mg 01 11000 11000 11 emmamactin benzoate crm 250 mg 01 11000 11000 12 malathion crm 100 mg 01 6000 6000 13 mancozeb crm 250 mg 01 4500 4500 14 methyl demeton crm 100mg 01 15000 15000 15 methabenzthiazuro n crm 100 mg 01 6500 6500 16 metsulfuron methyle crm 100 mg 01 8000 8000 17 propagite crm 100 mg 01 6300 6300 18 thiram crm 250 mg 01 6000 6000 19 tabuconazole crm 250 mg 01 8500 8500 20 trifluralin crm 50 mg 01 8000 8000 21 tridemorph crm 50 mg 01 15000 15000 22 thiodicarb crm 100 mg 01 7000 7000 23 ziram crm 250 mg 01 5000 5000 24 zineb crm 250 mg 01 5500 5500 rate contract tender for gprtl page 41 of 70 25 peraquat crm 100 mg 01 8400 8400 26 propineb crm 250 mg 01 4500 4500 27 qzalofop ethyl crm 100 mg 01 10000 10000 28 aldrin crm 250 mg 01 8000 8000 29 dieldrin crm 100 mg 01 14000 14000 30 diazinon crm 100 mg 01 7500 7500 31 alpha endosulfan crm 100 mg 01 9500 9500 32 heptachlor crm 100 mg 01 15500 15500 33 phorate crm 100 mg 01 9000 9000 34 captafol crm 100 mg 01 8900 8900 35 trizophos crm 100 mg 01 9000 9000 total group a 3, 03, 100 / group b chemicals 1 acetone ar 2.5 lt 40 700 28000 2 acetonitrile hplc 1.0 lt 12 800 9600 3 acetonitrile hplc 2.5 lt 4 1300 5200 4 acetonitrile ar 2.5 lt 12 900 10800 5 ammonia ( liquid ) ar 500 ml 2 260 520 6 acetic acid glacial ar 1.0 lt 2 430 860 7 benzene ar 500 ml 2 480 960 8 carbon disulphide ar 500 ml 2 550 1100 9 cellitte 545 ar 500 gm 4 450 1800 10 copper acetate ar 500 gm 1 900 900 11 ethanol 500 ml 15 225 3375 12 glycerol ar 500 ml 4 560 2240 13 hydrochloric acid ar 2.5 lt 4 960 3840 14 hydrochloric acid icp 1.0 lt 2 15000 30000 15 magnesium sulphate pr 500 gm 1 830 830 16 methyl orange indicator 125 ml 10 120 1200 17 methanol ar 2.5 lt 4 750 3000 18 methanol hplc 1.0 lt 2 580 1160 19 nitric acid ar 2.5 lt 4 800 3200 20 nitric acid icp 1.0 lt 4 18000 72000 21 hexane ar 2.5 lt 4 650 2600 22 n hexane hplc 1.0 lt 10 800 8000 23 potassium dichromate ar 500 gm 20 400 8000 24 sodium sulphate ar 500 gm 10 400 4000 25 sulphuric acid ar 2.5 lt 20 700 14000 26 stannous chloride ar 100 gm 4 650 2600 27 sodium chloride ar 500 gm 20 150 3000 total group b 2, 22, 785 / group c glassware’s 1 beaker b 1000 ml 6 230 1380 2 beaker b 500 ml 6 110 660 3 beaker b 50 ml 6 60 360 rate contract tender for gprtl page 42 of 70 4 beaker b 5 ml 15 60 900 5 measuring cylinder b 1000 ml 2 1300 2600 6 measuring cylinder b 500 ml 2 900 1800 7 measuring cylinder b 100 ml 4 380 1520 8 measuring cylinder b 10 ml 4 250 1000 9 volumetric flask a 1000 ml 6 1600 9600 10 volumetric flask a 500 ml 6 1100 6600 11 volumetric flask a 250 ml 6 800 4800 12 volumetric flask a 100 ml 6 600 3600 13 volumetric flask a 50 ml 6 600 3600 14 volumetric flask a 25 ml 30 600 18000 15 volumetric flask a 10 ml 50 650 32500 16 separating funnel b 1000 ml 12 900 10800 17 watch glass b 125 mm 18 90 1620 total group c 1, 01, 340 / group d filter papers 1 ordinary rim normal rim of 350 paper size 20 800 16000 2 what man no.1 no.1 125 mm ( pack of 100 paper 20 270 5400 total group d 21, 400 / group e laboratory gases 1 nitrogen iolar instr umental / 9 9.9998 % 07 cubic meter 6 2100 12600 2 helium instrument al / 99.9998 % 07 cubic meter 2 20000 40000 3 argon spectra / 99.9998% 07 cubic meter 08 3300 26400 4 air 99.9995% 07 cubic meter 1 2800 2800 5 hydrogen 99.9995% 07 cubic meter 1 2800 2800 total group e 84, 600 / group f micro syringe 1 hamilton micro syringe 10 ul 6 2000 12000 total group f 12, 000 / group g syringe filter 1 syringe filter pvdf filter media with polypropyl ene housing 25 mm dia, 0.45 um, pack of 50 piece 4 pk 9300 37200 rate contract tender for gprtl page 43 of 70 2 syringe filter ptfe filter media with polypropyl ene housing 25 mm dia, 0.45 um, pack of 50 piece 1 pk 7000 7000 total group f 44, 200 / group h capillary column 1 capillary column db 5 or equivalent 30 m, 0.250 mm id, 0.25 um film single 02 40000 80000 2 capillary column sh rxi 5sil ms, l 30 m, id 0.25, df 0.25 or equivalent single 02 40000 80000 total group h 1, 60, 000 / group i micro pipette 1 micro pipette 100 1000 ul single 01 8500 8500 2 micro pipette 10 100 ul single 01 8500 8500 3 micro pipette 0.5 10 ul single 01 8500 8500 total group i 25, 500 / group j quechers kit 1 quechers kit 15ml q sep dspe 900mg mgso4, 300 mg psa , 300 c18 , 45 mg gcb pack of 50 tubes 02 pk 22500 45000 2 quechers kit 15ml q sep dspe 1200mg mgso4, 400 mg psa pack of 50 tubes 02pk 22500 45000 3 quechers kit 15ml q sep dspe 1200mg mgso4, 400 mg psa, 400 c18 pack of 50 tubes 02 pk 22500 45000 total group j 1, 35, 000 / group k gas manifold s.s.single stage single 02 8000 16000 total group k 16, 000 / group l gas purification refill 1 nitrogen moisture trap single 02 3300 6600 2 nitrogen oxy trap single 02 3700 7400 3 helium moisture trap single 02 3300 6600 rate contract tender for gprtl page 44 of 70 4 helium oxy trap single 02 3700 7400 5 argon moisture trap single 02 3300 6600 6 argon oxy trap single 02 3700 7400 total group l group m battery for on line ups including installation in present ups smf battery 100 ah, 12 vdc etc ...

Sms Medical College - Rajasthan

27614417 supply of chemicals and consumables items for use in jk lon hospital. column nut for ssl and ssl back, 10ul syringe, focus liner, filament assembly lon trap, wilmad nmr tube, oligonucleotides, methanol gc grade, acetonitrle gc grade, chloroform hplc grade, pesticides mix organochlorine pesticide mix ab, hexane toluene, pesticides mix organochlorine pesticide mix europeam formulation , ethanol ar, syringe, tissue rolls, syringe filter 0.45 micrometer...

Indian Institute Of Technology - Rajasthan

26758486 supply of lab consumables 1 mtt, suitable for cell culture, pack size: 1 gm, catalog / make: m2128 1g, sigma 2 luminata crescendo western hrp substrate, pack size: 500 ml, catalog / make: wblur0500, millipore 3 anti mouse igg, hrp linked antibody, pack size: 1 mg in 1 ml, catalog / make: pi 2000 1, vector labs 4 anti rabbit igg, hrp linked antibody, pack size: 1 mg in 1 ml, catalog / make: pi 1000 1, vector labs 5 sso fast eva green supermix, pack size: 10 ml ( bottle ) , 1000 rxn, catalog / make: 172 5202, bio rad 6 itraconazole =98%, pack size: 100 mg, catalog / make: 16657 100mg 7 mefenamic acid, pack size: 50 gm, catalog / make: m4267 50g 8 proteasome glotm assays chymotrypsin like, pack size: 50 ml, catalog / make: g8622, promega 9 dual luciferase® reporter assay system, pack size: 100 assays, catalog / make: e1910, promega 10 znf294 polyclonal antibody, pack size: ( 100 ul ) , catalog / make: pa5 42315, invitrogen 11 ltn1 sirna ( h ) , pack size: 10um, catalog / make: sc 91401, santa cruz biotech 12 fetal bovine serum, origin: us / non us / brazil, eu approved, sterile filtered, pack size: 500 ml 13 10x pbs, molecular biology grade, ph 7.4, pack size: 500 ml 14 trypsin / edta solution ( 0.25% trypsin and 0.01% edta in dulbecco’s pbs, sterile filtered ) , pack size: 500 ml 15 cell freezing medium dmso 1x sterile filtered, suitable for cell culture, pack size: 50 ml 16 microscope cover glass 20mm no. 1 ( square ) , pack size: 10 gm 17 tissue culture plate sterile, black, 2 wells, pack size: 12 pcs 18 antibiotic antimycotic solution ( 100x ) , sterile filtered, suitable for cell culture, pack size: 100 ml 19 plasmid midiprep kit, pack size: 25 preps 20 ethanol import, pack size: 500 ml 21 syringe filters, pvdf membrane, pore size: 0.22μ, 33mm diameter, sterile, pack size: 50 pcs 22 grade 1 quantitative filter paper sheet, size: 46 x 57cm, pack size: 500 sheets...

Indian Institute Of Technology - Rajasthan

26302681 supply of lab consumables: 1. mtt, suitable for cell culture 2. luminata crescendo western hrp substrate 3. anti mouse igg, hrp linked antibody 4. anti rabbit igg, hrp linked antibody 5. sso fast eva green supermix 6. itraconazole ≥98% 7. mefenamic acid 8. proteasome glotm assays chymotrypsin like 9. dual luciferase® reporter assay system 10. znf294 polyclonal antibody 11. ltn1 sirna (h) 12. fetal bovine serum, origin: us/ non us/ brazil, eu approved, sterile filtered 13. 10x pbs, molecular biology grade, ph 7.4 14. trypsin/ edta solution (0.25% trypsin and 0.01% edta in dulbecco’s pbs, sterile filtered) 15. cell freezing medium dmso 1x sterile filtered, suitable for cell culture 16. microscope cover glass 20mm no. 1 (square) 17. tissue culture plate sterile, black, 2 wells 18. antibiotic antimycotic solution (100x), sterile filtered, suitable for cell culture 19. plasmid midiprep kit 20. ethanol import 21. syringe filters, pvdf membrane, pore size: 0.22μ, 33mm diameter, sterile 22. grade 1 quantitative filter paper sheet, size: 46 x 57cm, 23. tissue paper roll, 2ply x 50 mts 24. examination gloves, m size 25. examination gloves, l size...

Indian Institute Of Technology - Rajasthan

26248523 supply of lab consumables 1 mtt, suitable for cell culture, pack size: 1 gm, catalog / make: m2128 1g, sigma 2 luminata crescendo western hrp substrate, pack size: 500 ml, catalog / make: wblur0500, millipore 3 anti mouse igg, hrp linked antibody, pack size: 1 mg in 1 ml, catalog / make: pi 2000 1, vector labs 4 anti rabbit igg, hrp linked antibody, pack size: 1 mg in 1 ml, catalog / make: pi 1000 1, vector labs 5 sso fast eva green supermix, pack size: 10 ml ( bottle ) , 1000 rxn, catalog / make: 172 5202, bio rad 6 itraconazole =98%, pack size: 100 mg, catalog / make: 16657 100mg 7 mefenamic acid, pack size: 50 gm, catalog / make: m4267 50g 8 proteasome glotm assays chymotrypsin like, pack size: 50 ml, catalog / make: g8622, promega 9 dual luciferase® reporter assay system, pack size: 100 assays, catalog / make: e1910, promega 10 znf294 polyclonal antibody, pack size: ( 100 ul ) , catalog / make: pa5 42315, invitrogen 11 ltn1 sirna ( h ) , pack size: 10um, catalog / make: sc 91401, santa cruz biotech 12 fetal bovine serum, origin: us / non us / brazil, eu approved, sterile filtered, pack size: 500 ml 13 10x pbs, molecular biology grade, ph 7.4, pack size: 500 ml 14 trypsin / edta solution ( 0.25% trypsin and 0.01% edta in dulbecco’s pbs, sterile filtered ) , pack size: 500 ml 15 cell freezing medium dmso 1x sterile filtered, suitable for cell culture, pack size: 50 ml 16 microscope cover glass 20mm no. 1 ( square ) , pack size: 10 gm 17 tissue culture plate sterile, black, 2 wells, pack size: 12 pcs 18 antibiotic antimycotic solution ( 100x ) , sterile filtered, suitable for cell culture, pack size: 100 ml 19 plasmid midiprep kit, pack size: 25 preps 20 ethanol import, pack size: 500 ml 21 syringe filters, pvdf membrane, pore size: 0.22μ, 33mm diameter, sterile, pack size: 50 pcs 22 grade 1 quantitative filter paper sheet, size: 46 x 57cm, pack size: 500 sheets 23 tissue paper roll, 2ply x 50 mts, 1 roll 24 examination gloves, m size, pack size: 100 pcs 25 examination gloves, l size, pack size: 100 pcs...

