Rajasthan State Food And Civil Supplies Corporation Limited - Rajasthan

34175628 for supply of stationary and grocery / housekeeping items at rsfcsc hq jaipur photocopier paper a4 photocopier paper legal _.._ slip pad 20 page ..... slip pad no 33 file pad .___ reynolds ball pen ( blue ) reynolds ball pen ( black ) .:7a 8 reynolds ball pen ( red ) uni ball pen r: 10 scale plastic 30cm hp 11 kangaroo stapler no 12 kangaroo stapler nolo l13 pendrive32gb 14 pendrive64gb 15 stamp pad 16 envelop kraft 9 4f 17 envelop kraft 11*5 18 envelop cloth 9*12 19 20 envelop cloth 15*12 gum bottles ( 70oml ) kangaroo staple pin n, 22 kangaroo_staple pin 2 23.! peon book 160 page 24 glue stick kores m n m n __ 2s sticky pad 26 plastic folder a4 27 plastic folder_legal 28 plastic folder bag 29 hp marker 30 permanent marker 31 hiliter 32 natraj eraser 33 log book 16o page 34 kangaroo scissor 116, kangaroo scissor 118 allpi in kangaroo punching machine 280 kangaroo punching machine 5oo basta cloth paper cutter apsara steno pencil register 43 file cover 44unotesheet pad jouster white file lace fiie tag 48 dispatch re8ister 49 recipt register 50 cello tape big 51 packing_tape 2 inch 52 t dak pad 53 file flags, 54 attendance register 55 pay posting register 56 binder clips ( small ) 57 binder clips ( big ) , sugar cubes milk powder ( 1 kg ) nescafe coffee ( 100 gm ) taj mehal tea bags girnar detox green tea good day biscuits monacco biscuits marie gold biscuits bikaji namkeen room freshner dettol handwash white towel ( big bath size ) white towel ( small ) colin, phenyle bottles ( 5 ltr ) ( quarterly ) napthelene balls harpic toilet cleaner broom_ car perfume vim bar anticeptic soaps tissue napkins wiper toilet brush surf ( big packet ) ....

Sarva Shiksha Abhiyan Authority - Rajasthan

34175203 supply of vocational lab tourism and hospitalipy lab equipments and tools vocational lab tourism and hospitalipy lab equipments and tools , food & beverage service trainee , tables tables with wood plank laminated table top and base of steel 1. wooden table of size 24x 24 for two persons 1. wooden table of size 36x36 with sitting capacity of 4 persons 1. round table with size 44 with sitting capacity of 4 to 6 persons , dining chairs type of seat wood, material of frame: ms powder coated, chair height : 900 mm, backrest width: 400 mm, width of seat : 450 mm, depth of seat 450 mm, height of seat: 450 mm, seat finish mica , side station wooden side station: usually consists of a set of cabinets, or cupboards, and one or more drawers, all topped by a flat display surface for conveniently holding food, serving dishes, and even lighting devices. the overall height of the tops of most sideboards is approximately waist level. approx dimensionheight 42, width 48, depth 24 , bar counter ( front and back bar ) wooden bar counter with mirror ( as per image ) counter: granite top, finishing: shinny polished, design: modular, led lights: yes height of back bar 2260 mm, length of back bar 2600 mm, depth of back bar 350 mm. height of counter 1095 mm, length of counter 2615 mm, depth of counter 590 mm , hostess desk material: melamine / medium density fiber board ) mdf wood, thickness: 18mm , 4 hidden rolling casters, adjustable shelf 3, colour maple, brown, top surface width x depth : 22.5 x 15.8, overall width x height x depth : 22.5 x 45.8 x 16.6, shelf width x depth 22.5 x 15.8 , storage cabinet this stainless steel cupboard used in restaurentssize: 1000x500x1800 , computer core i3, 10th gen., 3.9 ghz, 4gb ram, 1tb hdd, dvd, usb drives, speakers, keyboard, mouse, operating system win10, 3 year onsite warranty , dinner plate 11 material of the plate: bone china, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 280, overall thickness of plate ( mm ) 2, product type: dinner plate, weight: 70 330 gm , dessert plate 9 material of the plate: bone china, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 230, overall thickness of plate ( mm ) 2, product type: dinner plate, size: 9 inch, weight: 70 gm 330 gm , b&b plate material of the plate : bone china, diameter of plate ( mm ) : 100, colour: white, pattern: plain, measurement : 15 cms in diameter , tea cup material ceramic, artistic design, pattern machine crafted, capacity 200 ml , tea saucer usage: serving tea, material ceramic, size 146 mm , soup bowl shape round, colour multi, material of the bowls bone china, length of bowl 120 ( mm ) , width of bowl 120 ( mm ) , height of bowl 55 ( mm ) , capacity of bowl 300 ( mm ) , weight of bowl 180 , soup bowl 4.5 chinese colour musk, size 4.5 inch, capacity 250 ml, shape round, material melamine, pattern plain , soup spoon chinese material: melamine , size ( mm ) : 16 x 4 x 1.2 , colour: white spoon with a short, thick handle extending directly from a deep, flat bowl. , service bowl 1 port 6 shape: square bowl, material: microwave safe plastic, size mm ( l*b*h ) : 110*110*50, capacity 125 ml , service bowl 2 port 7 shape: round bowl, material: microwave safe plastic, size mm ( l*b*h ) : 50*30*30, capacity 125 ml , service platter 1 port 10 material ceramic, edge type : rolled edge, microwave, colour white , service platter 2 port 12 material ceramic, edge type : rolled edge, microwave, colour white , pasta plate 11 material: ceramic, colour red, yellow, blue and white , cereal bowl capacity : 1.00 ltr, colour red, green, blue, white, yellow, brown , chutney bowl small shape: round bowl, colour: yellow, material of the bowls melamine plastic, length of bowl ( mm ) 70, width of bowl ( mm ) 70, height of bowl ( mm ) 60, capacity of bowl ( ml ) 75 , tea spoon material: stainless steel, type: tea spoon ( small ) , size: 18 / 8, 18 / 10 and 18 / 0, colour: steel grey , dessert ( a.p ) spoon material: stainless steel, colour: silver, finish: mirror , dessert ( a.p ) fork finish: chrome finish, weight: 50 gm, size: 10 12 cm material: stainless steel fork type: desert fork , soup spoon with bowl size: 10inch, colour white, material ceramic , dessert knife material: stainless steel colour: silver, size: 2.00mm , table service spoon thickness: 2mm, size: 5 7 inch ( length ) , material: stainless steel, finish type: mirror polish , table service fork material stainless steel, finishing polished, size: 178.6 mm, weight: 5.47 gm , tea strainer material of strainer stainless steel, diameter of stainless steel wire in mesh ( mm ) 0.24, strainer mesh aperture ( micron ) 700 , tea set cup: 6 pcs, saucer: 6 pcs , teapot 1 , milk pot 1 , sugar pot 1 , water jug capacity ( ml ) 2200: wall thickness of jug ( mm ) 1.3 mm, material of jug: food grade plastic food , material of lid: grade plastic, shape round cylindrical, capacity ( ml ) 2200 , salt and pepper set material: stainless steel, colour: any, packaging type: box, shape: round, height: 5 8 inch , tooth pick holder material: stainless steel, colour any, size: 4, 5 inches , straw holder material: stainless steel, colour: any, height: 105 mm , sugar sachet holder material: stainless steel, dimension: 5.1 x 2.4 x 1.5 inches, colour: silver, shape: square, finishing ceramic finish , napkin holder material: stainless steel, size: 16cm.x11cm.x4cm., colour silver, material brass, finishing powder coating , finger bowl large with under liner material: metal, size ( cm ) : 20 / 22 / 24 / 26 / 28 / 30 , finishing: polished , entree dish round with lid ( 1 portion ) shape round, capacity 450 ml, finishing chrome , entree dish round with lid ( 2 portion ) shape round, capacity 500 ml, finishing chrome , oval platter material stainless steel, product depth 24, product width 16, product height 1.50, style minimalist, modern , reserved stainless steel reserved table sign, booked stand reserve seats for guests , round service tray material metal, size: 12, 14, 16 inches, finish nickle plated, pattern plain, , rectangular service tray material: aluminium, size: 12 * 6, depth 2.5 cm, weight: 200 250 grams, surface finish: matt , ash tray material wooden, shape square, type smokeless, colour: brown & golden, size / dimension: 10 x 10 x 4 cm , tom collins ( glass ) capacity: 250 300 ml, material: glass, microwave safe: yes, thickness: 2 7 mm, shape: cylindrical , hi ball material: polycarbonate, capacity: 240 270 ml, colour: clear , pilsner material: glass, head shape: round, size: 300ml, thickness: 4 10 mm, colour: transparent, , decanter small capacity: 50, 100 ml, material: glass, colour : transparent, , decanter large capacity: 150 ml, material: glass, colour : transparent, , wine glass size: standard, colour: transparent, material: borosil glass , table cloths material: cotton, colour: white and blue, size: 54 x 54 inch , table napkins table cotton cloth napkins, specification 60*60 cm. , bar tool kit material: stainless steel, finish: graphite , cocktail shaker material: stainless steel with copper plating, size: 1 l, colour silver, dimension ( inches ) : 4.70 , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., microporous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Department Of Medical Education - Rajasthan

34173859 supply of rate contract for medicine for mndy supply of rate contract for medicine for mndy , laying and jointing pvc pipe. heading , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , liposomol amphotericine injection b 50mg , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mggel , crotamiton 10% + hydrocortisone 0.25% cream , methotrexate gel 1% , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , beclomethasone dipropionate0.064%+ salycylic acid 3% lotion , methoxsalen 1% lotion. each ml contain methoxsalen 1% , deca peptide 6 mg lotion. each ml contain deca peptide 6 mg , minocycline 50mg , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , trichloroacetic acid ( tca ) 50% w / v lotion , inj.hylan g f 20 , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains:ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine100 mg , cojugated estrogen 0.3 mg tab.each tablet contain 0.3 mg cojugated estrogen , telmisartan40mg + hydroclorothiazide12.5 mg, i.p.each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, , telmisartan80mg + hydroclorothiazide25 mg, i.p.each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, , mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg , combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . , dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg , tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg& lamivudine300 mg , efavirenz 600 each film coated tablet contain efavirenz 600 mg , nevirapine 200 each tablet contain nevirapine 200mg , atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg , tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg , abacavir300 eachtablet contain abacavir 300mg ip , lamivudine 100 eachtablet contain lamivudine 100 mg , raltegravir 400each film coated tablet contain raltegravir 400 mg , zideovudine 60+ lamivudine 30 , ultrasound contrast agent ( sulphur hexafluoride ) sonovue , contrast for ct scan / ivp / special investigations , iopamidol ct contrast solution for injectiuon , iopamidol ct contrast solution for injectiuon , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate paste ) , oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) , oral contrast forct ( diatrozoate sodium & diatrozoate meglumine ) , iopromide ct contrast usfda / ce approved , iopromide ct contrast usfda / ce approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iotrolon ct contrastusfda / ce approved , iotrolon ct contrast usfda / ce approved , venlafaxime tab. , olanzapineinj. , flupentixol inj. , memantine tab. , glycopyrrolate tab. , pramipexole tab. , pramipexole tab. , pramipexole tab. , inj. propofol mct / lct with oleic acid inj.iv , inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag , nalbuphine inj. , chlorprocaine inj , desflurane, 100ml , gelofusion infusion , albumin 5% infusion , inj.0.9% normal saline500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 1000 ml in100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate1000 ml in 100% biodegradablenon dehp double sterilized polyolefin closed system bag , inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed systempolyolefin 500 ml bag , inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin , inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag , nifedipine sublingual , nifedipine sublingual , papaverine inj. , nicardipine tab. , topical heparin solution 1000iu / ml , anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicumanti toxin 5000 iu ) , basiliximab 20 mg inj , betamethasone and neomycin cream ( 0.10%+0.5% ) , solution silver nitrate 2% , solution silver nitrate 5% , solution silver nitrate 10% , alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) , ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v , ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) , nasal drops haemcoagulase topical solutioneach ml contain aqueous solution of haemocoagluase 0.2 cu , triamcinolone oromucosal paste bp 0.1% w / w , ethiodized oil ( lipiodol ) inj. , htk solution1 lit ( histidine tryptophan ketoglutarate solution ) , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life factor viii , glycopegylated extended half life factor viii , tenofovir alafenamidefumerate ( taf ) 25 mgtab. / cap , entecavir 1mg tab. / cap film coated , dacalatasvir 30 mgtab. / cap , dacalatasvir 60 mgtab. / cap , sofosbuvir 400 mg tab. / cap , ribavirin 200 mg tab. / cap film coated , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007 ml 30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 mg , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab 400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab 1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds 20% , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine 1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab 100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75 iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab 150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension 5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , susp. azithromycin oral suspension 100mg / 5ml , susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 10mg + finofib 60mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride...

Sarva Shiksha Abhiyan Authority - Rajasthan

34173752 supply of food and beverage service trainee laboratory food and beverage service trainee laboratory , food & beverage service trainee , tables tables with wood plank laminated table top and base of steel 1. wooden table of size 24x 24 for two persons 1. wooden table of size 36x36 with sitting capacity of 4 persons 1. round table with size 44 with sitting capacity of 4 to 6 persons , dining chairs type of seat wood, material of frame: ms powder coated, chair height : 900 mm, backrest width: 400 mm, width of seat : 450 mm, depth of seat 450 mm, height of seat: 450 mm, seat finish mica , side station wooden side station: usually consists of a set of cabinets, or cupboards, and one or more drawers, all topped by a flat display surface for conveniently holding food, serving dishes, and even lighting devices. the overall height of the tops of most sideboards is approximately waist level. approx dimensionheight 42, width 48, depth 24 , bar counter ( front and back bar ) wooden bar counter with mirror ( as per image ) counter: granite top, finishing: shinny polished, design: modular, led lights: yes height of back bar 2260 mm, length of back bar 2600 mm, depth of back bar 350 mm. height of counter 1095 mm, length of counter 2615 mm, depth of counter 590 mm , hostess desk material: melamine / medium density fiber board ) mdf wood, thickness: 18mm , 4 hidden rolling casters, adjustable shelf 3, colour maple, brown, top surface width x depth : 22.5 x 15.8, overall width x height x depth : 22.5 x 45.8 x 16.6, shelf width x depth 22.5 x 15.8 , storage cabinet this stainless steel cupboard used in restaurentssize: 1000x500x1800 , computer core i3, 10th gen., 3.9 ghz, 4gb ram, 1tb hdd, dvd, usb drives, speakers, keyboard, mouse, operating system win10, 3 year onsite warranty , dinner plate 11 material of the plate: bone china, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 280, overall thickness of plate ( mm ) 2, product type: dinner plate, weight: 70 330 gm , dessert plate 9 material of the plate: bone china, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 230, overall thickness of plate ( mm ) 2, product type: dinner plate, size: 9 inch, weight: 70 gm 330 gm , b&b plate material of the plate : bone china, diameter of plate ( mm ) : 100, colour: white, pattern: plain, measurement : 15 cms in diameter , tea cup material ceramic, artistic design, pattern machine crafted, capacity 200 ml , tea saucer usage: serving tea, material ceramic, size 146 mm , soup bowl shape round, colour multi, material of the bowls bone china, length of bowl 120 ( mm ) , width of bowl 120 ( mm ) , height of bowl 55 ( mm ) , capacity of bowl 300 ( mm ) , weight of bowl 180 , soup bowl 4.5 chinese colour musk, size 4.5 inch, capacity 250 ml, shape round, material melamine, pattern plain , soup spoon chinese material: melamine , size ( mm ) : 16 x 4 x 1.2 , colour: white spoon with a short, thick handle extending directly from a deep, flat bowl. , service bowl 1 port 6 shape: square bowl, material: microwave safe plastic, size mm ( l*b*h ) : 110*110*50, capacity 125 ml , service bowl 2 port 7 shape: round bowl, material: microwave safe plastic, size mm ( l*b*h ) : 50*30*30, capacity 125 ml , service platter 1 port 10 material ceramic, edge type : rolled edge, microwave, colour white , service platter 2 port 12 material ceramic, edge type : rolled edge, microwave, colour white , pasta plate 11 material: ceramic, colour red, yellow, blue and white , cereal bowl capacity : 1.00 ltr, colour red, green, blue, white, yellow, brown , chutney bowl small shape: round bowl, colour: yellow, material of the bowls melamine plastic, length of bowl ( mm ) 70, width of bowl ( mm ) 70, height of bowl ( mm ) 60, capacity of bowl ( ml ) 75 , tea spoon material: stainless steel, type: tea spoon ( small ) , size: 18 / 8, 18 / 10 and 18 / 0, colour: steel grey , dessert ( a.p ) spoon material: stainless steel, colour: silver, finish: mirror , dessert ( a.p ) fork finish: chrome finish, weight: 50 gm, size: 10 12 cm material: stainless steel fork type: desert fork , soup spoon with bowl size: 10inch, colour white, material ceramic , dessert knife material: stainless steel colour: silver, size: 2.00mm , table service spoon thickness: 2mm, size: 5 7 inch ( length ) , material: stainless steel, finish type: mirror polish , table service fork material stainless steel, finishing polished, size: 178.6 mm, weight: 5.47 gm , tea strainer material of strainer stainless steel, diameter of stainless steel wire in mesh ( mm ) 0.24, strainer mesh aperture ( micron ) 700 , tea set cup: 6 pcs, saucer: 6 pcs , teapot 1 , milk pot 1 , sugar pot 1 , water jug capacity ( ml ) 2200: wall thickness of jug ( mm ) 1.3 mm, material of jug: food grade plastic food , material of lid: grade plastic, shape round cylindrical, capacity ( ml ) 2200 , salt and pepper set material: stainless steel, colour: any, packaging type: box, shape: round, height: 5 8 inch , tooth pick holder material: stainless steel, colour any, size: 4, 5 inches , straw holder material: stainless steel, colour: any, height: 105 mm , sugar sachet holder material: stainless steel, dimension: 5.1 x 2.4 x 1.5 inches, colour: silver, shape: square, finishing ceramic finish , napkin holder material: stainless steel, size: 16cm.x11cm.x4cm., colour silver, material brass, finishing powder coating , finger bowl large with under liner material: metal, size ( cm ) : 20 / 22 / 24 / 26 / 28 / 30 , finishing: polished , entree dish round with lid ( 1 portion ) shape round, capacity 450 ml, finishing chrome , entree dish round with lid ( 2 portion ) shape round, capacity 500 ml, finishing chrome , oval platter material stainless steel, product depth 24, product width 16, product height 1.50, style minimalist, modern , reserved stainless steel reserved table sign, booked stand reserve seats for guests , round service tray material metal, size: 12, 14, 16 inches, finish nickle plated, pattern plain, , rectangular service tray material: aluminium, size: 12 * 6, depth 2.5 cm, weight: 200 250 grams, surface finish: matt , ash tray material wooden, shape square, type smokeless, colour: brown & golden, size / dimension: 10 x 10 x 4 cm , tom collins ( glass ) capacity: 250 300 ml, material: glass, microwave safe: yes, thickness: 2 7 mm, shape: cylindrical , hi ball material: polycarbonate, capacity: 240 270 ml, colour: clear , pilsner material: glass, head shape: round, size: 300ml, thickness: 4 10 mm, colour: transparent, , decanter small capacity: 50, 100 ml, material: glass, colour : transparent, , decanter large capacity: 150 ml, material: glass, colour : transparent, , wine glass size: standard, colour: transparent, material: borosil glass , table cloths material: cotton, colour: white and blue, size: 54 x 54 inch , table napkins table cotton cloth napkins, specification 60*60 cm. , bar tool kit material: stainless steel, finish: graphite , cocktail shaker material: stainless steel with copper plating, size: 1 l, colour silver, dimension ( inches ) : 4.70 , frist aid kit must contains all major first aid accessories: crepe bandage , adhesive bandage, adhesive bandage round, pain relief gel, povidone iodine ointment, oral clinical thermometer, antiseptic liquid, absorbent cotton i.p., microporous surgical tape, paracip / parachoice, gauze swab, roller gauze, a pair of scissors, first aid leaflet sticker...

Rajasthan Tourism Development Corporation Limited - Rajasthan

34172090 tender for replating of epns items 1 butter dish 25 2 coffee pot 2cc 14 3 cruet set 25 4 champagne cooler 2 5 desert fork 100 6 desert knife 100 7 desert spoon 100 8 entre dish 8 9 finger bowl 11 10 ice cream cups 100 11 ice buckets 2 12 ice tongs 4 13 milk pot 2cc 14 14 milk pot 4cc 14 15 menu stand 20 16 ovel platter 19 10 17 oval platter 10 ( rice 8 18 oval platter medium 19 rice plater / salvar 15 20 sugar pot 2 cc 20 21 sugar pot 4cc 25 22 sauce boat 5 23 straw holder 3 24 service fork 5 25 soup spoons 100 26 service spoon 4 27 pastry tangs 4 28 tea pot 4cc 18 29 tea pot 2cc 14 30 tooth pick stand 2 31 tea spoon 100 32 water jug 2 33 peg major....

Department Of Ayurveda - Rajasthan

34170874 supply of ayurvedik medicine i description, colour, odour 2 ph value 3 specific gravity at 25’ c 4 total solids 5 alchohol content ( in % ) 6 test for methanol 7 redueing sugars, 8 9 non reduclng sugars total phenollc content identification by tlcihptlc microbial contamlnation total bacterial count total fungal count 112 test for specifie pathoqeas, ‘i descriptlon, colour, & taste, 2 odour loss on drylng at 105rcg rot& aeh& , ra hnoiuble ash 5 ph value 8 aleohol soluble oxtract!v 7 water ext ctlve b reduclng sugars, 9 non reducing sugars 10 — identification by tlc ( hptlc 11 microbial contamination a total bacterial count b total fungal count 12 test for speciric pathogens 13 test for aflatoxlns 14 test for heavy metals, etc....

Department Of Ayurveda - Rajasthan

34170641 supply of ayurved medicine i descrlptlon, colour, odour 2 ph value 3 specific gravity at 25 c 4 total solids 5 alchohol content tnin % ) 6 test for methanol lregucj, 1y_sugars, 8 non reducing sugars 9 total phenolic content identification by tlcihptlc 10 11 microbial contamination a total bacterial count b total fungal count 12 test for specific pathogens, i i description, colour, & taste, odour 2 loss on drylng at 1osrcg 3 total ash 4 acld insoluble ash 4.o 5 ph value 6 alcohol soluble extractive 7 water soluble extractive 8 reducing sugars, _1 identificntien 2 j loss of drying at 1o5 degree c. 3.jjotai ash 4 pariclersize ( in mesh ) , 5 acid insoluble ash 6 assay of elements 7 water soluble ash, etc....

Public Health Engineering Department - Rajasthan

34166961 parallel annual rate contract for supply of miscellaneous items for office arrangement for wsso and other offices 1 tea of taj mahal / red label / tata or equivalent quality ( 500 gm ) per packet 2 tea of taj mahal / red label / tata or equivalent quality ( 1 kg ) per packet 3 dip tea of taj mahal / tetley or equivalent quality ( 100 tea bags ) per packet 4 coffee powder of nescafe / bru or equivalent quality ( 50 gm ) per packet 5 coffee powder of nescafe / bru or equivalent quality ( 100 gm ) per packet 6 coffee premix for vending machine of nescafe / godrej or equivalent ( 1 kg ) per packet 7 milk powder of nestle / amul or equivalent quality ( 500 gm ) per packet 8 milk powder of nestle / amul or equivalent quality ( 1 kg ) per packet 9 green tea of tetley / lipton / organic india or equivalent quality ( 25 tea bags ) per packet 10 detx tea of girnar or equivalent ( 36 tea bags ) per packet 11 tulsi tea of taj mahal / tetley / lipton or equivalent quality ( 25 tea bags ) per packet 12 lemon tea of tetley / lipton or equivalent quality ( 25 tea bags ) per packet 13 disposable cups for tea / coffee of 100 ml capacity ( pack of 40 ) per packet 14 disposable cups for tea / coffee of 150 ml capacity ( pack of 50 ) per packet 23 15 disposable plate of small size ( pack of 30 ) per packet 16 disposable plate of large size ( pack of 30 ) per packet 17 mineral water bottle of bisler / aquafina / kinley or equivalent quality ( 200 ml ) each 18 mineral water bottle of bisler / aquafina / kinley or equivalent quality ( 250 ml ) each 19 mineral water bottle of bisler / aquafina / kinley or equivalent quality ( 500 ml ) each 20 mineral water bottle of bisler / aquafina / kinley or equivalent quality ( 1 litre ) each 21 mineral water camper ( 20 litre ) of bisleri or equivalent quality excluding the cost of empty camper ( empty camper will be returned by the department ) each 22 electric kettle of 1.5 litres capacity of milton / pigeon / havells or equivalent make each 23 electric kettle of 2 litres capacity of milton / pigeon / havells or equivalent make each 24 plastic bottle of 1 litre capacity of milton / cello or equivalent make each 25 sugar per kg 26 bhujia namkeen of bikaji / haldiram or equivalent quality ( 400 gm ) per packet 27 bhujia namkeen of bikaji / haldiram or equivalent quality ( 1 kg ) per packet 28 mixture namkeen of bikaji / haldiram or equivalent quality ( 400 gm ) per packet 29 mixture namkeen of bikaji / per packet 24 haldiram or equivalent quality ( 1 kg ) 30 biscuits of parle / britannia or equivalent quality ( pack of minimum 10 biscuits ) per packet 31 white sugar cubes ( 700 gm ) per packet 32 tomato soup powder of good quality ( 1 kg ) per packet 33 coffee premix for vending machine of red label / senso or equivalent ( 1 kg ) per packet 34 tea cup and saucer set of bone china goldline ( set of 6 cups and 6 saucers ) per set 35 tea / coffee cup of bone chine goldline ( set of 6 cups ) per set 36 plates of size 7.5 inches of bone china ( set of 6 plates ) per set 37 glass set of 6 glasses ( borosil or equivalent make ) per set 38 plastic coster set of 6 for tea cups per set 39 plastic jug with lid of 1.5 litre capacity each 40 plastic jug with lid of 2 litre capacity each 41 plastic bucket of 15 litre capacity each 42 normal table bell each 43 plastic wireless digital door bell of havells / anchor or equivalent make each 44 thermos ( hot and cold ) of 1 litre capacity of milton / cello or equivalent make each 45 plastic serving tray of size 8x12 inches each 46 room freshner ( minimum 240 ml ) of godrej / ambi pur or equivalent each 47 bathroom air freshner blocks ( 50 gm ) of odonil or equivalent make each 48 glass cleaner spray bottle ( 500 ml ) each 25 of colin or equivalent make 49 glass cleaner spray bottle ( 250 ml ) of colin or equivalent make each 50 soap ( minimum 125 gm ) of dettol / lifebuoy or equivalent make each 51 dish washing bar ( 700 gm ) each 52 face mask ( n 95 ) each 53 surgical face mask ( pack of 50 ) per packet 54 surgical gloves ( pack of 100 ) each 55 hand sanitizer bottle of 50 ml of dettol / lifebuoy or equivalent make each 56 hand sanitizer bottle of 250 ml of dettol / lifebuoy or equivalent make each 57 hand sanitizer bottle of 500 ml of dettol / lifebuoy or equivalent make each 58 plastic open dustbin of 5 litres capacity each 59 mosquito repellant starter pack of all out / good knight or equivalent make ( 1 unit ) each 60 mosquito repellant refill each 61 liquid soap bottle ( 200 ml ) of dettol / lifebuoy or equivalent make each 62 liquid soap refill ( 1.5 litres pack ) of dettol / lifebuoy or equivalent make each 63 floor wiper each 64 table duster each 65 floor duster each 66 long handle no dust broom for floor cleaning each 67 super soft microfiber bath towel of size 60x120 cms each 68 super soft microfiber hand towel of size 40x60 cms each 26 69 coconut water each 70 cardamom ( pack of 100 gm ) ...