Sawai Man Singh Medical College - Rajasthan

26081829 tender for supply of surgical , disposable and consumable item 1.1 b.p. blade no. 10, 11 & 15 2 blood transfusion set with leur lock 3 blood transfusion set 4 clinical thermometer oval shape 5 digital thermometer 6 latex folley balloon catheter no. 6 7 latex folley balloon catheter no. 8 10 8 latex folley balloon catheter no. 12 14 9 plain red rubber catheter no. 6, 8, 10, 12 10 malecot catheter with tip no. 10 to 24 11 malecot catheter no. 10 to 24 12 chest drainage catheter no. 12, 16, 20, 24 13 chest drainage catheter with trocar no. 12, 16, 20, 24 14 male catheter 15 disposable endotracheal tube no. 2, 2½, 3, 3½, 4, 4½, 5, 5½, 6, 6½, 7 16 disposable endotracheal tube with cuff no. 5, 5½, 6, 6½, 7 17 tracheostomy tube plain no. 2½, 3, 3½, 4, 4½, 5, 5½, 6, 6½, 7, 7½, 8 18 tracheostomy tube cuffed no. 2½, 3, 3½, 4, 4½, 5, 5½, 6, 6½, 7, 7½, 8 19 sterile latex surgeon’s gloves no. 6, 6½, 7, 7½ isi / ce marked 20 ecg electrode ( paed. size ) 21 bugbee electrode 22 i.v. infusion set with needle having built in air vent 23 infusion set non dehp light protective 24 i.v. set with flow regulator 5 to 250 ml / hour 25 flow regulator extension set 26 i.v. canula no. 22 with wings injection port & 3 way stop cock 27 iv canula no. 22 with wings & injection port 28 i.v. canula no. 24 with wings & with inj. port 29 i.v. canula no. 24 with wings & without inj. port 30 i.v. canula no. 26 with wings & inj. port 31 i.v. canula no. 26 with wings & without inj. port 32 i.v. access device closed port stand alone 33 i.v. access device closed port single extension 34 i.v. access device closed port double extension 35 three way stop cock 36 three way stop cock with extension line 150 cm 37 three way stop cock with extension line 100 cm 38 three way stop cock with extension line 50 cm 39 three way stop cock with extension line 10 cm 40 pressure monitoring line 200cm / 150cm / 100cm 41 long line catheter no. 20, 22 42 central / neck line catheter no. 20, 22, 24 mono 43 central / neck line catheter no. 20, 22, 24 duo 44 central / neck line catheter no. 20, 22, 24 trio 45 iv cannula no. 24 with radio detectable teflon fep. 46 iv cannula no. 26 with radio detectable teflon fep. 47 iv cannula no. 24 with volex polyurethane radio detectable catheter, instant flash back & sip clip safety mechanism . 48 iv cannula no. 24 with volex polyurethane radio detectable catheter& instant flash back. 49 guedel airway 50 measured volume infusion set 150 ml 51 measured volume infusion set 110 ml 52 measured volume infusion set with air vent, y inj. site & ll 150 ml 53 measured volume infusion set with air vent, y inj. site & ll 110 ml 54 micro i.v. infusion set with needle having air vent 55 micro infusion set with flow regulator 56 lancet 30 g for use on lancet device 57 sterile disposable hypodermic needle no. 18x1½ 58 sterile disposable hypodermic needle no. 21x1½ 59 sterile disposable hypodermic needle no. 23x1½ 60 sterile disposable hypodermic needle no. 26x1 61 paed. spinal needle no. 18, 19, 20, 22, 23, 25, 27 62 lumber puncture needle no. 18, 19, 20, 22, 23, 25, 27 63 bone marrow needle 64 biopsy needle 16gx10, 18gx10, 18gx16 should be compatible with reusable magnum core biopsy instrument. 65 disposable coaxial core biopsy ( guide ) needle should have engineered compatibility with biopsy enhance efficiency and accuracy. 66 infant feeding tube no. 5, 6, 7, 8, 9, 10 67 infant feeding tube having graduated scale no. 5, 6, 7, 8, 9, 10 68 nazal prongs ( adult ) 69 nazal prongs ( child ) 70 nazal prongs ( neonates ) 71 oxygen mask with variable venturi system to ensure accurate concentration of oxygen 72 ryles tube no. 10, 12, 14 73 suction bulb 74 suction catheter no. 6, 8, 10, 12 75 scalp vein set no. 18 to 27 76 winged infusion set 77 yaunkers suction set with standard tip 78 disposable syringe without needle 50 cc 79 disposable syringe with needle 20 cc 80 disposable syringe with needle 10 cc 81 disposable syringe with needle 5 cc 82 disposable syringe with needle 3 cc 83 disposable syringe with needle 2 cc 84 disposable syringe with needle 1 cc 85 sterile single use syringe 50cc with natural rubber gasket , central nozzle & luer mount. 86 sterile single use syringe 20cc with natural rubber gasket , central nozzle & luer mount. 87 sterile single use syringe 10cc with natural rubber gasket , central nozzle & luer mount. 88 sterile single use syringe 5cc with natural rubber gasket , central nozzle & luer mount. 89 sterile single use syringe 3cc with natural rubber gasket , central nozzle & luer mount. 90 sterile single use syringe 2cc with natural rubber gasket , central nozzle & luer mount. 91 sterile single use syringe 1cc with natural rubber gasket , central nozzle & luer mount. 92 sterile single use syringe 50cc with natural rubber gasket , central nozzle & luer lock. 93 sterile single use syringe 20cc with natural rubber gasket , central nozzle & luer lock. 94 sterile single use syringe 10cc with natural rubber gasket , central nozzle & luer lock. 95 sterile single use syringe 5cc with natural rubber gasket , central nozzle & luer lock. 96 sterile single use syringe 3cc with natural rubber gasket , central nozzle & luer lock. 97 sterile single use syringe 2cc with natural rubber gasket , central nozzle & luer lock. sterile single use syringe 1cc with 98 natural rubber gasket , central nozzle & luer lock. 99 sterile single use syringe 20cc with natural rubber gasket & auto disable mechanism 100 sterile single use syringe 10cc with natural rubber gasket & auto disable mechanism 101 sterile single use syringe 5cc with natural rubber gasket & auto disable mechanism 102 sterile single use syringe 3cc with natural rubber gasket & auto disable mechanism 103 sterile single use syringe 2cc with natural rubber gasket & auto disable mechanism 104 sterile single use syringe 1 ml with natural rubber gasket & auto disable mechanism 105 sterile single use syringe 0.5 ml with natural rubber gasket & auto disable mechanism 106 sterile single use syringe 0.1 ml with natural rubber gasket & auto disable mechanism 107 baby diapers large with natural anti rash shield 108 baby diapers small with natural anti rash shield 109 diaper rash cream 110 insulin syringe 30g 40 units 111 insulin needle 112 urine collection bag 2000 ml 113 urine collection bag with measured volume chamber 114 paed. urine collection bag having self adhesive facility 115 umbilical cord clamp 116 umblical canula / catheter ( pvc ) no. 2.5, 3.5, 4, 5, 6, 7, 8 117 umblical canula / catheter ( polyurethan ) no. 2.5, 3.5, 4, 5, 6, 7, 8 118 ureteral catheter 119 p.d. catheter pp fr12 with open tip & 32 lateral eyes supplied with stainless steel trochar, blunt type withclip to identify the length of catheter. 120 p.d. catheter set adult 121 p.d. catheter set child 122 p.d. catheter set infant 123 p.d. transfusion set 124 disposable surgeon’s cap 125 disposable surgeon’s face mask 126 closed wound suction unit no. 6, 8 127 closed wound suction unit no. 10, 12 128 closed wound suction unit no. 14, 16, 18 129 d.j. stent no. 3f 16cm 130 d.j. stent no. 3.5f 16cm 131 d.j. stent no. 3.5f 25cm 132 d.j. stent no. 4f 16cm 133 d.j. stent no. 4.5 134 v.p. shunt lp / mp / hp 135 under water seal drainage system 136 abdominal drainage kit no. 16, 18, 20, 22 & 24 137 stominal closed / drainable pouch 25 50 mm 138 colostomy drainage bag 139 colostomy bag tail clip 140 epidural needle no. 16, 18, 19 , 20, 24 141 epidural catheter no. 16, 18, 19, 20, 24 142 epidural kit containing lor syringe , filter, catheter needle no. 16 143 epidural kit containing lor syringe , filter, catheter needle no. 18 144 epidural kit containing lor syringe , filter, catheter needle no. 19 145 epidural kit containing lor syringe , filter, catheter needle no. 20 146 epidural kit containing lor syringe , filter, catheter needle no. 22 147 suprapubic catheter no. 10, 12, 14, 16 148 anatomical face mask 149 anatomical face mask ( for anaesthesia ) 150 venturi mask 151 absorbent cotton 500 gm 152 absorbent cotton 400 gm 153 absorbent cotton 200 gm 154 absorbent cotton 100 gm 155 breast pump 156 n 95 mask 157 t piece resuscitator 158 bain circuit ( adult ) 159 bain circuit ( child ) 160 jrp circuit 162 bubble tube for suction 10 mtr. 163 b.p. cuff complete large / medium / small 164 safety box as per who standard 10 ltr 165 safety box as per who standard 5 ltr 166 mackintosh sheet 167 medicine chamber for nebulizer ( adult ) 168 medicine chamber for nebulizer ( child ) 169 medicine chamber for nebulizer ( neonates ) 170 d.j. guide wire 2.5f 171 d.j. guide wire 3f 172 d.j. guide wire 3.5f 173 d.j. guide wire 4f 174 oxygen tube 25 mtr. 175 disposable oxygen mask child with nose clip 176 disposable oxygen mask child without nose clip 177 rebreathing rubber bag 1½ ltr. 178 rebreathing rubber bag 1 ltr. 179 rebreathing rubber bag ½ ltr. 180 disposable tongue depressor 181 leucocyte removal filter 182 6 bands multi band ligator 183 corrugated drainage sheet 184 patient identity band 185 under pad sheet 90x60 cm 186 baby diaper large 187 baby diaper medium 188 baby diaper small 189 plastic test tube 3” with screw cap with label 190 edta vial 2ml with label 191 p.t. vial with label & chemical 192 vaccum blood collection tube esr 2 ml 193 vaccum blood collection tube serum 2 ml 194 vaccum blood collection tube edta 2 ml 195 vaccum blood collection tube coagulation 2 ml 196 sterile sample container 30ml 198 aluminium foil 199 anal dilator set 9 / 10, 11 / 12, 12 / 14, 13 / 14, 15 / 16 200 micro endotracheal tube with cuff no. 2, 2½, 3, 3½, 4, 4½, 5, 5½ 201 adult diaper 202 picc and cvc paed. suture fixation device 203 canula fixation iv dressing size 6x7 cm 204 canula fixation iv dressing size 10x12 cm 205 transparent medicated wound dressing size 10x12 cm 206 transparent medicated wound dressing size 10x20 cm 207 transparent medicated wound dressing size 10x25 cm 208 incentive volumetric exerciser 209 suction catheter with standard tip 210 hydrogel electrode 211 nasal cannula standard tip 212 hme filter 213 bacterial filter 214 anesthesia circuit corrugated 215 anesthesia circuit expandable 216 breathing circuit corrugated 217 catheter mount corrugated 218 catheter mount expandable 219 neonatal single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. 220 paed. single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. 221 adult single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. 222 neonatal dual heated wire breathing system with suction port in y piece with 0.3m incubator extension with .15m limb and detachable pressure line with autofill humidification chamber with spare connectors . sterile pack and us fda approved. should be compatible with every humidifier 223 paediatric universal heated wire breathing system with detachable inspiratory and expiratory temperature ports with auto fill humidification chamber with dual heated wire system in inspiratory limb and in expiratory in sterile pack and us fda approved. should be compatible with every humidifier 224 adult universal heated wire breathing system with detachable inspiratory and expiratory temperature ports with auto fill humidification chamber with dual heated wire system in inspiratory limb and in expiratory in sterile pack and us fda approved. should be compatible with every humidifier 225 sterile single use disposable laryngoscope miller blades. pack should consist of a handle with fitted batteries, led lightsource and fibreoptic metal miller blades both in one pack for single patient use. sizes 00, 0, 1 226 bubble cpap system with nasal cpap kit should contain neonatal 15mm inspiratory limb heated wire 1.6m • 0.3m incubator extension • 10mm expiratory limb 1.2m • bubble cpap generator • pressure relief valve 40 cmh2o • universal 22mm connector • 15f / 8m connector • 15f / 10m connector • auto fill chamber 227 infant nasal cpap kit : anatomically curved soft silicone cannula with depth marking • should comes in 7 different sizes • colour coded marking on nasal cannula • sterile & dehp free infant nasal cpap kit to include sizing guide, soft knitted cap, nasal cannula, pressure monitoring line, 10mmbreathing circuits 1.2m. 228 neonatal single patient use resuscitator bag with mask size 1, 3.0m oxygen line and 600ml oxygen reservoir bag volume, 280ml resuscitator bag volume, should provide 100 ml stroke volume. should be us fda approved. 229 paediatric single patient use resuscitator bag with mask size 3, 3.0m oxygen line and 2500ml oxygen reservoir bag volume, 550ml resuscitator bag volume, should provide 350 ml stroke volume. should be us fda approved. 230 laryngeal mask airway mri compatible in sterile pack, made of medical grade pvc, should not contain any metal or spring in pilot ballon, size 1, 1.5, 2, 2.5, 3. should be us fda approved. 231 disposable inflatable anaesthetia face mask should have soft cushion when inflate, size 0, 1, 2, 3. us fda approved 232 neonatal high flow nasal cannula having 8 litre flow. should have soft tip . 233 premature soft tip nasal cannula having soft tip nasal cannula with tubing. 234 latex free reservoir bag. sizes: 0.5 litre, 1 litre, 2 litre. 235 reusable anaesthetia face mask made of silicone autoclavable & pure transparent. us fda approved and size should be mentioned on mask. 236 hemodialysis catheter pur fr 10 237 hemodialysis catheter pur fr 12 238 hemodialysis catheter pur fr 10 2lumen + pur 10 cm ext. tube with colour clip to identify , radioopaque with seldinger technique , with fixing wing straight position length 15cm ( 300ml / min ) & 20cm ( 280ml / min ) centimetre graduation from 9 cm to distal tip us fda approved 239 hemodialysis catheter pur fr 12 2lumen + pur 10 cm ext. tube with colour clip to identify , radioopaque with seldinger technique , with fixing wing straight position length 15cm ( 410ml / min ) & 20cm ( 390ml / min ) centimetre graduation from 9 cm to distal tip us fda approved 240 hemodialysis catheter pur fr 12 3lumen + pur 10 cm ext. tube with colour clip to identify , radioopaque with seldinger technique , with fixing wing straight position length 15cm ( 410ml / min ) & 20cm ( 390ml / min ) centimetre graduation from 9 cm to distal tip, 16g distal code green with flow rate high 50 55 ml / min for drug administration during hemodialysis us fda approved 241 long term hemodialysis catheter ( expert ) antimicrobial +pur fr 10 2 lumen + pur 10 cm ext. tube with colour clip to identify , radioopaque with seldinger technique agion incorporate with pur , with fixing wing straight position length 15cm ( 300ml / min ) & 20cm ( 280ml / min ) 15cm+20cm centimetre graduation from 9 cm to distal tip, 16g distal code green with flow rate high 55 / 50 ml / min for drug administration during hemodialysis us fda approved long term hemodialysis catheter ( expert ) antimicrobial +pur fr 12 242 2 lumen + pur 10 cm ext. tube with colour clip to identify , radioopaque with seldinger technique agion incorporate with pur , with fixing wing straight position length 15cm ( 410ml / min ) 20cm ( 390ml / min ) 24cm ( 370ml / min ) ml / min centimetre graduation from 9 cm to distal tip, us fd 243 pur xro catheter 20 cm, 28g / 1fr picc line with stylet, splitting needle with securing wings with 8 cm extension tubing ( flow rate 1ml / min ) 244 pur xro catheter 30 cm, 24g / 2fr picc line with split cannula and 10cm extension tubing over catheter ( flow rate 0.2ml / min ) 245 multi purpose close, needle free self sealling disinfectable membrane on neutral displacement with non touch applicator on male lure lock. us fda approved. 246 hydrocolloid non suture picc line fix with velcro to seure picc line wings 247 double lumen umblical catheter pur xro 40cm with 4.5 fr and 20cm with 4fr with distal eye on rounded tip for multiple access with 5cm extension tube with clamp with fenale leurlock colour coded port . us fda approved. 248 hydrocolloid non suture prepared bridge to secure umblical catheters 249 icd trocar connector to connect trocar with hemlich valve or under water seal recommended to use only on 8amd 10 fr trocar 250 lantex material on way valve for icd drain which replace underwater seal pvc et with secondary lumen for airway mang. +surfactant 251 administration size 2, 2.5, 3, 3.5, 4, 4.5, with 165cm and 230 cm. us fda approved 252 pe baby wrap double layer green house gas generating bad with adjustable hud, front velcro and spine support for preterm baby avoid hypothermia ( size ..s, m, l ) 253 gauze 90cmx18mtr 254 bandage 10cm x 4 mtr 255 neonatal closed suction catheter 256 paediatric closed suction catheter 257 red rubber endotracheal tube 258 microlaryngeal tube with high volume, low pressure cuff continuous x ray marker, blue pilot ballon. 259 adhesive remover spray 240 ml 260 adhesive remover spray 50 ml 261 silicon face mask made of silkomed, transparent, non inflatable, non conductive, 22mm inside cone size 0 to 3 262 i.v. set with three way extn. line 263 i.v. set auto stop with dehp free 264 resuscitation circuit with peep is indicated as an accessory o add positive and expiratory pressure breathing capability to a manual resuscitator. 265 double lumen catheter with kit internal jugular catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 8 fr x 12 cm double lumen catheter with kit internal jugular catheter should be 266 made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 9 fr x 11 cm 267 double lumen catheter with kit internal jugular catheter should be made of flexible radio opaque polyurethane with a radio opaque tip easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot.catheter should be us fda or ce approved ( both certificate must be enclosed ) .size 10 fr x 12 cm 268 double lumen catheter with kit internal jugular catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 11 fr x 13 cm 269 double lumen catheter with kit internal straight catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 8 fr x 9 cm 270 double lumen catheter with kit internal straight catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 9 fr x 11 cm 271 double lumen catheter with kit internal straight catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 10 fr x 12 cm 272 double lumen catheter with kit internal straight catheter should be made of flexible radio opaque polyurethane with a radio opaque tip ( easy visualization in x ray ) accessory should be provided as contains 272 ( catheter , dilator, introducer needle18g , guide wire with dispenser and inj. caps ) catheter should be double d shep to have and consistent blood flow with laser cut side slot. catheter should be us fda or ce approved ( both certificate must be enclosed ) . size 11 fr x 13.5 cm 273 a.v. fistula needle rotating wing type having back eye 16 g 274 a.v. fistula needle rotating wing type having back eye 17 g 275 tenckhoff dialysis catheter 37 cm / 31 cm ( capd ) should contain coiled catheter should be radio opaque catheter should be us fda or ce approved. ( both certificate must be enclosed ) . 276 cut filter for nikksio dialysis machine 277 plasma filter size 0.06 m2 278 plasma filter size 0.03 m2 279 soft peritoneal dialysis catheter set pead with kit singal cuff. should contain catheter and standard accessories and catheter should be radio opaque catheter should be us fda approved or ( both certificate must be enclosed ) . 280 netural displacement connector mono 281 netural displacement connector duo 282 netural displacement connector trio 283 netural displacement connector access ( nv ) 284 netural displacement connector clear 285 i.v. canula with safety guard & quick flash back 286 i.v. canula with quick flash back. 287 dehp free ryles tube 288 dehp free feeding tube 289 i.v. canula no. 24 ptfe 290 i.v. canula no. 26 ptfe 291 i.v. canula no. 22 ptfe 292 i.v. canula no. 20 ptfe 293 gamma sterile syringe 50 cc 294 gamma sterile syringe 20 cc 295 gamma sterile syringe 10 cc 296 gamma sterile syringe 5 cc 297 gamma sterile syringe 2 cc 298 gamma sterile syringe 1 cc 299 gamma sterile canula 26 g 300 gamma sterile canula 24 g 301 gamma sterile canula 22 g 302 gamma sterile canula 20 g 303 black disinfectant fluid phenolic type , grade – 3 20 ltr 304 black disinfectant fluid phenolic type , grade – 3 5 ltr 305 creosol with soap soln. 5 ltr. 306 sodium hypochlorite 4% 5 ltr 307 formaldehyde soln. 5 ltr. 308 formaldehyde soln. 500 ml 309 distilled / deionized water 5 ltr. 310 adhesive plaster 5cm x 5mtr. 311 microporuous surgical tape with cutter 3” x 9m 312 microporuous surgical tape with cutter 2” x 9m 313 microporuous surgical tape with cutter 1” x 9m 314 microporous surgical tape 3” x 9m 315 microporous surgical tape 2” x 9m 316 microporous surgical tape 1” x 9m 317 hypoallergenic adhesive tape 2” x 9m 318 hypoallergenic adhesive tape 1” x 9m 319 hypoallergenic surgical tape 1” x 9m 320 hypoallergenic surgical tape ½” x 9m 321 soft cloth surgical tape 1” 322 elastic adhesive bandage 3”x1 mtr 323 elastic adhesive bandage 4”x1 mtr 324 crape bandage 8 x 4m 325 crape bandage 6 x 4m 326 crape bandage 4 x 4m 327 transparent i.v. paed. dressing 328 transparent dressing with extra securing strips for canula & with non wowen cloth securement. 329 transparent i.v. paed. dressing with absorbent pad 5 x 7 cm 330 transparent i.v. paed. dressing with absorbent pad 6 x 10 cm 331 wound closure system 332 sterile laprotomy pad with tape & x ray detectable thread size 30 x 30 cm 333 sterile laprotomy pad with tape & x ray detectable thread size 25 x 25 cm 334 antiseptic tulle dressing 10 cm x 10 cm 335 paraffin gauze tulle dressing 10 cm x 10 cm 336 no sting barrier film made of copolymner acrylic terpolymer, poly phenyl methyl disiloxane plus isooctane, phenyl methyl siloxane bed source, iad, adhesive trauma prevention. 337 biopolimeric hydrogel dressing 10x10 cm 338 clot activator tube 3ml 339 ostomy appliance belt meant to be connected to a 2 piece pouch 340 tail closure with insert 341 hydrocolloid based skin protection powder & elastomeric polymers 342 hydrocolloid based skin protection paste with elastomeric polymers 57 gms 343 single piece ostomy appliance having triple hydrocolloid skin barrier comprising of elastomeric polymers with flexible tape collar integrated wth opaque drianable pouch 12 ( inches ) and one sided comfort panel 344 system should have 03 micron hydrophobic filter protected closedsuction which should prevent cross contamination and ventilator associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 25cm / 6 ch 345 system should have 03 micron hydrophobic filter protected closedsuction which should prevent cross contamination and ventilator associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 5cm / 6 ch 346 system should have 03 micron hydrophobic filter protected closedsuction which should prevent cross contamination and ventilator 346 associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 45cm / 6 ch 347 system should have 03 micron hydrophobic filter protected closedsuction which should prevent cross contamination and ventilator associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 25cm / 8 ch 348 system should have 03 micron hydrophobic filter protected closedsuction which should prevent cross contamination and ventilator associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 35cm / 8 ch 349 system should have 03 micron hydrophobic filter protected closedsuction 349 suction which should prevent cross contamination and ventilator associated pneumonia ( v.a.p. ) along with rotating patient access valve to enable complete isolation of the sleeved suction catheter from patient airway when suctioning is not required. should have color coded flanges – for immediate visual identification of ch size and flushing port which should swivels 360 degrees and should be equipped with built in non return valve. 45cm / 8 ch 350 diuresis monitoring system should be compact & top mounted of two parts, a graduated top chamber & bottom collection bag, to minimize retrograde infection and to minimize floor contamination. should have a non return valve built into the tube connector, should have built in non return valve in the collecting bag. the unit should have double lumen tubing of 150cm length, the tubing should have needlefree sample port compatible to all standard syringes, it should have anti kink spiral on tubing. the unit should be compatible with all standard foley catheters, should have flexible hanging options for use on all bed types, should have detailed graduation in main top chamber for accurate measurements for low urine output patients and paediatric patients, the collection bag should have 2l storage capacity, the unit should have provision for tuck –in the bottom outlet in case of lower floor clearance and on transportation 351 hydrofiber dresssings with high exudate management capability 5cm x 5cm 352 hydrofiber dresssings with high exudate management capability 10cm x 10cm 353 hydrofiber dresssings with high exudate management capability 15cm x 15cm 354 hydrofiber dresssings with high exudate management capability 2cm x 45cm rope 355 stich bonded hydrofiber dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability 5cm x 5cm 356 stich bonded hydrofiber dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability 10cm x 10cm 357 stich bonded hydrofiber dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability 15cm x 15cm 358 stich bonded hydrofiber dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability 20cm x 30cm 359 stich bonded hydrofiber dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability 2cm x 45cm rope 360 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days 23cm x 30cm 361 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days 50cm x 54cm 362 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days 23cm x 100cm 363 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days standarard glove size 1 364 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days standarard glove size 2 365 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days standarard glove size 3 366 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days standarard glove size 4 367 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand antimicrobial activity with high exudate management capability with a wear time of 21 days standarard glove size 5 368 pre filled normal saline syringes 5ml 369 pre filled normal saline syringes 3ml 370 dual close port with extension & integrated catheter 24g 371 needle hub cutter with container heavy capacity to cut upto 120 needles 372 non ported iv catheter with kink resistant vialon material 24g 373 long term tunneled central venous catheters for pediatrics should be made of radiopaque silicone material. should have a surecuff in order to promote tissue growth should be able to clamp the catheter. should come with complete kit with micro introducer, peel apart sheath, plastic tunneler, guidewire and other accessories. size : 2.7 fr should be usfda & ce approved. 374 long term tunneled central venous catheters for pediatrics should be made of radiopaque silicone material. should have a surecuff in order to promote tissue growth should be able to clamp the catheter. should come with complete kit with micro introducer, peel apart sheath, plastic tunneler, guidewire and other accessories. size : 4.2 fr should be usfda & ce approved. 375 long term tunneled central venous catheters for pediatrics should be made of radiopaque silicone material. should have a surecuff in order to promote tissue growth should be able to clamp the catheter. should come with complete kit with micro introducer, peel apart sheath, plastic tunneler, guidewire and other accessories. size : 6.6 fr single lumen should be usfda & ce approved. 376 long term tunneled central venous catheters for pediatrics should be made of radiopaque silicone material. should have a surecuff in order to promote tissue growth should be able to clamp the catheter. should come with complete kit with micro introducer, peel apart sheath, plastic tunneler, guidewire and other accessories. size : 7 fr double lumen should be usfda & ce approved 377 pur xrocatheter 4cm with 2fr on seldinger technique ( flow rate 17 ml / min ) with integral ext.tube of 4.5cm with female luer lockand securing wings us fda approved 378 pur xrocatheter 6cm with 2fr on seldinger technique ( flow rate ml / min ) with integral ext.tube of 4.5cm with female luer lockand securing wing us fda approved 379 pur xro catheter 8cm with 2fr on seldinger technique ( flow rate 12 ml / min ) with integral ext.tube of 4.5cm with female luer lock and securing wings us fda approved 380 pur xrocatheter 20cm / 15cm with 2fr on seldinger technique ( flow rate 4.4 ml / min ) with integral ext.tube of 4.5cm with female luer lockand securing wings us fda approved 381 pur xro catheterwith 4, 6, 8, 12 cm by 20g on seldinger techniquewith female luer lock . arrowed needle with securing wings. flowrate 30 / 27 / 24 / 20 ml / minus fda approved 382 pur xro catheter with 6, 10 cm by 18g on seldinger techniquewith female luer lock , arrowed needle with securing wings flowrate 55 / 44ml / min. us fda approved 383 pvc catheter xro 40 cm, 3.5, 4, 5, 6, 7, 8 fr compatible to venous and arterial routes with fenale luerlock dehp free us fda approved 384 pur catheter xro 30cm , 2.5g and 40cm with 3.5, 4, 5, 8, fr compatible to both venous and arterial routes with fenale luerlock , supplied with stopcock. us fda approved dehp free 385 exchange transfusion tray for umblical catheterization supplied with 5 & 7 fr exchange tranfussing catheter of pvc , venous pressure measurment ruler , drape, transfussino set and othe assessries . 386 kit for picc insertion with starile drape and other essential assessries. 387 pur locked anti reflex valve with silocon duff and 10 cm extension tubing with coloured coding for multiple infussion on cannula us fda approved pur locked anti reflex valve with silocon duff and 10 cm extension tubing2 lumen with coloured coding for double infussion on 388 cannula us fda approved 389 pur locked anti reflex valve with silicon duff and 10 cm 3 lumen extension tubing with coloured coding for triple infussion on cannula us fda approved 390 ptfe safty cannula 18g, 20g, 22g ( lock at niddle avoid needle strick injuries ) snap open cannula cap type 391 ot icd tray sterilised ot drain tray with trocar drain and dual suction hemlich valve and other component 392 pvc intercostal drainage 8, 10, 12, 14, 16 with 8cm, 25cm, 15 cm with female lure lock 393 pur transparent, semi permiable , stretchable , hypoallergic sterile incision drape or dressing for protecting catheter introduction sites q ( permiable to water vapur and oxygene ) , 300% strechable, fda approved sizes 15cm x 20cm, 33cm x 30cm, 33cm x 45cm, 48cm x 45cm, 48cm x 60cm, 48cm x 90cm, 56cm x 90cm. 8*6 cm and 15*10cm 394 ramp of colour coded individual port controller , lipid resistant, on neutral displacement for exchange transfussion us fda approved pe, pressure capacity 40 bar, male to female, venous infusion and 395 pressure monitring line, fda approved length with 1mm internal diameter 50 / 100 / 150 / 200 / 10cm us fda approved 396 pe coilled extension line for fluid infusion, fda approved 1mm internal diameter length 100 / 200 / 150cm us fda approved 397 sensitive drugs 1mm internal diameter length 100 / 150 / 200 cm us fda approved 398 pp pd catheter fr12 with 30cm length with open tip &at 8 cmof catheter 64 lateral eyes supplied with stainless steel trochar , blunt type withclip to identify the length of catheter. us fda approved 399 neck line 2 lumen 3fr xro+ pur ) 10cm, 15cm, 20cm / 3 fr ( 22g / 22g ) in seldinger technique with stright. us fda approved 400 neck line 3 lumen 4.5 fr xro+ pur 6cm , 12.5cm / 4.5 fr ( 20 / 20 / 23g ) in seldinger technique with stright guidewire us fda approved 401 neck line 3 lumen 4.5 fr xro+ pur 6cm , 8cm, 10cm, 12.5cm ( 20 / 20 / 23g in seldinger techniquewith nitinol kink resistant. j guidewire us fda approved 402 neck line 3 lumen 5.5fr xro+ pur 8cm, 12.5cm ( 19 / 21 / 21g ) fr in seldinger technique with kink resistant j guidewire. us fda approved 403 neck line 2lumen xro+ pur 8cm, 12.5cm / 5.5 fr in seldinger technique with kink resistant j guidewire us fda approved 404 quincke bevel spinal needle transparent hub with lug indiacting bevel orientation with iso color code inq.. 25g with50 / 30mm q...22g with38 / 50mmqq.20gwith38 / 50mmq 19g50mmq.18g50mm us fda approved 405 whitacre bevel spinal needle transparent hub with lug indiacting bevel orientation with iso color code in q.. 25g with 30mm 406 pur paediatric epidural anaesthesia catheter with 22g in 40 cm supplied with 19g / 50mm directional tuohy bevel us fda approved. 407 disposable inflatable cushion vanilla scented face mask in number 1, 2, 3, 4, 5, 6 us fda approved tube exchanging and oxygenating bougie 60cm with 40 degree angled device to treat 96% of difficult intubationwith oxygenation 408 upto 15lt / min size 01 & 02 us fda approved 409 4way stopcock for exchange transfussion us fda approved 410 pe xro pural drain catheter in 6fr with 30cm , 8fr with40cm , 8fr with 50cm anf 10fr with 50cm place by needleintroducer covered with handling sleeve and a 3 way stopcock with conical adapter 411 pe 10cm extension tube 40bar male to female vein o line. us fda approved 412 duodenal feeding tubes pur+silicon with 2 lateral eye universal colour code with flexiable female mount & cap 4, 5, 6, 7 fr with 40cm / 75cm / 125cm us fda approved 413 96 hr i / v filter endotoxin filter with .22micron filtering air, bacteria, endotoxin with pvv ext tube supplied with clamp 414 silicone nasal oxygen cannulae with adjustable nasal tip and stright , open rounded distal end with 30cm length us fda approved 415 surgical scrub brush with sponde impregnated with 12% poverdine iodine in 15ml sol of teepol with nail cleaner 416 surgical scrub brush spog in 20% chlorhexidine in 15 ml sol of isopropyl alcohol and water with nail cleaner with large septum and silicone iv catheter 417 implantable port for chemotherapy fully titanium implantable port ( totally radiopaque ) length 60 cm, with anti kinking sleeve. markings every centimeter along the length of the catheter. should be supplied with , lockable desilet sheath with dilator, should contain kink resistant nitinol ‘’j’’ guidwire, with one way valve on introducer, should contain extra huber needle in tray, should be compatible with mri, and c.t rated sizes – 9.6fr, 6.6fr 418 extension line with 3 way lipid resistant stopcock with 2.5 mm ext tube testes at 145psi in 13.5, 25.50.80, 100 cm fda approved 419 20 / 22g in 20 / 25 cm infusion device with huber bevelfor implantable port curved at 90degree with wing and flexiable ext.tube of length 30cm with clamp 420 video laryngoscope for difficult airway intubation device with color coded blades supporting differebt et size supported with pencil battery with multiple video connectivity ( endocam, phone adapter, web wi fi cam, ) et tube slider to pre load et.tube, battery operated.us fda approved 421 mobile application operated adapter to mount on laryngoscope compatible to all mobile us fda approved 422 vaccumed silicon coated with cherry red or plain tube with monocap 2ml 423 vaccumed silicon coated with cherry red or plain tube with monocap 3ml 424 vaccumed gel +bca tube or gel tube with mono cap 2ml 425 vaccumed gel +bca tube or gel tube with mono cap3.5ml 426 vaccumed edta k3 tube with monocap 2ml 427 vaccumed edta k3 tube with monocap 3ml 428 vaccumed edta k2 tube with monocap 2ml 429 vaccumed edta k2 tube with monocap 3ml 430 vaccumed glucose tube with monocap 2ml 431 vaccumed glucose tube with monocap 3ml 432 multi sample blood collection needle 22g 433 multi sample blood collection needle 23g 434 disposal transducer with integrated flashing device with color tubing should be ce / usfda approved 435 triple lumen polyurethene catheter 5fr ( 18g, 20g 20g ) with clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 5fr 6cm / 10cm. should be ce / usfda approved. 436 quad lumen polyurethene catheter 8.5fr ( 14g, 16g, 16g, 18g ) with c lear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices with scalpal. size 5fr 15cm. should be ce / usfda approved. 437 radio opaque ptfe catheter 20g ( 2.7fr ) length 76mm polyetyienecather, one introducer needle, one straight guidewire 438 radio opaque ptfe catheter 18g ( 4fr ) length 76mm polyetyienecather, one introducer needle, one straight guidewire 439 radio opaque ptfe catheter 16g length 13 cm, ptfe material with flowswitch 440 radio opaque ptfe catheter 16g length 16 cm, ptfe material with flowswitch 441 radio opaque ptfe catheter 16g length 20 cm, ptfe material with guidewire 0.9 x 500mm introducers 1.7cm x 70mm 1.4 x 70mm 442 polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 22g 6cm / 10cm / 20cm. should be ce / usfda approved. 443 polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml guiging syringe, luer lock plugs and secondary fixation devices. size 7fr. lrngth 15cm / 20cm. should be ce / usfda approved. double lumen polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, 444 vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 7fr. lrngth 15cm. should be ce / usfda approved. 445 polyurathane long canula with ptfe material with flowswitch, pre puncyure stylus and stabilizing wings. size: 16g, 13cm / 16cm / 18g, 9cm. should be ce / usfda approved 446 triple lumen polyurethene catheter 7fr ( 16g, 18g 18g ) with clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 7fr 15cm. should be ce / usfda approved 447 pulmonary artery catheters for monitoring right heart pressure and cardiac output measurement. size: 7fr, 110cm 5lumen with one piece introducer kit 8fr. 11cm 448 triple lumen sets with guiding syring. polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide tm seldinger wire advancing device with nitinol guidewire, 5ml guiding syringe, luer lock plugs and secondary fixation devices. size 5fr, , 6cm / 10cm, 7fr. 15cm. should be ce / usfda approved. 449 triple lumen sets with guiding syring. polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide tm seldinger wire advancing device with nitinol guidewire, 5ml guiding syringe, luer lock plugs and secondary fixation devices ( without floswitch ) . size 7fr. 15cm. should be ce / usfda approved. 450 triple lumen sets polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, floswitch over the needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, luer lock plugs and secondary fixation devices . size 7fr. 15cm. should be ce / usfda approved 451 transducer set length 180cm, flush / flow rate 3cc / hr should be ce / usfda approved. 452 percetaneous introducer kits, standard length with double ended wire. size: 5 fr. 11cm / 6fr. 11cm / 7fr. 11cm should be usfda approved 453 percetaneous introducer kits, standard length without wire . size: 5 fr. 11cm / 6fr. 11cm / 7fr. 11cm should be usfda approved central venous catheter made of polyurethane and fitted with floswitch 454 size: 16g, 20cm should contain a steel needle ( needle type ) introducer with a j type guidewire. should be usfda approved. 455 single lumen set with extension. polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 2.5fr. 100cm. should be ce / usfda approved. 456 single lumen set with extension. polyurethene catheter clear extensions and pinch clamps, cannula introducer, steel needle introducer, vessel dilator, vena guide seldinger wire advancing device with nitinol guidewire, 5ml syringe, luer lock plugs and secondary fixation devices. size 4fr. 60cm. should be ce / usfda approved 457 picc silicone picc single lumen catheter size : 2.8fr. 50cm should be usfda approved 458 picc silicone picc single lumen catheter without safety introducer size : 3fr. 65cm should be usfda approved 459 picc silicone picc single lumen catheter with safety introducer size : 3fr. 65cm should be usfda approved 460 emergency catheter designed for high flow rate infusions ptfe material construction and incorporating a floswitch is ideal for rapid short term insertion into central veins or large peripheral vessels. complete kit contains pre puncture stylus and stablising wing. size: 18g, 9cm 16g, 13cm, 16g, 16cm 461 biopsy gun can be easily operated with one hand, making it ideal for procedures requiring ultrasound guidance. its small size and light weight make it equallt ideal for ct guided core biopsies. size : 16gx10cm, 16gx16cm, 16gx20cm 462 biopsy gun can be easily operated with one hand, making it ideal for procedures requiring ultrasound guidance. its small size and light weight make it equallt ideal for ct guided core biopsies. size : 18gx10cm, 18gx16cm, 18gx20cm 463 core biopsy gun 16g ultra reusable automatic biopsy instrument is a reusable device that utilizes disposable needles to harvest high quality histological specimens. us fda approved 464 double lumen central line catheter polyurethane catheter with clear extensins and pinch clamps, canula introducer, steel nedle introducer, vessel dilator, size: 7fr. 15 cm 465 nasal pharyngeal ventilation tube double lumen in silicon material fr 8, 10, 12 466 disposable cautery plates 467 triple blood bag 350ml sagm totm 468 transfer bag 300ml 469 paediatric blood bag 100ml 470 quadruple blood bag 450ml sagm top & bottom 471 suthi 472 cautery pencil disposable electrosurgical finger switch pencil 3 m cable 3 pin connectivity 473 double lumen endotracheal tubes 474 disposable abdominal laproscopic ports 475 disposable hiv / hbsag precaution kits 476 pigtail catheter silicone 12 f 477 pigtail catheter silicone 14 f 478 pigtail catheter silicone 16 f 479 pigtail catheter silicone 20 f 480 pigtail catheter silicone 24 f 481 pigtail catheter silicone 22 f 482 pigtail catheter silicone 26 f 483 percutaneous nephrostomy tube 14 f 484 percutaneous nephrostomy tube 16 f 485 percutaneous nephrostomy tube 18 f 486 percutaneous nephrostomy tube 20 f 487 bronchial blocker size 6 488 suprapubic catheter 14 f 489 suprapubic catheter 16 f 490 suprapubic catheter 18 f 491 suprapubic catheter 20 f 492 relaxatation balls 493 tourniquate 494 cautery tip reusable 495 testicular silicone implant 10cc 496 testicular silicone implant 15cc 497 testicular silicone implant 20cc 498 gastrostomy tubes small size 499 jejunostomy tubes 500 disposable gowns for biopsy / cannulation 501 mucus extractor 502 rovo bag 503 mini bag set 504 nasal oxygen canula 505 nasal prong seal 506 nasal cpap mask 507 et holder neonatal 508 ultrasound guided single shot tap block cannula canula should have special reflector surface for visibility under ultrasound and clearly visible for penetration marking in cm should be supplied iwht tubing for injecting anesthetic size : 22gx50mm, 22g x80 mm, 21g 1 110mm 509 pediatric epidural anaeshtesia set touhy cannula with stainless steely stylet & detachable wings. catheter with 1 cm graduation upto 20 cm & radiographic contrast strip made up of kink resistant rugged nylon material with close tip & 2 laterial eyes. complete with : 0.2 um flat filter tuohy borst adapter 10ml lor syringe x ray contrast catheter guide canula size: 19gx45mm catheter size : 23gx45cm 510 pediatric caudal needle caudal needle with crawford tip 45 deg with graduations & depth stop size 23 gx 25mm, 22 g x 40 mm 511 spinal needle for paediatric should have ogive sprotte tip with lateral opening for smooth flow of a anesthetic should provide quick identification of csf flashback. size : 25g, 27g length: 35, 50mm acrylic adhesive based dressing 512 coated with medical grade, bio compatible latex free size : 10cm x 5cm 513 transparent dressing impregnated with chlorexidine gluconate gel patch for central line & pic line. size : 7 cm x 8.5 cm 514 intravenous transparent film dressing wih border for neonates & pediatrics size: 5cm x 5.7 cm 515 no sting barrier film, alcohol free, non cytotoxic size : 3ml 516 bubble humidifier with sterile water 340 ml 517 e.t. tube cuff with cylindrical shape 2.5 6mm ce / usfda approved 518 disposable face mask scented 15 mm connector size 1 to 2 519 disposable face mask scented 22 mm connector size 3 to 6 520 double lumen bronchial tube left / right no.26 521 lma supreme disposable with oropharygeal & oesophageal seal size : 1 3 522 lma mucosal atomization device disposable 523 lma nasal intranasal mucosal automization device disposable 524 lma intubating airway mucosal atomizatin with syringe disposable 525 closed suction system et for paediatric & neonatal separate y connectors catheter is made up to medical grade silicon material. size 5fr, 6fr, 7fr, 8fr 526 mickey feeding tube medical grade silicone construction, proximal anti reflux valve, gamma sterilized, secure lock extension set connector mechanism, radiopaque strip. size: 12, 14, 16, 20 fr autoclave tape – steam sterlization 527 tape for sterilization packages tapes conform to en iso 11140 1, class 1 steam tape changes color from white to brown / black when exposed to steam sterilization conditions two widths, 18 mm & 24 mm fits with tape dispenser for two rolls 528 bowie dick test pack – mini for monitoring of pre vacuum sterilizers for air removal , can be used in 134oc sterilization, new superior diagnostic technology , unique compact design , clear color change – purple to green space saving credit card size. size of individual card: l 90 mm, w 46 mm lead free and no toxic heavy metals recordable conforms to en iso 11140 4 529 bowie dick test – sheet 530 multiparameter indicator – steam &eto 531 emulating indicator 7a – steam 532 alkaline detergent 533 smart read incubator 534 lubricant solution 535 smart read biological indicator for steam 536 intercostal drainage tube with trochar no. 10, 12, 14 &16 537 folleys silicone catheter no. 6 538 folleys silicone catheter no. 8 539 folleys silicone catheter no. 10 540 gel foam 541 kolhars t tube no. 12 542 kolhars t tube no. 14 543 kolhars t tube no. 16 544 romavac negative suction set no. 10 545 romavac negative suction set no. 14 546 romavac negative suction set no. 16 547 k 90 548 k 91 549 linear cutter cartridge 60mm 550 linear cutter cartridge 80mm 551 bladeless trochars 5mm 552 optical trochars 5mm 553 reusable lap hand instrument handle 554 reusable hand instrument interchangeable tips 555 harmonic probes with hand piece 556 spiral high pressure monitoring line 557 vein o line marvel plus 558 vente suck suction set 559 disposable three layer mask 560 oxygen mask paed 561 nebulizer mask paed 562 vein o line marvel 563 jackson patt drinage set 564 codon iv set for 565 chemotherapy 566 lma gastro 567 neonational cannula no 24 568 needle free extention i.v connector line at one end rotating luer lock at the other end. 569 needle free extensioni.v connector with dual extention for running two lines . 570 needle free connector with tri extention line provided with rotating luer lock and three clamps. 571 interflow as safety infusion set 572 multi acess catheter 5fr. 573 mini flow neonational system 574 mepilex border 7.5.x7.5 cm 575 mepilex border 10x10 cm 576 mepilex border 125.x12.5 cm 577 mepilex border 10x20 cm 578 mepilex border post op 6x8 cm 579 mepilex border post op 9x10 cm 580 mepilex border post op 10x15 cm 581 meplix border lite 5x12.5 cm 582 meplix border lite 7.5x7.5 cm 583 meplix border lite 10x10 cm 584 meplix border ag7.5x7.5 cm 585 meplix border ag 10x10 cm 586 meplix border ag 10x20 cm 587 meplix ag 10x10 cm 588 meplix ag 12.5x12.5 cm 589 meplix 10x10 cm 590 meplix 12.5x12.5 cm 591 mepital one 17x25 cm 592 mepital one 10x18 cm 593 mepital one 7.5x10 cm 594 mepital one 5x7.5 cm 595 biogel indicator system 6.5 596 biogel pl indicator system 7.0 597 biogel pl indicator system 7.5 598 biogel pl indicator system 8.0 599 biogel pl indicator system 8.5 600 p.d. cannula infante / neonate size 601 pigtail cather size 14&16 602 central neck line double lumen 603 colostomy bag 604 stapler remover 605 minilap mis alligator thumb grip graspers ( 2.3mm ) 606 minilap m / s clutch thumb grip graspers ( 2.3mm ) 607 minilap m / s babcock thumb grip graspers ( 2.3mm ) 608 minilap m / s bowelthumb grip graspers ( 2.3mm ) 609 minipoler percutaneous monopolar curved spatula probes ( 2.4mm ) 610 minipoler percutaneous monopolar straight spatula probes ( 2.4mm ) 611 minipoler percutaneous monopolar hook probes probes ( 2.4mm ) 612 minipoler percutaneous monopolar conical probes ( 2.4mm ) 613 minigrip m / s alligator grasper ( 2.4mm ) 614 minigrip m / s clutch grasper ( 2.4mm ) 615 minigrip m / s babcock grasper ( 2.4mm ) 616 minigrip m / s tong grasper ( 2.4mm ) 617 diasafe plus filter 618 hepa filter 619 disposable tubing close circuit paed. 620 h.d. fluid ( part – a ) 1016 compatible with bibag 621 part b ( bibag 5008 ) 650 gm 622 central venous catheter with silk suture and gauze swab and latex free size 623 double lumen catheter size 5fr x 8 cm 624 triple lumen catheter size 4.5fr x 8 cm 625 nebulizer mask 20 ml capacity with bigger chamber and sterilized 626 flow regulator flow rate 2ml to 350 ml per hour 627 endotracheal tube size 2 628 lma block baster 629 e.t. tube with secondary luman for surfactant or other medication or airway pressure monitoring size 2, 2½, 3, 3½, 4, 4½ 630 poly ethylene high pressure 580psi extendion tube with 1ml priming volume in 100 cm comes in double packing & color coated clip size 10, 50, 100, 150, 200 cm 631 poly urathane umblical catheter supplied with stop cock & identification clip with cm marking & transparent hub size 4, 5, & 8 fr 632 csf sampling short pediatric & neonatal spinal needle with stylet, transparent hub & beval oriantation mark come in 25 & 22g with 50, 30, 38 mm length 633 pur catheter with stylet & extension tube every 5 cm marking comes with peel apart introducer & messuring tep size 3fr with 60cm length 634 pur xro double lumer 3 fr seldinger cvc catheter with tafflon coated nitinol guide wire length 6, 8 & 10 cm 635 disposable continue positive airway pressure kit 636 emergency disposable cpap kit comes with 2 device, 3 mask. menometer, harness, flow meter, fio2 regulator, nebulizer 20ml syringe 637 surfactant delivery tube to avoid magil forceps comes in 6fr, 20cm length with 0.2ml dad space & 2 cm black blunt ultra soft tip with cm marking 638 sting free adhesive releaser / remover with 100% blend of silicones, sting free, hypoallergenic, clear with flexible barrier free from oil, alcohol, fragrance & preservatives 50ml 639 bacteria and viruses, water proof or shower proof with perforated with gentle, skin friendly silicone adhesive, easy to apply & reposition designed to absorb low exudate levels and helping maintain a moist wound healing environment 5cmx5cm 640 transleucent foam dressings with protective barrier against water, bacteria and viruses, water proof or shower proof with perforated with gentle, skin friendly silicone adhesive, easy to apply & reposition designed to absorb low exudate levels and helping maintain a moist wound healing environment 5.5cmx12cm 641 disposable bone marrow biopsy needle should have lightweight handle with built in comfort knob. should have bevel tip for easy coring of bone. should have bevel cannula tip. should have tapered distal cannula for easy recovery of sample. should be available in 8 gauge in 4 inch length, 11 gauge in 4 inch & 6 inch length, 13 gauge in 2 inch & 3.5 inch length, usfda approved. 642 disposable bone marrow aspiration needle with adjustable depth guard and cap. should have sharp lancet point to penetrate. should be available in 15 gauge with adjustable length of 24mm & 48mm. 18 gauge with adjustable length of 14 &48 mm length. should be usfda approved. 643 non ported iv cannula made up of vialon biomaterial that give upto 90% kink recovery, 70% softening capability, upto 96 hrs indweling time with insta flash notch needle technology for faster visualizatio or flashback y notch near the tip of the needle, with radio opaque strip for better civilisation of cannula under ct scan / mri / xray size 24 g 644 non ported iv cannula made up of vialon biomaterial that give upto 90% kink recovery, 70% softening capability, upto 96 hrs indweling time with insta flash notch needle technology for faster visualizatio or flashback y notch near the tip of the needle, with radio opaque strip for better civilisation of cannula under ct scan / mri / xray size 26 g 645 sterile and non pyrogenic fluid pathway, 96hrs air eliminating particle, microbial and endotoxin retentive filter, it should have filter media of 0.2 μm positively charged nylon posidyne membrane having non phthalate free of natural latex rubber, 0.4 ml hold up volume, 110 ml / hr flow rate and 1500 mm hg ( approx 30 psi, 2bar ) working pressure. 646 sterile and non pyrogenic fluid pathway, 96hrs air eliminating particle, microbial and endotoxin retentive filter, it should have filter media of 1.2 μm polyethersulphone membrane for infusion of nutrient lipid emulsions.having non phthalate free of natural latex rubber, 0.5 ml hold up volume, 110 ml / hr flow rate and 1500 mm hg ( approx 30 psi, 2bar ) working pressure. 647 sterile and non pyrogenic fluid pathway, 96hrs air eliminating particle, microbial and endotoxin retentive filter, it should have filter media of 1.2 μm polyethersulphone membrane for infusion of nutrient lipid emulsions.having non phthalate free of natural latex rubber, 0.8 ml hold up volume, 75 ml / hr flow rate and 1500 mm hg ( approx 30 psi, 2bar ) working pressure. 648 self adherent moist wound dressing made up to triple hydrocollid elastomeric polymer matrix 10cmx10cm 649 fiber optic laryngoscope paed. set should be led white light should have mat finish with slim paed. handle miller blade size 00, 0, 1 in pvc box 650 photosensitive pm line should be sterile, pyrogen free should be non toxic latex free ce mark length 150 cm 651 laryngoscope paed. set should have led white light should have mat finish with slim paed. handle miller blade size 000, 00, 0, 1 in pvc box 652 fully transparent backing, absorbent pad, hypoallergenic acrylic adhesive size 5 cm *7 cm 653 fully transparent backing, absorbent pad, hypoallergenic acrylic adhesive size 6 cm *10 cm 654 non woven 3 layered 45 gsm sterile, lightweight, breathable and low linting surgical disposable gown with outer and inner layer made of strong and spun bond repellent fabric, and middle layer offering fluid control and bacterial barrier. having alcohol repellent &anti static properties with two paper towel 655 transparent film reinforced piv dressings with pattern coating of adhesive, unique paper window frame delivery design. size 3.8 cm x 4.5 cm. 656 transparent film reinforced piv dressings with pattern coating of adhesive, unique paper window frame delivery design. size 5 cm x 5.7 cm. 657 steam chemical integratorwith an extender strip affixed that is a 17.8 cm ( 7 in ) long by 1.8 cm ( 0.7 in ) wide rigid strip that serves as a handle to retrieve processed integrators from inner packs. • should have 510 ( k ) registration • should have a bsi kitemark certificate 658 super rapid attest biological indicator for steam. • it should be positive and negative bi read out time within 10 to 15 minute by an audible alarm in super rapid auto reader. • it should be two years self life. • should have fda clearance. • designed and certified as per iso 11138 and en 866. 659 bowie dick test pack • should be compliant to ansi / aami / iso 11140 1:20051 or 5:20072. 660 waterless scrub with hand mosturizer chlorhexidine gluconate 1% w / w and ethyl alcohol 61% w / w supplied with a touch less delivery. 661 advanced iv safety cannula with stainless steel having multiple acces blood septum and without injection port 18g, 20g, 22g, 24g. 662 antibiofilm wound irrigation solution with 0.1% polihexanide and 0.1% betaine ( 350ml ) 663 antibiofilm wound gel with 0.1% polihexanide and 0.1% betaine and glycerol ( 30ml ) 664 central line single lumen paediatric 22 g made of certonmaterial catheter 10 cm length . 665 central line double lumen paediatric catheter 4fr 22g / 22 g made of certon material catheter 8 cm and 13 cm length . 666 central line triple lumen paediatric catheter 5fr 22g / 22 g made of certon material catheter 8 cm and 13 cm length . 667 epidural kit for paediatric patients with polyamide and poly urethinyellow colour catheter in 20 g . 668 single lumen certon material catheter with v needle kink free nitinol guide wire 3 fr 15 cm. 669 double lumen certonmaterial catheter with v needle kink free nitinol guide wire 7 fr 15 and 20 cm. 670 triple lumen certon material catheter with v needle kink free nitinol guide wire 7 fr 15 cm and 20 cm.. 671 micro cuff e.t.t. 3mm, 3.5 mm, 4mm, 4.5mm, 5mm, 5.5mm, 6mm, 6.5mm, 7mm, polyurethane thickness of 10 microns 672 standard pf gamma sterile low protein latex powder free surgical gloves with synthetic polymer coating in accordance with en455 3 and iso 21171 all sizes. 673 examination gloves size 6.5, 7.0, 7.5 674 nitrile gloves size 6.5, 7.0, 7.5...