Medical And Health Services - Rajasthan

34166615 supply of lab items uric acid kit serum c.r.p kit serum amylase kit serum l.d.h. kit s. ck nac kit s. ck mb kit cholesterol kit seru triglyceride kit 19 20 fidl kit direct and precipitant 130t71 method s. electrolyte kit 21 22 erba wash cleaner micropipetie 0 50m1crolitre, 1 11111e glass 75x 12 witii rim 31 mt ii:1 istix 32 i justin alit, sugar 3? 11:s1 t1.1111: stand plasi ic 34 tim 111111? srand ai 1.1minium 35 tis1 111141, . ( il ass 100x12 mm 36 patter role 1:1 ) 11. eli ci roi n:11: maciiine 37 tes1 11111e with cap 12x75r1m 3k iii .11 it pappi it 39 di avkad marker pi ncil 40 1i55111. papper soef 41 pastel :r pipette 42 glacial. aci tic acid 1% 43 serum lipase kit 44 ggt kit 45 eletroly1e kit flud pack na+ / k , cl• 800ml, item code il 212id daily cleaning solution kit item codien1e 211w 5211 / 411, printer papper roil item code 25410 46 ptiinit stago start 4 machine pt regent neoplaspine papper rim i x10 ( 110 mm ) cuve1te i x100 steel bali. i x100 47 swine flu 48 micropro } ein 49 isopropyl. alcopial 50 vi stag ( ) 51 coagulation control 52 finntips for start i anti a monoclonal 2 anti b monoclonal 3 anti ab monoclonal 4 anti d igm + igg monoclonal antibody 5 anti h lectin 6 anti al lectin 7 anti human serum ( coombs anti sera ) 8 22% bovine albumin 9 anti d ign1 monoclonal anti body 10 glass slides 11 normal saline malaria card antigen, and antibody 1 dengue card ns 1 3 4 5 6 7 s 9 10 11 12 13 14 15 16 17 18 19 widal slide test card hiv rapid test card vdrl rapid test card rheumatoid factor test card kit aslo kit hbsag rapid card test urine pregnancy test card elisa kit for dengue elisa kit for scrub typhus elisa kit for chickenguniya card for scrub typhous widal test card; kit vtm kit ppe suit face mask dengue combi pack rapid + ns1+igm crp kit 20 ichickenguniya rapid igisdl 21 ibenedicts reagent 22 33% sulfosalicylic acid 23 hydrogen peroxide spirit lamp test tube 4 crp latex agglutination card csf fluid protein kit hand wash liquid vdrl test strip sodium hypochloride 5% giemsa stain reticulocute stain 1111.1 ) stain a field spain ii 5 hematoxyl1n stain 6 eosin stain ____ 7 rapid pap s fain 8 urine container 9 sputum container 10 pasteur pipette ii ed1a via!. k3 12 plain vial vacuutainer double cap 13 pt vial ( na+ citrate ) 14 cotton roll 15 fnac gun 16 1413 cuvette 301 17 semen diluting fluid 18 disposable esr tube 19 capillary tube for bt ct 20 tincture iodine 21 spirit 22 methanol 23 m ) 24 horiba cbc abx 20 liter 25 cleaner i liter 26 lyse i liter 27 m1noclair 500ml 28 black top vial ( e.5.11 ) 29 grey top vial ( gluestinestion ) 30 cbc five part sfri diluint 20 liter • 31 cleaner 10 liter 32 sheath 10 liter 33 lysoglobulin 500ml 34 cover slip for improved neubeaur 35 improved neui3eaur chamber silver . coated 36 test kit for occult blood stool 37 n / i 0 hcl 38 tourniquet 39 slides box 40 glass slide stand 41 microscope lens cleaner 1$ 011. i or olt, immursion !ins stip ( ovia 41 44 . 4, 46 ( oplin ) , 111 „....„.. i m 111111 wilt di i .1 , i ino 11.111 ) 47 riec dii 1 jim, fluid 0 ..... rstri soii i al c1tra1 i. ...._ a 49 iii 11.12 pa iipi.r 50 1% ( ar1101. !.! sciiin 51 25% si il imf ric acid 52 ion wily l i• blue 53 imu ;sill ior 4 i eaning or i i ni• i imic 54 1.1oui1 ) parawn 55 ?vinyl 56 microscopi be 1 b 20m, 57 nisrosam i. nt edle .14.16.18.20 22 no 5s u.s1 ri1nt i 5n11. 59 d.s1 1211nici leivil 60 d.svri1n..i 21, n1l 61 gloves ( .5 62 gloves 7 63 gloves 7.5 64 tec solution 65 paper for h13 test 65 ili% sodium hypoci lome 67 rtaptt kit 68 stop watc11 69 x ylene 70 non tooth forcep 71 113 mission cuvette strip 72 h3 tube 73 sulphur powder 74 sticker for slides small 75 sticker for tedt tube mediun1 76 marker pen black 77 esr tube glass 78 dpx 79 blood bag 350m1. cpu a 80 blood transfer bag 350 91. 81 hiv test kli tridot 82 bleaciiing powder 83 lit mus paper 84 marker pan ( cd marker ) 85 n 95 disposable mask 86 nickmominuti digital fortemperature recording in reirig1 ( a1010 87 wi1atsman paper for a1.1. size 88 disposable needle no. 14, 16, 18 99 platelet count solution 90 glass mari: i ni; pencil 1 latex agglutination slide test for screening oft gondii 2 enzymatic / fixed 11me kinetic assay for ada determination 3 adenosine deaminase acitivity in serum, plasma biological fluid 4 latex agglutination inhibition slide test for detection of microalbuminaria in urine 5 cystatin c kit 6 plasma d dimer card test kit 7 rapid test hcv test kit 8 rapid test for psa kit 9 rapid test cea kit 10 rapid test afp kit 11 rapid test troponin i 12 logols iodine 13 bouins fixative 14 buffered fomalin 10% 15 hb al, c test kit 16 rh antibody titre 17 h pylori kit 1 latex agglutination slide test for screening of t gondii 2 enzymatic / fixed time kinetic assay for ada determination 3 adenosine deaminase acitivity in serum, plasma biological fluid 4 latex agglutination inhibition slide test for detection of microalbuminaria in urine 5 cystatin c kit 6 plasma d dimer card test kit 7 rapid test hcv test kit 8 rapid test for psa kit 9 rapid test cea kit 10 rapid test afp kit 11 rapid test troponin i 12 logols iodine 13 bouins fixative 14 buffered fomalin 10% 15 hb a1, c test kit 16 rh antibody titre 17 h pylori kit...

Medical And Health Services - Rajasthan

34149457 supply of lab item cbc vial plan vial sodium flu ride vial caiciam vial gimsastaind jsbistaind jsbiistalnd fildstainda fildstalndb 10 methylene blue soution 11 methenol 12 liquid peraffin 13 seman fluid 14 3.8 % sodium citrate 15 glass washing solution 16 s%hypochloride solution 17 all bleach 18 blood group 19 vdrl rapid card 20 hbsag rapid card 21 hcv rapid card, 23 dengue rapid card 24 chlkangunia rapid card 25 scrub typhus rapid card 26 cover slip 27 sample cup 1 / y2 inch ( fully automatic biochemistry 28 aliquit 29 blue tips 30 yellow tips 31 capillary tube 32 droper 33 glassmpslide 34 urine strip 2 para 35 sugarstripmutipara 36 tishu pepar roll 37 test tube 12x25 inch 38 test tube 12x100 inch 39 tourniquet with gripbelt 4o urine container — 41 crp, 42 rf 43 aslo 44 widal slide method kit 45 bovine albumine solution 46 esr pipette 47 hemocue hb 301 48 sugar strip ( dr. odin / accu sure soul ) 49 vtm kit 50 niddle disp....

Medical And Health Services - Rajasthan

34133147 chc nimaj invites bid for medicines supply didofenac sod + paracetamol tablets ip didofenac sod 50 mg + paracetamol 325 mg 1483i 2 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetai 325 mg tab [ 498 ] calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin tablets ip ( elemental calcium 500 mg, vitamin d3.250 iu ) ( non chewable ) [ 622 ] ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg [ 22 ] 5 levoceitrizine tablet 5mg [ 659 ] 6 acedofenac and paracetamol tablets acedofenac 100 mg and paracetamol 325 mg [ 492 ] multivitamin tablets nfi formula sugar coated vit a 2500 iu vii b1 2mg vit b6 0.5mg vit c 50mc calcium pantothenate 1 mg vit d3 200iu yd 132 2 mg niadnamide 25mg folic add 0.2 mg [ 394 ] amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg [ 70 ] 9 amoxycillin cap ip 500mg [ 72 ] to cefodme tab ip 200 mg [ 85 ] 11 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) [ 660 ] 12 ciprofloxacin tablet ip 500 mg film coated [ 103 ] 13 ors powder ip [ 274 ] 14 metronidazole tablets ip 400 mg ( film coated ) [ 123 ] 15 theophylline and etoyline tablets ( theophylline ip 23mg + etofylline 77 mg ) [ 375 ] 16 ascorbic acid tab ip 500 mg [ 387 ] • 17 amoxycillin cap ip 250mg [ 71 ] 18 ranitidine tab ip 300mg film coated [ 433 ] 19 azithromycin tab ip 250 mg ( 79 ) 20 cephalexin cap ip 500 mg 197 ) 21 ciprofloxacin tablets ip 250 mg film coated [ 102 ] 22 didofence prolonged release tablet ip 100 mg [ 437 ] 23 methyl cobalmine tablet 1500mcg [ 653 ) 24 didofenac sodium in ] ip 25 mg / ml ( im / iv use ) [ 19 ] 25 cinnarizine tablets ip 25 mg [ 543 ] 26 ampicillin cap ip 500mg 1412 ] 27 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate • mg, and paracetamol 125 mg [ 497 ] 28 bedomethasone, neomycin neomycin and clotrimazole cream ( bedomethasone dipropionate 0.025 %, sulphate 0.5 % and clotrimazole 1 % ) 14451 29 povidone iodine ointment 5% 15 gm 12211 , 22 ceftriaxone inj ip 1g / vial [ 93 ] cefuroxime axetil tab ip 250 mg [ 512 ] gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( detalls in rc [ s5.b ] acebrophylline tablet / capsule 100 mg [ 780 ] 36 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) [ 457 ] 37 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) [ 376 ] etoricoxib tablet ip 90 mg [ 658 ] 1, 1 levofioxacin tablets ip 250 mg [ 5151 0 chlordiazepoxide tablets ip 10mg [ 342 ] 41 dextrose inj ip 5% [ 380 ] 42 metronidazole inj ip 500 mg / 100m1 [ 120 ] 43 domperidone suspension ip 5mg / 5m1 [ 266 ] $4 spironolactone tablets ip 50 mg [ 574 ] is glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) [ 452 ] is acyclovir tab ip 200 mg [ 63 ] a ceftriaxone inj ip 250 mg / vial [ 94 ) a alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) ( 788 ] 9 lisinopril tab ip 5 mg [ 199 ] drotaverine hydrochloride inj 40 mg / 2 ml [ 5 ] cefixime oral suspension ip 25mg / mi ( paediatric drops ) [ 511 ] disposable sterile surgical rubber gloves size 8 inches, powdered ( s89.a ) cefotaxime injection ip 1 g 187 ] disposable sterile surgical rubber gloves size 8 inches, powder free [ 889.b ] amikacin inj ip 250 mg [ 504 ] urine collecting bag, disposable 2000 ml ( details in rc ) [ s40 ] syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) ( 529 ) dextrose inj ip 10% [ 379 ] artemether and leumetantrine tablet ( 60 mg and 480 mg ) [ 651 ] artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1m1 ampoule ) , sodium chloride injection ip 0.9o / w / v ( 5ml ampoule ) [ 508a ] tetanus vaccine ( adsorbed ) ip 5 ml vial [ 310 ] terbinafine hydrochloride tablet 250 mg [ 721 ] 5 surgical spirit ip ( 100 ml ) [ 449 ] 6 tobramydn and dexamethasone ophthalmic suspension usp 0.3 0 / 0 +0.1 o / o [ 330 ] 7 calcium gluconate in ] ip 10% ( iv use ) [ 368 ] a clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) [ 443 ] a diazepam in ] ip 10mg / 2m1 ( 1m / iv use ) [ 349 ] 0 mecobalamin in ] 500 mcg / ml [ 624 ] 1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 2 mm length 76 cm ) size 2 / 0 ( r3 ] 12 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 112 cir rb needle 3 mm length 76 cm ) size 1 / 0 [ r4 ] 73 nebulization mask adult ( detail in rc ) ( 5134 ) 74 noradrenaline injection ip 2 mg / ml [ 554 ] 75 ryles tube / nasogastric tube size: 18 ( details in rc ) [ s24.c ] 76 suction catheter, sterile. size: f g 14 ( details in rc ) [ s8.f ] 77 neomycin. polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp [ 588 ] 78 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% [ 487 ] 79 finasteride tablets ip 5 mg [ 575 ] so fluconazole eye drops 0.3% [ 425 ] in vaccum suction set. 2.5 meter length ( detail in rc ) 181091 82 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cn ( r71 ] 63 endotracheal tube, cuff size 8 ( details in rc ) ( s44.hj 54 offoxacin oral suspension ip ( each 5m1 contains ofloxacin ip 100 mg ) 30 ml size [ 711 ] 35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) [ r33 ] endotracheal tube, cuff size 7 ( details in rc ) ( s44.1 ] atracurium inj 10 mg / ml [ 311 ] umbilical catheter for new born, all sizes ( details in rc ) [ s931 digoxin inj ip 0.25 mg / ml [ 189 ) . non absorbable surgical suture, sterilised needle ( ) black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) ir20 ] ceftazidime inj ip lg [ 89 ] absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm [ r10 ] terbinafine cream 1%whv ( 10 gm tube ) [ 760 ] , etc....

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

34097011 supply of tourism and hospitality tourism and hospitality , tables with wood plank laminated table top and base of steel 1. wooden table of size 24x 24 for two persons 1. round table with size 44 with sitting capacity of 4 to 6 persons , dining chairs type of seat wood, material of frame: ms powder coated, chair height : 900 mm, backrest width: 400 mm, width of seat : 450 mm, depth of seat 450 mm, height of seat: 450 mm, seat finish mica , side station wooden side station: usually consists of a set of cabinets, or cupboards, and one or more drawers, all topped by a flat display surface for conveniently holding food, serving dishes, and even lighting devices. the overall height of the tops of most sideboards is approximately waist level. approx dimensionheight 42, width 48, depth 24 , bar counter ( front and back bar ) wooden bar counter with mirror ( as per image ) counter: granite top, finishing: shinny polished, design: modular, led lights: yes height of back bar 2260 mm, length of back bar 2600 mm, depth of back bar 350 mm. height of counter 1095 mm, length of counter 2615 mm, depth of counter 590 mm , storage cabinet this stainless steel cupboard used in restaurentssize: 1000x500x1800 , dinner plate 11 material of the plate: melamine, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 280, overall thickness of plate ( mm ) 2, product type: dinner plate , dessert plate 9 material of the plate: melamine, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 230, overall thickness of plate ( mm ) 2, product type: dinner plate, size: 9 inch , b&b plate material of the plate : melamine, diameter of plate ( mm ) : 100, colour: white, pattern: plain, measurement : 15 cms in diameter , tea cup material ceramic, artistic design, pattern machine crafted, capacity 200 ml , tea saucer usage: serving tea, material melamine, size 146 mm , soup bowl shape round, colour multi, material of the bowls melamine, length of bowl 120 ( mm ) , width of bowl 120 ( mm ) , height of bowl 55 ( mm ) , capacity of bowl 300 ( mm ) , , soup bowl 4.5 chinese colour musk, size 4.5 inch, capacity 250 ml, shape round, material melamine, pattern plain , soup spoon chinese material: melamine , size ( mm ) : 16 x 4 x 1.2 , colour: white spoon with a short, thick handle extending directly from a deep, flat bowl. , service bowl 1 port 6 shape: square bowl, material: microwave safe plastic, size mm ( l*b*h ) : 110*110*50, capacity 125 ml , service bowl 2 port 7 shape: round bowl, material: microwave safe plastic, size mm ( l*b*h ) : 50*30*30, capacity 125 ml , service platter 1 port 10 service platter 1 port 10 material melamine, edge type : rolled edge, microwave, colour white , service platter 2 port 12 material melamine, edge type : rolled edge, microwave, colour white , pasta plate 11 material: melamine, colour red, yellow, blue and white , cereal bowl capacity : 1.00 ltr, colour red, green, blue, white, yellow, brown , chutney bowl small shape: round bowl, colour: yellow, material of the bowls melamine plastic, length of bowl ( mm ) 70, width of bowl ( mm ) 70, height of bowl ( mm ) 60, capacity of bowl ( ml ) 75 , tea spoon material: stainless steel, type: tea spoon ( small ) , size: 18 / 8, 18 / 10 and 18 / 0, colour: steel grey , dessert ( a.p ) spoon dessert ( a.p ) spoon material: stainless steel, colour: silver, finish: mirror , dessert ( a.p ) fork finish: chrome finish, weight: 50 gm, size: 10 12 cm material: stainless steel fork type: desert fork , size: 10inch, colour white, material melamine , dessert knife material: stainless steel colour: silver, size: 2.00mm , table service spoon thickness: 2mm, size: 5 7 inch ( length ) , material: stainless steel, finish type: mirror polish , table service fork material stainless steel, finishing polished, size: 178.6 mm, weight: 5.47 gm , tea strainer material of strainer stainless steel, diameter of stainless steel wire in mesh ( mm ) 0.24, strainer mesh aperture ( micron ) 700 , tea set cup: 6 pcs, saucer: 6 pcs , teapot 1 , milk pot 1 , sugar pot 1 , water jug capacity ( ml ) 2200: wall thickness of jug ( mm ) 1.3 mm, material of jug: food grade plastic food , material of lid: grade plastic, shape round cylindrical, capacity ( ml ) 2200 , salt and pepper set material: stainless steel, colour: any, packaging type: box, shape: round, height: 5 8 inch , tooth pick holder material: stainless steel, colour any, size: 4, 5 inches , straw holder material: stainless steel, colour: any, height: 105 mm , sugar sachet holder material: stainless steel, dimension: 5.1 x 2.4 x 1.5 inches, colour: silver, shape: square, finishing ceramic finish , material: stainless steel, size: 16cm.x11cm.x4cm., colour silver, material brass, finishing powder coating , finger bowl large with under liner material: metal, size ( cm ) : 20 / 22 / 24 / 26 / 28 / 30 , finishing: polished , entree dish round with lid ( 1 portion ) shape round, capacity 450 ml, finishing chrome , entree dish round with lid ( 2 portion ) shape round, capacity 500 ml, finishing chrome , oval platter material stainless steel, product depth 24, product width 16, product height 1.50, style minimalist, modern , reserved stainless steel reserved table sign, booked stand reserve seats for guests , round service tray material metal, size: 12, 14, 16 inches, finish nickle plated, pattern plain, , rectangular service tray material: aluminium, size: 12 * 6, depth 2.5 cm, weight: 200 250 grams, surface finish: matt , ash tray material wooden, shape square, type smokeless, colour: brown & golden, size / dimension: 10 x 10 x 4 cm , tom collins ( glass ) capacity: 250 300 ml, material: glass, microwave safe: yes, thickness: 2 7 mm, shape: cylindrical , hi ball material: polycarbonate, capacity: 240 270 ml, colour: clear , pilsner material: glass, head shape: round, size: 300ml, thickness: 4 10 mm, colour: transparent, , decanter small capacity: 50, 100 ml, material: glass, colour : transparent, , decanter large capacity: 150 ml, material: glass, colour : transparent, , wine glass size: standard, colour: transparent, material: borosil glass , table cloths material: cotton, colour: white and blue, size: 54 x 54 inch , table napkins table cotton cloth napkins, specification 60*60 cm. , bar tool kit material: stainless steel, finish: graphite , cocktail shaker material: stainless steel with copper plating, size: 1 l, colour silver, dimension ( inches ) : 4.70...

Rajasthan Council Of Secondary Education - Rajasthan

34094436 supply of tourism and hospitality lab items for school tables, dining chair, side station, bar counter, hostess desk, storage cabinet, computer, dinner plate, sessert plate, plate, tea cup, tea saucer, soup bowl, spoon, service bowl, knife, table service spoon, tea strainer, tea set, water jug, tooth pick holder, straw holder, sugar sachet holder, napkin holder, etc....

Rajasthan Council Of Secondary Education - Rajasthan

34093981 supply of tourism and hospitality lab items for school tables, dining chair, side station, bar counter, hostess desk, storage cabinet, computer, dinner plate, sessert plate, plate, tea cup, tea saucer, soup bowl, spoon, service bowl, knife, table service spoon, tea strainer, tea set, water jug, tooth pick holder, straw holder, sugar sachet holder, napkin holder, etc. ...

Medical Health And Family Welfare - Rajasthan

34079201 bids are invited for hb meter , hcg , multi parameter urine strip test , blood sugar gluco meter code free , malariya rapid card test , hiv rapid card test , dengu rapid card test , visual supply of medical item to 383 sub centres inspretion sticker , hbsag rapid card test , smear forfilaria test kit , rapid test kit syphillis , test for iodine saltsolution , water testing by strip method , sputum for afbas per fdsi guideline total quantity : 14136...

Medical And Health Services - Rajasthan

34058742 supply of lab regents and x ray green senstive, x ray developer, x ray fixer and hardener, 1 micros es 60 ) abx minidil lmg. ( diulent ) 2oltr. ( for haematology analyser hori 2 abx cleaner 01 ltr. ( for haematology analyser horiba micros es 60 ) 3 abx lyse bic ) 01 ltr. ( for haematology analyser horiba micros e5 60 4 minoclair ( for haematology analyser horiba micros es 60 ) 500 ml 5 thermal paper roll for cell counter. ( horiba micros es 60 ) 6 others hiv rapid test card ( maxline / jmitra / merril ) 7 vdrl rapid card ( maxline / jmitra / merril ) 8 anti abd set 10 ml ( tulip / arkray / span ) 9 micro tips blue ( big size ) 10 micro tips white / yellow ( small size ) micro pipete ( 100 ul to 1000 ul ) micro pipete ( 10 ul to 100 ul ) distilled water ( deionsed water ) 5 ltr. widal test ( slide method ) 5 ml ( tulip / span / arkray ) 15 sodium citrate 3.8% 560 ml ( nice / merck ) 16 n / 10 hcl 500 ml ( nice / merck ) 17 urine pregnancy card ( transasiya / ds / maxline / merril ) 18 urine strip ( albumin♦ sugar ) ( precision / sd / siemens ) , 19 urine multistrip ( alb . / sugar / ph / sg aceton e / bilesalt / bile pigment / ketone ) ( precision / sd / siemens ) 20 malaria rapid antigen test ( jmitra / ozone / 5d ) 21 j.5.8 stain i for malaria 500 ml ( witro / rankem ) 22 i j.s.b stain ii for malaria 500 ml ( witro / rankemy 23 cover sup 24 test tube glass 12x75 ( borossil ) 25 esr tube ( disposable ) 26 hb pipet ( gla55 ) ( borossil ) 27 hb tube round ( glass ) ( borossil ) 28 sample collection vial plane 29 sample collection vial with cover k3 ( edta ) 30 i glass slide 31 filter paper 32 sticker for sample vial 33 dispo needle 24n0 ( dispovan ) 4 dispo syringe 2 ml ( dispovan ) 35 dispo syringe 5 ml ( dispovan ) 36 capillary tube ( glass ) 37 tourniquet 38 dengue rapid antigen test / serology ( j mitra / sd / ozone ) 39 chikungunia ( igm / igg ) rapid card ( j mitra / sd / ozone ) 40 i sodium hypochloride 05 itr 41 spirit 500m1 42 dispo urine container 43 labowash for glass test tube cleaning 44 tissue roll 45 blood glucose strip ( glucospark / morpen 46 cotton 500 gm 47 immersion oil 48 dropping bottle for hb 49 wash bottle 500 ml size 50 fib meter ( sahli s method ) 51 test tube rack ( plastic / aluminium ) 52 slide staining rack ( aluminium ) 53 forcep ( iron / plastic ) steel tray 55 test tube brush ( small ) 56 glass beaker ( 100ml / 200m1 ) 57 syringe / needle destroyer machine 58 gloves 7.5 size ( sterile ) face mask ( disposable ) . 60 ecg roll 61 ecg jelly 62 slide stand lencet ( glucometer ) 63 66 alkaline phosphatese kit mini ( 4*35+2*18 ) 67 alanine aminotrans ferase kit ( 4*35+2*18 ) 68 bilirubine direct kit ( 4*20+2*20 ) 69 bilirubine total kit ( 4*20+2*20 ) 70 crea s ( 2*35ml+1*18ml ) 71 glucose kit ( 4*40+2*20 ) 72 hdl chlostrole ( 1*40+1*14 ) 73 ldl chlostrole ( 1*40+1*14 ) 74 total chlostrole ( 4*40 ) 76 triglycerides kit ( 4*40 ) 76 total protein kit ( 4*46 ) 77 albumin kit ( 4*40 ) 78 urea kit ( 4*20+2*20 ) 79 aspratate aminotranfersae ( 4*35+2*18 ) 80 controls normal ( randox / spinreact ) 81 controls low ( randox / spinreact ) 82 controls high ( randox / spinreact ) . 83 calibrators ( randox / spinreact ) 85 diatro diulent ( 20 litre ) diatron 86 diatro cleaner ( 1 litre ) diatron 87 diatro ly5e ( 1 litre ) diatron...

University of Rajasthan - Rajasthan

34054037 supply of chemicals, laboratory accessories and outsourcing servicing supply of chemicals, laboratory accessories and outsourcing servicing at botany department, uor, jaipur , chemical items : , 2(4 iodophenyl) 3 (4 nitrophenyl) 5 phenyl 2h tetrazolium chloride (int) 98% , 1 kb dna ladder , 1,10 phenanthroline , 1,2 dichloroethane, hi lr , 100 bp dna ladder , 10x mops buffer , 1 amine 2 napthol 4 sulfonic acid , 1n hydrochloric acid , 1 naphthaleneacetic acid; , 2,3,5 triphenyl tetrazolium chloride , 2,4 dichlorophenoxyacetic acid , 2,4 dinitrophenylhydrazine, hi ar , 20 bp dna ladder(50 ?g) , 2 mercaptoethanol , 2 oxoglutarate , 2 thiobarbituric acid , 3,3’ diaminobenzidine , 3,3 diaminobenzidine tetrahydrochloride (dab hcl) , 5,5 dithiobis (2 nitrobenzoic acid) (dtnb) , 50 bp dna ladder 50ln (150?l) , 50 x tae buffer , 500 bp dna ladder , 5 bromo 4 chloro 3 indolyl phosphate disodium salt (bcip) extrapure, 98% , 5 bromo 4 chloro 3 indolyl ? d galactopyranoside(x gal) 98% , 6 benzylaminopurine , 6x gel loading buffer , 6x orange gel loading buffer , abscisic acid , acetic acid glacialextrapure, 99.5% , acetic acid glacial, hi ar™ , acetone hplc grade 99.9% , acetone pure 99% , acetone, hi ar , acrylamide , adenosine 5 triphosphate , adonitol (ad, sugar discs , agar powder, bacteriological , agarose special, low eeo (nuclease and protease free) , amikacin (ak 10mcg), antibiotic discs , ammonium acetate for hplc, 99% , ammonium dihydrogen phosphate , ammonium ferrous sulphate hexahydrate extrapure, 98% , ammonium molybdate tetrahydrate , ammonium molybedate tetrahydrate extrapure ar, 99% , ammonium persulfate(aps) , ammonium sulphate , amoxyclav (amc 30mcg), antibiotic discs , a napthylamine , andrade’s indicator , aniline blue , anisaldehyde , arabinose (ar), sugar discs , arsenic acid sodium salt heptahydrate , ascorbate oxidase , atp , barium chloride , beef extract powder , betaine , biscrylamide , boric acid , boric acid extrapure, 99.5% , bovine serum albumin , bovine serum albumin ph 7.0 , bromo thymol blue , bromocresol green sodium salt (water soluble) acs (3,3”,5,5 tetrabromo mcresolsulfonphthalein sodium salt) dye content — 90% , buffer capsule ph 4 , buffer capsule ph 7 , buffer capsule ph 9 , butanol extra pure , calcium carbonate extrapure 98% , calcium chloride anhydrous , calcium chloride dihydrate , calcium chloride dihydrate extrapure ar,99.5% , calcium nitrate tetrahydrate , calcium phytate , carbenicillin (cb 100mcg), antibiotic discs , carboxy methyl cellulose sodium , carboxymethyl cellulose , casein enzyme hydrolysate, type i (tryptone type i) , casein hydrolysate , catechol , ceftriaxone (ctr 30mcg), antibiotic discs , cellobiose (ce), sugar discs , chaps buffer extrapure, 99% , chitosan (high mw) , chitosan (low mw) , chitosan (medium mw) , chloroform : isoamyl alcohol (24:1) , chloroform extrapure , cholorodinitrobenzene , ciprofloxacin (cip 10mcg), antibiotic discs , citric acid anhydrous extrapure, 99% , cobalt chloride hexahydrate , colloidal chitin , congo red , coomassie® brilliant blue g 250 , coomassie® brilliant blue r 250 , copper (ii) chloride anhydrous , copper (ii) sulphate pentahydrate , copper(ii) sulfate (cuso4) , cotrimazine (cm 30mcg), antibiotic discs , cotrimoxazole (cot 25mcg), antibiotic discs , ctab , cu nanopowder , cycloheximide , cysteine , d (+) glucose anhydrous , d biotin , deacetylated chitin (high mw extrapure,90% da) , deacetylated chitin (low mw extrapure10 150m.pas, 90% da) , deacetylated chitin (medium mw extrapure, 150 500m.pas, 90% da) , dextrose (de), sugar discs , diethyl pyrocarbonate , diethylpyrocarbonate (depc) , diphenylamine , diphenylamineextrapure ar, 99% , di potassium hydrogen ortho phosphate , di sodium hydrogen phosphate dihydrate, hi ar , disodium phosphate (na2h po4) , disodium phosphate (na2h po4) , dithio nitrobenzoic acid , dithiothretiol (dtt), molecular biology grade , dl dopa , d mannitol, for molecular biology , dnase i, rnase free , dntp mix, 10 mm (2.5 mm each) , dpph , dpta , dulcitol (du), sugar discs , ecori, 5000 units , edta , electrophorsis kitone kit , ethanol (absolute) 500ml , ethidium bromide , ethyl acetate , evans blue dye , ferric chloride anhydrous , ferrous ammonium sulphate , ferrous sulphate heptahydrate, hi ar/acs , ferrric chloride (fecl3) , first strand cdna synthesis kit , fluorescein diacetate , folin ciocalteu reagent , formaldehyde sol 37 41%, hi ar , formamide 500ml , formic acid , fructose (fc), sugar discs , galactose (ga), sugar discs , gallic acid , gelatin bacteriological , gentamicin (gen 10mcg), antibiotic discs , gibberellic acid , glucosinolate , glutathione , glutathione oxidized , glutathione reduced , glutathione reductase , glycerol , glycine , guaicol , h2so4 , hemocytometer , hexane , hi pure a soil dna extraction kit , hydrogen peroxide , hydroxyl amine , hydroxylamine hydrochloride (nh2oh.hcl) , imidazole , indole 3 acetic acid (iaa); , indole 3 butyric acid(iba); , inositol (is), sugar discs , inulin (in), sugar discs , iodine , iodine resublimed , isopropyl alcohol extrapure , kanamycin (k 30mcg), antibiotic discs , kinetin , kovac’s indole reagent , l glutamic acid , l glutamine , l (+) tartaric acid, , labolene phosphate free , lactophenol , lactose (la), sugar discs , l ascorbic acid, a.r , levofloxacin (le 5mcg), antibiotic discs , lithium chloride 100gm , litmus milk , l methionine , l phenylalanine , l tryptophan , magnesium chloride anhydrous500 gm , magnesium sulphate 500gm , magnesium sulphate. 7h2o , maleic acid , maltose (ma), sugar discs , manganese (ii) sulfate tetrahydrate (500gm) , manganese (ii) sulphate monohydrate, hi ar™/acs , mannitol 500gm , mannitol, sugar discs , mannose (mo), sugar discs , melibiose (mb), sugar discs , mercuric chlorideextrapure ar, acs, exiplus, multi compendial, 98% , mercury(ii) oxide (hgo) , mesitylene extrapure, 98% (1,3,5 trimethyl benzene) , methanol , methanol extrapure , methanol pure 99% , methoxyamine hydrochloride , methyl jasmonate , methyl red sodium salt (water soluble) acs, 95% , methyl viologen , mo nanopowder , monosodium phosphate (nah2po4) , m phosphoric acid sticks, hi ar™/acs , ms medium w/cacl2& vitamine , mspi (hpaii), 3000 units , murashige and skoog (m.s) media 5lt , n(1 napthyl) ethylene diaminedihydrochloride , nadh , nadph , nano2 , naoh , napthyl etylene diamine dihydrochloride , nessler’s reagent , netillin (net 30mcg), antibiotic discs , nicotinic acid , ninhydrin , nitrobluetetrazolium chloride (nbt) , nitrofurantoin (nit 300mcg), antibiotic discs , n methyl n (trimethylsilyl) trifluoroacetamide (mstfa) , nuclease free water , nutrient agar , o dianisidine (25 g) , ofloxacin (of 5mcg), antibiotic discs , orthophosphoric acid , orthophosphoric acid extrapure, 85% (phosphoric acid) , oxalic acid , oxidase discs , p amino benzoic acid , pcr master mix 100r (2.5ml) , pda , pectin pure , peptone bacteriological grade , perchloric acid , phenol crystals 100gm , phenol saturated with 10mm tris hcl ph8.0, 1mm edta , phenol, saturated w/10% water500ml , phenol: chloroform: isoamyl alcohol mixture , phenylmethanesulphonyl fluoride , phosphate bufferph 7.2 (apha) , phytase agar media , picloram , picric acid , pikovskaya’s agar , p nitrophenol , p nitrophenyl phosphate disodium , polyethylene glycol mw6000 , polyvinyl pyrrolidone (pvp) k 30 , potassium biphosphate, hi ar , potassium chloride , potassium chloride 99.5% , potassium chromate, , potassium dichromate pure, 99.5% , potassium dihydrogen orthophosphate extrapure ar, 99.5% , potassium dihydrogen phosphate (kh2po4) , potassium hydrogen phosphate (k2h po4) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium permanganate extrapure, 99% , potassium sulfate (k2so4) , prestained protein ladder , proline 99% , protein loading dye , psti, 3000 units , putrescine dihydrochloride , pvpp , pyridine, hi ar/acs , pyridoxal 5’ phosphate anhydrous, hi lr , pyrogallol , quercetin , raffinose (rf), sugar discs , restriction digestion kit , revertaid reverse transcriptase, 10,000 u , rhamnose (rh), sugar discs , ribitol , riboflavin , rna gel loading dye (0.25ml) , rnase100mg , rnase inhibitor (20 u/?l) 2500 units , rnasezap , rochelle salt(na k tartrate) , salicin (sa), sugar discs , salicylic acid , schffs reagent , selenium dioxide (seo2) , silver nitrate, hi lr , silver sulphate pure, 98.5% , simmons citrate agar , sio2 powder , skim milk powder , sodium acetate 100g , sodium acetate 3m , ph 5.2 5.4 , sodium acetate anhydrousfor hplc & uv spectroscopy, 99% , sodium acetate trihydrate , sodium acetate trihydrate , sodium azide (nan3) , sodium bicarbonate , sodium bisulphite , sodium carbonate anhydrous, hi ar/acs , sodium chloride , sodium chloride extrapure ar, 99.9% , sodium citrate anhydrous , sodium citrate tribasic dihydrate extrapure ar, 99% , sodium citrate, 3.8% w/v , sodium dithionite , sodium dodecyl sulphate, ultrapure , sodium fluoride , sodium fluoride pure, 98% , sodium hydrogen sulphite, hi ar/acs , sodium hydroxide pellet , sodium hydroxide pellets extrapure ar, 98% , sodium hypochlorite , sodium hypochlorite, hi ar™/acs(4% w/v solution) , sodium molybdate dihydrate, hi ar™/acs , sodium phenolate , sodium phosphate dibasic anhydrous extrapure ar, 99% , sodium phosphate monobasic anhydrous extrapure ar, 99% , sodium sulfite, hi ar/acs , sodium sulphite , sodium tetraborate , sorbitol (sb), sugar discs , spermidine , spermine , stannous chloride dihydrate dihydrate pure, 97% , starch soluble , streptomycin (s 10mcg), antibiotic discs , sucrose (su), sugar discs , sulfosalicylic acid , sulphanilic acid, purified , sulphosalicylic acid (3%) , taq dna polymerase (3 u/?l) (includes enzyme: 1 vial; 10x taq buffera : 4 vials; 25 mm mgcl2: 4 vials), 1000units , taq polymerase (5 units/?l) , temed , tetra chloroacetic acid , tetracycline (te 30mcg), antibiotic discs , thiamine hydrochloride , thiobarbituric acid (tba) , thiourea, hi ar/acs , titanium (?) oxysulfate hydrate , tlc silica gel 60 f254 , toluene , toluene extrapure ar, 99.5% , toluene, rectified, l.r. , trehalose (te), sugar discs , trichloroacetic acid extrapure ar, acs, 99.5% , triclogel , triclogel dispenser bottle , trimethylsilane (tms) , tris (hydroxylmethyl) aminomethane , tris base , tris buffer ar, acs for molecular biology, 99.9% , tris hydrochloride , tris hydrochloride (tris hcl) extrapure ar, 99% , triton x 100 , trizol reagent® , trypan blue dye , tryptone, certified (casein enzyme hydrolysate) , turbo dna freetm kit , tween 20 , urea extrapure ar, 99.5% , urea extrapure, 99% , xylose (xy), sugar discs , yeast extract 500gm , yeast mannitol broth , zeatin , zinc chloride 500gm , zinc dust , zinc oxide, hi ar™500gm , zinc sulphate heptahydrate , zn nanopowder , glassware items : , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , beaker, glassware , beaker, glassware , beaker, glassware , beaker, glassware , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim,amber, glassware , cover glass, square, glassware , funnel, glassware , funnel, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , microscopic glass slides, plain, ground edges, glassware , petri plats glass, 90mm, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , stirring rod, glassware , test tubes with rim, glassware , watch glasses, borosil s line, 150 ml, glassware , plasticware items : , applied biosystems™ microamp™ optical fast well reaction plate with barcode & optical adhesive films , art™ gel loading pipette tips (20 ?l) , carboy with stopcock ( liquid storage container), 10li , centrifuge tube conical bottom sterile 15 ml (pack of 500) , centrifuge tube conical bottom sterile 50 ml (pack of 500) , conical centrifuge tube rack , draining tray , drying rack , eppendorf tubes (1.5) (pack of 500) , eppendorf tubes (2 ml) (pack of 500) , funnel, 100 mm , funnel, 50 mm , ice bucket , ice tray (1 l) , ice tray (4 l) , junior 4 way tube rack , measuring cylinder class b, material: pp autoclavable 10 ml , pcr rack with cover (pack of 6) , pcr tubes (0.2 ml) (pack of 1000) , pcr tubes box for 0.2 ml , petri plates 100 mm (pack of 12) , pipette tips 0.2 10 ?l(pack of 1000) , pipette tips200 1000 ?l(pack of 500) , pipette tips2 200 ?l (pack of 1000) , plastic pots , polygrid test tube stand , rack for micro tube , test tube basket with cover 180x170x160 , tip box for 200 1000 ?l(pack of 10) , tip box for 5000 ?l (pack of 2) , tip box of 2 200 ?l (pack of 10) , utility tray, material: pp autoclavable; 320x260x100 , utility tray, material: pp autoclavable; 320x260x70 , utility tray, material: pp autoclavable; 360x310x130 , wash bottle new type (750 ml) , wash bottles plastic, 250ml; , wash bottles plastic, 500ml; , other items : , 1kg gross aluminium silver kitchen foil roll paper , 3 step interlocking micro tube rack (24x0.2 ml,14x0.5 ml and 12x1.5 ml tubes) (pack of 6) , autoclavable bags (pack of 100) , casting tray , cheese cloth , comb set (pack of 2) , conical centrifuge tube rack (pack of 4) , cryo cube box , cryo tags , cryocan ba 11 liquid nitrogen container (20l capacity) , cryo cube box1.8ml (pack of 8) , falcon tubes (15 ml) (pack of 500) , falcon tubes (50 ml) (pack of 500) , hand protector grip , hands on™ nitrile examination gloves , hijama surgical blades size 11 , liquid nitrogen flask , magnetic stirrer bar (round) 8x30 mm (pack of 10) , magnetic stirrer bar (round) 8x50 mm (pack of 10) , microcentrifuge tubes box for 1.5 ml(pack of 4) , microchattaway spatula , mortar and pestle (suitable for crushing of plant sample in liquid nitrogen) , multipurpose labelling tape , nitrile gloves powder free large , nitrile gloves powder free medium , non absorbent cotton , nylon membrane filter , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , parafilm tape (size in inches 4 x 125) , pcr rack with cover; 96 well , pipette rack horizontal , pointer spatula (6) , purple nitrile gloves (medium size) , qualitative filter paper grade 1: 11um 150 mm 100/pk , quartz cuvette; capasity; 1.0 ml;190 nm to 2500nm , quartz cuvette; capasity; 3.5 ml;190 nm to 2500nm , romino® silicone heat resistant cooking pinch mitts , round magnetic stirrer bar 8x30 mm , round magnetic stirrer bar 8x50 mm , spatula; 200mm , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , sterial scalpel blade no.22 , syringe filter 4 mm, 0.2 micron (sterile) 100/pack , syringe filter holder, pc (reusable), 13 mm , test tube stand 12 tubes(pack of 4) , tissue roll , tough tags , vertical gel casting system, 18 x 18 cm (glass plates dimension) , whatman® qualitative filter paper, grade 2 , out sourcingservicingitems : , mrna sequencing , small rna/ micro rna sequencing , sequencing of pcr products...

Dr. S.N.Medical College - Rajasthan

34047116 tender for investigation scheme ( 1 year ) 1 invetigations item list 2 b.sugar fasting 3 b. sugar pp 4 b. sugar random 5 g.t.t. 6 g.c.t. 7 b. urea 8 s. creatinine 9 s.total cholesterol 10 s.triglyceride 11 s.hdl cholesterol 12 s.ldl cholesterol 13 s.vldl cholesterol 14 s. got 15 s. gpt 16 b. bilirubin ( total ) 17 b. bilirubin ( direct ) 18 b. bilirubin ( indirect ) 19 s. albumin 20 s. total protien 21 s. alk phos. ( alp ) 22 s.phosphorus 23 s.uric acid 24 s. calcium 25 s.electrolyte 26 s.lipase 27 s. amylasae 28 s.cpk nac 29 s.cpk mb 30 s.ldh 31 s. magnesium 32 s. acid phosphates 33 s. g.g.t. 34 crp quantitative 35 fluid sugar 36 fluid protien 37 hba1c 38 il 6 39 t3 40 t4 41 tsh 42 ft3 43 ft4 44 fsh 45 lh 46 prolactin 47 testosteron 48 uibc 49 iron 50 folate 51 ferritine 52 vitamin d3 53 vitamin b12 54 hla typeing 55 dsa titer 56 fdc cross match 57 t & b call cross match 58 complement c3 & c4 level 59 ana 60 tacrolimus and / or cyclosporine zerolevels 61 bk virus ( rt pcr ) 62 cmv ( rt pcr ) 63 hcv rna ( rt pcr ) 64 hbv dna ( rt pcr ) 65 ca breast –er, pr ( ihc ) , her 2 neu, ki 67 ( ihc ) , brca 1 & 2, pdl 1 ( fish ) 66 ca lung egfr ( rt pcr ) , alk ( rt pcr ) , ros 1 ttf ( fish ) , ck 5 & 6 ( fish ) , c met ( fish ) 67 hcc s beta hcg, serum arginas 68 ca ovary & testicular tumor s.afp, alp, ldh, cea, ca 125 69 colorectal b raf ( rt pcr ) , k raf ( rt pcr ) , k ras ( rt pcr ) , n ras ( rt pcr ) 70 ca prostate s.psa, s.testosterone 71 cml bcr / abl ( rt pcr ) 72 myloproliferative disorder jak 2mutation ( rt pcr ) 73 multiple myeloma= cd 19 ( ihc ) , cd 38 ( ihc ) , cd 45 ( ihc ) , cd 56 ( ihc ) , cd 20 ( ihc ) , cd 138 ( ihc ) , cytometry kappa & lamba, serum electrophoresis, flowcytometry kappa & lambda 74 hodgkins and non hodgkins lymphoma= cd 3 ( ihc ) , cd 15 ( ihc ) , cd 20 ( ihc ) , cd 30 ( ihc ) , cd 45 ( ihc ) , cd 5 ( ihc ) . 75 sarcoma panel ( ihc ) 76 ca pancreas.ca19.9 77 cbc 78 hemoglobin 79 tlc 80 dlc 81 esr 82 mp 83 pbf 84 bt & ct 85 tec 86 pt 87 aptt 88 reticulocyte count 89 bone marrow 90 blood group 91 urine complete 92 urine microscopy 93 urine pregnancy test 94 24 hrs. urine protein 95 stool complete 96 stool occult blood 97 semen examination 98 csf cytology 99 ascitic fluid cytology 100 pleural fluid cytology 101 fnac 102 pap smear / other 103 tzanck smear 104 bone marrow 105 urine cytology 106 d dimer 107 fdp 108 fibrinogen 109 thrombine time 110 reptilase time 111 intrinsic and extrinic factors ii, v, vii, viii, ix, x, xi, xii, xiii 112 antithrombine iii 113 protine c and protine s 114 anti xa assay for lmwh and ufh 115 lupus anticogulant and drvv assays 116 von willebrand factor 117 fibrin monomers 118 tissue factor pathwayinhibitor ( tfpi ) 119 quantitaive determination of the thrombin activated fibrinolysis inhibitor ( tafi ) 120 plasminogen 121 anti plasmin 122 plasminogen activator inhibitor 123 tissue plasminogen activator 124 alkalidenaturation test 125 osmotic fragility test 126 methemoglobin rediuction test 127 hma s acidified serumlysis 128 sucrose hemolysis test 129 sickle cell slide test 130 lbc ( liquid based cytology 131 flow cytomatry 132 cytochemistry for acute leukemia 133 fish 134 grams staining 135 z.n staining ( modified ) 136 alberts stain 137 geimsa stain 138 koh mount for fungus 139 blood 140 shunt 141 pus 142 urine 143 sputum 144 stool 145 tracheal 146 fluids 147 central line tip 148 csf cytology 149 vaginal 150 throat swab 151 fungal culture 152 other body fluid 153 seman 154 pleural fluid culture and sensitivity 155 automated blood culture 156 nasal swab 157 any swab culture and sensitivty 158 hiv 159 hbsag 160 hcv 161 vdrl rpr ) slide test ( indilution ) 162 mp 163 dengue 164 widal 165 ra 166 aso 167 crp 168 trop 1 ( qualitative ) 169 stool ova&cyst 170 brucella abortus & brucella melitensis slide test 171 cd 4 lab 172 ictc 173 coombs test 174 lactophenol cotton blue stain...