Indian Institute Of Technology - Rajasthan

25818231 supply of lab consumables 1 freezing container, 18 ( 1.0 to 2.0ml tubes ) ex.thermo 5100 0001, pack size: 1 2 microtissues® 3d petri dish® micro mold spheroids, size s, 8 x 12 array, fits 24 well plates, pack size: 6 3 nutrient mixture f 12 ham, kaighn’s modification w / l glutamine and 1.5gms per litre sodium bicarbonate ex.himedia al106s or equivalent, pack size: 5x100ml 4 rpmi 1640 w / 1mm sodium pyruvate, 2mm l glutamine, 4.5gms glucose per litre, 10mm hepes and 1.5 gms per litre sodium bicarbonate ex.himedia al162s or equivalent, pack size: 5x100ml 5 fbs, origin: us / non us / brazil, eu approved, sterile filtered, pack size: 500 ml 6 dulbecco’s modified eagle medium ( dmem ) , high glucose w / 4.5gms glucose per litre, 1mm sodium pyruvate, l glutamine and 1.5 gms per litre of sodium bicarbonate 1x liquid cell culture medium, sterile filtered, pack size: 6 x 500 ml 7 oct freezing medium, pack size: 118 ml 8 penicillin streptomycin amphotericin b with 10, 000 units penicillin, 10 mg streptomycin and 25 μg amphotericin b per ml, sterile filtered, suitable for cell culture, pack size: 100 ml 9 trypsin / edta solution ( 0.25% trypsin and 0.01% edta in dulbecco’s pbs, sterile filtered ) , pack size: 500 ml 10 cd11b fitc antibody, catalog: mabf80a, pack size: 100 samples 11 cd45 pe antibody, catalog: 555484, pack size: 100 samples 12 cd68 antibody, catalog: sc 20060, pack size: 200ug / ml 13 nestin antibody, catalog: mab353, pack size: 100ug 14 cd31 antibody, catalog: ab9498, pack size: 100ug 15 gfap antibody, catalog: 3670s, pack size: 100 ul 16 p p65 antibody, catalog: 3033s, pack size: 100 ul 17 vegf receptor antibody, catalog: 2479s, pack size: 100 ul 18 egf receptor antibody, catalog: 2232s, pack size: 100ul 19 asc antibody, catalog: 13833s, pack size: 100 ul 20 anti mouse igg, hrp linked antibody, catalog: 7076s, pack size: 1 ml 21 anti rabbit igg, hrp linked antibody, catalog: 7074s, pack size: 1 ml 22 nf kb pathway sampler kit: #9936t ( cst ) or equivalent, pack size: 1 kit 23 rna stabilization solution ex rna later or equivalent, pack size: 250 ml 24 rnase decontamination solution ex rnase zap or equivalent, pack size: 6 x 250ml 25 trizol reagent / tri reagent, pack size: 200 ml 26 taq polymerase ( 5units / μl ) ( 10x buffera without mgcl2 ) , pack size: 1000u 27 cdna synthesis kit ex biorad iscript or equivalent, pack size: 100 x 20 μl rxns 28 qrt pcr sybr master mix ex agilent 600886 / 600887 or equivalent, pack size: 400 rxns 29 tissue culture flask  ( t25, for adherent cells )  sterile, surface type: treated, vented cap, 50ml volume, growth area: 25.0cm², pack size: 200 30 tissue culture flask  ( t12.5, for adherent cells )  sterile, surface type: treated, vented cap, 25ml volume, growth area: 12.5cm², pack size: 200 31 tissue culture plate sterile ( 6 well ) , material: ps, pack size: 50 32 tissue culture plate –sterile, 96 well plates, flat bottom, pack size: 50 33 centrifuge tubes conical bottom, cap. 15ml, pp, pack size: 500 34 centrifuge tubes conical bottom, cap. 50ml, pp, pack size: 500 35 universal micropipette tips, 0.2 10ul, pp, pack size: 1000 36 universal micropipette tips, 200ul, pp, pack size: 500 37 universal micropipette tips, 1000ul, pp, pack size: 500 38 micro cover glass square , size : 22, thickness n0. 1, pack size: 20x10gm 39 tissue culture plate – sterile, black,  2 wells, pack size: 12 40 serological pipettes, 5ml, sterile, individually wrapped, pack size: 200 41 serological pipettes, 10ml, sterile, individually wrapped, pack size: 200 42 microcentrifuge tube, 1.5 ml, pp, pack size: 500 43 protein assay dye reagent concentrate, ex biorad 5000006 or equivalent, pack size: 450 ml 44 nitrocellulose membrane,  pore size 0.45 μm, pack size: 30cm x 3m or better 45 methanol, ar, pack size: 2.5 liter 46 50 bp dna ladder, pack size: 50 lane 47 prestained protein standard, broad range ( 10 250 kda ) , pack size: 100 lane 48 water sterile for rna work depctreated and nuclease free, pack size: 100ml x 5 49 agarose, low eeo, mb grade, pack size: 500 gm 50 sds, ar grade, pack size: 500 gm 51 100% ethanol, pack size: 500 ml 52 syringe filters, pvdf membrane, pore size: 0.22μ, 25 mm diameter, sterile, pack size: 50 53 parafilm, pack size: 4 inch x125 ft. 54 dmso, sterile filtered, suitable for cell culture, pack size: 100 ml 55 mounting medium with dapi ex sigma fluoroshield or equivalent, pack size: 20 ml 56 lipofectamine 2000, pack size: 0.75 ml 57 gelatin cell culture tested, pack size: 100 gm...

Medical And Health Services - Rajasthan

22709733 supply of laboratory reagent kits and other items b.sugar god/pod mack erba, b.urea (berthelot) mack erba, s. cretinine (kinetic) mack erba, s.bilirubin t&d mack erba, sgot (kinetic) mack erba, sgpt (kinetic) mack erba, colestrol mack erba, widal, ra, aslo, crp, vdrl (rp strip), hb sag card, hcv, hiv rapid, hiv tri dot, anti a, anti b, anti d igg+igm monocolan, anti ab, anti xh, ahg, anti a1, seurm bovine albumin, uristi x s parameter, multisti x, coomb sera vail, n/10 hcl, 2, sodium citrate 3.8%, lesmen stain, lesmen powder, tlc flude, ceder wood oil, pregnancy test rapid kit, jsb stain a, jsb stain b, sodium hypocloride, xylene, semen diluting fluid, cpd beg, cpd beg, distil water, micro tips 2 200 ul, micro tips 5 1000 ul, cover slip, glass slide, edta vail with screw cap (k2), sodium cicrate tube for blood collection edta k3, plane vail with screw cap, urine collection container, urine centrifugal vail, esr tube glass, state fax tube glass, glass tube 10 ml, tissue paper, ph paper, blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes, abx minoclear, abx minidil lmg, abx lyse bio, abx cleaner, minocal calibrator, minotrol 16 twin pak (02l), minoclair, paper roll for abx micro es 60, reagents for elisa reader, hiv elisa, hbs ag elisa, hcv alisa, vtm kit, anti d igg + igm, tournicate, rubber ball for blood donner, tharmograph paper for, papper roll for sami auto analizer transasia, papper roll sami auto analizer gyro, papper roll automatic fully esr analizer transasia, projection lamp 6v20w for microscope, fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables, albumin mack erba, amylase mack erba, bilirubin t&d mack erba, urea mack erba, cholestrol mack erba, alkaline phosphate mack erba, glucose mack erba, s. creatinine mack erba, calcium mack erba, total protein mack erba, triglyceride mack erba, hdl cholestrol direct mack erba, sgot mack erba, sgpt mack erba, chloride mack erba, uric acid mack erba, ck mack erba, ckmb mack erba, sample cup mack erba, ggt mack erba, ldl cholestrol with calibrator mack erba, ldhp mack erba, microprotein mack erba, 2, phosporus mack erba, x l multical mack erba, x l wash mack erba, blood gas analizer regants mack phox plus l nova biomedical, calibration solution c 1, calibration solution c 2, fluid pack c 3, fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal, amylase direct mack biosystem, amylase pancreatin mack biosystem, adenosine deaminase (ada) mack biosystem, alanine aminotransferase (alt/gpt) mack biosystem, albumin mack biosystem, alkaline phosphatase(alp) amp mack biosystem, alkaline phosphatase (alp) dea mack biosystem, aspantate aminotransferase (ast/got) mack biosystem, bilrubin (direct) mack biosystem, bilrubin (total) mack biosystem, calcum arsenazo mack biosystem, cabon diooxide mack biosystem, cholesterol mack biosystem, cholesterol hdl direct mack biosystem, cholesterol ldl direct mack biosystem, crecatinine kinase ck mack biosystem, creatinine kinase mb(ck ,mb) mack biosystem, creatinine mack biosystem, glutamyl transferase (y gt) mack biosystem, glucose mack biosystem, iron ferrozine mack biosystem, lactate dehydrogenase ldh mack biosystem, lipase mack biosystem, magnesium mack biosystem, phosphorus mack biosystem, protein total mack biosystem, protein (urine/csf) mack biosystem, total bile acid mack biosystem, triglycerides mack biosystem, urea/bun vv mack biosystem, uric acid mack biosystem, sample cup mack biosystem, washing solution mack biosystem, washing solution mack biosystem, rotor mack biosystem, conc. system liquid mack biosystem, halogen uv p lamp mack biosystem, control level 1 mack biosystem, control level ii mack biosystem, calibrator mack biosystem, urine analyzer strip, gluco strip sd cheek code 21, gluco strip accuchek, gluco strip dr. marpirn, semi auto analizer regents, hemoglobino meter micro cuvette, edta vial k 3 double cap, fully auto analyser sample cube, micropipettes 1 10 microliter, micropipettes fix 500 microliter, westergreen stand, westergreen esr tube, dengue test kit rapid igm/ns1, chikungunia test card, scrub typhus ab. card, ns1 elisa for dengue, igm elisa for chikungunia, igm elisa for hepatitis a, igm elisa for hepatitis e, igm elisa for scrub typhus, igm elisa for japanese enaphalitis, typhl dot for typhoid, igm elisa for leptospirosis, t pal salution 5 ltr, trop – t test, printed paper for cbc 5 part, printed paper for cbc 3 part, seman diluent fluid 100 ml, fruity 200ml, idsp lab reagents, test tubes without rim borosilicate, 25 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 15 x 150 mm, autoclavable caps for above test tubes 15 ml, test tubes without rim borosilicate, 12 x 150 mm, autoclavable caps for above test tubes, burette borosilicate 50 ml, burette stands, measuring cylinders graduated, 10 ml, petridishes, 15 x 90 mm borosilicate, universal bottles, 28 ml, mccartney bottles, 28 ml, funnels glass, diameter 100 mm, stem 50 mm, buchner flasks, 1 liter, beakers, borosilicate / pyrex, 1000 ml, conical flasks (erlenmeyer), pyrex 100 ml, volumetric flasks, grade a, 500 ml, pipettes, 1ml with 0.1 ml graduations grade a, glass bottles with polypropylene (autoclavable) screw caps, 500 ml, durham tubes 50 x 7.5 mm, cotton wool non absorbent, weighing boats, plastic 1 ¾ 5 boxes, weighing boats, plastic 3 5/16 5 boxes, brushes for bottle washing 40 cm, h2s water testing bottle, brilliant green broth, macconkey broth, eosin methylene blue, lactose broth, durham tubes 20x 7.5 mm, cotton wool non absorbent, measuring cylinders graduated, 10 ml, test tubes without rim borosilicate, 15 x 150 mm, pipettes, 1ml with 0.1 ml graduations grade a, test tubes without rim borosilicate, 25 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 15 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 12 x 150 mm, autoclavable caps for above test tubes, test tubes stand aluminium 9 x 3 holes triple rack, meat extract b, powder, brilliant green stain powder, bromo cresol green indicator powder, carbol fuchsin, practical grade, carmine staining powder, sq’ chloroform, cresol red indicator powder, sq’ m cresol, sq’ diethyl ether, eosin yellow staining powder (water soluble), eosin stain solution (2% w/v), fuchsin acid staining powder (acid fuchsin), gentian violet powder, giemsa’s staining powder, gram’s iodine stain solution, sq’ iodine resublimed, litmus blue indicator papers, litmus red indicator papers, malachite green staining powder, sq’ mannitol, nessler’s reagent (for ammonia), leishman’s stain powder, phenol red indicator powder (water soluble), phenolphthalein indicator powder, phosphotungstic acid ‘excelar’, sq’ potassium iodide, sq’ potassium oxalate monohydrate, sq’ iso propyl alcohol (propan 2 ol), safranine staining powder, sq’ sodium chloride, sq’ sodium hydroxide flakes, thymol blue indicator powder, tryptone (bacteriological) mediaid, wright’s stain, hi cert, sq’ xylene sulphur free, sq’ zinc sulphate heptahydrate, methylene blue staining powder, sq’ hydrochloric acid, sq’ amyl alcohol (iso amyl alcohol), n,n,n’,n’ tetramethyl p phenylenediamine dihydrochloride, sq’ p dimethyl amino benzaldehyde (ehrlich’s reagent), kovacs’ indole reagent, hidispotm bag 10*, gordon mcleod reagent (oxidase reagent), gram stains kit, albert`s metachromatic stains kit, crystal violet staining powder, carbol fuchsin conc. (ziehl neelsen) stain solution, carbol fuchsin dilute (ziehl neelsen) stain solution, gram’s iodine stain solution, neutral red indicator powder, safranine staining powder, methylene blue staining powder, sq’ iodine resublimed, sq’ potassium iodide, sq’ ammonium oxalate monohydrate, thymol blue indicator powder, phenol red indicator powder (water soluble), neutral red indicator powder, bromo cresol green indicator powder, bromo cresol green indicator powder, chlorophenol red, hi cert, congo red indicator powder, horse serum, antibiotics, ampicillin 10 mcg (50 disc), chloramphenicol 30 mcg, co trimoxazole 25 mcg (sulpha/trimethoprim) (23.75/1.25mcg), erythromycin 15 mcg, gentamicin 10 mcg, nitrofurantoin 300 mcg, oxacillin 1 mcg, piperacillin 100 mcg, tetracycline 30 mcg, trimethoprim 5 mcg, amikacin 30 mcg, ceftriaxone 30 mcg, cefuroxime 30 mcg, ciprofloxacin 30 mcg, clindamycin 10 mcg, nalidixic acid 30 mcg (50 disc), tobramycin 10 mcg, bacitracin 10 units, potassium tellurite 3.5% (1 ml per vial), vancomycin, colistin (methane sulphonate), nystatin 50 mcg, urea broth base, xylose lysine deoxycholate agar (xld agar), potassium cyanide broth base w/o kcn, dulcitol selenite broth, glucose broth, lactose monohydrate, bacteriological grade, lactose broth, brilliant green bile broth, macconkey broth w/ neutral red, ethyl alcohol, malachite green staining powder, ‘sq’ sodium chloride, ‘sq’ phenol (carbolic acid), toluidine blue o, practical grade, fuchsin basic staining powder (basic fuchsin), ‘sq’ potassium hydroxide pellets, ‘sq’ sodium carbonate anhydrous, azure a, hi cert, azure b, hi cert, ‘sq’ sodium dihydrogen orthophosphate dihydrate (sodium acid phosphate), ‘sq’ potassium dihydrogen orthophosphate, ‘sq’ methanol, ‘sq’ acetic acid glacial, ‘sq’ maltose monohydrate, ‘sq’ sodium thiosulphate pentahydrate (hypo), ‘sq’ calcium carbonate, n 95 particulate respirator with exhalation, size regular,, ‘sq’ hydrochloric acid, whatman filter paper no. 1, size 12.5cm, 100/pk, triclogel dispenser bottle* w/ pump in 500 ml bottle (hand sanitizer), spatula 8, ‘sq’ hydrogen peroxide solution 30% w/v (100 volumes), glucose phosphate broth, granulated (buffered glucose broth, granulated) (mr vp medium, granulated), micropipette 100* capacity : 10 to 100 μl, micropipette 1000* capacity : 100 to 1000 μl, micropipette 10 capacity : 0.5 to 10 μl, μpet autoclavable micropipette 8 channel (20 200 μl), antibiotics disk positive hexa g, antibiotics disk negative hexa g, maleriya card antigen, maleriya card antibody, hiculture™ transport swabs w/amies medium (b), hiculture™ transport swabs w/ dey engley neutralizing broth, alkaline saline peptone water (aspw), alternative thioglycollate medium (nih thioglycollate broth) (thioglycollate broth, alternative), amies transport medium w/ charcoal, agar medium m (triple sugar, iron agar), columbia blood agar base, cooked meat medium (revised as cooked m medium) (r.c.medium), reagan lwe medium, hoyle medium base, potassium tellurite 3.5% (1 ml per vial), loeffler medium base, horse serum donor herd gamma irradiated sterile filtered, macconkey hiveg™ agar w/ cv, nacl, 0.003% nr and 1.5% agar, mycoplasma agar base (pplo agar base), mycoplasma enrichment supplement, nutrient broth w/ 1% peptone, nutrient agar w/ 1% peptone, nutrient agar, 1.5%, peptone water, pyrazinamidase agar, selenite f broth (twin pack) medium 11 (in accordance with ip 2007), stuart transport medium w/o methylene blue with charcoal, tellurite blood agar base, haemoglobin powder, vitamino growth supplement (twin pack), potassium tellurite 1% (1 ml per vial), transport charcoal medium, transport liquid medium, stuart transport medium (transport medium, stuart), tryptic soya agar, field’s tryptic digest broth (tryptic digest broth), tryptone tellurite agar base, potassium tellurite 1% (1 ml per vial), autoclavable petri plates polycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm., makarthy tube, aluminium cap with silicon rubber gasket, flat bottom vol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall, wash bottle; capacity 500ml, metaloop sl, sterile cotton swab, triclogel in 100 ml bottle, steriswift™ disinfectant wipes size: 7” x 7”, bactrex™ plus, bottles, reagent, graduated with screw cap and pouring ring, 100ml, sterile pure viscose swab, mbl esbl, esbl multi, steam indicator tape, hivibrio™ identification kit, hisalmonella™ identification kit, himotility™ biochemical kit for salmonella, geobacillus stearothermophilus, anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre (le002f) 1 no & anaero indicator tablet (le065)., anaerobic system mark v, hisalmonella™ latex test kit, mccartney bottle w/ aluminium cap neutral glass, autoclavable., sterile pure viscose swab, nasco sampling bag, thumb press dispensing dropper/ pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack., test tube without rim, glass cap. 38x200mm, 50/pk, labolene neutral ph, plasticine, dpx mountant (for microscopy), sq’ potassium hydroxide pellets, sq’ hydrogen peroxide solution 30% w/v (100 volumes), sq’ charcoal powder activated 250 mb, spore strips (25 strips/pack), sterile membrane syringe filters all size, lugol’s iodine, grams iodine, stabilized, methylene blue (aqueous), safranin, 0.5% w/v, gram’s crystal violet, albert’s stain a, albert’s stain b, grams decolourizer, conical flask erlenmeyer cap. 250ml, 120 ml capacity glass bottle with alluminium cap, felix tube, dreyers tube, pointed foceps 6/4, kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm, alluminium racks 4*12 all size tubes, magnifying glass/hand lens dia 3, metal loops holder, test tube without rim, glass cap.12x75mm, 100/pk, 2, test tube without rim, glass cap. 15x125mm, 100/pk, test tube without rim, glass cap. 18x150mm, 100/pk, hiassorted™ biochemical test kit, blotting papers sheet 46x57cm, antibiotics, bacitracin disc 10 mcg, 5 x 100 disc, bile esculin disc, (50 discs / vl), novobiocin disc, 5 x 100 disc, optochin disc, (50 discs / vl), ampicillin disc 10 mcg , 5 x 100 disc, ampicillin/sulbactam (10/10 mcg), 5 x 100 disc, amikacin disc 30 mcg , 5 x 100 disc, amoxycillin + clavulanic acid (20/10 mcg) (amoxyclav 30mcg), 5 x 100 disc, aztreonam disc 30 mcg , 5 x 100 disc, azithromycin disc 15 mcg , 5 x 100 disc, cefixime disc 5 mcg , 5 x 100 disc, ceftazidime disc 30 mcg , 5 x 100 disc, ceftazidime + clavulanic acid disc, 5 x 100 disc, cetriaxone disc 30 mcg , 5 x 100 disc, cephalexin disc, 5 x 100 disc, cefachlor disc 30 mcg , 5 x 100 disc, cefamadmandole disc 30 mcg , 5 x 100 disc, cefazoline disc 30 mcg , 5 x 100 disc, cefdinir disc 5 mcg , 5 x 100 disc, cefmetazole disc 30 mcg , 5 x 100 disc, cefonicid disc 30 mcg , 5 x 100 disc, cefoparazone disc 75 mcg , 5 x 100 disc, cefotetan disc 30 mcg , 5 x 100 disc, cefpodoxime disc 10 mcg , 5 x 100 disc, cefprozil disc 30 mcg , 5 x 100 disc, ceftizoxime disc 30 mcg , 5 x 100 disc, cefuroxime disc 30 mcg , 5 x 100 disc, cephalothine disc 30 mcg , 5 x 100 disc, cephotaxime (cefotaxime) disc 30 mcg, 5x100 disc, cefoxitime disc 30 mcg , 5 x 100 disc, clarithromicine disc 15 mcg , 5 x 100 disc, clindamycin disc 2 mcg , 5 x 100 disc, colistin disc 10 mcg , 5 x 100 disc, co trimoxazole disc 25 mcg , 5 x 100 disc, furazolidone disc 50 mcg , 5 x 100 disc, kannamimycine disc 30 mcg, 5 x 100 disc, cefepime disc 30 mcg , 5 x 100 disc, chloramphenicol disc 30 mcg , 5 x 100 disc, ciprofloxacin disc 5 mcg , 5 x 100 disc, cefoxitin disc , 5 x 100 disc, cotrimoxazole disc, 5 x 100 disc, doxycyline disc 30 mcg , 5 x 100 disc, erythromycin disc 15 mcg, 5 x 100 disc, gentamycin disc 10 mcg , 5 x 100 disc, imipenam disc 10 mcg , 5 x 100 disc, linezolid disc 30 mcg , 5 x 100 disc, levofloxacine disc 5 mcg , 5 x 100 disc, lomefloxacine disc 10 mcg , 5 x 100 disc, methicilline disc 5 mcg , 5 x 100 disc, mezlocilline disc 5 mcg, 5 x 100 disc, mecillinam disc 10 mcg , 5 x 100 disc, meropenem disc 10 mcg , 5 x 100 disc, nitrofurantoin disc , 5 x 100 disc, nafcilin disc 1 mcg , 5 x 100 disc, netilmicin disc, 5 x 100 disc, norfloxacin disc, 5 x 100 disc, oxacilline disc , 5 x 100 disc, ofloxacin disc , 5 x 100 disc, penicilline g disc 10 mcg , 5 x 100 disc, piperacillin disc 100 mcg, 5 x 100 disc, piperacillin tazobactum disc, 5 x 100 disc, quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc, sulfisoxazole disc 300 mcg , 5 x 100 disc, ticarcilline disc 75 mcg , 5 x 100 disc, ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc, teicoplanin disc, 5 x 100 disc, tetracycline disc 30 mcg , 5 x 100 disc, tobramycin disc, 5 x 100 disc, vancomycin disc, 5 x 100 disc, meropenam disc, 5 x 100 disc, cefpodoxime, 5 x 100 disc, clarithromycin disc, 5 x 100 disc, clindamycin disc, 5 x 100 disc, polymyxin b 300 units disc, 5 x 100 disc, nalidixic acid disc, 5 x 100 disc, swabs cat. ref. case qty material sterility, wooden applicator sticks, plain swab, wooden shaft, cotton tip, plain swab, wooden shaft, cotton tip individually, plain swab, polystyrene shaft, cotton tip individually, plain swab, wooden shaft, cotton tip, plain swab in round tube, wooden shaft, cotton tip, plain swab in round tube, polystyrene shaft, cotton tip, amies transport swab, plain media, polystyrene shaft,, viscose tip, amies transport swab, charcoal media, polystyrene, shaft, viscose tip, environmental swabs, enviromax foam tip sampling swab, enviromax foam tip sampling swab sterile, enviromax pre moistened samplig swab sterile, esk 4ml neutralising buffer swab, esk 10ml neutralising buffer swab, petri dishes loops and spreaders, 90mm triple vent, 55mm triple vent, contact plate 65 x 16mm, 120mm x 120mm square, vented, 140mm triple vent, 1ul shortie loop, 10ul shortie loop, 5ul shortie loop, 1ul loop packs, 10ul loop packs, l shaped spreaders in packs, blue spreaders in packs, ‘u’ well microtitration plate, ‘f’ well microtitration plate, ‘v’ well microtitration plate, lid for microtitre plates, large containers ( 24 hour urine ) and sweetie jars, 2 litre graduated pe container, 2.5 litre 24 hour urine collection, labelled, 2.7 litre graduated pe container, 5 litre 24 hour urine container, sweet jar with cap, small, sweet jar with cap & label, small pet, sweet jar with cap, large pet, sweet jar with cap & label, large, 250ml snap top bucket, 250ml snap top bucket and lid, 500ml snap top bucket, containers, 7ml bijou container, no label, 7ml bijou container, with plain label, 7ml bijou container, with boric acid, 7ml bijou container, no label, 30ml universal, with label flow seal, 30ml universal, plain label, 30ml universal with spoon, printed label, 30ml universal, no label, 30ml universal, printed label, 30ml universal, with boric acid, no label, 60ml clear plastic cap, no label, 60ml clear plastic cap, with printed label, 60ml container blue p/p screw cap plain label, 60ml container dark blue p/p screw cap plain label, 60ml plastic cap container, no label, 60ml plastic cap container, no label, 60ml plastic cap container, plain label, 60ml metal cap container, printed label, tray wrapped, 60ml metal cap container, no label, tray wrapped, 100ml metal cap container, printed label, tray wrapped, 100ml metal cap container, no label, tray wrapped, 125ml container dark blue, screw cap, plain label, 125ml container blue, screw cap, plain label, 125ml container natural, screw cap, plain label, 125ml container screw cap with spoon, plain label, 150ml metal cap container, no label, tray wrapped, 150ml metal cap container, printed label, tray wrapped, 160ml container with spoon, 200ml container blue p/p screw cap, no label, 200ml container blue p/p screw cap, plain label, 200ml container natural p/p screw cap, no label, 250ml metal cap container, printed label, tray wrapped, 250ml metal cap container, no label, tray wrapped, 250ml metal cap container, plain label, tray wrapped, 200ml container, no label, 30ml dippa sampler with handle, 250ml dippa sampler with handle ps/pp blue, 500ml sodium thiosulphate bottle, 1000ml sodium, thiosulphate bottle, 500ml sample bottle plain label, 1000ml sample bottle plain label, 500ml wide mouth container with thiosulphate, 1000ml wide mouth container with thiosulphate, 1000ml wide mouth container, test tubes polystyrene and polypropylene, 55 x 11mm, round bottom, cap to fit 11mm diameter tube, cap to fit 12mm diameter tube, plug tight cap to fit 13mm diameter tube, re caps to fit 13mm tube, 13mm hanging vacutainer insert flat bottom., 12ml conical base, 16 x 100 conical tube, centrifuge tubes, 15ml graduated with screw cap, 15ml conical with screw cap, 50ml graduated with screw cap (self standing), 4.5ml pasteur pipette, 1ml pasteur, plastic graduated, 1ml pasteur pipette, ind. wrapped, 3ml pasteur, plastic graduated, 3ml pasteur pipette, ind. wrapped, 1ml pasteur, plastic graduated sterile pack, 1ml pasteur, plastic graduated sterile ind. wrap., 3ml pasteur, plastic graduated sterile ind. wrap, 5ml pasteur pipette, graduated, 7ml pasteur pipette, jumbo, 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s, 3ml fine tip, pasteur pipette 210002 500 pe ns, 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns, 3.0ml micro tip, pasteur pipette 210004 250 pe ns, 2.5ml pasteur pipette 210006 400 pe ns, 3ml fine tip, pasteur pipette, ind. wrapped, 1ml micro tip pasteur pipette, 3ml pasteur pipette, peel pack, serological pipettes, 1ml. taper jet, bulk wrap, pipette tips, yellow pipette tip 5 200ul eppendorf, yellow pipette tip 5 200ul eppendorf (racked), blue pipette tip 100 1000ul eppendorf, blue pipette tip 100 1000ul eppendorf (racked), yellow pipette tip 5 200ul, yellow pipette tip 5 200ul (racked) 199620 10 x 96 pp ns, blue pipette tip 100 1000ul, blue pipette tip 100 1000ul (racked) 10 x 96 pp ns, white slim pipette tip 5 200ul, blue slim line tip 200 1000ul, white macro pipette tip 5000ul, natural pipette tip 1000 5000ml, natural pipette tip 1000 5000ml universal, essential microbiology consumables gloves cat. ref. case qty material sterility, powder free / small (6 7) latex ns, powder free, easy stretch, white, small (6 7) nitrile ns, plastic bags / zip lock bags, microcentrifuge tubes, microtube 0.5ml, microtube 2.0ml flat cap, screw cap microtubes and cryovials, 2ml skirted microtube without cap, screw cap with o ring, natural, screw cap with o ring, white, screw cap with o ring, orange, screw cap with o ring, red, screw cap with o ring, blue, screw cap with o ring, green, screw cap with o ring, yellow, screw cap with o ring, black, 1.2ml cryovial storage to 190 c, 2.0ml cryovial storage to 190 c, 5.0ml cryovial storage to 190 c, essential microbiology consumables, scoops and weigh boats cat. ref. case qty material sterility, 5ml white diamond, 41 x 41 x 8mm, 30ml white diamond, 89 x 89 x 25mm, 100ml white diamond, 140 x 140 x 22mm, 10ml measuring scoop, microscope slides and cover slips, white superfrost slides blue superfrost slides, plain slide cut edge, plain slide ground edge, twin frosted slide ground edge twin frosted slide ground edge, twin frosted slide cetiglass pure glass 76x26x1mm, cover slip 18x18, slide mailer, slide box 100, autoclave bags and paper products, autoclave bags 310 x 660mm, high temp., yellow clinical waste bags 30 x 39, ethylene oxide gas tape 19mm x 50m, dry heat (pou pinel) tape 19mm x 50m, autoclave tape 19mm x 50m, specimen bag, 5½˝ x 6˝ x 8½˝, specimen bag, printed biohazard, absorbent benchcoat 50cm x 50 meters, 10 inch hygiene rolls 2 ply, white, c fold 1 ply, green, medical wipes 2 ply, white, post lip paper / slide blotting paper, absorbent bench paper sheets, filter paper 50x50cm, microtips racks box of all size, macconkey agar w/o cv w/0.15% bile salt, nutrient agar, ss agar (salmonella shigella agar), mueller hinton agar, cary blair medium base (transport medium w/o charcoal), triple sugar iron agar, mannitol salt agar, urea agar base (christensen) (autoclavable), simmons citrate agar, bile salt agar, xylose lysine deoxycholate agar (xld agar), tcbs agar, deoxycholate citrate agar (agar medium j), brain heart infusion broth, peptone, bacteriological, sorbitol agar (macconkey sorbitol agar), sabouraud dextrose agar, glucose broth, tryptic soya agar, bordet gengou agar base with supllements, gordon mcleod reagent (oxidase reagent), kovacs’ indole reagent, ‘sq’ acetone, ‘sq’ iodine resublimed, gram stains kit, albert`s metachromatic stains kit, ‘sq’ phenol (carbolic acid), spirit, ethanol, absolute, antibiotics disc positive, antibiotics disc negative, metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml., nicrome wire(resistance wire) 100gm, spirit lamp, cotton roll 500gm, aluminium foil, plain slides, cover slip size 18mm round, grooves glass slides, bhi supplemented w/ 0.05% spsä, conical flask erlenmeyer cap.500ml, petri dish culture, s line size, 80x15, glass measuring cylinder, cap. 250ml, glass measuring cylinder, cap. 500ml, test tube with rim size 12x75mm, 100/pk, test tube with rim size 15x125mm, 100/pk, test tube with rim size 18x150mm, 100/pk, surgical gloves, 100/pk, micro tips 10 100μl, 1000/pk, yellow, micro tips 100 1000μl, 500/pk, blue, plastic beaker 500 ml, pvc, glass beaker, cap. 500ml, sterile disposable petri plates* polystyrene, optically clear, size : 100 mm diameter x 15 mm, individually packed., labolene neutral ph (soap solution), for glassware washing, ph indicator papers full range (ph 1.0 to 14.0), distill water, micropipette 100* capacity : 10 to 100 μl, micropipette 1000* capacity : 100 to 1000 μl, micropipette 10 capacity : 0.5 to 10 μl, μpet autoclavable micropipette 8 channel (20 200 μl), disposable masks, bloting paper, filter paper size 12.5cm circule, serological test for typhoid, zn acid fast stains, ‘sq’ sulphuric acid, giemsa’s stain, ‘sq’ formaldehyde solution 37 41% w/v, ‘sq’ potassium oxalate monohydrate, ‘sq’ sodium hypochlorite solution (available chlorine 4% w/v approx.), funnels, plain , size 50mm, funnels, plain , size 75mm, pestle & mortar, ‘sq’ acetic acid glacial, methylene blue aqueous stain solution, staining rods/ staining tray/ slide tray, salmonella polyvalent somatic (o) antigen, salmonella polyvalent somatic (h) antigen, test tubes stand, pvc, glassware for measuring, forceps 5, tranport container etc ...