Medical And Health Services - Rajasthan

34045858 rate contract for medicine for mndy 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp ( 10 ampoules ) 2 4 bupivacaine inj ip 0.5% 20 ml vial 3 6 halothane bp 250 ml in amber colour bottle 4 7 isoflurane usp 100 ml bottle 5 8 ketamine inj ip 50 mg / ml 10 ml vial 6 9 lignocaine ointment 5 o / o 10 gm tube in unit carton 7 10 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 8 12 lignocaine gel ip 2% 30gm tube in a unit carton 9 13 lignocaine inj ip 2 o / o 30 ml vial 10 14 propofol inj ip 10 mg / ml 20 ml vial / ampoule 11 15 thiopentone inj ip 0.5 g vial 12 491 sevoflurane 250 ml bottle 13 654 atropine sulphate injection 0.6mg / ml 1ml amp 25 ampoules 14 799 liquid medical oxygen ( lmo ) rc not exists 15 19 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 3 ml amp ( 10 amp ) 16 20 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) 10x10 tab strip / blister 17 21 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 18 22 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 19 23 ibuprofen tab ip 200 mg ( coated ) 10x10 tab blister 20 24 ibuprofen tab ip 400 mg ( coated ) 10x10 tab blister 21 25 morphine sulphate inj ip 10mg / ml 1 ml 10 ampoules 22 26 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 23 27 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 60 ml bottle ( with measuring cap ) 24 28 paracetamol tab ip 500 mg 10x10 tab blister 25 29 paracetamol inj. 150 mg / ml 2 ml amp 50 ampoules 26 30 pentazocine inj ip 30mg / ml ( im / iv use ) 1ml amp 25 ampoules 27 32 tramadol cap ip 50 mg 10x10 cap strip / blister 28 33 tramadol inj 50 mg / ml 2 ml amp 10 ampoules 29 436 indomethacin cap ip 25 mg 10x10 cap strip 30 437 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 31 477 ibuprofen oral suspension bp / usp 100 mg / 5 ml 60 ml bottle ( with measuring cap ) 32 483 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 10x10 tab blister 33 492 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 10x10 tab blister 34 493 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 35 495 etoricoxib tab ip 120mg 10x10 tab blister 36 496 mefenamic acid tablets bp 500 mg 10x10 tablets 37 655 fentanyl citrate injection 50mcg / ml 10ml vial / amp 38 656 naproxen tablet ip 500mg 10x10 tab blister 39 657 naproxen tablet ip 250mg 10x10 tab blister 40 658 etoricoxib tablet ip 90 mg 10x10 tablets 41 679 aspirin tablet ip ( gastro resistant ) 150 mg 14x10 tablet 42 695 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 1 ml. ampoule 43 696 paracetamol infusion ip 1% w / v 100ml size 100 ml bottle 44 697 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 10x10 tablets 45 698 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 46 699 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 10x10 tablets 47 34 adrenaline injection ip 1mg / ml im / iv use 1ml amp ( ambercolor ) 25 amp 48 35 betamethasone tab ip 0.5mg 10x10 tab blister 49 37 chlorpheniramine maleate tab ip 4mg 10x10 tab strip / blister 50 39 dexamethasone inj ip 8mg / 2ml 2 ml vial ( usp type i vial ) 51 40 dexamethasone tab ip 0.5 mg 10x10 tab strip 52 42 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) vial 53 43 hydroxyzine tab ip 25 mg 10x10 tab strip / blister 54 44 methyl prednisolone sodium succinate for injection usp 500 mg vial 55 45 pheniramine inj ip 22.75mg / ml 2 ml amp 25 ampoules 56 47 prednisolone tab ip 5 mg 10x10 tab strip / blister 57 48 promethazine syrup ip 5 mg / 5ml 60 ml bottle ( with measuring cap ) 58 49 promethazine inj ip 25mg / ml 2 ml amp ( amber color ) ( 10 ampoules ) 59 50 promethazine tab ip 25 mg 10x10 tab strip 60 418 betamethasone sod phos inj ip 4mg / ml 1 ml ampoule / vial 61 469 prednisolone tablet ip 10 mg 10x10 tab strip / blister 62 470 prednisolone tab ip 20 mg 10x10 tab strip / blister 63 497 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg rc not exists 64 498 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 10x10 tablets 65 499 cetirizine syrup ip 5mg / 5 ml 30 ml bottle with measuring cap 66 659 levoceitrizine tablet 5mg 10x10 tablets 67 660 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 10x10 tablet blister / strip / alu alu pack 68 700 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 10x10 tablets 69 51 naloxone inj ip 0.4mg / ml 1 ml 10 ampoules 70 52 pralidoxime chloride injection ip 25 mg / ml / 500 mg vial 71 500 acetylcystine solution usp ( injection ) 200 mg / ml 2 ml ampoule ( 5 ampoules ) 72 53 carbamazepine tab ip 200 mg 10x10 tab strip / blister 73 54 carbamazepine tab ip 100 mg 10x10 tab strip / blister 74 56 phenobarbitone tab ip 30 mg 10x10 tab strip 75 57 phenytoin injection bp 50mg / ml 2 ml amp ( amber colour ) ( 25 ampoules ) 76 58 phenytoin oral suspension ip 25mg / ml 100 ml bottle ( with measuring cap ) 77 59 phenytoin tab ip 100 mg ( film coated ) 10x10 tab strip 78 61 sodium valproate gastro resistant tablets ip 200 mg 10x10 tab strip 79 420 phenobarbitone inj ip 200mg / ml 1 ml ampoule / vial 80 474 carbamazepine oral suspension usp 100 mg / 5ml 100 ml bottle ( with measuring cap ) 81 479 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle ( with measuring cap ) 82 661 sodium valproate tablet ( gastro resistant ) ip 500mg 10x10 tab strip 83 662 clobazam tablet / capsule 5 mg 10x10 tablet / capsule blister 84 663 clobazam tablet / capsule 10 mg 10x10 tablet / capsule blister 85 664 levetiracetam tablet ip 500 mg 10x10 tab blister 86 665 levetiracetam oral solution / suspension 100mg / ml 100ml 87 666 levetiracetam injection 500mg / 5ml vial 88 667 gabapentine tablet / capsule 100mg 10x10 tablet / capsule blister / strip 89 668 gabapentine tablet / capsule 300mg 10x10 tablet / capsule blister / strip 90 701 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) rc not exists 91 702 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 10x10 tablets 92 703 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 10x10 tablets 93 704 lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 10x10 tablets 94 705 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) 10x10 tablets 95 62 acyclovir oral suspension ip 400mg / 5ml 60 ml bottle ( with measuring cap ) 96 63 acyclovir tab ip 200 mg 10x10 tab blister 97 64 acyclovir tab ip 800 mg 10x10 tab strip 98 65 albendazole oral suspension ip 400 mg / 10ml 10 ml bottle 99 66a albendazole tablets ip 400 mg ( detail in rc ) 10*10*1 tablet strip / blister 100 67 amikacin inj ip 100 mg 2 ml vial 101 68 amikacin inj ip 500 mg 2 ml vial 102 69 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 103 70 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg rc not exists 104 71 amoxycillin cap ip 250mg 10x10 cap strip / blister 105 72 amoxycillin cap ip 500mg rc not exists 106 73 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 107 74 amphotericin b inj ip 50 mg vial 108 75 ampicillin injection ip 500 mg vial 109 78a azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 110 79a azithromycin tablets ip 250mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 111 80a azithromycin tab ip 500 mg no. 112 81 benzathine benzylpenicillin inj ip 12 lac units rc not exists 113 82 benzathine benzylpenicillin inj ip 6 lac units rc not exists 114 84 cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg 10x10 tab strip 115 85 cefixime tab ip 200 mg rc not exists 116 86 cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) rc not exists 117 87 cefotaxime injection ip 1 g rc not exists 118 88 cefotaxime inj ip 250 mg vial 119 89 ceftazidime inj ip 1g vial 120 90 ceftazidime inj ip 250 mg vial 121 91 ceftazidime inj ip 500 mg vial 122 93 ceftriaxone inj ip 1g / vial vial ( packed in monocarton ) 123 94 ceftriaxone inj ip 250 mg / vial vial ( amber colour ) 124 95 ceftriaxone inj ip 500mg / vial vial ( packed in monocarton ) 125 96 cephalexin cap ip 250 mg 10x10 cap blister 126 97 cephalexin cap ip 500 mg rc not exists 127 98 chloroquine phosphate inj ip 40 mg / ml 5 ml amp ( 25 amp ) 128 99 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip / blister 129 100a chloroquine phosphate suspension ip 50 mg / 5ml 60 ml bottle ( with measuring cap ) 130 101 ciprofloxacin injection ip 200mg / 100ml 100 ml ffs / bfs bottle 131 102 ciprofloxacin tablets ip 250 mg film coated rc not exists 132 103 ciprofloxacin tablet ip 500 mg film coated rc not exists 133 104 clotrimazole cream ip 2% w / w 15gm tube in a unit carton 134 105 clotrimazole vaginal tab ip 500mg single tablet ( 10 tabs with an applicator ) 135 107 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle ( with measuring cap ) 136 108 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 137 110 diethylcarbamazine tab ip 100 mg 10x10 tab blister 138 111 doxycycline cap ip 100 mg 10x10 cap strip / blister 139 114a fluconazole tablets ip 150mg 10*10*1 tab strip ( perforated ) 140 116 gentamycin injection ip 80mg / 2ml ( im / iv use ) 2 ml amp 50 ampoules 141 117 griseofulvin tab ip 125 mg rc not exists 142 118 itraconazole cap 100 mg 10x4 cap strip 143 119 meropenem inj ip 500 mg vial 144 120 metronidazole inj ip 500 mg / 100ml 100 ml ffs / bfs bottle 145 121 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60 ml bottle ( amber colour ) with measuring cap 146 122 metronidazole tablets ip 200 mg ( film coated ) 10x10 tab blister 147 123 metronidazole tablets ip 400 mg ( film coated ) rc not exists 148 124 norfloxacin tab ip 400mg film coated 10x10 tab blister 149 125 ofloxacin tab ip 200 mg 10x10 tab blister 150 128 primaquine tab ip 2.5 mg 10x10 tab strip / blister 151 129 primaquine tab ip 7.5 mg 10x10 tab strip / blister 152 131 quinine dihydrochloride inj ip 300 mg / ml 2 ml amp 25 ampoules 153 132 quinine sulphate tablets ip 300 mg ( film coated ) 10x10 tab blister 154 412 ampicillin cap ip 500mg rc not exists 155 413 nitrofurantoin tab ip 100mg 10x10 tab blister 156 417 cloxacillin sodium inj ip 500mg vial 157 427 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 30 ml bottle with measuring cap 158 428 ofloxacin oral suspension ip 50mg / 5ml 30 ml. bottle 159 430 tinidazole tab ip 300 mg ( film coated ) 10x10 tab blister 160 431 tinidazole tab ip 500 mg ( film coated ) 10x10 tab blister 161 468 piperacillin + tazobactum for injection ip 4gm+500mg vial 162 473 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 30 ml bottle with measuring cap 163 475 cefpodoxime dispersible tab 50 mg 10x10 tab strip 164 476 cephalexin tablets 125 mg ( dispersible tablets ) 10x10 tab strip 165 481 meropenem inj. ip 1gm vial 166 502 acyclovir intravenous infusion ip 250mg vial 167 503 acyclovir intravenous infusion ip 500mg vial 168 504 amikacin inj ip 250 mg vial 169 505 amoxicillin and potassium clavulanic ip inj 600mg 10 ml vial 170 506 amoxicillin and potassium clavulanate inj ip 1.2gm vial 171 507 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) 30 ml bottle with measuring cap 172 508a artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) each combo pack in a unit carton 173 509 aztreonam injection usp 500 mg rc not exists 174 510 cefepime injection ip 500 mg vial 175 511 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 176 512 cefuroxime axetil tab ip 250 mg 10x10 tab strip 177 513 clindamycin capsule ip 150mg 10x10 cap strip / blister 178 514 clindamycin capsule ip 300 mg 10x10 cap strip / blister 179 515 levofloxacin tablets ip 250 mg rc not exists 180 516 linezolid tablets ip 600 mg 10x10 tablets 181 517 linezolid inj 200mg / 100ml 100ml 182 518 mefloquine tablets ip 250 mg 10x6 tablet blister 183 520 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 184 521 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) 100 ml bottle 185 523 vancomycin for intravenous infusion ip 500 mg vial 186 524 vancomycin for intravenous infusion ip 1 gm vial 187 651 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 1x6 tablet blister 188 669 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) 10x10 tablets 189 683 aztreonam injection 1gm vial 190 684 framycetin sulphate cream 1 o / o 30gm pack 30gm pack 191 685 framycetin sulphate cream 1 o / o 100 gm pack 100gm pack 192 686 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 1x6 tablet blister 193 706 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg rc not exists 194 707 piperacillin injection 2 gm + tazobactom 250mg ip rc not exists 195 708 ceftriaxone 1 gm + tazobactum 125 mg injection vial 196 709 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 10x10 tablets 197 710 cefadroxil tablet 500 mg rc not exists 198 711 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size rc not exists 199 712 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 10x10 tablets 200 713 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 10x10 tablets 201 714 clindamycin phosphate injection ip 300 mg vial / ampoules 202 715 imipenem + cilastatin injection 500mg / 500mg ip powder for solution vial 203 716 polymixin sulphate b injection usp 5 lac i.u. vial 204 717 meropenem injection ip 250 mg rc not exists 205 718 colistimethate injection ip 1m iu powder for solution vial 206 720 voriconazole injection 200mg / vial vial 207 721 terbinafine hydrochloride tablet 250 mg 10x10 tablets 208 722 valganciclovir tablet 450 mg 10x10 tablets 209 723 entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 10x10 tablets 210 724 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) vial 211 133 azathioprine tab ip 50 mg 10x10 tab strip 212 134 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) vial 213 136 chlorambucil tab ip 5 mg rc not exists 214 137 cisplatin inj ip 50 mg / 50 ml 50 ml vial 215 138 cyclophosphamide inj ip 200 mg 10 ml glass vial 216 139 cyclophosphamide inj ip 500 mg 25ml glass vial 217 141 cytarabine injection bp 500mg 5 ml vial 218 142 danazol cap ip 50 mg 10x10 cap blister 219 143 daunorubicin inj ip 20 mg 10 ml glass vial 220 144 doxorubicin inj ip 50 mg / 25 ml vial 221 146 etoposide inj ip 100 mg 5 ml glass vial 222 148 fluorouracil inj ip 250 mg / 5ml 5 ml ampoule 223 149 l asparaginase inj 10000 iu vial 224 150 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 5 ml vial 225 151 melphalan tab ip 5 mg 25 tab bottle 226 152 mercaptopurine tab ip 50 mg 10x10 tab strip 227 153 methotrexate inj ip 50 mg / 2 ml rc not exists 228 154 methotrexate tab ip 2.5 mg 10x10 tab strip 229 155 paclitaxel inj ip 260 mg 43.4 ml vial 230 156 paclitaxel inj ip 100 mg 16.7 ml vial 231 157 tamoxifen tab ip 10 mg 10x10 tab strip 232 158 vinblastine inj ip 10mg / 10ml vial 233 159 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) vial / ampoules 234 525 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million vial 235 526 carboplatin injection ip 150 mg 15 ml vial 236 527 carboplatin injection ip 450 mg 45 ml vial 237 528 cisplatin inj ip 10 mg / 10 ml 10 ml vial 238 529 dacarbazine injection 500 mg usp / bp rc not exists 239 530 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 pre filled syringe / vial 240 531 gemcitabine for injection 200 mg vial 241 532 gemcitabine for injection ip 1gm vial 242 533 ifosfamide injection ip / bp / usp 1gm vial 243 534 imatinib tab ip 400mg 10x10 caps / tab 244 536 methotrexate tablets ip 10 mg 10x10 tab strip 245 538 oxaliplatin injection usp 50 mg 25 ml vial 246 677 cyclosporin capsule usp / ip 50 mg 50 caps pack 247 726 bendamustine injection 100 mg vial 248 727 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 10x10 tablets 249 728 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 10x10 tablets 250 729 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) strip of 5 cap / bottele of 5 cap 251 730 bortezomib injection 2mg vial 252 731 abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) bottle of 30 tablets 253 733 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) 10x10 cap strip / blister 254 734 bevacizumab injection 400 mg vial 255 735 bevacizumab injection 100 mg vial 256 736 cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 10x10 tablets 257 737 gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 10x10 tablets 258 738 mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) 10x10 caps / tab 259 739 tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 10 x 10 capsule 260 740 mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) 10x10 tablets 261 741 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 10x10 tablets 262 742 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) rc not exists 263 743 zoledronic acid injection ip 4mg vial vial 264 797 dasatinib tab 100 mg 60 tablet 265 160 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg rc not exists 266 161 levodopa and carbidopa tab 250 mg+ 25 mg rc not exists 267 162 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 268 540 bromocriptine tablets ip 2.5 mg 10x10 tab strip 269 163 acenocoumarol tab ip / nicoumalone tab ip 2 mg 10x10 tab strip 270 165 deferasirox tab 100 mg 30 tablets 271 166 deferasirox tab 500 mg 30 tablets 272 167 deferiprone cap 250 mg 50 caps 273 168 deferiprone cap 500 mg 50 caps 274 169 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) vial 275 171 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) vial with diluent 276 172 enoxaparin sodium inj ip 60 mg vial / pfs 277 173 ethamsylate inj 250 mg / 2ml ( im / iv ) 2 ml amp 10 ampoules 278 174 heparin sodium inj ip 5000 iu / ml ( im / iv use ) 5 ml vial 279 175 human albumin solution ip 20% 100 ml bottle 280 176 rh erythropoetin inj ip 10000 iu vial / pfs 281 177 rh erythropoetin inj ip 2000iu vial / pfs 282 179 rh erythropoetin inj 4000 iu vial / pfs 283 180 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 1ml amp ( ambercolor ) 25 amp 284 405 polygeline 3.5% solution with electrolytes for i.v. infusion rc not exists 285 406 factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) 500 iu vial with solvent 286 407 anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) vial with 20ml solvant 287 416 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle / 500 ml free flex 288 545 tranexamic acid tablets ip 500 mg 10x6 tablet blister 289 546 warfarin sodium. tab ip 5mg 10x10 tablets 290 644 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) each pack along with syringe in a unit carton 291 688 dried factor viii fraction ip ( iv use ) 500 iu / vial vial with diluent 292 689 dried factor viii fraction ip ( iv use ) 1000 iu / vial rc not exists 293 690 recombinant coagulation factor viia 1mg vial 294 691 recombinant coagulation factor viia 2mg vial 295 745 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) rc not exists 296 746 feracrylum 1% w / v sterile solution 100 ml 100ml 297 747 tranexamic acid injection ip 100mg / ml 5ml size 5ml vial / amp 298 748 recombinant f ix 500 iu with diluent vial with diluent 299 749 3rd generation recombinant f viii 250 iu with diluent vial with diluent 300 750 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 301 181 amiodarone tab ip 100 mg 10x10 tablets 302 182 amiodarone tab ip 200 mg 10x10 tab strip 303 183 amiodarone hydrochloride inj 50 mg / ml 3 ml amp ( 10 amp ) 304 184 amlodipine tab ip 2.5 mg 10x10 tab strip / blister 305 185 amlodipine tablets ip 5 mg 10x10 tab blister 306 186 atenolol tab ip 50 mg 10x14 tab blister 307 187 atorvastatin tab ip 10mg 10x10 tab strip / blister 308 188 clopidogrel tab ip 75 mg 10x10 tab strip 309 189 digoxin inj ip 0.25 mg / ml rc not exists 310 190 digoxin tab ip 0.25 mg. 10x10 tab strip 311 191 diltiazem tabs ip 30 mg film coated 10x10 tab blister 312 192 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) 10 vial / amp 313 193 dopamine hydrochloride inj ip 40 mg / ml 5 ml amp ( amber colour ) 25 ampo 314 194 enalapril maleate tab ip 5mg 10x10 tab strip 315 195 enalapril maleate tab ip 2.5mg 10x10 tab strip 316 197 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 317 198 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 318 199 lisinopril tab ip 5 mg 10x10 tab strip 319 200 losartan tab ip 50 mg 10x10 tab strip 320 201 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 2 ml amp 25 ampoules 321 202 methyldopa tab ip 250mg film coated rc not exists 322 203 nifedipine cap ip 5mg 10x10 cap strip 323 204 nifedipine tablets ip 10 mg ( sustained release ) 10x10 tab blister 324 205 nitroglycerin inj 5 mg / ml 5 ml amp ( 10 ampoules ) 325 207 propranolol tab ip 40 mg 10x10 tab strip / blister 326 209 streptokinase injection 15 lac units ip vial 327 211 verapamil tab ip 40 mg film coated 10x10 tab strip 328 410 labetalol tab ip 100mg 10x10 tab blister 329 411 labetalol hcl inj ip 20mg / 4ml 4 ml ampules 330 444 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 10x14 tab strips 331 457 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 10x10 tab strip 332 458 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 10x10 tab strip / blister 333 459 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 10x10 tab blister 334 460 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 10x10 tab strip / blister 335 461 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 10x10 tab blister 336 462 atenolol tab ip 25 mg 10x14 tab blister 337 463 enalapril maleate tablets ip 10 mg 10x10 tab strip 338 465 lisinopril tablets ip 10 mg 10x10 tab strip / blister 339 466 lisinopril tab ip 2.5 mg 10x10 tab strip / blister 340 467 losartan tab ip 25 mg 10x10 tab blister 341 547 adenosine injection ip 6 mg / 2ml 2ml vial / ampoule 342 548 atorvastatin tablets ip 40 mg 10x10 tablets 343 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 10x10 tab strip 344 550 fenofibrate capsules / tab ip 200 mg 10 x 10 capsule 345 551 isoprenaline injection ip 2mg / ml rc not exists 346 552 metoprolol tablets ip 25 mg 10x10 tablets 347 553 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 348 554 noradrenaline injection ip 2 mg / ml 2ml vial / ampoule 349 555 prazosin tablets ( extended release ) 2.5 mg 10x15 tablet strip / blister 350 556 telmisartan tablets ip 40 mg 10x10 tablets 351 557 urokinase injection 5 lac unit ( lyophilized ) rc not exists 352 636 ramipril tablets ip 2.5 mg 10x10 tablets 353 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 354 751 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) 10x10 tablets 355 752 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 10x10 tablets 356 753 esmolol hydrochloride injection 10mg / ml 10ml size 10 ml vial 357 754 sodium nitroprusside injection 25mg / ml 2ml size 2ml vial / ampoule 358 755 carvedilol tablet 3.125 mg 10x10 tablets 359 756 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 10x10 tablets 360 757 rosuvastatin tablet 10 mg 10x10 tablets 361 758 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 362 580 chlorhexidine mouthwash ip 0.2 o / o 50 ml bottle 363 581 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 10 gm tube 364 582 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 50 gm tube in unit carton 365 583 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 366 584 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 367 106 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 15gm tube in mono carton 368 213 acyclovir cream 5% 5 gm tube in unit carton 369 215a cetrimide cream ip 15 gm 15gm tube in a unit carton 370 216a fusidic acid cream ip 2% 10gm tube in mono carton 371 217 glycerin ip 400 gm rc not exists 372 218 liquid paraffin ip 400 ml 400 ml bottle 373 220 miconazole nitrate cream ip 2% 15gm tube in a unit carton 374 221 povidone iodine ointment 5% 15 gm rc not exists 375 223 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 10 gm plastic bottle with nozzle to sprinkle powder 376 224 silver sulphadiazine cream ip 1% 50gm tube 50 gm tube 377 246 gentian violet topical solution usp 1o / o 200 ml bottle 378 443 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) 15 ml squeeze bottle 379 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 10 gm tube in unit carton 380 446 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 100 ml bottle 381 558 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 382 559 betamethasone lotion ip 0.05 o / o 50ml 383 560 clindamycin phosphate gel usp 1 o / o 20gm tube in mono carton 384 561 clobetasol propionate cream ip 0.05 o / o 20 gm tube 385 564 glycerin ip 100 ml rc not exists 386 565 ketoconazole cream 2% 15gm tube in mono carton 387 568 permethrin lotion 5% 30 ml 388 569 permethrin cream 5% 30gm tube in a unit carton 389 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 390 670 coal tar 6% & salicylic acid 3% ointment 20gm 391 671 calamine lotion ip 100ml 100 ml bottle 392 759 powder clotrimazole 1% w / w 30 gm 30 gm bottle 393 760 terbinafine cream 1%w / w ( 10 gm tube ) 10 gm tube 394 761 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 5ml bottle 395 762 oitment mupirocin ip 2% 5 gm tube 396 225 anti a blood grouping serum ip ( anti a monoclonal serum ) 10 ml vial 397 226 anti b blood grouping serum ip ( anti b mono clonal serum ) 10 ml vial 398 227 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 10 ml vial 399 232 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 20 ml vial / ampoule 400 233 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 20 ml ampoule 401 235 gadodiamide inj. 0.5mml / ml vial 10 ml vial 402 242 vdrl antigen ( with + ve and ve control ) / rpr slide kit 100 test kits 403 482 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 20 ml pack 404 672 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 50 ml pack 405 801 multistix test strip each piece 406 222 povidone iodine solution ip 5 % 500 ml 500 ml bottle 407 244 compound benzoin tincture ip 500 ml bottle 408 245 formaldehyde solution ( 34.5 per. 38 per. ) rc not exists 409 247 gluteraldehyde solution 2% 5 ltrs can 410 248 hydrogen peroxide solution ip 6 o / o ( 20 vol ) rc not exists 411 249 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 5 ltrs can 412 250 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml bottle 413 252 surgical spirit ip ( 500 ml ) 500 ml opaque white bottle with inner cap 414 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 415 449 surgical spirit ip ( 100 ml ) 100ml opaque white bottle with inner cap 416 450 povidone iodine solution ip 5% 100ml bottle 100 ml bottle 417 571 povidone iodine ointment usp 250 gm rc not exists 418 572 povidone iodine solution ip 10 % 100 ml bottle 419 573 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 420 253 acetazolamide tab ip 250mg 10x10 tab blister 421 254 frusemide tab ip 40 mg 10x10 tab strip 422 255 furosemide injection ip 10mg / ml ( im and iv use ) 2 ml ampoule 423 256 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 424 257a mannitol inj ip 20% w / v 100 ml ffs / bfs bottle 425 258 spironolactone tab ip 25mg 10x10 tab blister 426 259 torsemide tab 10 ip mg 10x10 tab strip / blister 427 464 hydrochlorthiazide tab ip 25mg 10x10 tab strip 428 574 spironolactone tablets ip 50 mg 10x10 tablets 429 585 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops 5 ml. vial with sterilized dropper, or squeeze vial 430 586 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 5 ml ear drops 431 588 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial / bottle with a seperate dropper 432 589 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 10ml bottle / vial ( with a seperate dropper which should be able to screw&cap the bottle ) in unit carton 433 5 drotaverine hydrochloride inj 40 mg / 2 ml 2 ml amp 10 ampoules 434 219 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 15gm tube in a unit carton 435 260a antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 436 261a antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle ( with measuring cap ) 437 262 bisacodyl tab ip 5 mg 10x10 tab strip 438 263 dicyclomine tab ip 10 mg 10x10 tab strip / blister 439 264 dicyclomine inj ip 10 mg / ml 2 ml amp 25 ampoules 440 265 dicyclomine hydrochloride oral solution ip 10mg / 5ml 30 ml bottle with measuring cap 441 266 domperidone suspension ip 5mg / 5ml rc not exists 442 267 domperidone tab ip 10 mg 10x10 tab blister 443 268 hyoscine butylbromide inj ip 20 mg / ml 1ml amp 25 ampoules 444 269 loperamide tab ip 2 mg 10x10 tab strip 445 270 metoclopramide inj ip 10mg / 2ml 2 ml amp 25 ampoules 446 271 metoclopramide tab ip 10 mg 10x10 tab blister 447 272 omeprazole cap ip 20 mg 10x10 cap strip / blister 448 273 ondansetron inj ip 2mg / ml 2 ml amp 10 ampoules 449 274 ors powder ip pouches 20.5 gms 450 275 pentoprazole inj 40 mg vial 451 276 ranitidine hcl injection ip 50mg / 2ml 2 ml amp ( amber colour ) ( 25 ampoules ) 452 277 ranitidine tab ip 150mg film coated rc not exists 453 278 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 100 ml polypropylene pack 454 414 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 455 415 drotaverine tab ip 40 mg 10x10 tab blister 456 433 ranitidine tab ip 300mg film coated 10x10 tab strip 457 438 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 458 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 459 478 metoclopramide hydrochloride syrup ip 5 mg / 5ml 30 ml bottle ( with a seperate dropper which should be able to screw & cap the bottle ) in unit carton 460 590 domperidone oral drops 10mg / ml ( 10ml ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 461 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 462 592 lactic acid bacillus tab 60 million spores 10x10 tablets 463 593 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml 100 ml bottle ( with measuring cap ) 464 594 liquid paraffin ip 100 ml 100 ml bottle 465 595 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 466 596 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 10x10 cap strip 467 597 ursodeoxycholic acid tablets ip 300 mg 10x10 tab strip / blister 468 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 469 765 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1 gm each sachet 470 766 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 10x10 tablets 471 598 allopurinol tablets ip 100 mg 10x10 tablets 472 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 473 600 leflunomide tablets ip 10mg ( film coated ) 10x10 tablets 474 601 leflunomide tablets ip / usp 20mg ( film coated ) 10x10 tablets 475 602 sulfasalazine gastroresistant tablets ip 500 mg ip 10x10 tablets 476 279 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 10 ml vial 477 280 carbimazole tabs ip 5 mg ( film coated ) 10x10 tab blister 478 281 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 1 ml amp / vials ( 25 ampoule / vial ) 479 282 clomifene tab ip 25 mg 10x10 tab strip 480 283 clomiphene tab ip 50 mg 10x10 tab strip 481 284 conjugated estrogen tabs usp 0.625 mg. rc not exists 482 285 dinoprostone cream / gel 0.5 mg dinoprostone in syringe syringe 483 286 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 484 287 glibenclamide tab ip 5 mg 10x10 tab strip / blister 485 288 gliclazide tab ip 40 mg 10x10 tab strip / blister 486 289 glimepiride tab ip 2 mg 10x10 tab strip / blister 487 290 glimepiride tab ip 1mg 10x10 tab strip / blister 488 291 glipizide tab ip 5mg 10x10 tab blister 489 293 hydroxyprogesterone inj ip 250mg / ml 1ml amp 25 ampoules 490 294 isophane insulin inj ip 40 iu / ml 10 ml vial 491 295 metformin tab ip 500 mg 10x10 tab blister 492 296 norethisterone tab ip 5 mg 10x10 tab strip 493 297 pioglitazone tab ip 15 mg 10x10 tab blister 494 298 progesterone inj 200 mg / 2ml 2 ml amp 10 ampoules 495 300 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna 10 ml vial 496 301 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 497 451 metformin hydrochloride ( sustained release tablets ip 1000 mg 10x10 tab blister 498 452 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 10x10 tab blister 499 453 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) 10x10 tab blister 500 454 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 10x10 tab blister 501 455 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 10x10 tab blister 502 456 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 10x10 tab blister 503 603 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 10x10 tablets 504 604 glucagon for injection usp 1 mg / ml vial 505 605 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 506 607 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 507 608 octreotide injection 50 mcg / ml 1 ml. ampoule 508 680 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 3ml vial 509 682 tenaligliptin tablet ip 20mg 10x10 tablet blister / alu alu pack 510 693 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 10 ml vial 511 303 human anti d immunoglobulin injection 300mcg ( im use ) pre filled syringe / vial 512 304 human anti d immunoglobulin 150 mcg pre filled syringe / vial 513 305 human rabies immunoglobulin inj 150 iu / ml rc not exists 514 306 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 1 ml vial with 1.0 ml diluent 515 307 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose single tablet ( 10 tabs with an applicator ) 516 308 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) vial 517 309 tetanus immunoglobulin ip 250 iu / vial vial / ampoules 518 310 tetanus vaccine ( adsorbed ) ip 5 ml vial rc not exists 519 408 rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) 5 ml vial 520 480 diphtheria antitoxin 10000 iu vial 521 767 hepatitis b immunologlobin injection ip 200 i.u vial / pfs 522 798 human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) 10ml vial ( 0.5gm ) 523 311 atracurium inj 10 mg / ml 2.5 ml amp ( 10 ampoules ) 524 312 glycopyrrolate inj ip 0.2 mg / ml 1 ml amp ( 10 amp ) 525 313 midazolam inj ip 1 mg / ml 5 ml vial 526 314 neostigmine inj ip 0.5 mg / ml 1 ml 10 ampoules 527 317 succinylcholine inj. ip 50 mg / ml ( iv use ) 10 ml vial 528 318 valethamate bromide inj 8mg / ml rc not exists 529 419 vecuronium bromide for injection 4mg ( freeze dried ) each vial / ampoule 530 610 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 10x10 tablets 531 638 neostigmine injection ip 2.5mg / 5ml 5 ml amp ( 10 ampoules ) 532 768 cis atracurium besylate injection 2 mg / ml in 5 ml vial 5 ml vial 533 241 tropicamide eye drop ip 1o / o 5 ml. vial with sterilized dropper, or squeeze vial 534 319 atropine eye ointment ip 1% rc not exists 535 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper, or squeeze vial 536 321 chloramphenicol eye drops ip 0.5 0 / 0 5 ml. vial with sterilized dropper, or squeeze vial 537 322 ciprofloxacin eye drops ip 0.3 o / o w / v 5 ml squeeze vial 538 323 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 539 324 hydroxypropylmethyl cellulose solution 20 mg / ml rc not exists 540 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o 5ml vial with sterilized dropper packed in seperate polythene pack 541 331 tobramycin eye drops 0.3% [ 331 ] 5 ml. vial with sterilized dropper, or squeeze vial 542 332 tobramycin ophthalmic ointment usp 0.3% rc not exists 543 421 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5 ml squeeze vial 544 423 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 545 424 lidocaine hcl topical solution usp 4% rc not exists 546 425 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper, or squeeze vial 547 484 timolol eye drops ip 0.5 o / o w / v 5 ml squeeze vial 548 485 homatropine eye drops ip 2% 5 ml squeeze vial 549 486 travoprost eye drops ip 0.004 o / o 3 ml squeeze vial 550 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5 ml squeeze vial 551 612 betaxolol eye drops 0.5 o / o rc not exists 552 613 carboxymethylcellulose eye drops ip 0.5% 10 ml squeeze vial 553 769 acyclovir eye ointment ip 3% w / w 5gm size 5 gm tube 554 770 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper, or squeeze vial 555 771 chloramphenicol 1% w / w eye ointment ip, 3gm size 3 gm tube 556 333 isoxsuprine inj ip 5 mg / ml 2 ml amp 10 ampoules 557 334 isoxsuprine tab ip 20 mg 10x10 tab strip 558 335 methylergometrine inj ip 0.2 mg / ml 1ml amp ( ambercolor ) 25 amp 559 336 methylergometrine tab ip 0.125 mg 10x10 tab strip 560 337 misoprostol tab ip 200 mcg 10x10 tablets 561 338 oxytocin inj ip 5 iu / ml 1 ml ampoule ( single unit in blister pack ) 562 615 mifepristone tab ip 200mg single tablet 563 772 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 10x10 tablet / capsule blister / strip 564 773 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 10x10 tablets 565 774 human chorionic gonadotropin injection ip 5000 i.u. vial 566 775 leurprolide acetate depot 3.75 mg vial 567 776 leurprolide acetate depot 11.25 mg vial 568 339 alprazolam tab ip 0.25 mg 10x10 tab strip / blister 569 340 alprazolam tab ip 0.5mg 10x10 tab strip / blister 570 341 amitriptyline tab ip 25mg film coated 10x10 tab strip 571 342 chlordiazepoxide tablets ip 10mg 10x10 tab strip 572 343 chlorpromazine tablets ip 100 mg ( coated tablet ) 10x10 tab strip 573 344 chlorpromazine tablets ip 25 mg ( sugar coated ) 10x10 tab strip 574 345 chlorpromazine tablets ip 50 mg ( coated tablets ) 10x10 tab strip 575 349 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 2 ml amp 25 ampoules 576 350 diazepam tab ip 5 mg 10x10 tab strip / blister 577 351 escitalopram tab ip 10 mg 10x10 tab strip / blister 578 352 fluoxetine cap ip 20 mg 10x10 cap strip / blister 579 353 haloperidol inj ip 5 mg / ml 1 ml amp ( 10 amp ) 580 354 haloperidol tab ip 1.5 mg 10x10 tab strip 581 355 haloperidol tab ip 5 mg 10x10 tab strip 582 356 imipramine tab ip 25 mg ( coated tab ) 10x10 tab blister 583 357 imipramine tab ip 75 mg ( coated ) 10x10 tab blister 584 358 lithium carbonate tab ip 300 mg 10x10 tab strip 585 359 lorazepam inj ip 2 mg / ml 2 ml amp 25 ampoules 586 360 olanzapine tab ip 5 mg 10x10 tab strip 587 361 risperidone tab 2mg 10x10 tab strip / blister 588 362 risperidone tab 1 mg 10x10 tab strip / blister 589 363 sertraline tab ip 50 mg 10x10 tab strip / blister 590 364 trifluperazine tab ip 5 mg coated, 591 674 quetiapine tablet ip 50mg 10x10 tab blister 592 675 quetiapine tablet ip 25mg 10x10 tab blister 593 678 clonazepam tablet 0.5 mg 10x10 tablets 594 777 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 10x10 tablets 595 778 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 596 779 zolpidem tablet 5 mg 10x10 tablets 597 365 aminophylline inj ip 25 mg / ml 10 ml amp 25 ampoules 598 366 beclomethasone inhalation ip 200 mcg / dose 200metered dose container 599 367 budesonide nebulizer suspension 0.25mg / ml 2 ml amp 10 ampoules 600 368 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 50 ml bottle ( with measuring cap ) 601 369 ipratropium bromide nebulizer solution 250 mcg / ml 15 ml glass bottle 602 370 salbutamol tablet ip 4 mg 10x10 tab strip / blister 603 371 salbutamol inhalation 100 mcg / dose 200metered dose container 604 372 salbutamol nebuliser solution bp 5 mg / ml 10 ml vial 605 373 salbutamol tab ip 2 mg 10x10 tab strip / blister 606 374 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 2 ml amp 25 ampoules 607 375 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) rc not exists 608 376 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) rc not exists 609 432 salbutamol syrup ip 2mg / 5ml 100 ml bottle ( with measuring cap ) 610 440 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 611 442 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 10 ml bottle with dropper / squeeze bottle 612 616 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 613 617 budesonide powder for inhalation 200 mcg 30 capsule ( rota caps ) 614 618 ipratropium powder for inhalation ip 40 mcg 30 capsule ( rota caps ) 615 619 terbutaline tablets ip 2.5 mg 10x10 tablets 616 620 xylometazoline nasal drops ip 0.1% 5ml vial / bottle ( with a seperate dropper ) in a unit carton 617 692 cough syrup / expectorant ( 50 ) ml 50 ml bottle ( with measuring cap ) 618 780 acebrophylline tablet / capsule 100 mg 10x10 tablets 619 377 compound sodium lactate inj. ip 500 ml ffs / bfs bottle 620 378 dextrose inj ip 25% w / v 100 ml ffs / bfs bottle 621 379 dextrose inj ip 10% 500 ml ffs / bfs bottle 622 380 dextrose inj ip 5% 500 ml ffs / bfs bottle 623 381 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 500 ml ffs / bfs bottle 624 382 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs / bfs bottle 625 383 potassium chloride inj. 0.15 gm / ml 10 ml amp 10 ampoules 626 384 potassium chloride oral solution u.s.p 500mg / 5ml 200ml bottle ( amber color ) 627 385 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500 ml ffs / bfs bottle 628 386 sodium chloride inj ip 500 ml 500 ml ffs / bfs bottle 629 621 sodium chloride injection ip 100 ml 100 ml bottle 630 781 ringer acetate infusion 500 ml 500 ml bottle 631 782 sodium chloride 0.45% w / v polypack 500 ml 500 ml bottle 632 575 finasteride tablets ip 5 mg 10x10 tab strip / blister 633 576 tamsulosin hcl tablets / capsule 0.4 mg 10x10 tablet / cap strip 634 579 flavoxate tablets ip 200 mg ( coated tablet ) 10x10 tablets 635 783 savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 10x10 tablets 636 784 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 10x10 tablets 637 785 levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 10x10 tablets 638 787 dutasteride tablet 0.5 mg 10x10 tablets 639 788 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) rc not exists 640 541 betahistine tab ip 8 mg 10x10 tablets 641 542 betahistine tab ip 16 mg 10x10 tablets 642 543 cinnarizine tablets ip 25 mg 10x10 tab blister 643 544 cinnarizine tablet ip 75 mg 10x10 tab blister 644 387 ascorbic acid tab ip 500 mg 10x10 tab strip 645 388 calcium gluconate inj ip 10% ( iv use ) rc not exists 646 390 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 10x10 tab strip / blister 647 391 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip / blister 648 392 folic acid tab ip 5 mg 10x10 tab blister 649 393 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 650 394 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip / blister 651 395 vitamin b complex inj nfi 10 ml vial 652 397 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 10x10 tab strip / blister 653 409 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml / 2ml in unit carton 654 441 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle ( with measuring cap ) 655 448 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper ( details in rc ) 656 472 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip / blister 657 488 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule ( amber colour ) 658 622 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 10x10 tablets 659 623 cholecalciferol granules 60, 000 iu / gm 1 gm sachet ( 50 sachets ) 660 624 mecobalamin inj 500 mcg / ml 1 ml. ampoule 661 627 pyridoxine tablet ip 40mg 10x10 tab strip 662 629 thiamine tablets ip 100 mg 10x10 tab strip 663 630 calcitriol capsules ip 0.25 mcg 10x10 cap strip / blister 664 652 methyl cobalmine tablet 500mcg 10x10 tab strip / blister 665 653 methyl cobalmine tablet 1500mcg 10x10 tab strip / blister 666 676 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 667 789 ferric carboxymaltose injection 50 mg / ml 10 ml size 10 ml vial 668 790 multi vitamin syrup 100ml 669 147 flunarizine tab 5 mg 10x10 tab blister 670 398 black disinfectant fluid ( phenyl ) as per schedule o grade iii 5 ltrs can 671 399 conc haemodialysis fluid b.p acetate concentrate 10 litre can rc not exists 672 401 peritonial dialysis solution ip 1000 ml ffs / bfs pack 673 402 sodium bicarbonate inj ip 7.5% w / v 10 ml amp 25 ampoules 674 404 water for inj ip rc not exists 675 631 alendronate sodium tablets usp / bp 35 mg 4 tablets ( 20 *4tablet ) 676 632 mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml ffs / bfs bottle 677 633 normal human intravenous immunoglobulin 5g / 100ml 100 ml vial 678 634 pregabalin cap ip 75 mg 10 x 10 capsule 679 635 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml vial 680 687 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans rc not exists 681 791 intravenous fat emulsion 20% w / v 250ml 250 ml bottle 682 792 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 683 793 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 3ml vial 684 794 amino acid 10% injection 100ml size 100 ml bottle 685 795 vitamin e capsule 400 mg 10x10 cap strip / blister 686 796 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1.5ml vial 687 639 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) strip / blister of 10 capsule 688 640 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) strip / blister of 10 capsule 689 641 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) strip / blister of 10 capsule 690 642 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 75 ml bottle with measuring cap 691 645 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) one combi blister pack 692 646 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) rc not exists 693 647 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) one combi blister pack 694 648 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) rc not exists 695 649 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg rc not exists 696 800 liposomol amphotericine injection b 50mg vial 697 nrd 15 amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mg gel 15 gm tube 698 nrd 16 crotamiton 10% + hydrocortisone 0.25% cream 10 gm tube 699 nrd 17 methotrexate gel 1% 20 gmtube 700 nrd 57 eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg 15 gm tube 701 nrd 59 beclomethasone dipropionate 0.064%+ salycylic acid 3% lotion 50 ml lotion 702 nrd 63 methoxsalen 1% lotion. each ml contain methoxsalen 1% 30 ml lotion 703 nrd 68 deca peptide 6 mg lotion. each ml contain deca peptide 6 mg 6 ml lotion 704 nrd 72 minocycline 50mg capsule 705 nrd 73 trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg 10*10 706 nrd 75 trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg 10*10 707 nrd 111 trichloroacetic acid ( tca ) 50% w / v lotion lotion 708 nrd 168 inj.hylan g f 20 6 ml prefiled syringe 709 nrd 171 hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, lornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg tablet 710 nrd 213 spores of polyantibiotic resistant bacillus clausii 2 billion capsules hard gelatin capsules 711 nrd 218 iron as ferric saccharate and phospholipid chewable tabletseach chewable tablet contains: ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine 100 mg tablet 712 nrd 235 cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen 1x28 tab 713 nrd 247 telmisartan40mg + hydroclorothiazide12.5 mg, i.p. each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, 10x10 714 nrd 248 telmisartan80mg + hydroclorothiazide25 mg, i.p. each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, 10x10 715 nrd 259 mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg 10x10 716 nrd 270 combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . kit 717 nrd 388 dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg 30 tab in bottle 718 nrd 405 tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg & lamivudine300 mg 30 tab in bottle 719 nrd 455 efavirenz 600 each film coated tablet contain efavirenz 600 mg tab 720 nrd 457 nevirapine 200 each tablet contain nevirapine 200mg 10x10 tab 721 nrd 470 atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg 30 tab in bottle 722 nrd 641 tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg tab 723 nrd 825 abacavir300 each tablet contain abacavir 300mg ip 60 tab in bottle 724 nrd 826 lamivudine 100 each tablet contain lamivudine 100 mg 10x10 725 nrd 827 raltegravir 400 each film coated tablet contain raltegravir 400 mg 60 tab in bottle 726 nrd 828 zideovudine 60+ lamivudine 30 tab 727 nrd 829 ultrasound contrast agent ( sulphur hexafluoride ) sonovue 8 micro ltr. per ml 728 nrd 830 contrast for ct scan / ivp / special investigations 729 nrd 831 iopamidol ct contrast solution for injectiuon 50 ml, vial 730 nrd 832 iopamidol ct contrast solution for injectiuon 100 ml 731 nrd 833 contrast for special investigations ( barium sulphate powder ) 100gm 732 nrd 834 contrast for special investigations ( barium sulphate powder ) 100gm 733 nrd 835 contrast for special investigations ( barium sulphate suspension ) high density low viscosity 100ml 734 nrd 836 contrast for special investigations ( barium sulphate suspension ) high density low viscosity 300ml 735 nrd 837 contrast for special investigations ( barium sulphate paste ) 100ml 736 nrd 838 oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) 100ml 737 nrd 839 oral contrast for ct ( diatrozoate sodium & diatrozoate meglumine ) 738 nrd 840 iopromide ct contrast usfda / ce approved 50 ml 739 nrd 841 iopromide ct contrast usfda / ce approved 100 ml 740 nrd 842 iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved 50 ml 741 nrd 843 iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved 100 ml 742 nrd 844 iotrolon ct contrast usfda / ce approved 50 ml 743 nrd 845 iotrolon ct contrast usfda / ce approved 100 ml 744 nrd 846 venlafaxime tab. 37.5 mg 745 nrd 847 olanzapine inj. 5 mg 746 nrd 848 flupentixol inj. 20 mg 747 nrd 849 memantine tab. 5 mg 748 nrd 850 glycopyrrolate tab. 1 mg 749 nrd 851 pramipexole tab. 0.125 mg 750 nrd 852 pramipexole tab. 0.25mg 751 nrd 853 pramipexole tab. 0.5 mg 752 nrd 854 inj. propofol mct / lct with oleic acid inj.iv inj. iv 753 nrd 855 inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag 754 nrd 856 nalbuphine inj. iv / im, 1ml 755 nrd 857 chlorprocaine inj 20ml vial 756 nrd 858 desflurane, 100ml inhalational agent 757 nrd 859 gelofusion infusion 500ml 758 nrd 860 albumin 5% infusion 100ml 759 nrd 861 inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 760 nrd 862 inj. 0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 761 nrd 863 inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 762 nrd 864 inj. ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 763 nrd 865 inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 764 nrd 866 inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 765 nrd 867 inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag infusion 766 nrd 868 balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed system polyolefin 500 ml bag infusion 767 nrd 869 inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin infusion 768 nrd 870 inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag infusion 769 nrd 871 nifedipine sublingual 5mg, capsule 770 nrd 872 nifedipine sublingual 10mg, capsule 771 nrd 873 papaverine inj. 2ml 772 nrd 874 nicardipine tab. 10mg 773 nrd 875 topical heparin solution 1000iu / ml 1 glass bottle with dropper 5ml 774 nrd 876 anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicum anti toxin 5000 iu ) 775 nrd 877 basiliximab 20 mg inj inj. 776 nrd 878 betamethasone and neomycin cream ( 0.10%+0.5% ) cream 777 nrd 879 solution silver nitrate 2% cream 778 nrd 880 solution silver nitrate 5% cream 779 nrd 881 solution silver nitrate 10% cream 780 nrd 882 alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) 781 nrd 883 ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v 782 nrd 884 ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) 5 ml 783 nrd 885 nasal drops haemcoagulase topical solution each ml contain aqueous solution of haemocoagluase 0.2 cu 10 ml 784 nrd 886 triamcinolone oromucosal paste bp 0.1% w / w 5 gm tube 785 nrd 887 ethiodized oil ( lipiodol ) inj. 10 ml 786 nrd 888 htk solution 1 lit ( histidine tryptophan ketoglutarate solution ) 1 liter 787 nrd 889 glycopegylated extended half life nonacog beta pegol f ix 500 iu 788 nrd 890 glycopegylated extended half life nonacog beta pegol f ix 1000 iu 789 nrd 891 glycopegylated extended half life factor viii 500 iu 790 nrd 892 glycopegylated extended half life factor viii 1000 iu 791 nrd 893 tenofovir alafenamide fumerate ( taf ) 25 mg tab. / cap 1 bottle of 30 tab. / cap 792 nrd 894 entecavir 1mg tab. / cap film coated 1 bottle of 30 tab. / cap 793 nrd 895 dacalatasvir 30 mg tab. / cap 1 bottle of 28 tab. / cap 794 nrd 896 dacalatasvir 60 mg tab. / cap 1 bottle of 28 tab. / cap 795 nrd 897 sofosbuvir 400 mg tab. / cap 1 bottle of 28 tab. / cap 796 nrd 898 ribavirin 200 mg tab. / cap film coated 1 bottle of 42 tab. / cap 797 nrd 1 artificial saliva solution 798 nrd 2 balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag solution 799 nrd 3 alpha+lipoic acid + leycopen +multivitamin and miltiminerals cap. 800 nrd 4 glucosamine + hydrochloride +methylsulfonylmethane cap. 801 nrd 5 racecadotril 100mg cap. 802 nrd 6 rabeprazole +levosulpiride cap. 803 nrd 7 acitretin 10 mg cap. 804 nrd 8 acitretin 25 mg cap. 805 nrd 9 alectinib 150 mg ( monopoly ) cap. 806 nrd 10 all trans retinoic acid 10 mg cap. 807 nrd 11 anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) cap. 808 nrd 12 aprepitant 125 mg cap. 809 nrd 13 budesonide 9 mg cap. 810 nrd 14 calcium dobesilate 500mg cap. 811 nrd 15 ceritinib 50 mg cap. 812 nrd 16 ceritinib 100 mg cap. 813 nrd 17 ceritinib 200 mg cap. 814 nrd 18 ceritinib 250mg cap. 815 nrd 19 clomipramine ip 25 mg cap. 816 nrd 20 cyclosporine 100 mg cap. 817 nrd 21 dacarbazine 200 mg inj. 818 nrd 22 danazol 100mg cap. 819 nrd 23 evening primosa 1000 mg cap. 820 nrd 24 formetrol 12mcg + budesonide 400 mcg. respule 821 nrd 25 indacaterol and glycopyronium inhalation powder 110 / 50 mcg cap. 822 nrd 26 isotretinoin 10mg cap. 823 nrd 27 isotretinoin 20 mg cap. 824 nrd 28 lomustine 40 mg cap. 825 nrd 29 minocycline 100mg. cap. 826 nrd 30 mycophenolate mofetil 500mg cap. 827 nrd 31 netupitant + palonosetron 300 mg + 0.5 mg cap. 828 nrd 32 ramipril ip 5 mg cap. 829 nrd 33 rucaparib 200 mg cap. 830 nrd 34 rucaparib 300 mg cap. 831 nrd 35 silodosin 4 mg cap. 832 nrd 36 silodosin 8 mg cap. 833 nrd 37 temozolamide 250 mg cap. 834 nrd 38 vitamin a 25000 iu cap. 835 nrd 39 carbolic acid 50% in 500 ml solution 836 nrd 40 carbolic acid 100% in 500 ml solution 837 nrd 41 continuous ambulatory peritoneal dialysis fluid 2 ltr 838 nrd 42 lidocaine 25 mg + prilocaine 25mg cream 839 nrd 43 / ointment ( modified lanolin ) cream 840 nrd 44 aloe vera moisturizing cream 841 nrd 45 amophous hydrogel with colloid silver wound dressing cream 842 nrd 46 amorolfine 0.25% cream 843 nrd 47 azelaic acid 20% cream 844 nrd 48 benzoyl peroxide 2.5 % cream 845 nrd 49 desonide 0.05% cream 846 nrd 50 fenticonazole 2% cream 847 nrd 51 glycolic acid 6% cream 848 nrd 52 hydrocortisone 1% cream 849 nrd 53 hydroquinone 2% cream 850 nrd 54 kojic acid 2%, arbutin, niacinamide cream 851 nrd 55 luliconazole 1% cream 852 nrd 56 mometasone 0.1 % cream 853 nrd 57 mometasone 2% cream 854 nrd 58 neomycin sulphate cream cream 855 nrd 59 permethrin 1% rinse cream 856 nrd 60 adaplene ( 0.1% w / w ) gel 857 nrd 61 desflurane usp 240 ml bottle solution 858 nrd 62 dextrose with sod.chloride polypack 5% 500ml inj. 859 nrd 63 distilled water 10ml inj. 860 nrd 64 sodium chloride and dextrose 0.45% infusion 500ml inj. 861 nrd 65 salmetrol 50mcg+fluticasone 500 mcg dpi 862 nrd 66 budesonide 400 mcg dpi 863 nrd 67 glycopyrronium 25 + formoterol 6 mcg dpi 864 nrd 68 glycopyrronium 25 dpi 865 nrd 69 glycopyrronium 50 dpi 866 nrd 70 levosalbutamol 100mcg+ ipratropium bromide 40mcg dpi 867 nrd 71 diastase pepsin with simethicone 15 ml drop 868 nrd 72 furosemide 10mg / ml drop 869 nrd 73 ondansetron oral solution 30 ml drop 870 nrd 74 prednisolone acetate opthalmic suspension 10 ml eye drop 871 nrd 75 terbutalin drop 872 nrd 76 hydroxyzine oral solution 15 ml drop 873 nrd 77 ambroxol drop 874 nrd 78 anticold drop 875 nrd 79 astymine c ( vitamin c+ essential amino acid ) drop 876 nrd 80 enzyme drop 877 nrd 81 iron ( ferrous ascorbate ) drop 878 nrd 82 simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml drop 879 nrd 83 vitamin – e 50mg / ml, 400 iu drop 880 nrd 84 vitamin d3 400iu / ml drop 881 nrd 85 vitamin d3 800iu / ml drop 882 nrd 86 cefpodoxime oral suspension 20mg / ml drops 883 nrd 87 lactulose enema 884 nrd 88 docosahexaenoic 30ml drops 885 nrd 89 acetic acid otic solution 2% ear drop 886 nrd 90 gentamycin ear drop 887 nrd 91 digoxin 0.25% elixir 888 nrd 92 carboxymethylcellulose + glycerin eye drop 889 nrd 93 moxifloxacin+ difluoprednate eye drop 890 nrd 94 natamycin opthalmic suspension 5% eye drop 891 nrd 95 olaptadine & ketorolac eye drop 892 nrd 96 polymyxin b 10000iu / gm + neomycin 3400iu / gm eye drop 893 nrd 97 betadin 5% eye drop 894 nrd 98 brinozolamide+brimonidine eye drop 895 nrd 99 cpm+cmc+nephazoline eye drop 896 nrd 100 cyclopentolate 1% eye drop 897 nrd 101 dorzolamide 2% eye drop 898 nrd 102 fluromethalone 0.1% eye drop 899 nrd 103 gatifloxacin+prednisolone eye drop 900 nrd 104 hpmc 0.3% eye drop 901 nrd 105 itraconazole 1% eye drop 902 nrd 106 loteprednol 0.25% eye drop 903 nrd 107 moxifloxacin 0.5%+ketorolac tromethamine 0.5% eye drop 904 nrd 108 moxifloxacin and dexamethasone eye drop 905 nrd 109 moxifloxacin and prednisolone eye drop 906 nrd 110 nepafenac 0.1% eye drop 907 nrd 111 oloptadine opthalmic solution 0.1% eye drop 908 nrd 112 pilocarpine eye drop 909 nrd 113 prednisolone sodium phosphate 1% eye / ear drop 910 nrd 114 proparacaine 0.5% w / v eye drop 911 nrd 115 sodium chloride 5 % eye drop 912 nrd 116 sulfacetamide 20% eye drop 913 nrd 117 travapost+timolol eye drop 914 nrd 118 tropicamide+phenylepherine eye drop 915 nrd 119 voriconazole eye drop 916 nrd 120 azithromycin 1% eye ointment 917 nrd 121 chloramphenicol 0.5% eye ointment 918 nrd 122 chloramphenicol +polymycin eye ointment 919 nrd 123 chloramphenicol +polymycine + dexamethasone eye ointment 920 nrd 124 ganciclovir 0.15% eye ointment 921 nrd 125 itraconazole 1% eye ointment 922 nrd 126 moxifloxacin 0.5% eye ointment 923 nrd 127 sodium chloride 6% eye ointment 924 nrd 128 povidone iodine gargle 925 nrd 129 gatifloxacin 0.3% eye drop 926 nrd 130 diltiazem 2% p / r gel 927 nrd 131 nifedipine + lidocaine p / r gel 928 nrd 132 glycine irrigation solution 1.5% 3ltr solution 929 nrd 133 esmoprazole 10mg granules 930 nrd 134 hormonal intra uterine device 931 nrd 135 hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg tab. 932 nrd 136 hydrocortisone oromucosal 5 mg tab. 933 nrd 137 hydrocortisone oromucosal 10 mg tab. 934 nrd 138 hydrocortisone oromucosal 20 mg tab. 935 nrd 139 hydrogen 11% + silver nitrate .01% solution 936 nrd 140 tiotropium + glycopyrolate 25mg inhaler 937 nrd 141 metoprolol 5ml vial inj 938 nrd 142 docetaxel 20mg inj. 939 nrd 143 docetaxel 80 mg inj. 940 nrd 144 folinic acid 200mg / vial inj. 941 nrd 145 sodium chloride 3% 100ml inj. 942 nrd 146 acth synacthen 250 mcg inj. 943 nrd 147 adalimumab 40 mg inj. 944 nrd 148 ado trastuzumab 100 mg945 nrd 149 ado trastuzumab 160 mg inj. 946 nrd 150 alpha beta arteether 2 ml inj. 947 nrd 151 prostaglandin 500mcg / ml inj. 948 nrd 152 aminocaproic acid 20ml inj. 949 nrd 153 amoxycillin & clavulanic acid 300 mg inj. 950 nrd 154 ampicillin + salbactum 1.5g inj. 951 nrd 155 progesterone injection 50 inj. 952 nrd 156 artesunate 120 mg inj. 953 nrd 157 atezolizumab 1200 mg ( monopoly ) inj. 954 nrd 158 avelumab 200 mg ( monopoly ) inj. 955 nrd 159 azacitidine 50mg inj. 956 nrd 160 azacitidine 100mg inj. 957 nrd 161 azithromycin 10 ml vial equaivelent to 500 mg inj. 958 nrd 162 bacitracin for injection 25, 000 iu inj. 959 nrd 163 bortezomib 2.5 inj. 960 nrd 164 botulinum toxin type a for injection / botulinum toxin type b for injection 100 inj. 961 nrd 165 botulinum toxin type a for injection / botulinum toxin type b for injection 50 iu inj. 962 nrd 166 busulfan 60mg / 1ml inj. 963 nrd 167 cabazitaxel 20 mg inj. 964 nrd 168 cabazitaxel 40 mg inj. 965 nrd 169 caffeine cirate 20mg / ml inj. 966 nrd 170 calcium chloride 5ml vial inj. 967 nrd 171 calcium gluconate / folinate inj. 968 nrd 172 carbetocin 1ml / 100micro. inj. 969 nrd 173 carfilzomib 20 mg inj. 970 nrd 174 carfilzomib 60 mg inj. 971 nrd 175 carmustine 100 mg inj. 972 nrd 176 caspofungin 50 mg inj. 973 nrd 177 caspofungin 70 mg inj. 974 nrd 178 cefipime 1000mg + tazobactum 125mg inj. 975 nrd 179 cefoperazone 1gm+tazobactum 125mg inj. 976 nrd 180 cefoperazone 500mg inj. 977 nrd 181 ceftazidime 1gm+sulbactam500 mg inj. 978 nrd 182 ceftazidime+ avibactum 2gm+500mg inj. 979 nrd 183 ceftizoxime 1 gm inj. 980 nrd 184 ceftriaxone ip 125 mg inj. 981 nrd 185 ceftriaxone +salbactum+ disodium edta inj. 982 nrd 186 ceftriaxone and sulbactam 1.5g inj. 983 nrd 187 ceftriaxone1000mg+ tazobactom125mg inj. 984 nrd 188 cefuroxime 1gm inj. 985 nrd 189 cetrorelix acetate 0.25 mg inj. 986 nrd 190 cetuximab 100 mg inj. 987 nrd 191 cetuximab 500mg inj. 988 nrd 192 chloramphenicol 1gm / vial inj. 989 nrd 193 cladrabine 10 mg inj. 990 nrd 194 clarithromycin 500mg inj. 991 nrd 195 clindamycin 600mg / 4ml inj. 992 nrd 196 clonidine 150mcg / ml inj. 993 nrd 197 compound sodium lactate ( ringer lactate ) in glass bottle 500ml inj. 994 nrd 198 crystilline penicillin 2 lakh inj. 995 nrd 199 cytarabine 1000 mg inj. 996 nrd 200 d penicillamine 250mg cap. 997 nrd 201 dextrose 5% 500 ml glass bottle inj. 998 nrd 202 daratumumab 100 mg ( monopoly ) inj. 999 nrd 203 daratumumab400 mg ( monopoly ) inj. 1000 nrd 204 darbepoietin alfa 100mcg inj. 1001 nrd 205 darbepoietin alfa 200 mcg inj. 1002 nrd 206 darbepoietin alfa 500mcg inj. 1003 nrd 207 decitabine 50 mg inj. 1004 nrd 208 decitabine 100 mg inj. 1005 nrd 209 degarelix 80 mg inj. 1006 nrd 210 degarelix 120 mg inj. 1007 nrd 211 degludec insulin 300iu / 3ml inj. 1008 nrd 212 denosumab 120 mg inj. 1009 nrd 213 deriphylline 1 ampul inj. 1010 nrd 214 detemir insuline inj. 1011 nrd 215 dexmedetomidine 100mcg / ml inj. 1012 nrd 216 dextran 40 inj. 1013 nrd 217 diazoxide 300 mg / 20ml inj. 1014 nrd 218 digoxin 2mg inj. 1015 nrd 219 diltiazem 25 mg inj. 1016 nrd 220 docetaxel 120 mg inj. 1017 nrd 221 doxycycline for injection 100 mg inj. 1018 nrd 222 durvalumab 120 mg ( monopoly ) inj. 1019 nrd 223 durvalumab 500mg ( monopoly ) inj. 1020 nrd 224 enalapril 1.25 mg 1 ml inj. 1021 nrd 225 ephedrine 30 mg / ml inj. 1022 nrd 226 epirubicin 50mg / ml inj. 1023 nrd 227 epirubicin 150mg / ml inj. 1024 nrd 228 eribulin 0.5mg inj. 1025 nrd 229 eribulin 1 mg inj. 1026 nrd 230 ertapenem sodium 1gm = ertapenem 1.046 gm inj. 1027 nrd 231 etomidate 20 mg inj. 1028 nrd 232 etomidate mct / lct 10ml vial inj. 1029 nrd 233 fentanyl 25iu patch patch 1030 nrd 234 fentanyl 50iu patch patch 1031 nrd 235 fluconazole 100mg inj. 1032 nrd 236 fluconazole 200 mg inj. 1033 nrd 237 fludarabine phosphate injection 100mg inj. 1034 nrd 238 fludarabine phosphate injection 50mg inj. 1035 nrd 239 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien inj. 1036 nrd 240 fluphenazine deconate injection ( long acting ) 25mg / ml ampule inj. 1037 nrd 241 folic acid +methylcobalamine 10 ml pack inj. 1038 nrd 242 fondaparinux 2.5mg inj. 1039 nrd 243 fosphenytoin sodium 150mg / ml inj. 1040 nrd 244 fsh 75 iu inj. 1041 nrd 245 fsh 150 iu inj. 1042 nrd 246 fulvestrant 250mg inj. 1043 nrd 247 gdw 5% glass bottle / 500ml inj. 1044 nrd 248 glyceryl trinitrate injection, diluted 5mg / ml inj. 1045 nrd 249 goserelin acetate implant 3.6 mg inj. 1046 nrd 250 haemocoagulase 1 ml inj. 1047 nrd 251 haloperidol ( long acting ) 50mg / ml ampoule inj. 1048 nrd 252 horse atg ( anti thymocyte globulin ) 250 mg inj. 1049 nrd 253 hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu inj. 1050 nrd 254 hp hmg ( highly human menopausal parodied gonadotropin ) 75 iu inj. 1051 nrd 255 hydralazine 20mg / ml inj. 1052 nrd 256 indomethacin lyophilized powder 1mg inj. 1053 nrd 257 inotuzumab1 mg ( monopoly ) inj. 1054 nrd 258 insulin aspart inj. 1055 nrd 259 insulin glulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges inj. 1056 nrd 260 insulin glulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen inj. 1057 nrd 261 insulin lispro inj. 1058 nrd 262 interferon beta 1 a 30mg inj. 1059 nrd 263 intralipds inj. 1060 nrd 264 invert sugar 10% ( fructodex 10% ) 500 cc inj. 1061 nrd 265 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml inj. 1062 nrd 266 ipilimumab 50 mg inj. 1063 nrd 267 irinotecan 40mg / 5ml inj. 1064 nrd 268 irinotecan 100 mg / 5ml inj. 1065 nrd 269 isolyte g inj. 1066 nrd 270 isolyte p 10% 500 ml inj. 1067 nrd 271 lacosamide infusion inj. 1068 nrd 272 levobupivacaine 0.5% ( 20mg / 4ml ) ampule inj. 1069 nrd 273 levofloxacine 500mg / 100 ml inj. 1070 nrd 274 levosulpride 12.5 mg / ml inj. 1071 nrd 275 lignocaine ( preservative free ) 2% inj. 1072 nrd 276 lignocaine + adrenaline ( 1:10000, 2:10000 ) inj. 1073 nrd 277 lignocaine 10% spray inj. 1074 nrd 278 lignocaine hydrochloride 2% 50ml vial inj. 1075 nrd 279 liposomal doxorubicin 20mg inj. 1076 nrd 280 liposomal doxorubicin 50 mg inj. 1077 nrd 281 lorazepam 1.0 mg inj. 1078 nrd 282 lorazepam 5 mg inj. 1079 nrd 283 l orinithine l aspartate 10 ml inj. 1080 nrd 284 low molecular wt. heparin 0.4mg inj. 1081 nrd 285 mephentermine 50mg / ml inj. 1082 nrd 286 meropenem 2gm inj. 1083 nrd 287 mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) inj. 1084 nrd 288 methotrexate 250 mg inj. 1085 nrd 289 methotrexate 1000 mg inj. 1086 nrd 290 methylene blue inj. 1087 nrd 291 methylprednisolon acetate 40mg inj. 1088 nrd 292 methylprednisolon acetate 125mg inj. 1089 nrd 293 metotrexate 15mg ( preservative free ) inj. 1090 nrd 294 midazolam 5mg / ml 1 ml inj. 1091 nrd 295 milrinone 10 mg inj. 1092 nrd 296 mitomycin 2 mg inj. 1093 nrd 297 mitomycin 40 mg inj. 1094 nrd 298 mitoxanthrone infusion 10 mg inj. 1095 nrd 299 mitoxanthrone infusion 20mg inj. 1096 nrd 300 moxifloxacin intra cameral 0.5% inj. 1097 nrd 301 moxifloxin 400mg / 100ml inj. 1098 nrd 302 multivitamin 10 ml inj. 1099 nrd 303 nabpaclitaxel ( paclitaxel nano particle ) 100 mg inj. 1100 nrd 304 nandrolone decanoate 100mg inj. 1101 nrd 305 nandrolone decanoate 50 mg inj. 1102 nrd 306 natalizumab 300 mg ( monopoly ) inj. 1103 nrd 307 neostigmine+ glycopyrrolate 2.5 mg / 0.5 mg inj. 1104 nrd 308 netilmycin 300mg / 3ml inj. 1105 nrd 309 nicardipin 10mg inj. 1106 nrd 310 nicorandil 48 mg inj. 1107 nrd 311 nimodipine infusion 10mg / 50 ml inj. 1108 nrd 312 nimotuzumab 50 mg inj. 1109 nrd 313 nivolumab 40 mg ( monopoly ) inj. 1110 nrd 314 nivolumab 100 mg ( monopoly ) inj. 1111 nrd 315 normal saline 500 ml glass bottle inj. 1112 nrd 316 normal saline 1000 ml glass bottle inj. 1113 nrd 317 octreotide 100mg inj. 1114 nrd 318 octreotide lar ( long acting release ) 20 mg inj. 1115 nrd 319 octreotide lar ( long acting release ) 30 mg inj. 1116 nrd 320 lidocaine1% intra cameral inj. 1117 nrd 321 omalizumab 150 mg vial inj. 1118 nrd 322 ornidazole 500mg inj. 1119 nrd 323 palonosetron 0.25mg inj. 1120 nrd 324 paracetamol infusion 500 mg with both temper evident caps spray 10% inj. 1121 nrd 325 paracetamol infusion 1000 mg with both temper evident caps spray 10% inj. 1122 nrd 326 peg asparaginase 3750 iu 5 ml inj. 1123 nrd 327 peg filgrastim injection 6mg inj. 1124 nrd 328 pembrolizumab 50 mg ( monopoly ) inj. 1125 nrd 329 pembrolizumab100 mg ( monopoly ) inj. 1126 nrd 330 pemetrexed 100mg inj. 1127 nrd 331 pemetrexed 500 mg inj. 1128 nrd 332 pertuzumab 100 mg inj. 1129 nrd 333 phenylephrine hydrochloride 10 mg / ml inj. 1130 nrd 334 pilocarpine 0.5% w / v inj. 1131 nrd 335 piperacillin 1 gm + tazobactum 125 mg inj. 1132 nrd 336 piracetam 200mg inj. 1133 nrd 337 placental extract 2ml inj. 1134 nrd 338 plerixafor 24 mg inj. 1135 nrd 339 polymyxin b for injection 1 million inj. 1136 nrd 340 potassium chloride for injection inj. 1137 nrd 341 procaine penicillin fortified 2 lack inj. 1138 nrd 342 protamine sulphate 5ml inj. 1139 nrd 343 rabbit atg ( anti thymocyte globulin ) 100 mg inj. 1140 nrd 344 ramucirumab 100 mg ( monopoly ) inj. 1141 nrd 345 ramucirumab 500 mg ( monopoly ) inj. 1142 nrd 346 ranizumab 10mg / ml inj. 1143 nrd 347 rasburicase 1.5 mg inj. 1144 nrd 348 recombinant fsh 150 iu inj. 1145 nrd 349 recombinant fsh 300iu inj. 1146 nrd 350 recombinant hcg 250 iu inj. 1147 nrd 351 recombinant lh 75iu inj. 1148 nrd 352 reteplase 18 mg inj. 1149 nrd 353 risperidone prolonged released depot 25 mg inj. 1150 nrd 354 risperidone prolonged released depot 50mg inj. 1151 nrd 355 rituximab 100 mg inj. 1152 nrd 356 rituximab 500 mg inj. 1153 nrd 357 rocuronium 100mg / 10ml inj. 1154 nrd 358 romiplostim 125 mcg inj. 1155 nrd 359 romiplostim 250 mcg inj. 1156 nrd 360 romiplostim 500 mcg inj. 1157 nrd 361 ropivacaine 0.75% 20ml vial inj. 1158 nrd 362 ropivacaine 0.75% 3 ml ampule ( heavy ) inj. 1159 nrd 363 secukinumab 150 mg inj. 1160 nrd 364 sildenafil 0.8mg inj. 1161 nrd 365 sodium bicarbonate injection inj. 1162 nrd 366 sodium fluroresceine dye 20% inj. 1163 nrd 367 sodium hyaluronate 1.4mg inj. 1164 nrd 368 streptomycin 1gm inj. 1165 nrd 369 streptomycin 500mg inj. 1166 nrd 370 sugmadex inj. 1167 nrd 371 teicoplanin 200 mg inj. 1168 nrd 372 teicoplanin 400 mg inj. 1169 nrd 373 tenecteplase 20mg inj. 1170 nrd 374 tenecteplase 40 mg inj. 1171 nrd 375 testosteron propionate 50mg inj. 1172 nrd 376 testosteron propionate 250mg inj. 1173 nrd 377 thiamine 100ml inj. 1174 nrd 378 ticarcillin and clavulanic acid inj. 1175 nrd 379 tigecycline for injection 50mg inj. 1176 nrd 380 tigecycline for injection 100mg inj. 1177 nrd 381 tobaramycin 80mg inj. 1178 nrd 382 topotecan 1 mg inj. 1179 nrd 383 topotecan 2.5 mg inj. 1180 nrd 384 topotecan 4 mg inj. 1181 nrd 385 t pa 20mg alteplase for injection inj. 1182 nrd 386 t pa 50mg alteplase for injection inj. 1183 nrd 387 trabectedin 1 mg inj. 1184 nrd 388 tranexamic acid 500mg / 5ml inj. 1185 nrd 389 trastuzumab 440 mg inj. 1186 nrd 390 trastuzumab150mg inj. 1187 nrd 391 triamcinolone acetonide 10 mg per ml inj. 1188 nrd 392 triamcinolone acetonide 40 mg per ml inj. 1189 nrd 393 trypan blue 0.6% inj. 1190 nrd 394 triptorelin 0.1 mg inj. 1191 nrd 395 triptorelin 3.75 mg inj. 1192 nrd 396 triptorelin 11.25 mg inj. 1193 nrd 397 varicella immunoglobulin for iv use inj. 1194 nrd 398 vasopressin 3ml inj. 1195 nrd 399 verapamil 2.5 mg / ml inj. 1196 nrd 400 vinorelbine 10mg inj. 1197 nrd 401 vinorelbine 50mg inj. 1198 nrd 402 vitamin d ( 600000 iu ) inj. 1199 nrd 403 insulin glargine 300 iu per ml / prefilled pen inj. 1200 nrd 404 insuline 50 / 50 inj. 1201 nrd 405 xylocaine lubricating 30gm jelly 1202 nrd 406 lignocaine 4% 30ml 1203 nrd 407 lignocaine viscous 1204 nrd 408 liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) inj. 1205 nrd 409 l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) cap. 1206 nrd 410 asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl 17% lotion 1207 nrd 411 clotrimazole 1%+beclomethasone 0.25% lotion 1208 nrd 412 ketaconazole 2% lotion 1209 nrd 413 minoxidil 2% lotion 1210 nrd 414 minoxidil 5% lotion 1211 nrd 415 minoxidil 10 % lotion 1212 nrd 416 podophyliin toxin lotion 1213 nrd 417 sulphur + calamine lotion 1214 nrd 418 sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 lotion 1215 nrd 419 clotrimazole 10mg lozenses 1216 nrd 420 ( medium chain triglyceride ) oil 1217 nrd 421 budesonide 200 mcg. mdi 1218 nrd 422 formeterol 6mcg.+ fluticasone 250 mcg. inhalation, etc...