Medical Health And Family Welfare - Rajasthan

22708176 supply of laboratory reagents kits and other material 1 1 b.sugar god / pod nmack erba 1 10 x 500 ml 2 2 b.urea ( berthelot ) nmack erba 1 2 x 50 ml 3 3 s. cretinine ( kinetic ) nmack erba 1 2 x 50 ml 4 4 s.bilirubin t&d nmack erba 1 2 x 100 ml 5 5 sgot ( kinetic ) nmack erba 1 20 x 50 ml 6 6 sgpt ( kinetic ) nmack erba 1 20 x 50 ml 7 7 colestrol nmack erba 1 2 x 50 ml 8 8 widal 1 4 x 5 ml ( per pkt ) 9 9 ra 1 typhe dot each 10 10 aslo 1 50 t ( per vial ) 11 11 crp 1 50 t ( per vial ) 12 12 vdrl ( rp strip ) 1 1 x 100 stp ( each packet ) 13 13 hb sag card 1 1 x 50 card ( each packet ) 14 14 hcv 1 1 x 40 card ( each packet ) 15 15 hiv rapid 1 1 x 40 card ( each packet ) 16 16 hiv tri dot 1 1 x 100 t ( each packet ) 17 17 anti a 1 1 x 10 ml ( per vial ) 18 18 anti b 1 1 x 10 ml ( per vial ) 19 19 anti d igg+igm monocolan 1 1 x 10 ml ( per vial ) 20 20 anti ab 1 1 x 10 ml ( per vial ) 21 21 anti xh 1 1 x 10 ml ( per vial ) 22 22 ahg 1 1 x 10 ml ( per vial ) 23 23 anti a1 1 1 x 10 ml ( per vial ) 24 24 seurm bovine albumin 1 1 x 10 ml ( per vial ) 25 25 uristi x s parameter 1 1 x 100 stp ( each packet ) 26 26 multisti x 1 1 x 100 stp ( each packet ) 27 27 coomb sera vail 1 1x10 ml ( per boil ) 28 28 n / 10 hcl 1 1 x 500 mm ( per bottle ) 29 29 sodium citrate 3.8% 1 1 x 500 ml ( per bottle ) 30 30 lesmen stain 1 1 x 250 ml ( per bottle ) 31 31 lesmen powder 1 1 x 25 gm ( per pkt ) 32 32 tlc flude 1 1 x 500 ml ( per bottle ) 33 33 ceder wood oil 1 1 x 50 ml ( per bottle ) 34 34 pregnancy test rapid kit 1 1 x 100 stp ( per pkt ) 35 35 jsb stain a 1 1x500ml ( per bottle ) 36 36 jsb stain b 1 1 x 500 ml ( per bottle ) 37 37 sodium hypocloride 1 5 ltr can 38 38 xylene 1 1 x 500 ml per bottle 39 39 semen diluting fluid 1 100 ml per bottle 40 40 cpd beg 1 350 ml ( 10 pkt ) 41 41 cpd beg 1 100 ml ( 10 pkt ) 42 42 distil water 1 1 x 5 ltr ( per can ) 43 43 micro tips 2 200 ul 1 1 x 1000 ( per pkt ) 44 44 micro tips 5 1000 ul 1 1 x 1000 ( per pkt ) 45 45 cover slip 1 1 x 20 ( per pkt. ) 46 46 glass slide 1 1 x 50 ( per pkt ) 47 47 edta vail with screw cap ( k2 ) 1 1 x 100 ( per pkt ) 48 48 sodium cicrate tube for blood collection edta k3 1 1 x 100 ( per pkt ) 49 49 plane vail with screw cap 1 1 x 100 ( per pkt ) 50 50 urine collection container 1 1 x 100 ( per pkt ) 51 51 urine centrifugal vail 1 1 x 100 ( per pkt ) 52 52 esr tube glass 1 1x10 ( per pkt ) 53 53 state fax tube glass 1 each 54 54 glass tube 10 ml 1 per pkt 55 55 tissue paper 1 per pkt 56 56 ph paper 1 per pkt 57 57 blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes 1 each 58 58 abx minoclear 1 100 ml per pack 59 59 abx minidil lmg 1 20 l per pack 60 60 abx lyse bio 1 1 l per pack 61 61 abx cleaner 1 1 l per pack 62 62 minocal calibrator 1 2.0 ml per vail 63 63 minotrol 16 twin pak ( 02l ) 1 2.5 ml per vail 64 64 minotrol 16 twin pack ( 2n ) 1 2.5 ml per vail 65 65 minotrol 16 twin pack ( 2h ) 1 2.5 ml per vail 66 66 minoclair 1 0.5 ml per vail 67 67 paper roll for abx micro es 60 1 per pkt 68 68 reagents for elisa reader 69 69 hiv elisa 1 1 x 96 t per pkt 70 70 hbs ag elisa 1 1 x 96 t per pkt 71 71 hcv alisa 1 1 x 96 t per pkt 72 72 vtm kit 1 1 x 50 tube per pkt 73 73 anti d igg + igm 1 per vail 74 74 tournicate 1 per piece 75 75 rubber ball for blood donner 1 per piece 76 76 tharmograph paper for 1 per pkt 77 77 papper roll for sami auto analizer transasia 1 per pkt 78 78 papper roll sami auto analizer gyro 1 per pkt 79 79 papper roll automatic fully esr analizer transasia 1 per pkt 80 80 projection lamp 6v20w for microscope 1 each 81 81 fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables 1 system pack 82 82 albumin nmack erba 1 system pack per pkt 83 83 amylase nmack erba 1 system pack per pkt 84 84 bilirubin t&d nmack erba 1 system pack per pkt 85 85 urea nmack erba 1 system pack per pkt 86 86 cholestrol nmack erba 1 system pack per pkt 87 87 alkaline phosphate nmack erba 1 system pack per pkt 88 88 glucose nmack erba 1 system pack per pkt 89 89 s. creatinine nmack erba 1 system pack per pkt 90 90 calcium nmack erba 1 system pack per pkt 91 91 total protein nmack erba 1 system pack per pkt 92 92 triglyceride nmack erba 1 system pack per pkt 93 93 hdl cholestrol direct nmack erba 1 system pack per pkt 94 94 sgot nmack erba 1 system pack per pkt 95 95 sgpt nmack erba 1 system pack per pkt 96 96 chloride nmack erba 1 system pack per pkt 97 97 uric acid nmack erba 1 system pack per pkt 98 98 ck nmack erba 1 system pack per pkt 99 99 ckmb nmack erba 1 system pack per pkt 100 100 sample cup nmack erba 1 system pack per pkt 101 101 ggt nmack erba 1 system pack per pkt 102 102 ldl cholestrol with calibrator nmack erba 1 system pack per pkt 103 103 ldhp nmack erba 1 system pack per pkt 104 104 microprotein nmack erba 1 system pack per pkt 105 105 phosporus nmack erba 1 system pack per pkt 106 106 x l multical nmack erba 1 system pack per pkt 107 107 x l wash nmack erba 1 system pack per pkt 108 108 blood gas analizer regants nmack phox plus l nova biomedical 1 per pkt 109 109 calibration solution c 1 1 per pkt 110 110 calibration solution c 2 1 per pkt 111 111 fluid pack c 3 1 per pkt 112 112 fully automated biochemisty analayzer n model biosystem a25 reagent chemical & disposal 113 113 amylase direct nmack biosystem 1 system pack per pkt 114 114 amylase pancreatin nmack biosystem 1 system pack per pkt 115 115 adenosine deaminase ( ada ) nmack biosystem 1 system pack per pkt 116 116 alanine aminotransferase ( alt / gpt ) nmack biosystem 1 system pack per pkt 117 117 albumin nmack biosystem 1 system pack per pkt 118 118 alkaline phosphatase ( alp ) amp nmack biosystem 1 system pack per pkt 119 119 alkaline phosphatase ( alp ) dea nmack biosystem 1 system pack per pkt 120 120 aspantate aminotransferase ( ast / got ) nmack biosystem 1 system pack per pkt 121 121 bilrubin ( direct ) nmack biosystem 1 system pack per pkt 122 122 bilrubin ( total ) nmack biosystem 1 system pack per pkt 123 123 calcum arsenazo nmack biosystem 1 system pack per pkt 124 124 cabon diooxide nmack biosystem 1 system pack per pkt 125 125 cholesterol nmack biosystem 1 system pack per pkt 126 126 cholesterol hdl direct nmack biosystem 1 system pack per pkt 127 127 cholesterol ldl direct nmack biosystem 1 system pack per pkt 128 128 crecatinine kinase ck nmack biosystem 1 system pack per pkt 129 129 creatinine kinase mb ( ck , mb ) nmack biosystem 1 system pack per pkt 130 130 creatinine nmack biosystem 1 system pack per pkt 131 131 glutamyl transferase ( y gt ) nmack biosystem 1 system pack per pkt 132 132 glucose nmack biosystem 1 system pack per pkt 133 133 iron ferrozine nmack biosystem 1 system pack per pkt 134 134 lactate dehydrogenase ldh nmack biosystem 1 system pack per pkt 135 135 lipase nmack biosystem 1 system pack per pkt 136 136 magnesium nmack biosystem 1 system pack per pkt 137 137 phosphorus nmack biosystem 1 system pack per pkt 138 138 protein total nmack biosystem 1 system pack per pkt 139 139 protein ( urine / csf ) nmack biosystem 1 system pack per pkt 140 140 total bile acid nmack biosystem 1 system pack per pkt 141 141 triglycerides nmack biosystem 1 system pack per pkt 142 142 urea / bun vv nmack biosystem 1 system pack per pkt 143 143 uric acid nmack biosystem 1 system pack per pkt 144 144 sample cup nmack biosystem 1 1x1000 per pkt 145 145 washing solution nmack biosystem 1 500 ml per pkt 146 146 r washing solution nmack biosystem 1 500 ml per pkt 147 147 rotor nmack biosystem 1 10x120 per pkt 148 148 conc. system liquid nmack biosystem 1 1000 ml per pkt 149 149 halogen uv p lamp nmack biosystem 1 1 unit per pkt 150 150 control level 1 nmack biosystem 1 5x5 ml per pkt 151 151 control level ii nmack biosystem 1 5x5 ml per pkt 152 152 calibrator nmack biosystem 1 5x5 ml per pkt 153 153 urine analyzer strip 1 per pkt 154 154 gluco strip sd cheek code 21 1 per bottle 155 155 gluco strip accuchek 1 per bottle 156 156 gluco strip dr. marpirn 1 per bottle 157 157 semi auto analizer regents 1 per bottle 158 158 hemoglobino meter micro cuvette 1 per bottle 159 159 edta vial k 3 double cap 1 per pkt 160 160 fully auto analyser sample cube 1 per pkt 161 161 micropipettes 1 10 microliter 1 each 162 162 micropipettes 2 20 microliter 1 each 163 163 micropipettes 10 100 microliter 1 each 164 164 micropipettes 20 200 microliter 1 each 165 165 micropipettes 100 1000 microliter 1 each 166 166 micropipettes fix 10 microliter 1 each 167 167 micropipettes fix 50 microliter 1 each 168 168 micropipettes fix 100 microliter 1 each 169 169 micropipettes fix 200 microliter 1 each 170 170 micropipettes fix 500 microliter 1 each 171 171 westergreen stand 1 per piece 172 172 westergreen esr tube 1 each 173 173 dengue test kit rapid igm / ns1 1 each 174 174 chikungunia test card 1 each 175 175 scrub typhus ab. card 1 each 176 176 ns1 elisa for dengue 1 1 x 96 test 177 177 igm elisa for chikungunia 1 1 x 96 test 178 178 igm elisa for hepatitis a 1 each 179 179 igm elisa for hepatitis e 1 each 180 180 igm elisa for scrub typhus 1 1 x 96 test per pkt 181 181 igm elisa for japanese enaphalitis 1 per pkt 182 182 typhl dot for typhoid 1 each test per pkt 183 183 igm elisa for leptospirosis 1 each test 184 184 t pal salution 5 ltr 1 per can 185 185 trop – t test 1 each test 186 186 printed paper for cbc 5 part 1 per pkt 187 187 printed paper for cbc 3 part 1 per pkt 188 188 seman diluent fluid 100 ml 1 per bottle 189 189 fruity 200ml 1 per pkt 190 190 idsp lab reagents 191 191 test tubes without rim borosilicate, 25 x 150 mm 1 per pkt 192 192 autoclavable caps for above test tubes 1 per pkt 193 193 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 194 194 autoclavable caps for above test tubes 15 ml 1 per pkt 195 195 test tubes without rim borosilicate, 12 x 150 mm 1 per pkt 196 196 autoclavable caps for above test tubes 1 per pkt 197 197 burette borosilicate 50 ml 1 each 198 198 burette stands 1 each 199 199 measuring cylinders graduated, 10 ml 1 each 200 200 measuring cylinders graduated, 100ml 1 each 201 201 measuring cylinders graduated, 500 ml 1 each 202 202 measuring cylinders graduated, 1000 ml 1 each 203 203 petridishes, 15 x 90 mm borosilicate 1 each 204 204 universal bottles, 28 ml 1 per pkt 205 205 mccartney bottles, 28 ml 1 per pkt 206 206 funnels glass, diameter 100 mm, stem 50 mm 1 each 207 207 buchner flasks, 1 liter 1 each 208 208 beakers, borosilicate / pyrex, 1000 ml 1 each 209 209 beakers, borosilicate / pyrex, 500 ml 1 each 210 210 beakers, borosilicate / pyrex, 250 ml 1 each 211 211 beakers, borosilicate / pyrex, 2000 ml 1 each 212 212 conical flasks ( erlenmeyer ) , pyrex 100 ml 1 each 213 213 conical flasks ( erlenmeyer ) , pyrex 500 ml 1 each 214 214 conical flasks ( erlenmeyer ) , pyrex 1000 ml 1 each 215 215 conical flasks ( erlenmeyer ) , pyrex 2000 ml 1 each 216 216 volumetric flasks, grade a, 500 ml 1 each 217 217 volumetric flasks, grade a, 250 ml 1 each 218 218 volumetric flasks, grade a, 10 ml 1 each 219 219 pipettes, 1ml with 0.1 ml graduations grade a 1 each 220 220 pipettes, 2 ml with 0.1 ml graduations grade a 1 each 221 221 pipettes, 5 ml with 0.5 graduations grade a 1 each 222 222 pipettes, 10 ml with 1 ml graduations grade a 1 each 223 223 glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml 1 each 224 224 glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml 1 each 225 225 glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml 1 each 226 226 durham tubes 50 x 7.5 mm 1 per pkt 227 227 cotton wool non absorbent 1 per pkt 228 228 weighing boats, plastic 1 ¾ 5 boxes 1 each 229 229 weighing boats, plastic 3 5 / 16 5 boxes 1 each 230 230 brushes for bottle washing 40 cm 1 each 231 231 h2s water testing bottle 1 per pkt 232 232 brilliant green broth 1 500 gm 233 233 macconkey broth 1 500 gm 234 234 eosin methylene blue 1 500 gm 235 235 lactose broth 1 500 gm 236 236 durham tubes 20x 7.5 mm 1 per pkt 237 237 cotton wool non absorbent 1 per pkt 238 238 measuring cylinders graduated, 10 ml 1 each 239 239 measuring cylinders graduated, 100ml 1 each 240 240 measuring cylinders graduated, 500 ml 1 each 241 241 measuring cylinders graduated, 1000 ml 1 each 242 242 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 243 243 pipettes, 1ml with 0.1 ml graduations grade a 1 each 244 244 pipettes, 2 ml with 0.1 ml graduations grade a 1 each 245 245 pipettes, 5 ml with 0.5 graduations grade a 1 each 246 246 pipettes, 10 ml with 1 ml graduations grade a 1 each 247 247 test tubes without rim borosilicate, 25 x 150 mm 1 per pkt 248 248 autoclavable caps for above test tubes 1 per pkt 249 249 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 250 250 autoclavable caps for above test tubes 1 per pkt 251 251 test tubes without rim borosilicate, 12 x 150 mm 1 per pkt 252 252 autoclavable caps for above test tubes 1 per pkt 253 253 test tubes stand aluminium 9 x 3 holes triple rack 1 each 254 254 meat extract b, powder 1 500 gm 255 255 brilliant green stain powder 1 per pkt 256 256 bromo cresol green indicator powder 1 per pkt 257 257 bromo cresol purple indicator powder 1 per pkt 258 258 bromo phenol blue indicator powder 1 per pkt 259 259 bromo thymol blue indicator powder 1 per pkt 260 260 carbol fuchsin, practical grade 1 per pkt 261 261 carmine staining powder 1 per pkt 262 262 ‘sq’ chloroform 1 per pkt 263 263 cresol red indicator powder 1 per pkt 264 264 ‘sq’ m cresol 1 per pkt 265 265 ‘sq’ diethyl ether 1 per pkt 266 266 eosin yellow staining powder ( water soluble ) 1 per pkt 267 267 eosin stain solution ( 2% w / v ) 1 per pkt 268 268 fuchsin acid staining powder ( acid fuchsin ) 1 per pkt 269 269 fuchsin basic staining powder ( basic fuchsin ) 1 per pkt 270 270 gentian violet powder 1 per pkt 271 271 giemsa’s staining powder 1 per pkt 272 272 gram’s iodine stain solution 1 per pkt 273 273 ‘sq’ iodine resublimed 1 per pkt 274 274 litmus blue indicator papers 1 per pkt 275 275 litmus red indicator papers 1 per pkt 276 276 malachite green staining powder 1 per pkt 277 277 ‘sq’ mannitol 1 per pkt 278 278 nessler’s reagent ( for ammonia ) 1 per pkt 279 279 leishman’s stain powder 1 per pkt 280 280 phenol red indicator powder ( water soluble ) 1 per pkt 281 281 phenolphthalein indicator powder 1 per pkt 282 282 phenolphthalein indicator solution 1 per pkt 283 283 phosphotungstic acid ‘excelar’ 1 per pkt 284 284 ‘sq’ potassium iodide 1 per pkt 285 285 ‘sq’ potassium oxalate monohydrate 1 per pkt 286 286 ‘sq’ iso propyl alcohol ( propan 2 ol ) 1 per pkt 287 287 safranine staining powder 1 per pkt 288 288 ‘sq’ sodium chloride 1 per pkt 289 289 ‘sq’ sodium hydroxide flakes 1 per pkt 290 290 thymol blue indicator powder 1 per pkt 291 291 thymol blue indicator solution 1 per pkt 292 292 thymolphthalein indicator solution 1 per pkt 293 293 tryptone ( bacteriological ) mediaid 1 per pkt 294 294 wright’s stain, hi cert 1 per pkt 295 295 ‘sq’ xylene sulphur free 1 per pkt 296 296 ‘sq’ zinc sulphate heptahydrate 1 per pkt 297 297 methylene blue staining powder 1 per pkt 298 298 ‘sq’ hydrochloric acid 1 500 ml 299 299 ‘sq’ amyl alcohol ( iso amyl alcohol ) 1 500 ml 300 300 n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride 1 500 ml 301 301 ‘sq’ p dimethyl amino benzaldehyde ( ehrlich’s reagent ) 1 500 ml 302 302 kovacs’ indole reagent 1 500 ml 303 303 hidispotm bag 10* 1 500 ml 304 304 gordon mcleod reagent ( oxidase reagent ) 1 500 ml 305 305 gram stains kit 306 306 albert`s metachromatic stains kit 1 1 kit 307 307 crystal violet staining powder 1 per pkt 308 308 carbol fuchsin conc. ( ziehl neelsen ) stain solution 1 per pkt 309 309 carbol fuchsin dilute ( ziehl neelsen ) stain solution 1 per pkt 310 310 gram’s iodine stain solution 1 per pkt 311 311 neutral red indicator powder 1 per pkt 312 312 safranine staining powder 1 per pkt 313 313 methylene blue staining powder 1 per pkt 314 314 ‘sq’ iodine resublimed 1 per pkt 315 315 ‘sq’ potassium iodide 1 per pkt 316 316 ‘sq’ ammonium oxalate monohydrate 1 per pkt 317 317 thymol blue indicator powder 1 per pkt 318 318 phenol red indicator powder ( water soluble ) 1 per pkt 319 319 neutral red indicator powder 1 per pkt 320 320 methyl red indicator powder 1 per pkt 321 321 bromo cresol green indicator powder 1 per pkt 322 322 bromo cresol green indicator powder 1 per pkt 323 323 chlorophenol red, hi cert 1 per pkt 324 324 congo red indicator powder 1 per pkt 325 325 horse serum 1 per vial 326 326 antibiotics 327 327 ampicillin 10 mcg ( 50 disc ) 1 per vial 328 328 chloramphenicol 30 mcg 1 per vial 329 329 co trimoxazole 25 mcg ( sulpha / trimethoprim ) ( 23.75 / 1.25mcg ) 1 per vial 330 330 erythromycin 15 mcg 1 per vial 331 331 gentamicin 10 mcg 1 per vial 332 332 nitrofurantoin 300 mcg 1 per vial 333 333 oxacillin 1 mcg 1 per vial 334 334 piperacillin 100 mcg 1 per vial 335 335 tetracycline 30 mcg 1 per vial 336 336 trimethoprim 5 mcg 1 per vial 337 337 amikacin 30 mcg 1 per vial 338 338 ceftriaxone 30 mcg 1 per vial 339 339 cefuroxime 30 mcg 1 per vial 340 340 ciprofloxacin 30 mcg 1 per vial 341 341 clindamycin 10 mcg 1 per vial 342 342 nalidixic acid 30 mcg ( 50 disc ) 1 per vial 343 343 tobramycin 10 mcg 1 per vial 344 344 bacitracin 10 units 1 per vial 345 345 potassium tellurite 3.5% ( 1 ml per vial ) 1 per vial 346 346 vancomycin 1 per vial 347 347 colistin ( methane sulphonate ) 1 per vial 348 348 nystatin 50 mcg 1 per vial 349 349 urea broth base 1 per vial 350 350 xylose lysine deoxycholate agar ( xld agar ) 1 500 gm 351 351 potassium cyanide broth base w / o kcn 1 500 gm 352 352 dulcitol selenite broth 1 500 gm 353 353 glucose broth 1 500 gm 354 354 lactose monohydrate, bacteriological grade 1 500 gm 355 355 lactose broth 1 500 gm 356 356 brilliant green bile broth 1 500 gm 357 357 macconkey broth w / neutral red 1 500 gm 358 358 ethyl alcohol 1 500 gm 359 359 malachite green staining powder 1 500 gm 360 360 ‘sq’ sodium chloride 1 500 gm 361 361 ‘sq’ phenol ( carbolic acid ) 1 500 gm 362 362 toluidine blue o, practical grade 1 500 gm 363 363 fuchsin basic staining powder ( basic fuchsin ) 1 500 gm 364 364 ‘sq’ potassium hydroxide pellets 1 500 gm 365 365 ‘sq’ sodium carbonate anhydrous 1 500 gm 366 366 azure a, hi cert 1 500 gm 367 367 azure b, hi cert 1 500 gm 368 368 ‘sq’ sodium dihydrogen orthophosphate dihydrate ( sodium acid phosphate ) 1 500 gm 369 369 ‘sq’ potassium dihydrogen orthophosphate 1 500 gm 370 370 ‘sq’ methanol 1 500 ml 371 371 ‘sq’ acetic acid glacial 1 500 ml 372 372 ‘sq’ maltose monohydrate 1 500 ml 373 373 ‘sq’ sodium thiosulphate pentahydrate ( hypo ) 1 500 ml 374 374 ‘sq’ calcium carbonate 375 375 n 95 particulate respirator with exhalation, size regular, 1 per pkt 376 376 ‘sq’ hydrochloric acid 1 500 ml 377 377 whatman filter paper no. 1, size 12.5cm, 100 / pk 1 per pkt 378 378 triclogel dispenser bottle* w / pump in 500 ml bottle ( hand sanitizer ) 1 per bottle 379 379 spatula 8 1 each 380 380 ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) 1 500 ml 381 381 glucose phosphate broth, granulated ( buffered glucose broth, granulated ) ( mr vp medium, granulated ) 1 500 gm 382 382 micropipette 100* capacity : 10 to 100 μl 1 each 383 383 micropipette 1000* capacity : 100 to 1000 μl 1 each 384 384 micropipette 10 capacity : 0.5 to 10 μl 1 each 385 385 μpet autoclavable micropipette 8 channel ( 20 200 μl ) 1 each 386 386 antibiotics disk positive hexa g 1 50 disc vial 387 387 antibiotics disk negative hexa g 1 50 disc vial 388 388 maleriya card antigen 1 1 pkt 389 389 maleriya card antibody 1 1 pkt 390 390 hiculture™ transport swabs w / amies medium ( b ) 1 1 pkt 391 391 hiculture™ transport swabs w / dey engley neutralizing broth 1 1 pkt 392 392 alkaline saline peptone water ( aspw ) 1 500 gm 393 393 alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) 1 500 gm 394 394 amies transport medium w / charcoal 1 500 gm 395 395 agar medium m ( triple sugar, iron agar ) 1 500 gm 396 396 columbia blood agar base 1 500 gm 397 397 cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) 1 500 gm 398 398 reagan lwe medium 1 500 gm 399 399 hoyle medium base 1 500 gm 400 400 potassium tellurite 3.5% ( 1 ml per vial ) 1 each vial 401 401 loeffler medium base 1 500 gm 402 402 horse serum donor herd gamma irradiated sterile filtered 1 500 ml 403 403 macconkey hiveg™ agar w / cv, ?nacl, 0.003% nr and 1.5% agar 1 500 gm 404 404 mycoplasma agar base ( pplo agar base ) 1 500 gm 405 405 mycoplasma enrichment supplement 1 1 pkt 406 406 nutrient broth w / 1% peptone 1 500 gm 407 407 nutrient agar w / 1% peptone 1 500 gm 408 408 nutrient agar, 1.5% 1 500 gm 409 409 peptone water 1 500 gm 410 410 pyrazinamidase agar 1 500 gm 411 411 selenite f broth ( twin pack ) medium 11? ( in accordance with ip 2007 ) 1 500 gm 412 412 stuart transport medium w / o methylene blue with charcoal 1 500 gm 413 413 tellurite blood agar base 1 500 gm 414 414 haemoglobin powder 1 1 pkt 415 415 vitamino growth supplement ( twin pack ) 1 1 pkt 416 416 potassium tellurite 1% ( 1 ml per vial ) 1 1 vial 417 417 transport charcoal medium 1 500 gm 418 418 transport liquid medium 1 500 gm 419 419 stuart transport medium ( transport medium, stuart ) 1 500 gm 420 420 tryptic soya agar 1 500 gm 421 421 field’s tryptic digest broth ( tryptic digest broth ) 1 500 gm 422 422 tryptone tellurite agar base 1 500 gm 423 423 potassium tellurite 1% ( 1 ml per vial ) 1 500 gm 424 424 autoclavable petri plates polycarbonate, clear, transparent and unbreakable, ?size : 90 mm, diameter x 15 mm. 1 per pkt 425 425 makarthy tube, aluminium cap with silicon rubber gasket, flat bottom vol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall 1 per pkt 426 426 wash bottle; capacity 500ml 1 each 427 427 metaloop sl 1 each 428 428 sterile cotton swab 1 per pkt 429 429 triclogel in 100 ml bottle 1 each bottle 430 430 steriswift™ disinfectant wipes size: 7” x 7” 1 per pkt 431 431 bactrex™ plus 432 432 bottles, reagent, graduated with screw cap and pouring ring, 100ml 1 each 433 433 sterile pure viscose swab 1 pkt 434 434 mbl esbl 1 pkt 435 435 esbl multi 1 pkt 436 436 steam indicator tape 1 pkt 437 437 hivibrio™ identification kit 1 pkt 438 438 hisalmonella™ identification kit 1 pkt 439 439 himotility™ biochemical kit for salmonella 1 kit 440 440 geobacillus stearothermophilus 1 pkt 441 441 anaero box – s transparent unbreakable polycarbonate box, ?size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, ?accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . 1 each 442 442 anaerobic system mark v 1 each 443 443 hisalmonella™ latex test kit 1 each 444 444 mccartney bottle ?w / aluminium cap neutral glass, autoclavable. 1 pkt 445 445 sterile pure viscose swab 1 pkt 446 446 nasco sampling bag 1 pkt 447 447 thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, ?available in individual sterile pack. 1 pkt 448 448 test tube without rim, glass cap. 38x200mm, 50 / pk 1 per pkt 449 449 labolene neutral ph 1 per pkt 450 450 plasticine 1 per pkt 451 451 dpx mountant ( for microscopy ) 1 per pkt 452 452 ‘sq’ potassium hydroxide pellets 1 per pkt 453 453 ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) 1 1 vial 500 ml 454 454 ‘sq’ charcoal powder activated 250 mb 1 pkt 455 455 spore strips ( 25 strips / pack ) 1 per pkt 456 456 sterile membrane syringe filters all size 1 per pkt 457 457 lugol’s iodine 1 500 ml 458 458 grams iodine, stabilized 1 500 ml 459 459 methylene blue ( aqueous ) 1 500 ml 460 460 safranin, 0.5% w / v 1 500 ml 461 461 gram’s crystal violet 1 500 ml 462 462 albert’s stain a 1 500 ml 463 463 albert’s stain b 1 500 ml 464 464 grams decolourizer 1 500 ml 465 465 conical flask erlenmeyer cap. 250ml 1 each 466 466 120 ml capacity glass bottle with alluminium cap 1 each 467 467 felix tube 1 each 468 468 dreyers tube 1 each 469 469 pointed foceps 6 / 4 1 each 470 470 kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm 1 each 471 471 alluminium racks 4*12 all size tubes 1 each 472 472 magnifying glass / hand lens dia 3 1 each 473 473 metal loops holder 1 each 474 474 test tube without rim, glass cap.12x75mm, 100 / pk 1 per pkt 475 475 test tube without rim, glass cap. 15x125mm, 100 / pk 1 per pkt 476 476 test tube without rim, glass cap. 18x150mm, 100 / pk 1 per pkt 477 477 hiassorted™ biochemical test kit 1 each kit 478 478 blotting papers sheet 46x57cm 1 pkt 479 479 antibiotics 480 480 bacitracin disc 10 mcg, 5 x 100 disc 1 1 vial 100 disc 481 481 bile esculin disc, ( 50 discs / vl ) 1 1 vial 50 disc 482 482 novobiocin disc, 5 x 100 disc 1 1 vial 483 483 optochin disc, ( 50 discs / vl ) 1 1 vial 484 484 ampicillin disc 10 mcg , 5 x 100 disc 1 1 vial 485 485 ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc 1 1 vial 486 486 amikacin disc 30 mcg , 5 x 100 disc 1 1 vial 487 487 amoxycillin + clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc 1 1 vial 488 488 aztreonam disc 30 mcg , 5 x 100 disc 1 1 vial 489 489 azithromycin disc 15 mcg , 5 x 100 disc 1 1 vial 490 490 cefixime disc 5 mcg , 5 x 100 disc 1 1 vial 491 491 ceftazidime disc 30 mcg , 5 x 100 disc 1 1 vial 492 492 ceftazidime + clavulanic acid disc, 5 x 100 disc 1 1 vial 493 493 cetriaxone disc 30 mcg , 5 x 100 disc 1 1 vial 494 494 cephalexin disc, 5 x 100 disc 1 1 vial 495 495 cefachlor disc 30 mcg , 5 x 100 disc 1 1 vial 496 496 cefamadmandole disc 30 mcg , 5 x 100 disc 1 1 vial 497 497 cefazoline disc 30 mcg , 5 x 100 disc 1 1 vial 498 498 cefdinir disc 5 mcg , 5 x 100 disc 1 1 vial 499 499 cefmetazole disc 30 mcg , 5 x 100 disc 1 1 vial 500 500 cefonicid disc 30 mcg , 5 x 100 disc 1 1 vial 501 501 cefoparazone disc 75 mcg , 5 x 100 disc 1 1 vial 502 502 cefotetan disc 30 mcg , 5 x 100 disc 1 1 vial 503 503 cefpodoxime disc 10 mcg , 5 x 100 disc 1 1 vial 504 504 cefprozil disc 30 mcg , 5 x 100 disc 1 1 vial 505 505 ceftizoxime disc 30 mcg , 5 x 100 disc 1 1 vial 506 506 cefuroxime disc 30 mcg , 5 x 100 disc 1 1 vial 507 507 cephalothine disc 30 mcg , 5 x 100 disc 1 1 vial 508 508 cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc 1 1 vial 509 509 cefoxitime disc 30 mcg , 5 x 100 disc 1 1 vial 510 510 clarithromicine disc 15 mcg , 5 x 100 disc 1 1 vial 511 511 clindamycin disc 2 mcg , 5 x 100 disc 1 1 vial 512 512 colistin disc 10 mcg , 5 x 100 disc 1 1 vial 513 513 co trimoxazole disc 25 mcg , 5 x 100 disc 1 1 vial 514 514 furazolidone disc 50 mcg , 5 x 100 disc 1 1 vial 515 515 kannamimycine disc 30 mcg, 5 x 100 disc 1 1 vial 516 516 cefepime disc 30 mcg , 5 x 100 disc 1 1 vial 517 517 chloramphenicol disc 30 mcg , 5 x 100 disc 1 1 vial 518 518 ciprofloxacin disc 5 mcg , 5 x 100 disc 1 1 vial 519 519 cefoxitin disc , 5 x 100 disc 1 1 vial 520 520 cotrimoxazole disc, 5 x 100 disc 1 1 vial 521 521 doxycyline disc 30 mcg , 5 x 100 disc 1 1 vial 522 522 erythromycin disc 15 mcg, 5 x 100 disc 1 1 vial 523 523 gentamycin disc 10 mcg , 5 x 100 disc 1 1 vial 524 524 imipenam disc 10 mcg , 5 x 100 disc 1 1 vial 525 525 linezolid disc 30 mcg , 5 x 100 disc 1 1 vial 526 526 levofloxacine disc 5 mcg , 5 x 100 disc 1 1 vial 527 527 lomefloxacine disc 10 mcg , 5 x 100 disc 1 1 vial 528 528 methicilline disc 5 mcg , 5 x 100 disc 1 1 vial 529 529 mezlocilline disc 5 mcg, 5 x 100 disc 1 1 vial 530 530 mecillinam disc 10 mcg , 5 x 100 disc 1 1 vial 531 531 meropenem disc 10 mcg , 5 x 100 disc 1 1 vial 532 532 nitrofurantoin disc , 5 x 100 disc 1 1 vial 533 533 nafcilin disc 1 mcg , 5 x 100 disc 1 1 vial 534 534 netilmicin disc, 5 x 100 disc 1 1 vial 535 535 norfloxacin disc, 5 x 100 disc 1 1 vial 536 536 oxacilline disc , 5 x 100 disc 1 1 vial 537 537 ofloxacin disc , 5 x 100 disc 1 1 vial 538 538 penicilline g disc 10 mcg , 5 x 100 disc 1 1 vial 539 539 piperacillin disc 100 mcg, 5 x 100 disc 1 1 vial 540 540 piperacillin tazobactum disc, 5 x 100 disc 1 1 vial 541 541 quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc 1 1 vial 542 542 sulfisoxazole disc 300 mcg , 5 x 100 disc 1 1 vial 543 543 ticarcilline disc 75 mcg , 5 x 100 disc 1 1 vial 544 544 ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc 1 1 vial 545 545 teicoplanin disc, 5 x 100 disc 1 1 vial 546 546 tetracycline disc 30 mcg , 5 x 100 disc 1 1 vial 547 547 tobramycin disc, 5 x 100 disc 1 1 vial 548 548 vancomycin disc, 5 x 100 disc 1 1 vial 549 549 meropenam disc, 5 x 100 disc 1 1 vial 550 550 cefpodoxime, 5 x 100 disc 1 1 vial 551 551 clarithromycin disc, 5 x 100 disc 1 1 vial 552 552 clindamycin disc, 5 x 100 disc 1 1 vial 553 553 polymyxin b 300 units disc, 5 x 100 disc 1 1 vial 554 554 nalidixic acid disc, 5 x 100 disc 1 1 vial 555 555 swabs cat. ref. case qty material sterility 1 pkt 556 556 wooden applicator sticks 1 pkt 557 557 plain swab, wooden shaft, cotton tip 1 pkt 558 558 plain swab, wooden shaft, cotton tip individually 1 pkt 559 559 plain swab, polystyrene shaft, cotton tip individually 1 pkt 560 560 plain swab, wooden shaft, cotton tip 1 pkt 561 561 plain swab in round tube, wooden shaft, cotton tip 1 pkt 562 562 plain swab in round tube, polystyrene shaft, cotton tip 1 pkt 563 563 amies transport swab, plain media, polystyrene shaft, 1 pkt 564 564 viscose tip 1 pkt 565 565 amies transport swab, charcoal media, polystyrene 1 pkt 566 566 shaft, viscose tip 1 pkt 567 567 environmental swabs 1 pkt 568 568 enviromax foam tip sampling swab 1 pkt 569 569 enviromax foam tip sampling swab sterile 1 pkt 570 570 enviromax pre moistened samplig swab sterile 1 pkt 571 571 esk 4ml neutralising buffer swab 1 pkt 572 572 esk 10ml neutralising buffer swab 1 pkt 573 573 petri dishes loops and spreaders 1 pkt 574 574 90mm triple vent 1 each 575 575 55mm triple vent 1 each 576 576 contact plate 65 x 16mm 1 each 577 577 120mm x 120mm square, vented 1 each 578 578 140mm triple vent 1 each 579 579 1ul shortie loop 1 each 580 580 10ul shortie loop 1 each 581 581 5ul shortie loop 1 each 582 582 1ul loop packs 1 pkt 583 583 10ul loop packs 1 pkt 584 584 l shaped spreaders in packs 1 pkt 585 585 blue spreaders in packs 1 pkt 586 586 ‘u’ well microtitration plate 1 each 587 587 ‘f’ well microtitration plate 1 each 588 588 ‘v’ well microtitration plate 1 each 589 589 lid for microtitre plates 1 each 590 590 large containers ( 24 hour urine ) and sweetie jars 1 each 591 591 2 litre graduated pe container 1 each 592 592 2.5 litre 24 hour urine collection, labelled 1 each 593 593 2.7 litre graduated pe container 1 each 594 594 5 litre 24 hour urine container 1 each 595 595 sweet jar with cap, small 1 each 596 596 sweet jar with cap & label, small pet 1 each 597 597 sweet jar with cap, large pet 1 each 598 598 sweet jar with cap & label, large 1 each 599 599 250ml snap top bucket 1 each 600 600 250ml snap top bucket and lid 1 each 601 601 500ml snap top bucket 1 each 602 602 1000ml snap top bucket 1 each 603 603 2500ml snap top bucket 1 each 604 604 5000ml snap top bucket 1 each 605 605 10000ml snap top bucket 1 each 606 606 20000ml snap top bucket 1 each 607 607 containers 1 each 608 608 7ml bijou container, no label 1 each 609 609 7ml bijou container, with plain label 1 each 610 610 7ml bijou container, with boric acid 1 each 611 611 7ml bijou container, no label 1 each 612 612 30ml universal, with label flow seal 1 each 613 613 30ml universal, plain label 1 each 614 614 30ml universal with spoon, printed label 1 each 615 615 30ml universal, no label 1 each 616 616 30ml universal, printed label 1 each 617 617 30ml universal, with boric acid, no label 1 each 618 618 60ml clear plastic cap, no label 1 each 619 619 60ml clear plastic cap, with printed label 1 each 620 620 60ml container blue p / p screw cap plain label 1 each 621 621 60ml container dark blue p / p screw cap plain label 1 each 622 622 60ml plastic cap container, no label 1 each 623 623 60ml plastic cap container, no label 1 each 624 624 60ml plastic cap container, plain label 1 each 625 625 60ml metal cap container, printed label, tray wrapped 1 each 626 626 60ml metal cap container, no label, tray wrapped 1 each 627 627 100ml metal cap container, printed label, tray wrapped 1 each 628 628 100ml metal cap container, no label, tray wrapped 1 each 629 629 125ml container dark blue, screw cap, plain label 1 each 630 630 125ml container blue, screw cap, plain label 1 each 631 631 125ml container natural, screw cap, plain label 1 each 632 632 125ml container screw cap with spoon, plain label 1 each 633 633 150ml metal cap container, no label, tray wrapped 1 each 634 634 150ml metal cap container, printed label, tray wrapped 1 each 635 635 160ml container with spoon 1 each 636 636 200ml container blue p / p screw cap, no label 1 each 637 637 200ml container blue p / p screw cap, plain label 1 each 638 638 200ml container natural p / p screw cap, no label 1 each 639 639 250ml metal cap container, printed label, tray wrapped 1 each 640 640 250ml metal cap container, no label, tray wrapped 1 each 641 641 250ml metal cap container, plain label, tray wrapped 1 each 642 642 200ml container, no label 1 each 643 643 30ml dippa sampler with handle 1 each 644 644 30ml dippa sampler with handle ps / pp blue 1 each 645 645 30ml dippa sampler with handle pp / pp 1 each 646 646 30ml dippa sampler with handle pp / pp blue 1 each 647 647 100ml dippa sampler with handle ps / pp 1 each 648 648 100ml dippa sampler with handle ps / pp blue 1 each 649 649 250ml dippa sampler with handle ps / pp 1 each 650 650 250ml dippa sampler with handle ps / pp blue 1 each 651 651 500ml sodium thiosulphate bottle 1 each 652 652 1000ml sodium, thiosulphate bottle 1 each 653 653 500ml sample bottle plain label 1 each 654 654 1000ml sample bottle plain label 1 each 655 655 500ml wide mouth container with thiosulphate 1 each 656 656 1000ml wide mouth container with thiosulphate 1 each 657 657 500ml wide mouth container 1 each 658 658 1000ml wide mouth container 1 each 659 659 test tubes polystyrene and polypropylene 1 pkt 660 660 55 x 11mm, round bottom 1 pkt 661 661 70 x 11mm, round bottom 1 pkt 662 662 75 x 12mm, round bottom 1 pkt 663 663 75 x 13mm, round bottom 1 pkt 664 664 100 x 16mm, round bottom 1 pkt 665 665 150 x 16mm, round bottom 1 pkt 666 666 55 x 11mm, round bottom 1 pkt 667 667 75 x 12mm, round bottom 1 pkt 668 668 75 x 13mm, round bottom 1 pkt 669 669 100 x 13mm, round bottom 1 pkt 670 670 100 x 16mm, round bottom 1 pkt 671 671 cap to fit 11mm diameter tube 1 pkt 672 672 cap to fit 12mm diameter tube 1 pkt 673 673 plug tight cap to fit 13mm diameter tube 1 pkt 674 674 re caps to fit 13mm tube 1 pkt 675 675 13mm hanging vacutainer insert flat bottom. 1 pkt 676 676 12ml conical base 1 pkt 677 677 16 x 100 conical tube 1 pkt 678 678 centrifuge tubes 1 pkt 679 679 15ml graduated with screw cap 1 pkt 680 680 15ml graduated with screw cap ( racked ) 1 pkt 681 681 15ml graduated with screw cap 1 pkt 682 682 15ml conical with screw cap 1 pkt 683 683 50ml graduated with screw cap 1 pkt 684 684 50ml graduated with screw cap 1 pkt 685 685 50ml graduated with screw cap ( self standing ) 1 pkt 686 686 4.5ml pasteur pipette 1 each 687 687 1ml pasteur, plastic graduated 1 each 688 688 1ml pasteur pipette, ind. wrapped 1 each 689 689 3ml pasteur, plastic graduated 1 each 690 690 3ml pasteur pipette, ind. wrapped 1 each 691 691 1ml pasteur, plastic graduated sterile pack 1 each 692 692 1ml pasteur, plastic graduated sterile ind. wrap. 1 each 693 693 3ml pasteur, plastic graduated sterile ind. wrap 1 each 694 694 5ml pasteur pipette, graduated 1 each pkt 695 695 7ml pasteur pipette, jumbo 1 each pkt 696 696 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s 1 pkt 697 697 3ml fine tip, pasteur pipette 210002 500 pe ns 1 pkt 698 698 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns 1 pkt 699 699 3.0ml micro tip, pasteur pipette 210004 250 pe ns 1 pkt 700 700 2.5ml pasteur pipette 210006 400 pe ns 1 pkt 701 701 3ml fine tip, pasteur pipette, ind. wrapped 1 pkt 702 702 1ml micro tip pasteur pipette 1 pkt 703 703 3ml pasteur pipette, peel pack 1 pkt 704 704 serological pipettes 1 pkt 705 705 1ml. taper jet, bulk wrap 1 pkt 706 706 1ml. taper jet, single wrap 1 pkt 707 707 1ml. open end, bulk wrap 1 pkt 708 708 2ml. taper jet, bulk wrap 1 pkt 709 709 2ml. taper jet, single wrap 1 pkt 710 710 5ml. taper jet, bulk wrap 1 pkt 711 711 5ml. taper jet, single wrap 1 pkt 712 712 10ml. taper jet, bulk wrap 1 pkt 713 713 10ml. taper jet, single wrap 1 pkt 714 714 10ml. open end, bulk wrap 1 pkt 715 715 25ml. taper jet, single wrap 1 pkt 716 716 pipette tips 1 pkt 717 717 yellow pipette tip 5 200ul eppendorf 1 pkt 718 718 yellow pipette tip 5 200ul eppendorf ( racked ) 1 pkt 719 719 blue pipette tip 100 1000ul eppendorf 1 pkt 720 720 blue pipette tip 100 1000ul eppendorf ( racked ) 1 pkt 721 721 yellow pipette tip 5 200ul 1 pkt 722 722 yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns 1 pkt 723 723 blue pipette tip 100 1000ul 1 pkt 724 724 blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns 1 pkt 725 725 white slim pipette tip 5 200ul 1 pkt 726 726 blue slim line tip 200 1000ul 1 pkt 727 727 white macro pipette tip 5000ul 1 pkt 728 728 white micro crystal tip 0.5 10ul 1 pkt 729 729 white micro crystal tip 0.5 10ul 1 pkt 730 730 natural pipette tip 1000 5000ml 1 pkt 731 731 natural pipette tip 1000 5000ml universal 1 pkt 732 732 essential microbiology consumables gloves cat. ref. case qty material sterility 1 pkt 733 733 powder free / small ( 6 7 ) latex ns 1 pkt 734 734 powder free / medium ( 7 8 ) latex ns 1 pkt 735 735 powder free / large ( 8 9 ) latex ns 1 pkt 736 736 powder free, small ( 6 7 ) nitrile ns 1 pkt 737 737 powder free, medium ( 7 8 ) nitrile ns 1 pkt 738 738 powder free, large ( 8 9 ) nitrile ns 1 pkt 739 739 powder free, easy stretch, white, small ( 6 7 ) nitrile ns 1 pkt 740 740 powder free, easy stretch, white, medium ( 7 8 ) nitrile ns 1 pkt 741 741 powder free, easy stretch, white, large ( 8 9 ) nitrile ns 1 pkt 742 742 plastic bags / zip lock bags 1 pkt 743 743 55 x 55 x 0.05mm 1 pkt 744 744 60 x 80 x 0.05mm 1 pkt 745 745 70 x 100 x 0.05mm 1 pkt 746 746 80 x 120 x 0.05mm 1 pkt 747 747 100 x 150 x 0.05mm 1 pkt 748 748 110 x 110 x 0.05mm 1 pkt 749 749 120 x 180 x 0.05mm 1 pkt 750 750 150 x 220 x 0.05mm 1 pkt 751 751 200 x 300 x 0.05mm 1 pkt 752 752 250 x 330 x 0.05mm 1 pkt 753 753 300 x 400 x 0.05mm 1 pkt 754 754 microcentrifuge tubes 1 each 755 755 microtube 0.5ml 1 each 756 756 microtube 0.5ml 1 each 757 757 microtube 1.2ml ( strips of 8 ) 1 each 758 758 microtube 1.5ml clear 1 each 759 759 microtube 1.5ml flat top 1 each 760 760 microtube 1.5ml twist lock 1 each 761 761 microtube 1.5ml yellow 1 each 762 762 microtube 1.5ml green 1 each 763 763 microtube 2.0ml 1 each 764 764 microtube 2.0ml flat cap 1 each 765 765 screw cap microtubes and cryovials 1 each 766 766 2ml skirted microtube without cap 1 each 767 767 screw cap with o ring, natural 1 each 768 768 screw cap with o ring, white 1 each 769 769 screw cap with o ring, orange 1 each 770 770 screw cap with o ring, red 1 each 771 771 screw cap with o ring, blue 1 each 772 772 screw cap with o ring, green 1 each 773 773 screw cap with o ring, yellow 1 each 774 774 screw cap with o ring, black 1 each 775 775 1.2ml cryovial storage to 190 c 1 each 776 776 2.0ml cryovial storage to 190 c 1 each 777 777 5.0ml cryovial storage to 190 c 1 each 778 778 essential microbiology consumables 1 each 779 779 scoops and weigh boats cat. ref. case qty material sterility 1 each 780 780 5ml white diamond, 41 x 41 x 8mm 1 each 781 781 30ml white diamond, 89 x 89 x 25mm 1 each 782 782 100ml white diamond, 140 x 140 x 22mm 1 each 783 783 10ml measuring scoop 1 each 784 784 25ml measuring scoop 1 each 785 785 100ml measuring scoop 1 each 786 786 microscope slides and cover slips 1 pkt 787 787 white superfrost slides blue superfrost slides 1 pkt 788 788 plain slide cut edge 1 pkt 789 789 plain slide ground edge 1 pkt 790 790 twin frosted slide ground edge twin frosted slide ground edge 1 pkt 791 791 twin frosted slide cetiglass pure glass 76x26x1mm 1 pkt 792 792 cover slip 18x18 1 pkt 793 793 cover slip 20x20 1 pkt 794 794 cover slip 22x22 1 pkt 795 795 cover slip 22x32 1 pkt 796 796 cover slip 22x40 1 pkt 797 797 cover slip 24x24 1 pkt 798 798 cover slip 24x50 1 pkt 799 799 cover slip 24x32 1 pkt 800 800 cover slip 24x36 1 pkt 801 801 cover slip 24x40 1 pkt 802 802 cover slip 24x60 1 pkt 803 803 slide mailer 1 pkt 804 804 slide box 25 1 pkt 805 805 slide box 50 1 pkt 806 806 slide box 100 1 pkt 807 807 autoclave bags and paper products 1 each 808 808 autoclave bags 310 x 660mm, high temp. 1 each 809 809 autoclave bags 400 x 700mm, high temp. 1 each 810 810 autoclave bags 600 x 780mm, high temp. 1 each 811 811 yellow clinical waste bags 30 x 39 1 each 812 812 ethylene oxide gas tape 19mm x 50m 1 each 813 813 dry heat ( pou pinel ) tape 19mm x 50m 1 each 814 814 autoclave tape 19mm x 50m 1 each 815 815 specimen bag, 5½? x 6? x 8½? 1 each 816 816 specimen bag, printed biohazard 1 each 817 817 absorbent benchcoat 50cm x 50 meters 1 each 818 818 10 inch hygiene rolls 2 ply, white 1 each 819 819 c fold 1 ply, green 1 each 820 820 medical wipes 2 ply, white 1 each 821 821 post lip paper / slide blotting paper 1 each 822 822 absorbent bench paper sheets 1 each 823 823 filter paper 50x50cm 1 pkt 824 824 microtips racks box of all size 1 each 825 825 macconkey agar w / o cv w / 0.15% bile salt 1 500 gm 826 826 nutrient agar 1 500 gm 827 827 ss agar ( salmonella shigella agar ) 1 500 gm 828 828 mueller hinton agar 1 500 gm 829 829 cary blair medium base ( transport medium w / o charcoal ) 1 500 gm 830 830 triple sugar iron agar 1 500 gm 831 831 mannitol salt agar 1 500 gm 832 832 urea agar base ( christensen ) ( autoclavable ) 1 500 gm 833 833 simmons citrate agar 1 500 gm 834 834 bile salt agar 1 500 gm 835 835 xylose lysine deoxycholate agar ( xld agar ) 1 500 gm 836 836 tcbs agar 1 500 gm 837 837 deoxycholate citrate agar ( agar medium j ) 1 500 gm 838 838 brain heart infusion broth 1 500 gm 839 839 peptone, bacteriological 1 500 gm 840 840 sorbitol agar ( macconkey sorbitol agar ) 1 500 gm 841 841 sabouraud dextrose agar 1 500 gm 842 842 glucose broth 1 500 gm 843 843 tryptic soya agar 1 500 gm 844 844 bordet gengou agar base with supllements 1 500 gm 845 845 gordon mcleod reagent ( oxidase reagent ) 1 500 gm 846 846 kovacs’ indole reagent 1 1 bottle 847 847 ‘sq’ acetone 1 1 bottle 848 848 ‘sq’ iodine resublimed 1 1 bottle 849 849 gram stains kit 1 1 kit 850 850 albert`s metachromatic stains kit 1 1 kit 851 851 ‘sq’ phenol ( carbolic acid ) 1 1 bottle 852 852 spirit 1 1 bottle 853 853 ethanol, absolute 1 1 bottle 854 854 antibiotics disc positive 1 1 vial 855 855 antibiotics disc negative 1 1 vial 856 856 metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. 1 each 857 857 nicrome wire ( resistance wire ) 100gm 1 each 858 858 spirit lamp 1 each 859 859 cotton roll 500gm 1 each 860 860 aluminium foil 1 each 861 861 plain slides 1 1 pkt 862 862 cover slip size 18mm round 1 1 pkt 863 863 grooves glass slides 1 1 pkt 864 864 bhi supplemented w / 0.05% spsä 1 500 gm 865 865 conical flask erlenmeyer cap.500ml 1 each 866 866 petri dish culture, s line size, 80x15 1 each 867 867 glass measuring cylinder, cap. 250ml 1 each 868 868 glass measuring cylinder, cap. 500ml 1 each 869 869 test tube with rim size 12x75mm, 100 / pk 1 1 pkt 870 870 test tube with rim size 15x125mm, 100 / pk 1 1 pkt 871 871 test tube with rim size 18x150mm, 100 / pk 1 1 pkt 872 872 surgical gloves, 100 / pk 1 1 pkt 873 873 micro tips 10 100μl, 1000 / pk, yellow 1 1 pkt 874 874 micro tips 100 1000μl, 500 / pk, blue 1 1 pkt 875 875 plastic beaker 500 ml, pvc 1 each 876 876 glass beaker, cap. 500ml 1 each 877 877 sterile disposable petri plates* polystyrene, optically clear 1 1 pkt 878 878 size : 100 mm diameter x 15 mm, individually packed. 1 1 pkt 879 879 labolene neutral ph ( soap solution ) , for glassware washing 1 1 bottle 880 880 ph indicator papers full range ( ph 1.0 to 14.0 ) 1 1 pkt 881 881 distill water 1 1 can 882 882 micropipette 100* capacity : 10 to 100 μl 1 each 883 883 micropipette 1000* capacity : 100 to 1000 μl 1 each 884 884 micropipette 10 capacity : 0.5 to 10 μl 1 each 885 885 μpet autoclavable micropipette 8 channel ( 20 200 μl ) 1 each 886 886 disposable masks 1 1 pkt 887 887 bloting paper 1 1 pkt 888 888 filter paper size 12.5cm circule 1 1 pkt 889 889 serological test for typhoid 1 1 pkt 890 890 zn acid fast stains 1 1 kit 891 891 ‘sq’ sulphuric acid 1 1 bottle 892 892 giemsa’s stain 1 1 bottle 893 893 ‘sq’ formaldehyde solution 37 41% w / v 1 1 bottle 894 894 ‘sq’ potassium oxalate monohydrate 1 1 bottle 895 895 ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) 1 1 bottle 896 896 funnels, plain , size 50mm 1 each 897 897 funnels, plain , size 75mm 1 each 898 898 pestle & mortar 1 each 899 899 ‘sq’ acetic acid glacial 1 500 ml 900 900 methylene blue aqueous stain solution 1 500 ml 901 901 staining rods / staining tray / slide tray 1 each 902 902 salmonella polyvalent somatic ( o ) antigen 1 1 kit 903 903 salmonella polyvalent somatic ( h ) antigen 1 1 kit 904 904 test tubes stand, pvc 1 each 905 905 glassware for measuring 1 each 906 906 forceps 5 1 each 907 907 tranport container 1 each...

Medical And Health Services - Rajasthan

21970652 supply of lab and x ray unit consumables and reagents i. organochlorine pesticide mix ab#3 2 organophosphorus pesticide mix. eu formulation 3 pyrethroids mix standards 4 acetonitrile gc grade 5 formic acid gc grade 6 magnesium sulphate ( ar ) 7. sodium chloride for analysis 8. ethanol 9. methanol gc grade 10. bondesi psa bulk sorbent, 40un i i. bondesil ci 18 bulk sorbent 40un 12. anhydrous sodium acetate 13 n hexane gc grade 14. cryo tube s. 0 45um nylon syringe filter ( non sterile ) 16. disposable syringe 2ml 17. gc vial 2ml 18. gc vials caps with septa 2ml i9. capped plastic falcon tube 15ml 20 capped plastic falcon tube 50m1 2 i powder free nitrite hand gloves, white, extra small 22 powder free nitrile hand gloves, white. extra large 23 disposable mask non sterile 24 tissue roll absorbent 25 plastic bottles 100m1 sample collection 26. silica crucibles 70 hr imemo q strip 77 lancet di test tube stand plastic 48 turfs 79 sodium nitroprusidf crystal 80 ammonium chi or ide powder 81 t ammonia soli ition x ray 82 fixer powder premier 22 .51.1t 83 developer premier 22 .5 lit 84 85 x ray film care stream 12x15 111.1w rase x ray film care stream 10x i 2 rlue rase 86 x ray film care stream 8x10 brie basf 87 x ray eli m care stream 12x12 blue rase 88 led no. 0 9 89 led no. l r 90 envelops printed 12•15 91 envelops printed 1092 92 envelops printed 8•10 93 clip 94 x ray 14ali. film rlocke.r 1012 95 x ray half film blocker 8•10 96 intensifying screen rlle base 1012 ecg 97 ecg r01.i 20 mtr•50 mm 98 ecg roll 20 mir.% mm 99 ecg gel....