Medical And Health Services - Rajasthan

34045573 rate contract for lab regents 1 hb 2 tlc 3 dlc 4 mp ( slide methods ) 5 esr 6 bt 7 ct 8 cbc 9 blood group 10 blood sugar 11 blood urea 12 serum creatinine 13 serum bilirubine ( t ) , 14 serum bilirubine ( d ) 15 sgot 16 sgpt 17 s.alk.phos 18 s.total protein, 19 s.albumin 20 v.d.r.l.rapid test 21 hiv rapid test 22 sputum for afb 23 widal slide test 24 urine sugar / albumin ‘. 25 urine pregnancy test..n 26 stool for ova and cyst 27 x ray 28 ecg 29 total red blood cell count platelet count by cell counter packed cell volume ( pcv ) serum cholestrol s.hdl s.vldl, 35 s.triglyceride 36 urine complete by strip — method 37 urine microscopy 38 cover slip 39 glass slid 40 tjssu papera ft ukuid para fin oil, 42 filteraupapera? 43 esr tube ( disposableja 44 d. water 45 sprit 46 testt1jbe ( apland ) ? 47 blood sugar stirp ( eligance ) 48 sulphr powdar 49 weak iodin / nitrcacid 50 letmus paper blue / red 51 urine contener 52 micro pipet ) ( sapsonn ) 53 lencet 54 micro tip ( yellow ) 2 20o ul 55 micro tip ( blue ) 200 1000 ul 56 hemocue ( hb strip ) 57 applicator strip 58 forcep 59 slide box 60_ silver / iron tray 61 i bowl, 63 glass beakar 64 glass keep 65 spirit lamp 66 lance cleaner solution 67 hb meter 68 plane vial 69 clotting vial 74 broom stick 75 testtube stand 76 droping bottal big 77 droping bottal small 78 dropper . 79 testtube holder 80 sude stand 81 sputum slide stain stand 82 paper clip 83 digital timer 84 digital watch 85 silicon oil 86 vacudaner tube. 87 vaccume vial 88? aslo 89 cell count & bio_ _e__ chemlstry ( csf / pleural / ascit ) 90 coombs test direct, 91 coombs test_ _____? i ndi rect 92 coombs test_ in direct 93 hbs ag ( rapld ) test 94 malaria by card test 95 prothrombin time test inr 96 rheumatoid ractor ( rf ) s.crp 98 semen analysis sperm cou nt ( manuall serum amylase 100 serum ck mb 101 serum ck nac 102 serum calcium 103 senum ldh 104 serum uric acid 105 tec total eosinophilic count...

Medical And Health Services - Rajasthan

34042665 supply of laboratory reagent and chemicals 1 albumin test kit ( 120 ml x 1 pcs ) • 2 i anti a, b, d blood group ( each 10 ml ) 3 i bilirubin t & d kit ( 120 test kit ) 4 blue tips ( 500 pcs in one packet ) 5 bt ct tube ( 100 test kit 6 cholesterol test kit ( 50 , test kit ) 7 horiba cleaner ( 1 litre ) 8 creatinine kit ( 100 ml x 1 pcs ) 9 horiba diluent ( 20 itr x 1 pcs ) 10 esr tube ( one pcs use and throw ) 11 sugar kit ( 400 ml ) 12 hdl direct kit ( 40m1 ) 13 hemocue 301 cuveete ( per pcs ) 14 jsb soln 1 ( 500m1 ) 15 jsb soln 2 ( 500 ml ) 16 k3edta vial ( per pcs ) 17 horiba lyse ( 1 itr ) , ( 19 20 21 22 23 pregnancy card kit ( one pcs ) sgot test kit ( 100 test kit ) sgpt test kit ( 5x20 ml, 100 test kit ) slide pkt ( 50 slides x 1 pcs ) total protein kit ( 100 test kit ) triglycerides kit ( 50 test kit ) 24 urea kit ( 100 ml x 1 pcs ) 25 urine / sputum container ( per pcs ) 26 urine strips 02p ( 1 box x . 100 pcs ) 27 widal test kit ( 4 x 5 ml set ) —28 yello tips ( 1000 pcs in one packet ) 29 sugar strip ( per pcs ) 30 vdrl kit 31 cover slip 32 h260 lyse 500 ml ( erba ) 33 34 h 360 dilluent 20 it ( erba ) h clean 50 ml ( erba ) 35 albumin test kit ( 120 ml x 1 pcs ) • 36 anti a, b, d blood group ( each 10 ml ) 37 38 bilirubin t & d kit ( 120 test kit ) cbc roll...

Sarva Shiksha Abhiyan Authority - Rajasthan

34031513 supply and installation of lab equipments and material for vocational education lab tourism and hospility supply and installation of lab equipments and material for vocational education lab tourism and hospility , tables with wood plank laminated table top and base of steel 1. wooden table of size 24x 24 for two persons 1. round table with size 44 with sitting capacity of 4 to 6 persons , dining chairs type of seat wood, material of frame: ms powder coated, chair height : 900 mm, backrest width: 400 mm, width of seat : 450 mm, depth of seat 450 mm, height of seat: 450 mm, seat finish mica , side station wooden side station: usually consists of a set of cabinets, or cupboards, and one or more drawers, all topped by a flat display surface for conveniently holding food, serving dishes, and even lighting devices. the overall height of the tops of most sideboards is approximately waist level. approx dimensionheight 42, width 48, depth 24 , bar counter ( front and back bar ) wooden bar counter with mirror ( as per image ) counter: granite top, finishing: shinny polished, design: modular, led lights: yes height of back bar 2260 mm, length of back bar 2600 mm, depth of back bar 350 mm. height of counter 1095 mm, length of counter 2615 mm, depth of counter 590 mm , storage cabinet this stainless steel cupboard used in restaurentssize: 1000x500x1800 , dinner plate 11 material of the plate: melamine, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 280, overall thickness of plate ( mm ) 2, product type: dinner plate , dessert plate 9 material of the plate: melamine, shape of the plate: round, overall diameter or diagonal of plate ( mm ) 230, overall thickness of plate ( mm ) 2, product type: dinner plate, size: 9 inch , b&b plate material of the plate : melamine, diameter of plate ( mm ) : 100, colour: white, pattern: plain, measurement : 15 cms in diameter , tea cup material ceramic, artistic design, pattern machine crafted, capacity 200 ml , tea saucer usage: serving tea, material melamine, size 146 mm , soup bowl shape round, colour multi, material of the bowls melamine, length of bowl 120 ( mm ) , width of bowl 120 ( mm ) , height of bowl 55 ( mm ) , capacity of bowl 300 ( mm ) , , soup bowl 4.5 chinese colour musk, size 4.5 inch, capacity 250 ml, shape round, material melamine, pattern plain , soup spoon chinese material: melamine , size ( mm ) : 16 x 4 x 1.2 , colour: white spoon with a short, thick handle extending directly from a deep, flat bowl. , service bowl 1 port 6 shape: square bowl, material: microwave safe plastic, size mm ( l*b*h ) : 110*110*50, capacity 125 ml , service bowl 2 port 7 shape: round bowl, material: microwave safe plastic, size mm ( l*b*h ) : 50*30*30, capacity 125 ml , service platter 1 port 10 service platter 1 port 10 material melamine, edge type : rolled edge, microwave, colour white , service platter 2 port 12 material melamine, edge type : rolled edge, microwave, colour white , pasta plate 11 material: melamine, colour red, yellow, blue and white , cereal bowl capacity : 1.00 ltr, colour red, green, blue, white, yellow, brown , chutney bowl small shape: round bowl, colour: yellow, material of the bowls melamine plastic, length of bowl ( mm ) 70, width of bowl ( mm ) 70, height of bowl ( mm ) 60, capacity of bowl ( ml ) 75 , tea spoon material: stainless steel, type: tea spoon ( small ) , size: 18 / 8, 18 / 10 and 18 / 0, colour: steel grey , dessert ( a.p ) spoon dessert ( a.p ) spoon material: stainless steel, colour: silver, finish: mirror , dessert ( a.p ) fork finish: chrome finish, weight: 50 gm, size: 10 12 cm material: stainless steel fork type: desert fork , size: 10inch, colour white, material melamine , dessert knife material: stainless steel colour: silver, size: 2.00mm , table service spoon thickness: 2mm, size: 5 7 inch ( length ) , material: stainless steel, finish type: mirror polish , table service fork material stainless steel, finishing polished, size: 178.6 mm, weight: 5.47 gm , tea strainer material of strainer stainless steel, diameter of stainless steel wire in mesh ( mm ) 0.24, strainer mesh aperture ( micron ) 700 , tea set cup: 6 pcs, saucer: 6 pcs , teapot 1 , milk pot 1 , sugar pot 1 , water jug capacity ( ml ) 2200: wall thickness of jug ( mm ) 1.3 mm, material of jug: food grade plastic food , material of lid: grade plastic, shape round cylindrical, capacity ( ml ) 2200 , salt and pepper set material: stainless steel, colour: any, packaging type: box, shape: round, height: 5 8 inch , tooth pick holder material: stainless steel, colour any, size: 4, 5 inches , straw holder material: stainless steel, colour: any, height: 105 mm , sugar sachet holder material: stainless steel, dimension: 5.1 x 2.4 x 1.5 inches, colour: silver, shape: square, finishing ceramic finish , material: stainless steel, size: 16cm.x11cm.x4cm., colour silver, material brass, finishing powder coating , finger bowl large with under liner material: metal, size ( cm ) : 20 / 22 / 24 / 26 / 28 / 30 , finishing: polished , entree dish round with lid ( 1 portion ) shape round, capacity 450 ml, finishing chrome , entree dish round with lid ( 2 portion ) shape round, capacity 500 ml, finishing chrome , oval platter material stainless steel, product depth 24, product width 16, product height 1.50, style minimalist, modern , reserved stainless steel reserved table sign, booked stand reserve seats for guests , round service tray material metal, size: 12, 14, 16 inches, finish nickle plated, pattern plain, , rectangular service tray material: aluminium, size: 12 * 6, depth 2.5 cm, weight: 200 250 grams, surface finish: matt , ash tray material wooden, shape square, type smokeless, colour: brown & golden, size / dimension: 10 x 10 x 4 cm , tom collins ( glass ) capacity: 250 300 ml, material: glass, microwave safe: yes, thickness: 2 7 mm, shape: cylindrical , hi ball material: polycarbonate, capacity: 240 270 ml, colour: clear , pilsner material: glass, head shape: round, size: 300ml, thickness: 4 10 mm, colour: transparent, , decanter small capacity: 50, 100 ml, material: glass, colour : transparent, , decanter large capacity: 150 ml, material: glass, colour : transparent, , wine glass size: standard, colour: transparent, material: borosil glass , table cloths material: cotton, colour: white and blue, size: 54 x 54 inch , table napkins table cotton cloth napkins, specification 60*60 cm. , bar tool kit material: stainless steel, finish: graphite , cocktail shaker material: stainless steel with copper plating, size: 1 l, colour silver, dimension ( inches ) : 4.70...