Sms Medical College - Rajasthan

21954938 supply of chemicals and consumables items i. organochlorine pesticide mix ab#3 2 organophosphorus pesticide mix. eu formulation 3 pyrethroids mix standards 4 acetonitrile gc grade 5 formic acid gc grade 6 magnesium sulphate ( ar ) 7. sodium chloride for analysis 8. ethanol 9. methanol gc grade 10. bondesi psa bulk sorbent, 40un i i. bondesil ci 18 bulk sorbent 40un 12. anhydrous sodium acetate 13 n hexane gc grade 14. cryo tube s. 0 45um nylon syringe filter ( non sterile ) 16. disposable syringe 2ml 17. gc vial 2ml 18. gc vials caps with septa 2ml i9. capped plastic falcon tube 15ml 20 capped plastic falcon tube 50m1 2 i powder free nitrite hand gloves, white, extra small 22 powder free nitrile hand gloves, white. extra large 23 disposable mask non sterile 24 tissue roll absorbent 25 plastic bottles 100m1 sample collection 26. silica crucibles...

State Forensic Science Laboratory - Rajasthan

21547451 tender for rc item 4 supply of consumables for equipments 1 auto sampler vials for hplc ( for thermo fisher scientific instrument ) filling capacity 1.8 ml with compatible caps screw, compatible capsscrew, precast with ptfe / red rubber / white silicone septa 1.002 hplc column rp 18 1.003 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.004 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.005 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.006 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.007 liners for gc split straight liner –no packing 1.008 liners for gc split straight liner –no packing 1.009 liners for gc split less straight liner no packing. 1.01 liners for gc split less straight liner no packing. 1.011 graphite sealing ring for inlet liners 1.012 septa bto ( low bleed silicone for inj. ssl ) compatible with thermo scientific instrument ( gc / ms trace and gc ultra ) 1.013 head space crimp vial 20 ml crimp top set of 125 20 cv 22x75mm 1.014 aluminium caps for 20mm hs vials headspace cap , locquvered with w / high perfsepta 350 a h6 / 281ads 1.015 filament assembly ion trap / dsq ll 1.016 tg 5ms gc col 30x0.25mm 1.017 carbowax column for nucon glc 1.018 se 30 column for nucon glc 1.019 porapac q column for nucon glc 1.02 rubber septum 1.021 cuvette ( quartz make ) 1.022 syringe gas tight 2.5 ml no plgr 1.023 tr 35 gc ms columns for pesticides herbicides drugs, pharmaceuticals 1.024 trace gc column for explosives 1.025 tr 5 ms ( gc ms columns ) 1.026 tr v1 1.027 gc ms column 1.028 gc ms column 1.029 ec 1 1.03 atm 1 1.031 column for hplc 1.032 tr 35 ms gs columns for pesticides herbicides , drugs pharmaceutical 0 25mm idx x30m lx 0.25μm ft 1.033 trace gc column for explosive trace tr 8095 1.034 tr 5 ms ( 30m l x0.25μm ft x 0.25mm ) 1.035 tr vi ( 30m l x 1.4μm ft x 0.25mm ) 1.036 hplc column 1.037 hplc samples vials 1.038 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45um or 0.2um layer 4 membrane filter with 1. diameter 1.039 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.04 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.41 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.42 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.43 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.44 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.45 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.46 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.047 syringe less filter ( mini uni prep ) 1.048 syringe less filter ( mini uni prep ) 1.049 syringe less filter ( mini uni prep ) 1.05 syringe less filter ( mini uni prep ) 1.051 syringe less filter ( mini uni prep ) 1.052 syringe less filter ( mini uni prep ) 1.053 tlc developing tank , rectangular , glass tank with lid 1.054 dual slot tlc developing chamber for 20x20 cm plates 1.055 sigma tlc spray box 1.056 prival spray unit 1.057 tlc sprayer 125 ml 1.058 tlc silica gel 60 f254 aluminum ( 20x20 cm ) 1.059 tlc silica gel 60 f254 aluminum ( 20x10 cm ) 1.06 tlc silica gel 60 f254 glassbaked layer ( 20x20 cm ) 1.061 tlc silica gel 60 f254 glassbaked layer ( 20x10 cm ) 1.062 flask type sprayer 250 ml 1.063 desiccant cartridges 1.064 twin trough chamber for tlc plates 20x20 1.065 twin trough chamber for tlc plates 20x20 1.066 d2 lamp for hptlc 1.067 tungsten lamp for hptlc 1.068 hg vapour for hptlc 1.069 d2 lamp for hplc 1.07 tungsten halogen lamp 1.071 hptlc silica gel 60 glass backed layer 200mm thickenss 10 cm x 10cm 1.072 hptlc silica gel 60 glass backed layer 200 mm thickness 20cm x 20 cm 1.073 hptlc silica gel 60 glass backed layer 200 mm thickness 20cm x 10 cm 1.074 hptlc silica gel 60 f254 glass backed layer 200 mm thickness 20cm x 20 cm 1.075 hptlc silica gel 60 f254 glass backed layer 200 mm thickness 20cm x 10 cm 1.076 hptlc silica gel 60 f254 glass backed layer 200 mm thickness 10cm x 10 cm 1.077 immersion oil for olympus bx 50 microscope [ viscosity 135 mm2 / s, refractive index ne=1.518 ( 230c ) ] 1.078 immersion oil for leica dm 2500 microscope [ viscosity 825 mm2 / s at 230c, optical characteristics ne ( 546, 1 nm ) 1, 5180, iso 8036 ] 1.079 immersion oil for leica dm 2500 microscope [ viscosity 825 mm2 / s at 230c, optical characteristics ne ( 546, 1 nm ) 1, 5180, iso 8036 ] 1.08 immersion oil for microscopy [ viscosity ( 20°c ) 1000 2000 mpa’s , refractive index n=1.515 1.516 ( 200 / d ) ] 1.081 gc hs column ec wax econo cap 1.082 micro litre syringe 1.083 micro litre syringe 1.084 s.s. gas tubing 1.085 a l retaining ring ( front & back ferrule ) for 1 / 8 inches gas tubing 1.086 trace & focus ssl 1.087 trace & focus ssl 1.088 trace & focus ssl 1.089 trace & focus ssl 1.09 o.d.liners graphite ring 1.091 trace / focus 1.092 trace / focus 1.093 trace / focus 1.094 trace ssl 1.095 trace ssl 1.096 trace ssl 1.097 split / split less bto 1.098 packed bto 1.099 large volume sl bto 1.1 transfer line o ring 1.101 vacuum pump oil 1.102 whatmann filter paper 1.103 whatmann filter paper 1.104 whatmann filter paper 1.105 stainless steel filter holder 1.106 stainless steel filter holder 1.107 ss die set for kbr pellet formation 1.108 deuterium lamp for uv 1.109 tungusten lamp for uv 1.110 budget priced brushes 1.111 burette brush...

Defence Research And Development Organisation - Rajasthan

20671320 supply of plasticwares=> open tender: 48 stopcock, pp / ptfe, 3 way ( 6 no per pack ) 49 nylone syringe filters non sterile dia 25 mm, 0.2μm ( 100 no per pack ) 50 nylone syringe filters non sterile dia 25 mm, 0.45μm ( 100 no per pack ) 51 pipette controller cap. 0.1ml to 100 ml piettes 52 pvdf syringe filters non sterile, dia 25 mm 0.2 μm ( 100 no. per pack ) 53 pvdf syringe filters non sterile, dia 25 mm 0.45 μm ( 100 no. per pack ) 54 ptfe syringe filters non sterile, dia 25 mm 0.2 μm ( 100 no. per pack ) 55 macro tip, pp autoclavable tip 10ml ( 100 no. per pack ) 56 pipette stand, pmma, place 5 ( 1 no per pack ) 57 traceable four channel alarm timer, timing capacity 99 hours 59 minutes 59 seconds accuracy 0.01% ( 1 no per pack ) 58 single channel variable volume pipette, finnpipette, f 3 capacity 100 1000 μl, increment 1.0 μl 59 single channel variable volume pipette, finnpipette, f 3 capacity 1 10 ml, increment 0.02 ml 60 single channel variable volume pipette, finnpipette, f 1 capacity 1 10 μl, increment 0.02 μl 61 single channel variable volume pipette, finnpipette, f 1 capacity 10 100 μl, increment 0.2 μl 62 hand operated vacuum pump, 15cc / stroke pumping rate and 7 psig pressure at the exhaust port 63 parafilm ( lab self sealing film ) , 4 inch ( h ) x 125 feet ( l ) 64 parafilm dispenser 65 petriseal, [ roll size 0.5 inch ( h ) x 108 inch ( l ) , ( 30 roll per pack ) ] 66 hand protector grip 67 lint free wipes 11x21 cm ( 280 no. per pack ) 68 nitrile gloves, large ( 100 no. per pack ) 69 gloves dispenser, acrylic 70 centrifugal tube conical bottom, sterile, blue cap, dia 29.2 mm, 116mm, ( 500 no. per pack ) 71 centrifugal tube box, pp, 16 ( 4x4 array ) 147 x 147 x 126 ( 4 no per pack ) 72 carboy with stopcock, pp confirming to usp class vi autoclavable, cap 25 lit 73 pipette filling device lightweight and uv resistant with lithium battery and spare filter 74 low retention tips, pp confirming to usp class vi, cap. 10 μl ( 1000 no. per pack ) ...

Defence Research And Development Organisation - Rajasthan

17949341 supply of plastic wares : 42. safety face shield with polycarbonate window ( 1 no per pack ) l.lsnapper clamp, acetal ( set of 24 pull cord switch per pack i 44. sample bags , ldpe, 6”x13” ( 100 nos per pack ) 45. cage bodies, pc confirming to us fire detection and alarm 21 cfr autodavable, 43x27x15 cm ( 6 no per pack ) 46. safety goggles, pvc, flexible ( 2 no per pack ) 47.stopcock, pp / ptfe, 2 way ( 6 no per pack ) 48. stopcock, pp / ptfe, 3 way ( 6 no per pack ) nylone syringe filters non sterile dia 25mm, 0.2 pm_ ( 100 no per pack ) 50. nylorie syringe filters non sterile dia 25mm, _0.45 pm ( 100 no per pack ) li1pettec9!1t!pr cap. 0.lml to 100 ml pipettes l 52. 1 pvdf syringe filters non sterile, dia 25mm 0.2 irn ( 100 no per pack ) pvdf syringe filters non sterile, dia 25mm_0.45_pm ( 100 no per pack ) , dia 25mm 0.2 pm ( 100 no per pack ) 5. macro tip, pp , autoclavable tip lomi ( 100 no. per pack ) t 56. pipettor stand ppm ma, place s ( 1 no per pack ) 57. traceable four channel alarm timer , timing capacity 99 hours 59 minutes 59 seconds accuracy r 0.o1% ( l no per pack ) 58. 59. single channel variable volume pipette , finnpi pette, f 3 capacity 100 1000 p1, increment 1.0 p1 sinle channel_variable volume pipette , finnpipette, f 3 capacity i 10 ml, increment0.02m! single channel variable volume pipette , f1nnpipette, f i capacity 1 10 p1, increment 0.02l single_channel_variable_volume pipette , finnpipette, f i capacity 10 100 p1, increment 0.2 p1 61. 62. 1 hand operated vacuum pump, lscc / stroke pumping rate and 7 psig pressure at the exhaust port 63. 1 paraflim ( lab self sealing film ) , 4inch ( h ) xi25feet ( lj_ 64. vrafilm dispenser 165.jpetriseal! [ ro!l size 0.5 tnch ( h ) xlo8inch ( l ) j, ( 30 rol! per pack ) .—.“ 67. lint free wipes 11x21 cm ( 280 no per packj 69. i gloves dispenser, acrylic 70. centrifugal tube conical bottom , sterile. blue cap, dia 29.2mm, 116mm, _...

Sms Medical College - Rajasthan

16994427 supply of surgical/disposable and consumable items 117 umblical canula/catheter (polyurethan) no. 2.5, 3.5, 4, 5, 6, 7, 8 118 ureteral catheter 119 p.d. catheter pp fr12 with open tip & 32 lateral eyes supplied with stainless steel trochar, blunt type withclip to identify the length of 120 p.d. catheter set adult 121 p.d. catheter set child 122 p.d. catheter set infant 123 p.d. transfusion set 124 disposable surgeon’s cap 125 disposable surgeon’s face mask 126 closed wound suction unit no. 6,8 127 closed wound suction unit no. 10,12 128 closed wound suction unit no. 14,16,18 129 d.j. stent no. 3f 16cm 130 d.j. stent no. 3.5f 16cm 131 d.j. stent no. 3.5f 25cm 132 d.j. stent no. 4f 16cm 133 d.j. stent no. 4.5 134 v.p. shunt lp/mp/hp 135 under water seal drainage system 136 abdominal drainage kit no. 16,18, 20,22 & 24 137 stominal closed/drainable pouch 25 50 mm 138 colostomy drainage bag 139 colostomy bag tail clip 140 epidural needle no. 16, 18, 19 , 20, 24 141 epidural catheter no. 16, 18, 19, 20, 24 142 epidural kit containing lor syringe , filter, catheter needle no. 16 epidural kit containing 143 lor syringe , filter, catheter needle no. 18 144 epidural kit containing lor syringe , filter, catheter needle no. 19 145 epidural kit containing lor syringe , filter, catheter needle no. 20 146 epidural kit containing lor syringe , filter, catheter needle no. 22 147 suprapubic catheter no. 10, 12, 14, 16 148 anatomical face mask...

Government Medical College - Rajasthan

16462888 rate contract for consumables and reagents for mdru laboratory, 1 qiaamp minelute ccf dna kit 2 all protect tissue reagent 3 rneasy mini kit ( 50 ) 4 standard control human genomic dna ( probe ) working at universal cycling condition 5 oligonucleotide ( primers ) 6 quanti nova syber green pcr kit ( 100 ) 7 xiap monoclonal abs 8 iap1 monoclonal abs 9 iap2 monoclonal abs 10 arts monoclonal abs 11 quantinova reverse trancription kit ( 50 ) 12 tgf alpha 13 il 6 14 acetonitrile, 100 %, hplc grade 15 perchloric acid , hplc grade ( 2.5 litres ) 16 methanol , hplc grade ( 2.5 litres ) 17 anhydrous potassium dihydrogen o – phosphate 18 0.44μ nylon membranefilters ( 47 mm ) for hplc 19 whatman gd / ( pvdf ) 20 x syringe filters ( pvdf ) 21 nalgene membrane forceps ( 1 each ) 22 20888 hamilton hplc syringe with blunt tip ( 100 μl ) ( for sample loading ) 23 m3g ( 5grms ) 24 m6g ( 5grms ) 25 beta endorphin 26 biobasic scx 5um 10*2.1 mmjavelin gurds 4 / pk 27 biobasic scx 5um 150*2.1mm column 28 spme cartridges ( 100mg / 1ml sola tube 100pk 29 mtt 30 srb dye 31 rpmi 1640 with l glutamine 32 dimethyl sulfoxide 33 trichloroacetic acid 34 trizma base 35 propidium iodide 36 phosphate buffer saline 37 rnase a 38 acetic acid 39 triton x 100 40 96 well plates 41 6 well plates 42 culture flasks ( 25 cm2 ) 43 tips 10 μl 44 tips 100 μl 45 tips 1000 μl 46 aerosol free filter tips 10 μl 47 aerosol free filter tips 100 μl 48 aerosol free filter tips 1000 μl 49 gloves nitrile medium 50 tissue roll 51 discard poly small 52 1.5 ml centrifuge tubes 53 absolute alcohol 54 sodium hypochlorite 10% 55 aluminium foil 56 parafilm 57 ecoshield 58 15 ml falcons 59 50 ml falcons 60 markers 61 labels 62 hand sanitizer 63 ziplocks 64 pcr tube rack 65 pcr tube 0.2 66 pcr tube 0.5 ml 67 dna ladder 100bp 68 chloroform 500ml 69 nuclease free water 500ml 70 gowns...

State Forensic Science Laboratory - Rajasthan

16445486 supply of consumables for equipments 1.037 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.038 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.039 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.040 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.041 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.042 syringe less filter ( mini uni prep ) 1.043 syringe less filter ( mini uni prep ) 1.044 syringe less filter ( mini uni prep ) 1.045 syringe less filter ( mini uni prep ) 1.046 syringe less filter ( mini uni prep ) 1.047 syringe less filter ( mini uni prep ) 1.048 tlc developing tank , rectangular , glass tank with lid...

State Forensic Science Laboratory - Rajasthan

16445483 supply of consumables for equipments 1.031 hplc colmn 1.032 hplc samples vials 1.033 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45um or 0.2um layer 4 membrane filter with 1. diameter 1.034 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.035 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.036 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter...

State Forensic Science Laboratory - Rajasthan

11320808 supply of item no. 4 consumables for equipments ( 1 item no. 4: consumables for equipments list 1.01 auto sampler vials for hplc ( for thermo fisher scientific instrument ) filling capacity 1.8 ml with compatible caps screw, compatible caps screw, precast with ptfe / red rubber / white silicone septa. 1.02 hplc column rp 18 1.03 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.04 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.05 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.06 syringe for gc ms for manual injection on spilt and splitless injectors / liners 1.07 liners for gc split straight liner –no packing 1.08 liners for gc split straight liner –no packing 1.09 liners for gc split less straight liner no packing. 1.10 liners for gc split less straight liner no packing. 1.11 graphite sealing ring for inlet liners 1.12 septa bto ( low bleed silicone for inj. ssl ) compatible with thermo scientific instrument ( gc / ms trace and gc ultra ) 1.13 head space crimp vial 20 ml crimp top set of 125 20 cv 22x75mm 1.14 aluminium caps for 20mm hs vials headspace cap , locquvered with w / high perfsepta 350 a h6 / 281ads 1.15 filament assembly ion trap / dsq ll 1.16 tg 5ms gc col 30x0.25mm 1.17 syringe gas tight 2.5 ml no plgr 1.18 tr 35 ms –gc columns for pesticides herbicides drugs, pharmaceuticals 1.19 trace gc column for explosives 1.20 tr 5 ms 1.21 tr v1 1.22 gc ms column 1.23 gc ms column 1.24 ec 1 1.25 atm 1 1.26 column for hplc 1.27 tr 35 ms gs columns for pesticides herbicides , drugs pharmaceutical 0 25mm idx x30m lx 0.25μm ft 1.28 trace gc column for explosive trace tr 8095 1.29 tr 5 ms ( 30m l x0.25μm ft x 0.25mm ) 1.30 tr vi ( 30m l x 1.4μm ft x 0.25mm ) 1.31 hplc colmn 1.32 hplc samples vials 1.33 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45um or 0.2um layer 4 membrane filter with 1. diameter 1.34 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.35 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.36 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.37 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.38 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.39 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.40 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.41 gd / x syringe filters ( for three layer pre filter ) for high particulate loaded sample for hplc sample preparation , uv analysis layer 4 membrane filter having filter down to 0.45μm or 0.2μm layer 4 membrane filter with 1. diameter 1.42 syringe less filter ( mini uni prep ) 1.43 syringe less filter ( mini uni prep ) 1.44 syringe less filter ( mini uni prep ) 1.45 syringe less filter ( mini uni prep ) 1.46 syringe less filter ( mini uni prep ) 1.47 syringe less filter ( mini uni prep ) 1.48 tlc developing tank , rectangular , glass tank with lid 1.49 dual slot tlc developing chamber for 20x20 cm plates 1.50 sigma tlc spray box 1.51 prival spray unit 1.52 tlc sprayer 125 ml 1.53 flask type sprayer 250 ml 1.54 desiccant cartridges 1.55 twin trough chamber for tlc plates 20x20 1.56 twin trough chamber for tlc plates 20x20 1.57 d2 lamp for hptlc 1.58 tungsten lamp for hptlc 1.59 hg vapour for hptlc 1.60 d2 lamp for hplc 1.61 tungsten halogen lamp )...