Medical And Health Services - Rajasthan

34006749 supply of lab regent & x ray 1 blood urea 2 serum creatnine 3 serum bilrubim 4 sgot 5 sg pt 6 s. cholestrol 7 s. triglyceride 8 s. hdl 9 blood sugar kit 10 blood sugar strips 11 widal kit 12 alkaline phosphate. 13 albumin 14 protien 15 ecg roll 80mm*20mtrs 16 ecg jelly 17 cbc roll 18 horiba mindil lmg 19 horiba cleaner 20 horiba lysebio 21 abx min clair 22 hbsag card 23 hcv card 24 urine strips 2p 25 urine strips 10 p rapid 26 sodium citrate 27 wbc fluid 28 leishman stain 29 jsb stain a 30 jsb stain b 31 n / 10 hcl 32 clot vials 33 edta vials 34 urine container 35 test tube small 36 plain vial 37 coverslips 38 glass slides 39 bt / paper 40 • ct / cappilary tube 41 yellow tips 42 syphilis strips 43 esr tube 44 hb pippet 1 x ray 10*12 2 x ray 12*15 3 x ray 8*10 4 x ray 14*17 5 devloper 6 fixer...

Medical And Health Services - Rajasthan

34006311 supply of lab regent 1 cbc fuid ( mini dail lmg ) 2 c8c fuid lysebio 3 cbc fuid cleaner cbc printingrooll 5 cretinine kit 6 se.billirabin kit 7 sgot kit 8 sgpt kit 9 se. albumin kit 10 vdrl kit / strip 11 hiv rapid test / tri dot 12 widal kit 13 pregnency card 14 cbcedtavoial 5 1 hdl&cholestrol & triglceride 16 field stain a&b, 17 hb!pipet? 18 dispo urine conter 19 jsbt1&2t 20 tarniquit 21 cbc roll 22 dispo pepet 23 urine strip alb / sugar 24 nideel 25 despovansyring with needal 2ml, 26 hb strip 44 dist.water 27 hbsag 28 uristrip 10 pm 29 uristrip 2pm 30 sugar kit / strip 31 bluetips50oe1 32 glass testtube 33 hand wash solution 34 arkayabd 36 blood glass slide 37 paraffion 38 3.s.b. i 39 j.s.b. il stain 40 esrpipeds 41 cover slips 42 tips ( yellow, white ) 43 b.urea kit 45 micro pipeds, 46 abx minoclar 47 abx hypo 48 glucometer stips 49 uptstips 50 akalin phasphote 51 urine billsett 52 bill pigment 53 ueshman stain 54 n / 1ohcl, 1 film 14x17 2 film 12x15 3 film 10x12 4 film 8x10 5 i developer 6 fixer....

District Collector - Rajasthan

34003492 yearly supply of kirana items 1 wheat atta ( ashirwad ) 10 kg 2 wheat atta ( shakti bhog ) 10 kg 3 thar oil groundnuts / 15 liter per tin 4 21 no. groundnuts oil / 15 liter per tin 5 ramdev groundnuts oil / 15 liter per tin 6 desi ghee ( saras ) 1 liter per lt 7 desi ghee ( / amul ) 1 liter per lt 8 rice basmati ( lalqilla ) 5 kg per pack 9 rice basmati ( dulhan ) 5 kg per pack 10 papad ( babulalbishan ) massala stan. quality per kg 11 papad ( babulalbishan ) sadda stand. quality per kg 12 besan ( laxmibhog ) per kg 13 besan ( shakti bhog ) per kg 14 maida ( double talwar delhi ) per kg 15 suji ( double talwar ) per kg 16 mix kair sangri per kg 17 toor dal regular ( standard wholesale quality ) per kg 18 urad wash ( standard wholesale quality ) per kg 19 urad split ( standard wholesale quality ) per kg 20 urad split ( tata i shakti ) per kg 21 urad whole ( standard wholesale quality ) per kg 22 moongchilka ( standard wholesale quality ) per kg 23 moongmogar ( standard wholesale quality ) per kg 24 moong split ( standard wholesale quality ) per kg 25 red masoor ( standard wholesale quality ) per kg 26 dal chana ( standard wholesale quality ) per kg 27 kabuli chana ( standared big size ) per kg 28 kala chanasabut ( standared big size ) per kg 29 rajma red ( standared big size ) per kg 30 chola whole ( standared big size ) per kg 31 moong dal ( standared big size ) per kg 7 32 arhar dal ( standared big size ) per kg 33 badimangodi masala marwadi per kg 34 mangodisada, jain per kg 35 sugar ( balrampur ) 5 kg 5 kg 36 sugar refined 10 kg packing 10 kg 37 gud ( barelly ) per kg 38 tata salt per kg 39 saindhanamak 100 gm 40 kala namak 100 gm 41 souf big 100 gm 42 souf small ( lucknowi ) 100 gm 43 garam masala powder ( mdh ) 100 gm 44 coconut powder ( mangal ) 500 gm 45 khuskhus ( rani ) 500 gm 46 mishri cutting 500 gm 47 elaichichoti 100 gm 48 mdh red chili powder ( 500 gms. ) per pkt 49 mdh dhaniya powder ( 500 gms. ) per pkt 50 mdh amchoor powder ( 100 gms. ) per pkt 51 mdh termeric powder ( 500 gms. ) per pkt 52 mdh chat masala ( 100 gms. ) per pkt 53 mdh kasaurimethi ( 100 gms. ) per pkt 54 mdh chana masala ( 100 gms. ) per pkt 55 mdh meat masala ( 100 gms. ) per pkt 56 mdh rajma masala ( 100 gms. ) per pkt 57 mdh kitchen king ( 100 gms. ) per pkt 58 mdh black peeper ( 100 gms. ) per pkt 59 mdh while peeper ( 100 gms. ) per pkt 60 catch hing ( 100 gms. ) per pkt 61 mdh hing ( 100 gms. ) per pkt 62 tatery 100 gms. ) per pkt 63 imli whole ( without seeds ) 500 gm per pkt 64 anardana ( 100 gm ) per pkt 65 jam kissan per pkt 66 soup packet ( maggi ) per pkt 67 black peeper powder pack 100 gm per pkt 68 real juice ( dabur ) per lt 69 real juice ( tropicana ) per lt 70 mashroom tin 800 gm per tin 71 long ( 100 gm ) per pkt 72 jaiphal 100 gm ) per pkt 73 dodailachi 100 gm ) per pkt 8 74 tezpatta 100 gm ) per pkt 75 black peeper whole 100 gm ) per pkt 76 saharzeera 100 gm ) per pkt 77 daalchinni 100 gm ) per pkt 78 sonth 100 gm ) per pkt 79 kalongi 100 gm ) per pkt 80 mutter tin 800 gm pack per pkt 81 bambino vermicili ( druks packet ) 900 gm per pkt 82 dabur tomato puree tin 800 gm per tin 83 mohuns tomato puree tin 800 gm per tin 84 mohuns corn flakes packet 500 gm per pkt 85 kellogs corn flakes packet 500 gm per pkt 86 kellogsmusli nuts 550 gm per pkt 87 kellogs oats 500 gm per pkt 88 sabut jeera 1 kg per pkt 89 red lable tea ( tetra pack ) 500 gm per pkt 90 lipton green label tea ( packet ) 500 gm per pkt 91 taj tea begs ( packet ) 25 beg pack per pkt 92 kissan tomato ketchup 1 kg per pkt 93 nescafe classic coffee ( jar ) 100 gm per pkt 94 milk powder tetra pack ( amul ) 500 gm per pkt 95 sugar cubes ( daurla ) 500 gm per pkt 96 sugar free ( small ) dabur per pkt 97 pickle mix ( nirlons ) 1 kg per pkt 98 pickle mix ( shree ) 1 kg per pkt 99 biscuits ( monaco ) 100gm per pkt 100 biscuits ( good day ) 100gm per pkt 101 biscuits ( dark fantasy / chocofills ) 75gm. per pkt 102 jelly ( rex ) 100 gm per pkt 103 frozen peas ( safal ) 1 kg per pkt 104 silver foil ( kitchnmat ) 32 meter per pkt 105 paper napkins per pkt 106 custard powder ( wekfield ) 100 gm per pkt 107 custard powder ( tops ) 100 gm per pkt 108 corn flour ( wekfield ) 500 gm per pkt 109 corn flour ( tops ) 500 gm per pkt 110 fruit cocktail tin ( morton ) 800 gm per pkt 111 fruit cocktail tin ( mohuns ) 800 gm per pkt 112 tooth pick per pkt 113 bikanerybhujiya 1 kg. ( bhikha / babu ) per pkt 114 bikanerybhujiya 500gm. ( bhikha / babu ) per pkt 115 bikanerybhujia mottey500 gm ( bhikha / babu ) ) perpkt 9 116 poha ( healthy choice ) 1 kg per pkt 117 poha ( tounch ) 1 kg per pkt 118 ground nut ( kachhi ) 250 gm per pkt 119 sabudana ( sacchamoti ) 1 kg per pkt 120 daliya ( gangaur ) 1 kg per pkt 121 sarso oil ( engine ) 1 liter...

Medical And Health Services - Rajasthan

34002870 supply of lab item 1 albumin test kit 2 alkaline phosphate tcst kit 3 anti a+b+d tcst kit 4 bilirubin test kit ( t&d ) 5 cholesterol test kit 6 blood sugar tcst kit 7 urea test kit ( bun ) 8 bovine albumin 22% 9 buffer solution , _. 10 buffer solution ill 4.0 11 buffer solution ph 9.2 . 12 capillary. tube / ct 13 cleaner cbc ( abx cleaner ) 14 cons.cleaner cbc ( abx minoclair ) 15 coombs sera 16 counting chambr neubaure bright line 17 cover slip 18 croat inine test kit 19 dengue test card 20 diluent cbc ( abx nitirtidil inig ) 21 distilled water 22 e.d.t.a. n / 50 solution 23 e.d.t.a. test tube k3 edta 24 eosinophill count fluid 25 esr dispo tube , 26 esr stand 27 esr glass tube 28 1 face mask , 29 field stain a malaria 30 field stain b malaria 31 filter paper 32 glass marking pencil 33 glass slide 34 gluco meter 35 h2 so4 36 fib paper book 37 i ib tube squrc 38 hiv blot me test kit 39 hiv comb. aid kit 40 hiv tridot test kit 41 hydrochloric acid n / l0 42 iodine liquid r 43 lcnse paper book 44 liquid paraffin oil. 1.. 45 lishmans stain 46 lysc cbc ( abx lyscbio ) 47 malaria rapid test card anrtigen 48 methelent blue 49 micro pipette fix 50 micro popette any range variable volume 51 micro tips ( blue ) 2 1000ul 52 micro tips yellow 2 200u1 53 normal stine 54 phcnyal 55 piston pump esr 56 platelateicount fluid 57 pregnancy test card 58 prinking needle ( lancet ) 59 pvc tube centrifuge machine 60 r.b.c. diluting fluid 61 s. hdl cholestrol direct method 62 sample container disposable 50 ml 63 test tube with cap ( plain ) 64 test tube without cap ( plain ) 65 sgot test kit 66 sodium citrate 3.8% 67 sodium hypochlorite solution 68 sprit . 69 sub. group. a . 70 sub. group. b 71 sulpher powder 72 timer electronic 73 tissue paper roll 74 tlc fluid 75 tlc pipette test 76 total protein kit . 77 triglyccrides tcstt it 78 urine container 79 uristix ( aim sugar ) 80 uristix ( multi ) 81 v.d.r.l.test strip kit 82 vldl cholestrol test kit 83 w.b.c. diluting fluid 84 widal slide test kit. 85 hdl cholesterol indirect method 86 sgpt test kit 87 fib. microcuvettes ( hcmo tie elb 301 ) glue ( ) meter strips 88 89 erba wash 90 liquid paraffin oil 91 test tube stand 92 cbcthurmal paper roll 93 erba xi glucose ( folly auto analyser ) 94 erba xi urea ( fully auto analyser ) 95 erba xl enzymatic creatininc ( fully auto analyser ) 96 erba xl billirubin total ( fully auto analyser ) 97 erba xl billirubin direct ( fully auto analyser ) 98 erba xl scot el ( fully auto analyser ) 99 erba xl.sgpt elifully auto analyser ) 100 erba xl alkaline phosphate ( fully auto analyser ) erba xl total protein ( fully auto analyser ) 101 102 erba xl albumine ( fully auto analyser ) 103 erba xl cholestranfully auto analyser ) 104 erba xl hdl direct ( fully auto analyser ) 105 erba xl triglyceride ( fully auto analyser ) 106 erba norm ( fully auto analyser ) 107 erba path ( fully auto analyser ) 108 erba xl multical ( fully auto analyser ) 109 erba auto wash ( ft 01y auto analyser ) 110 erba ac / al wash ( fully auto analyser ) 111 sample cup ( 1ml ) ( fully, autotanalyser ) 112 sample cup ( 2ml ) ( hilly auto analyser ) ...

Medical And Health Services - Rajasthan

34002771 supply of laboratory testing material, x ray film and regent 1 n / 10 hcl ( 500 ml. ) 2 microscopic glass slides 75x25 mm. 3 esr disposable plastic cup 4 esr disposable plastic tube 5 esr glass tube iesrite 6 capilliary tube ( non heparinized ) 7 hemo cue hb 301 cuvette 8 _ printing roll for cbc machine ( abx micros horiba ex 60 ) dilute minidil lmg for cbc machine ( abx micros horiba ex 60 ) ( pack size 20 / 10 ltr. ) 10 lysebio for cbc machine ( abx micros horiba ex 60 ) ( 1 ltr. pack ) 11 cleaner for cbc machine ( abx micros horiba ex 60 ) ( 1 ltr. pack ) 12 minoclair for cbc machine ( abx micros horiba ex 60 ) 13 hypochlorite solution 5 to 6 % ( 5 ltr. pack ) 14 platelet diluting fluid 100 ml. pack 15 tlc diluting fluid ( 100 ml. ) 16 blood grouping antisera ( a, b, d ) 17 glucostrip sd code free glucometer 18 blood urea kit 19 blood glucose kit 20 serum creatinine kit 21 bilirubin kit ( total & direct ) 22 sgot kit 23 sgpt kit 24 alkaline phosphatase kit 25 total protein kit 26 serum albumin kit 27 total cholestrol kit 28 tri glyceride kit 29 hdl cholestrol kit 30 vdrl test card 31 hiv test card 32 ecg balls 33 widal test kit 2 ( to, th ) ; ( to, th, ah, bh ) 34 microscopic cover slip . 35 urine ( albumin sugar ) test strip 36 urine multi test strip ( complete exam ) 37 normal saline 0.9% 38 edta k3 vaccutainer stopper vials 39 clot activater fluoride stopper vials 40 tissue paper roll 41 cotton absorbant 42 weak iodine 43 urine pregnancy test card 44 giemsas stain ( 100 ml. ) 45 leishmans stain with buffer 46 j.s.b. stain ( 1 ) 47 j.s.b. stain ( 2 ) 48 deionised distill water 49 disposable pricking lancet 50 disposable syringes sml. 51 erba wash soln kit 52 sterile sputum container 53 sterile urine container 54 disposable dropper 55 liquid paraffin ( 500 ml. ) 56 cnnn a 73 fterfj 1 jti— a 1 .1, 1_1^1 57 tourniquet 58 test tube wash brush 59 micro tips 1000 micro l. capacity 60 micro tips 100 micro l. capacity 61 borosil glass tube 1cm. 62 surgic scrub lotion ( hand wash ) 63 abx minotrol 64 abx minocel 65 sodium cytrafe 3.8% 66 blood mixer ( rotator ) 67 printing roll for semi auto anylizer 68 phenol ( carbolic acid crystel ) isy: for pregnant women 69 hbs. ag. test kit x ray machine 70 x ray films polyster base blue sensitive double coated size 8x10 71 x ray films polyster base blue sensitive double coated size 10x12 72 x ray films polyster base blue sensitive double coated size 12x15 73 dental x ray film f speed 74 x ray chemical developer powder ( 22.5 ltr. pack ) 75 x ray fixer ( 22.5 ltr. pack ) 76 medical dry film di hl size 8x10 ( fuji film ) 77 medical dry film di hl size 10x12 ( fuji film ) ....

Medical And Health Services - Rajasthan

34002365 supply of laboratory testing material x ray film and regent 1 n / 10 hcl ( 100m11500 ml. pack ) 2 microscopic glass slides 75x25 mm. 3 esr disposable plastic cup 4 esr disposable plastic tube 5 esr glass tube esrite 6 capilliary tube ( non heparinized ) 7 hemo cue hb 301 cuvette 8 printing roll 9 dilute for cbc machine ( pack size 10 ltr. / 20 ltr. ) 10 lysebio for cbc machine 11 cleaner for cbc machine • • minoclair wash solution 13 hypochlorite solution 5 to 6 % 14 platelet diluting fluid 15 tlc diluting fluid 16 blood grouping antisera ( a, b, d ) 17 glucostrip for sd code free glucometer 18 blood urea kit 19 blood glucose kit 20 serum creatinine kit 21 bilirubin kit ( total & direct ) 22 sgot kit 23 sgpt kit 24 alkaline phosphatase kit 25 total protein kit 26 serum albumin kit 27 total cholestrol kit 28 tri glyceride kit 29 hdl cholestrol kit 30 wash solution kit ( 50 ml. pack ) , 31 vdrl test card 32 hiv test card 33 capilliary tube ( non heparinized ) 34 widal test kit ( to, th, ah, bh ) 35 widal test kit 2 ( to, th ) 36 microscopic cover slip / cover glass 37 urine ( albumin sugar ) test strip 38 urine multi test strip ( complete exam ) 39 normal saline 0.9% 40 edta k3 vaccutainer stopper vials 41 clot activater fluoride stopper vials 42 clot activater plain stopper vials 43 tissue paper roll 44 cotton absorbant 45 weak iodine 46 urine pregnancy test card 47 giemsas stain 48 cytochrome stain with buffer ( 10011 ) 11500 ml. pack ) 49 j.s.b. stain ( 1 ) ( 100m1. / 500 nil, pack ) 50 i.s.b. stain ( 2 ) ( 1001111. / 500 ml. pack ) 51 deionised distill water 52 disposable pricking lancet ( 50 / 100 lancet pack ) 53 disposable syringes 5m1. 54 sterile sputum container 55 sterile urine container 56 disposable dropper 57 liquid paraffin ( 100 ml. / 500 ml. pack ) 58 sprit absolute alcohol 59 tourniquet 60 test tube wash brush 61 micro tips 1000 micro ltr. capacity ( transparent colour ) 62 micro tips 100 micro ltr. capacity ( transparent colour ) 63 borosil glass tube 1cm. 64 surgic scrub lotion ( hand wash ) 65 phenol ( carbolic acid crystel ) 66 hiv syphlis combined test kit 67 hbs. ag. combined test kit 68 x ray films polyster base blue sensitive double coated size 10x12 69 x ray films polyster base blue sensitive double coated size 12x15 70 dental x ray film 71 72 73 x ray chemical developer powder ( 22.5 ltr. pack ) x ray fixer ( 22.5 ltr. pack ) medical dry film di hl size 8x10 74 medical dry film di hl size 11x14...

Medical And Health Services - Rajasthan

34001745 supply of medical and surgical equipments 213 acycluvir crean bp 5% 2 acyclovir suspension ljsp 400ing15m1 3 lacyclosfir tablets ip 200 mg 4 64 jacyclovir tablets ip 800 mg 6 34 65 dhasivc plaster n.5cr adrenaline injection ip lmg / m1 lbendabole oral suspension 400 ne 10ml 66 lbendazole tablets ip 400 mg 9 339 iprazolam tablets ip 0.25 nap 10 340 11 260 iprazolam tablets ip 0.5mg minium hydroxide tab. nfi formula df chewabletab contains magnesium riesiliage ip 250mg, dried aluminium hydroxide gel ip 120mg, peppermint oil .003m1 12 67 ikacin injection ip 100 mg 13 68 mikacin injection ip 500 mg rininophylline injection ip 25 mg / ml 14 15 16 17 365 341 461 itriptyline tablets ip 25mg film .oated amlodipine and atenolol tablets [ amlodipine besilate equivalent to amlodipine 5 mg atenolol 50 mg ] 184 amlodipine tablets, ip tt‘g 18 19 20 21 l8$ 69 70 22 23 amlodipine tablets ip 5 mg amoxycillin and cloxacillin capsules 1250mg + 250 mg kmoxycillin and potassium ciavulanate cabs ip 500 me+125 mg 73 rnoxycillin capsules ip 250mg mcixycillin capsules ip 500mg moxycillin trihydrate dispersible tablets ip 125mg 24 412 lainpicillin c apsules [ p 26 75 .arnpieillin injection 500 mg 26 27 iampicilline+cloxaeine 250 in_ 261 antacid liquid each sail contains. aluminium hydroxide gel 250 mg, magnesium trisilicate ?50mg, methyl polysiloxane 50mg ; 225 rtuni a blood groving serum ( anti 28 a monoclonal sawn ip ) 29 226 nti b bkoil grouping serum 30 227 nti dri1 blood grouping serum , 31 228 anti 0 blood grouping serum 32 0 anti snake injection 33 0 antibiotic. ear drop cipro 34 0 ancifungel ear drop 35 387 ascorbic acid tablets ip 500 mg 36 16 aspirin tablets ip 300 mg 37 186 latenolol tablets ip 50 mg 38 187 latorvastatin tablets ip lonig 39 1 atropine sulphate injection 06 imglml ( sc / inviv tise ) , • 40 7s aziiktomycin tablets ip 100 mg dispersible tabs 41 79 i thromycin tablets ip 250 mg 42 80 i thrornycin tablets ip 500 mg 43 andage 4 44 0 t: a.ndage 6 46 366 : eclomethasonc inhalation ip•200 lidose ►6 230 : nedicts solution ( qualitative ) 47 81 benzathine beazylpenicillin inj p 12 lac units 48 82 enrathine benzylpenicillin inj ip 6 lac its 49 i ; etamediatone sodium phosphate 418 injestion ip 4nteml 50 s 35 retamethasont tablets ip 0, 5mg 51 279 biiahasic isaphane his din injection ip 30% soluble insulin & 70% lsophane insulin ) inj 40 ilitml ( r•dna origin ) 1 52 262 • isacodyl tablets ip 5 mg 53 398 lack disinfectant fluid ( phenyl ) ( as per schedule 0 grade iii 54 0 black g , nle 55 367 budesonide nebuliber suspension d.25mge ml 56 0 tlyoscine butyl bromide . 57 0 arbopro&t gel 58 214 alamine lotion ip 59 388 alcium glucose injection ip 10% ( iv use ) 60 389 • iciwn lactate tablets ip 300 mg 61 54 rbanutzepine tablets1p 100 mg ( film ed ) • 1 . , cs i w 53 arbamazepine tablets rp 200 mg ( film oated ) i u� 281 carboprost tromethamine injection each ini contains carboprost 025ing / m1 64 card throe 66 cat gut 0 no 66 cat gut i no 67 catheter k 90 68 84 cetixime tablets ip 100 mg 69 85 lcefixime tablets ip 200 mg 70 cefoteraxone and sulbactum for injectior gfopmazone stadium cq. to cetbperazone i g and sulbactu.m sodium 4 to stilbactum 04 g ow iv use ) 71 87 efotaxime injection ip i g 72 8 efotaxirne injection ip 250 mg 73 89 eltatidime inection ip 1 g 74 90 cftazidimc injection ip 250 mg 75 91 ettazidirne injection ip 500 mg 76 ceftrioxone injection ip 125mg 77 93 ceftrioxone injection ip ig / vial 78 ceillioxone injection ip i gm 79 94 ceflrioxone injection ip .250 mg / vial 80 95 ceftrioxone injection ip 500mg / vial 81 96 cepltalexin capsules ip 250 mg 82 97 cephalexin capsules ip 500 mg 83 36 cetirizine tablets ip 10mg 84 215 cetritnide cream ip; 85 243 cetrimide tincture 9.5% *iv ( ceylon& 04% wfv. average absolute alcohol content 65.5 % viv ) 86 321 chioramphertieol eye drops 0, 5% r , , 88 ;41 chloridazepoxidc tablets ip lartig chloroquine phosphate injection ip 40 ingi ml 89 i� chlomquine phosphate tab, ip 250mg ( 74155 mg of chloroquine base ) ( film coated ) 90 100 chloskz siptup [ p 50 ins :51111 91 37 chlorphenirami►e maleate tablets ip :mg 38 92 hlorpheniramine oral solution bp m ) gl5m i 343 93 chlorpmmazine tablets 100 mg sugar coated 94 346 chlorpromazine inj, ip 25mgern1 344 95 chlorpromazine tablets rri 2$ ca.?, sugar coated 95 345 chlorpromazinefrobs ip 50 mg, ( coated tablets ) 97 98 99 322 niprofloxacin eye drops 0, 3% wiv 4, 101 ronoxaciu in onion ip 2002ng / 100m1 323 ciproflosacin ophthalmic ointment usf 1 3% 100 102 ciprofloxacin tablets ep 256 mg film elated 1101 103 ciptolloxacin tablets ip 500 mg film coated 102 283 clomiphene tablets ip 50 mg 103 348 clonazepam tablets ip i mg 104 188 clopidogrel tablets all 75 mg 105 104 lotrimazole cream ip 2% wiw 106 105 lotrimazole vaginal tablets ip 500mg 108 244 mpound benzoin tincture ip 109 106 ompound benzoic add ointment 11 ) it enzoic add 6%+ salicylic acid 3% 110 377 =pound sodium pen latj. ip 111 284 onjugated estrogen tabs usp 0.625 mg 112 o trimoxazole oral suspension ip 107 each s ml contains trimethoprim 40 mg • d sulphamethoxazole 200 mg 113 109 o trimoxazole tablets ip trimethoptim 0 m = and sul liainethoxazote 400 m • 114 108 co trimoxazole tablets [ p trimethoprim , 0 mg and sulphamethoxazole 200 mg 115 0 tam thread 40 no. 116 0 onion thread w no. 117 0 onott roll `18 368 ough syrup ead► sail contains hloropheniramine maleate ip 3ing inmoniurn chloride 13.0misodium citrate 65 mg menthol 0.5 mg syrup q.s. • 119 ed sthring niddle 120 39 dexarnethasone injection ip gt2rni 121 40 exarnetbasone tablets ip 0.s.ing 122 xtrose 5% injection 123 379 dextrose injection 10% 124 380 dextrose injection 5% isotonic 125 378 dextrose injection ip 25 % w / v 126 231 diagnostic sticks for urine sugar 127 diamond brush 126 diamox tablets 129 349 diazepam injection ip 10mg2ml ( imi1v sise ) 130 350 diazepam tablets ik 5.mg • 131 diazpam injection 132 17 diclofenac gel bp 1% 133 18 diclofenac sodium and paracetamol ablets dklorenac sodium 50 mg paracetamol 500 mg 134 483 iclofenac sodium and paracetamol ablets iclofenac saari% 50 tag + paracetamol 325 mg, etc....

Department Of Ayurveda - Rajasthan

33985711 medicine purchase for anchal prasuta, jaravasta, panchkarm year 2022 23 decitiiecoieur, odouhr value specific gravity total solids alchohol test for methanol reducngu!o, [ i reducing sugars total phenolic content .____ [ io identification bytlcihptlsjas applicnbi• ) lil micronial contamination la lto bacterial.count lb total fungal count [ a2 test for specific pathogenla, tlon, colwur, 8 taste, __ odour 2? — i oss on drying at 105 c 3 ___ total ash 4 aeid.insoluble ash 5 ph value 8 alcohol soluble ewtr.ctive 7 water soluble extract eve 8 r.ducln1 ug, etc....

Sms Medical College - Rajasthan

33985207 supply of microbiology lab reagents and disposables items at hospital 1 abo antigen kit 2 aslo test kit ( slide test ) 3 barium chloride 4 blood group kit a 5 blood group kit a, b & d ( combi pack ) 6 blood group kit b 7 blood group kit d 8 blood sugar strip ( compatible to accusure glucometer ) 9 blood sugar strip ( compatible to nocoding one plus glucometer ) 10 capillary tube100x10 11 cbc paper roll 12 chest electrode ( disposable ) 13 chicken gunia 1gg / igm ( elise ) 14 chicken gunia igg / igm ( rapid ) 15 cover slip 18mmx18mm. 200gm. 16 dengue card rapid ag ( ns1 ) 17 dengue card rapid test ( ab ) igg+igm 18 dengue elisa test kit 19 distilled water 20 dropping bottle 21 dropping bottle wash bottle 22 ecg jelly 250gms. 23 ecg paper roll for 12 channel machine 24 edta k2 stand 25 edta rotator 26 edta vial ic2 27 electrolyte cleaner 104 elicate sample 28 esr pipette with tube ( disposable ) 29 esr stand 30 esr tube 31 filter paper 12.5cmx100 32 fsh 100m1. 33 fuechest reagent solution 34 glass marker bold, etc....

Sms Medical College - Rajasthan

33985032 biochemistry lab reagents supply at hospital he 1 csf fluid 125m1. 2 hba1c 40m1. 3 hdl chelesterol 100m1. 4 hdl cholesterol ppt (ldl) 250r 5 iron & tibc 35m1. 6 serum albumin 250+250m1. 7 serum alkaline phosphate 2504250m1. 8 scrum amylase 60m1. 9 serum bilirubin (t) 250+250m1. 10 serum bilirubin (d) 250+250m1. 11 serum blood sugar 500m1. 12 serum blood urea 250+250m1. 13 serum calcium 150m1. 14 serum cholesterol 250m1. 15 serum cholesterol + hdl 250m1. 16 serum ck mb 3x10m1. 17 serum creatinine 500m1. r1 500m1.+r2 500m1. 18 serum ldh 30m1. 19 scrum lypase 50m1. 20 serum phosphorous 100m1. 21 serum total protein 250m1 22 serum triglyceride 500+500,m1. 23 scrum uric acid 125m1 24 sgot 500m1 25 sgpt 500m1. z6 serum ck nac 3x10m1. ...

Medical And Health Services - Rajasthan

33983316 supply of mnjy lab item consumable 1 n / 10 hcl 2 i hb meter 3 i hb tube ( square ) 4 hb pipette 5 i whatmans filter paper ( cirular ) 6 l lanscet 7 capillary tube fine 8 i wbc diluting fluid 9 neubars chamber 10 wbc pipette 11 methanol 12 13 14 15 field stain 1x500 ml a, 1x500ml b glass slides oil cedar wood platelate count fluid 16 reticulocyte count fluid 17 esr stand with marking and disposal cup and pipettes ( top tech ) 18 for esp test cup ( plastic ) top tei 19 esr pipette ( glass ) top tech 20 esp. epeite with hub ( disposal auto such 21 tii co ( loilf11 citrate 3 8% ( solution ) , 23 k3 edta tube ( double cap ) 24 urine albumin / sugar 25 urine cover slip 26 urine pregnancy test card 27 lugols idoine 28 benedict reagent 29 3% sulfosalicylic acid 30 modified rothras nitroprysside 31 33% acetic acid 32 5% barrium chloride powder 33 fouchets reagent 34 sulpher powder 35 hydrogen peroxide 36 benzidine powder 37 hepatitis b ( hbsag ) card 38 hepatitis c ( hcv ) card 39 vdrl strip 40 blood vdrl test kit 41 hiv card 42 hiv tridot 43 hiv combaids / elisa 44 dengue card antigen +antibody 45 dengue elisa 46 malaria card 47 widal test kit ( vials ) ( to. th. ah, bh ) 48 abo rh a, b, d, vials 49 coombs reagent 50 bovine albumin 22% 51 aso reagents vials 52 rf reagent vial 53 jsb i & ii , 55 z n stain rapid kit 56 sprit lamp 57 test tube 4for all serology glass / p 58 blood sugar 59 gldh kinetic system pack for xl 300 ureasi 60 urea for semi auto urease 61 creatinine for semi auto ( initial rtae ) 62 sgot without pyridoxal phosphate for semi auto ifcc method 63 sgpt without pyridoxal phosphate for semi auto ifcc method alkaline phosphates for semi auto __ kinetic ( pnpp ) total protein serail auto analyzer 66 albumin semi auto analyzer _ 67 bilirubin total for semi auto for total & direct biluribin 68 bilirubin direct for semi auto for total & direct biluribin 69 serum uric acid semi auto analyzer ( mono vial ) serum calcium semi auto analyzer ( mono vial ) 71 serum ldh semi auto analyzer 64 65 70 72 ckmb semi auloanalyzer 73 cknac semi autoanalyzei 74 serum arnlyase semi autoanalyzer kinetic 75 chole:strol semi auto 76 hd_ cholestrol semi auto analyzer 77 serum triglyceride for semi auto urease end point 78 crp 79 trbc :11 / 1.01 80 810 medical wr, ip iuckra 131w• wah ;if wo 81 bio medical wane bucket pee ) with ;jew 82 micro pipette 0 to 50 micio1.11 fix 83 micro pipette 0 in 10 micro lu f ix 8 86 87 i micro pipette 0 to 1000 micro ltr fix micro pipette 10 to 100 micro lti varaible micro pipette 20 to 200 micro ltr varaible micro pipette 100 to 1000 micro ltr varaible 88 gloves latex disposable lms 89 gloves latex 6 6% 90 hand wash liquid 91 92 3 parts dilucel plus 3 parts lycel plus 93 3 parts rincel plus 94 cemical h 560 five parts dilucel plus 95 cemical h 560 five parts lycel plus 96 cemical h 5605 parts rincel plus 97 auto pipet 98 mp staend 99 test tube 5 ul 100 101 102 103 104 test tube bad! test tube stand test tube holdar sprit sfri 5 parts dilucel plus 105 sfri 5 parts lycel plus 106 sfir 5 parts rincel plus 107 sodium hypo chlorite 5% 108 test tube rack plastic ( 1x48 wells ) 109 test tube rack plastic ( 1x24 wells ) 110 slide tray aluminum for 20 slides 111 112 113 needle 18 20 22 gauge csf diluting fluid semen diluting fluid 114 keton diastix 115 hemo spot test for occult blood 116 disposable syringe with needle 10 cc 117 disposable syringe with needle 5 ( . ( ., 118 disposable syringe with needle 2cc 119 120 121 122 123 blue tips yello tips tissue paper d.i. water glass marking pencil 124 125 126 127 black permanenl marker pen cotton sample cup plastic staining box glass 128 129 130 131 132 coplin jar dropper plastic disposable cap dispo mask cpd beg 350 ml 133 cpd beg 100 ml ( peadiatnc bag ) 134 135 forrnaline soul gloves powder 136 137 suger strip 138 139 blood sugar strip rapid accucheck go blood sugar strip rapid accucheck proforma blood sugar strip rapid accucheck sens ( 140 blood sugar strip rapid accucheck active 141 142 143 blood sugar strip rapid abbot optium blood sugar strip rapid easy touch coombs test 144 prothrombin test ( tulip ) 145 hdl direct method ( arta ) 1461 ldl direct method ( arba ) 147 148 149 150 electrolyte solution pack ( na, k, cl ) daily rinse kit quality control print roll 151 i leshmin stain 152 ec ) 1 / 4, solution gla acitic acid 154 gram iodine 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 erba wash printer roll ( 56mm ) adhesive roll cloth tonikete slide hb stripe, hemocue multistix ( urine strip for multiple test ) p t reagent bulb for microscope plain vail all antigen vovine albumin 22% coomb sera anti h anti d ( polyclonp ) anti ab ( polyclonp ) hcv card hbsag elisa hiv elisa hcv elisa betadine solution ph enyle solution anti d ( polyclonp ) anti ab ( polyclonp ) adhesive papper 180 liquid paraffin , 181 giemsa stain 182 183 184 185 186 187 chikunganya scrub typhus card swine flue vtm test tube brush plastic dropping bottle semi auto anaiyzer p.m. kit 188 ayres spatula 189 slide fixative 190 oil ermersion lence ( 100x ) 191 edta solution 192 193 194 sodium citrate vail anti al lectine anti human comb sera 195 anti h lactin 196 blood collection bag adult 197 blood collection bag pediatric 198 blood bank i bandage / hansaplast 199 bloodheamochek 200 esr tube 201 ethanol bottle 202 preventive and maintance kit for lab earba 203 hydrocloride acid 204 bbr graph paper...

Sawai Man Singh Medical College - Rajasthan

33980601 tender for supply of generic drugs and medicines for hospital use tender for supply of generic drugs and medicines for hospital use , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) tab. , calcium phosphate 200 ml syrup , cefipime 1000mg + tazobactum 125mg inj. , cefoperazone 1gm+tazobactum 125mg inj. , cefpodoxime proxetil oral suspension 50mg syrup , cefuroxime 1gm inj. , cefuroxime axetil oral suspension 125mg / 5ml syrup , cetrorelix acetate 0.25 mg inj. , diltiazem 25 mg inj. , dydrogesterone 10mg tab. , estradiolvalerate 2 mg tab. , etomidate 20 mg inj. , etomidate mct / lct 10ml vial inj. , fluconazole 100mg inj. , fsh 150 iu inj. , fsh 75 iu inj. , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu inj. , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu inj. , inositol + myoinositol 1000mg tab. , invert sugar 10% ( fructodex 10% ) 500 ml inj. plastic bottle , isolyte p 10% 500 ml inj. glass bottle , low molecular wt. heparin 0.4mg inj. , mephentermine 50mg / ml inj. , meropenem 2gm inj. , methotrexate 1000 mg inj. , methylene blue inj. , normal saline 1000 mlglass bottle inj. , ondansetron oral suspension syrup , pheniramine 25 mg tab. , phenobarbitone 20mg / 5ml in 100ml syrup , placental extract 2ml inj. , prostaglandin 500mcg / ml inj. , recombinant fsh 150 iu inj. , recombinant fsh 300iu inj. , recombinant hcg 250 iu inj. , recombinant lh 75iu inj. , sildenafil 0.8mg inj. , sildenafil 20 mg tab. , teicoplanin 200 mg inj. , triptorelin 0.1 mg inj. , triptorelin 3.75 mg inj. , vasopressin 3ml inj. , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg [ 492 ] , acyclovir sodium 500mg inj. , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection ip 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml [ 65 ] , albendazole tablets ip 400 mg ( detail in rc ) [ 66a ] , alcoholic anticeptic hand rub sol. 500ml , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , aloe vera mosituzing cream , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , amino acid cap , amino acid withour sorbitol 250ml inj. , amino acid withour sorbitol 500ml inj. , amiodarone hydrochloride inj 50 mg / ml , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) [ 461 ] , amlodipine tablets ip 5 mg , amophous hydrogel with colloid silver wond dressing cream , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) [ 507 ] , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amphotericin b inj ip 50 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg [ 261a ] , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg [ 497 ] , antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , aqueous progesterone 50mg inj. , argininesachets 10 gm , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg [ 679 ] , atracurium besylate 25mg / 2.5ml inj. , atracurium inj 10 mg / ml , atropine sulphate injection 0.6mg / ml , azithromycin 100mg / 5ml oral syrup / suspension [ nrd [ dh ] , azithromycin tab ip 500 mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin inj. , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed system polyolefin 500 ml bag , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) [ 445 ] , benzathine benzylpenicillin inj ip 12 lac units [ 81 ] , benzathine benzylpenicillin inj ip 6 lac units [ 82 ] , betahistine tab ip 16 mg , betahistine tab ip 8 mg , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg [ 617 ] , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% 20ml ( without preservative ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) [ 773 ] , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size [ 793 ] , caffiene citrate oral solution oraldrop 03 ml , caffine citrate 02ml inj. , calamine lotion ip 100ml , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) [ 441 ] , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , cefixime tab ip 200 mg [ , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) [ 86 ] , cefotaxime injection ip 1 g , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 500mg / vial , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , chlorhexidine gluconate solution 5% 250 ml [ 447 ] , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , cholecalciferol granules 60, 000 iu / gm , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablet ip 500 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , clindamycin capsule ip 300 mg , clindamycin phosphate injection ip 300 mg , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clotrimazole cream ip 2% w / w , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg cojugated estrogen , colistimethate injection ip 1m iu powder for solution , combikit of ( tab fluconazole150mg and azithromycin 1gm and secnidazole1gm ) each kit contain 1tab fluconazole150mg and 1 tab.azithromycin 1gm and 2 tab.secnidazole1gm . , compound sodium lactate inj. 500 ml ip ffs bottle , conjugated estrogen tabs usp 0.625 mg. , copper sulpate ( cuso4 ) , cough syrup / expectorant ( 50 ) ml , cyproterone acetate 2 mg and ethynil estradiol. 035mg tab bp [ nrd , danazol cap ip 50 mg , desflurane, 100ml inj , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dextrose 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dextrose inj ip 10%500mlffs bottle , dextrose inj ip 25% w / v 500mlffs bottle , dextrose inj ip 5% 500mlffs bottle , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diclofenac each transdermal patch contain 200 mg diclofenac patch , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg [ 483 ] , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) [ 19 ] , diclofence 50 mg + paracetamol 325 mg+ serratiopeptidase 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , digoxin inj ip 0.25 mg / ml , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , distilled water 10ml inj. , distilled water 500ml bottle inj. , dns 5% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone tab ip 10 mg , dopamine hydrochloride inj ip 40 mg / ml , doxycycline cap ip 100 mg , doxycycline for injection 100 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , enoxaparim inj. 20mg / 0.2ml , enoxaparim inj. 40mg / 0.4ml , enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added tosurfactant and stabilizing agent. protease, lipaseamylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) [ 745 ] , ethynil estradiol 0.02mg and desogestral 0.15mg tablets [ nrd 628 ] [ m ] , eusol soluction 500 ml , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , fluconazole tablets ip 150mg , folic acid tab ip 5 mg , folinic acid injection , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack [ 685 ] , framycetin sulphate cream 1 o / o 30gm pack [ 684 ] , frusemide tab ip 40 mg , fumigation 1 ltr sol. , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gentamycin injection ip 80mg / 2ml ( im / iv use ) [ 116 ] , gluteraldehyde solution 2% , glycerin ip 100 ml , glycopyrrolate inj ip 0.2 mg / ml , goserelin acetate implant 3.6 mg inj. , haloperidol inj ip 5 mg / ml , halothane bp solution , hand sanitizer total + 50ml , heparin 50 iu benzyl nicotinate 2 mg ointment [ nrd 436 ] [ m ] 20 gm , heparin sodium inj ip 5000 iu / ml ( im / iv use ) [ 174 ] , hormonalintra uterine contraceptive device , human chorionic gonadotropin injection ip 10000 i.u. , human chorionic gonadotropin injection ip 5000 i.u. , human milk fortyfier hmf 05 mg , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) [ 248 ] , hydroxychloroquine sulphate tab 200 mg , hydroxychloroquine sulphate tab 400 mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen tab ip 400 mg ( coated ) , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , instrument rust removerphosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges [ 680 ] , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , ipratropium bromide nebulizer solution 250 mcg / ml , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp inj. 100ml , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg [ 118 ] [ p ] , ivermectioni.p. tab 12 mg , ketamine inj ip 50 mg / ml [ 8 ] , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , l arginine+proanthocynadine granules 3mg sachet , legols iodine soluction100 ml , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500mg / 5ml , levetiracetam tablet ip 500 mg , levoceitrizine tablet 5mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levofloxacine 500mg / 100 ml injection , lignocaine ( preservative free ) 2% injection [ nrd [ m ] 10ml , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , linezolid inj 200mg / 100ml , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , luprolide multidose vial 04 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mct oil 100ml , medical device sterlization solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous. it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , medroxyprogesterone acetate tablets ip 10 mg [ 605 ] , mefenamic acid 250mg and dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg and dicyclomine hydrochloride10mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , metformin tab ip 500 mg , methotrexate inj ip 50 mg / 2 ml , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methyle blue stain powder 25 gm , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , methylprednisolone acetate40mg inj. , methylprednisolone acetate 125mg inj. , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol tablets ip 25 mg , metronidazole inj ip 500 mg / 100ml , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , mifepristone tab ip 25 mg , milk low birth formula powder , misoprostol tab ip 100 mcg , misoprostol tab ip 200 mcg , misoprostol tab ip 25 mcg , misoprostol tab ip 600 mcg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size [ dh ] , nalbuphine inj. 10mg / ml01 ml , nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12, 5% c18, …….10% 68%c12, 32% c14………10% inert ingredient ………80% usepa registration number mandatory. usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory. product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / , natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , nifedipine sublingualtab , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg [ 296 ] , normal saline 0.9% 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , normal saline 0.9% 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin tab ip 200 mg [ , oitment mupirocin ip 2% , olanzapine tab ip 5 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) [ , oxytocin inj ip 5 iu / ml , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag inj. , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenytoin syrup 125 mg , phenytoin tab ip 100 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin injection 2 gm + tazobactom 250mg ip , polymixin sulphate b injection usp 5 lac i.u. [ 716 ] , polymyxin b for injection 1 million inj. , potassium chloride inj. 0.15 gm / ml10ml , povidone iodine ointment 5% 15 gm , povidone iodine pessary , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500ml , povidone iodine solution ip 10 % 100ml bottle , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle [ 450 ] , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , preglac powder , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesterone inj 200 mg / 2ml , propofol inj ip 10 mg / ml , propofol mct / lct with oleic acid iv inj. , propranolol tab ip 40 mg , protein powder 200 gm , pulmosil 10ml inj. , racecadotril sachet 30 mg sachet , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , ranizumab 10mg / ml injection , remdesivir injection 100mg / 20ml , ringer acetate infusion 500 ml , ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag inj. , ropivacaine 0.75% 20ml vial inj. ip [ nrd 361 ] [ m ] , ropivacaine 0.75% 3 ml ampule ( heavy ) injection [ nrd 362 ] [ m ] , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sapagard gel ( feracrylum ) , serrapiopeptidase tab. 10 mg , serrapiopeptidase tab. 20 mg , sildenafil 10mg / 12.5 ml for iv inj. , soda lime specification: • it should be medical grade sodalime • its granules should be of “d” shape • its dust content should be less than 0.25 % • it should contain sodium hydroxide 0 4% by weight and calcium hydroxide over 85% by weight • it should consistently absorb 150 litres of co2 per kg of sodalimebefore experiencing 0.5% co2 breakthrough • its hardness should be of optimum level ( 99% uspxxii ) • it should change color from white to violet • it should be iso and ce. , sodium chloride 0.3 % 100ml inj. , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500mlffs bottle , sodium chloride inj 0.9 %ip 500 mlffs bottle , sodium chloride inj 0.9 % ip 1000 ml ffs bottel , sodium chloride injection 0.9 % ip 100 ml ffs bottle , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 04 ml ( natural surfactant ) , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , telmisartan tablets ip 40 mg , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml inj. , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) [ 374 ] , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , ticyline inj. , tocilizumab 400 mg inj. , topical heparin solution 1000iu / ml , torsemide tab 10 ip mg , tramadol inj 50 mg / ml , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , trypsin chymotripsin tablet ( each enteric coated tablet contains 1 lacks unit of enzymetic activity ) , ursodeoxycholic acid tablets ip 300 mg , vancomycin for intravenous infusion ip 1 gm [ 524 ] , vancomycin for intravenous infusion ip 500 mg [ 523 ] , vecuronium bromide for injection 4mg ( freeze dried ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) [ 397 ] , vitamin d3 800iu / ml drop 15ml , vitamin d3 oral solution 60000 iu , vitamin e capsule 400 mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , water for inj ip , xylocard 2% 50ml inj. , zinc oxide ointment , zinc sulphate dispersible tablets ip elemental zinc 10 mg...

Sawai Man Singh Medical College - Rajasthan

33980106 supply of microbiology lab reagents and disposables microbiology lab reagents and disposables supply at hospital , microbiology / pathology / disposables items , abo antigen kit , aslo test kit ( slide test ) , barium chloride , blood group kita , blood group kit a, b & d ( combi pack ) , blood group kit b , blood group kit d , blood sugar strip ( compatible to accusureglucometer ) , blood sugar strip ( compatible to nocoding one plus glucometer ) , capillary tube100x10 , cbc paper roll , chest electrode ( disposable ) , chicken gunia igg / igm ( elisa ) , chicken gunia igg / igm ( rapid ) , cover slip 18mmx18mm. 200gm. , dengue card rapid ag ( ns1 ) , dengue card rapid test ( ab ) igg+igm , dengue elisa test kit , distilled water , dropping bottle , dropping bottle wash bottle , ecg jelly 250gms. , ecg paper roll for 12 channelmachine , edta k2 stand , edta rotator , edta vial k2 , electrolyte cleaner , elicate sample , esr pipette with tube ( disposable ) , esr stand , esr tube , filter paper 12.5cmx100 , fsh 100ml. , fuechest reagent solution , glass marker bold , glass slide 25x75mm. , glucometer , hb pipette , hb tube , hba1c 40ml. , hbsag card rapid , hbsag strip test , hdl cholestrol , hdl cholestrol ppt ( ldl ) , hemoglobinometer , hemoglobionometer strip , hiv coombs aid , hiv test kit , hiv triline , hiv trispot , iodine , iron & tibc , jsb i stain , jsb ii stain , leisman stain with buffer solution , lh , lyse , malaria card ( elisa method ) , malaria card rapid ( ab+ag ) , micro pipette 100 1000 ul adjustable , micro pipette 10 100ul adjustable , micro pipette 50 100 ul adjustble , micro tips 100 1000ul , micro tips 10 100 ul , multi parameter urine strip , n / 10 hcl , neubar chamber , pcv tube with stand , plain tube 12x75 with cap ( with sticker ) , plain tube 12x75 without cap , pregnancy card rapid , rbc diluting fluid , rbc pipette , readymade nutrient agar plate , reagent bottle – glass 250ml. , rhematoid factor ( rf ) test kit ( slide test rapid ) , serum sample cup for auto analyzer , semman diluting fluid , serum crp test ( rapid slide test ) , sodium citrate solution , sodium hypochloride 5% , stop watch , strip for coombs test , sugar vial , swab sticks , t3 elisa test kits , t4 elisa test kits , tec diluting fluid , test tube stand 10x12 ( 48holes ) , tissue paper roll , tlc pipette , torniquate , tsh , urine strip for albumin / sugar , urine strip for ketone , vacutainer activatd vial plane , vacutainer edta vial , vacutainer holder , vacutainer needle , vdrl test kit rapid –card , vtm vials for swine flu samples , wbc diluting fluid , widal test kit ( slide method ) 4x5ml. , wintrobe tube...

Sawai Man Singh Medical College - Rajasthan

33980079 supply of biochemistry lab reagents biochemistry lab reagents supply at hospital , biochemistry : , hba1c 40ml. , hdl with cholestrol 100 ml , hdl cholestrol 100 ml , hdl cholestrol ppt ( ldl ) 250 ml , iron & tibc 35 ml , serum albumin 250+250 ml. , serum alkaline phosphate 300ml , serum amylase 60 ml , serum bilirubin ( t ) 250+250 ml. , serum biluribin ( d ) 250+250 ml. , serum blood sugar 500 ml , serum blood urea 250+250 ml. , serum calcium 150 ml , serum cholesterol250 ml , serum ck mb3x10 ml , serum ck nac 3x10 ml , serum creatinine 250ml.r1+250ml.r2 , serum ldh 30 ml , serum lypase 50 ml , serum phosphorous 100ml , serum total protein 250ml , serum triglyceride 250+250ml. , serum uric acid 125 ml , sgot 500 ml , sgpt 500 ml , csf fluid 125 ml....

Sms Medical College - Rajasthan

33971959 tender invited for supply of generic drug and medicine at zenana hospital jaipur 1. bupivacaine inj. ip 0.5% 2. drotavering hydrochloride inj 40 mg / 2 mi 3• inj.halothane bp 4. inpsoflurane usp 5. ketamine inj ip 50 mg / mi 6. lignocaine inj ip 2 0 / 0 7. propofol inj ip 10 mg / mi 8. thiopentone inj ip 0.5 g 9. diclofenac sodium inj ip 25 mg / mi ( im / iv use ) 10. fentanyl citrate injection ip 2 ml 11. morphone sulphate inj ip 10mg / mi 12. paracetamol inj, 150 mg / mi 13. pentazocine inj ip 30 mg / mi ( im / iv use ) 14. adrenaline injection ip 1mg / ml im / iv use 15. dexamethasone inj ip 8mgj2mi 16. hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 17. pheniramine inj ip 22.75 mg / mi 18. promethazing inj ip 25mg / ml 19. naloxone inj ip 0.4mg / ml 20. amikacin inj ip 100 mg 21. amikacin inj ip 500 mg lir. nmphotericin b inj ip 50 mg 4. i arnold11in injection ip 500 mg benzathine benzylpenicillin inj ip 12 lac units 25. benzathine benzylpenicillin inj ip 6 lac _ units 26. cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium _ eq. to sulbactum 0.5gm ) ( im / iv use ) 27. cefotaxime injection ip 1 g 28. cefotaxime inj ip 500 mg / 250 mg 29. ceftazidime inj ip lg 30. ceftazidime inj ip 250 mg 31. ceftazidime inj ip 500 mg 32. ceftriaxone inj ip lg / vial 33. chloroquine phosphate inj ip 40 mg / ml 34. ciprofloxacin injection ip 200mg / 100m1 35. gentamycin injection ip 80mg / 2m1 ( im / iv use ) 36. meropenem inj ip 500 mg 37. meropenem inj ip 250 mg 38. metronidazole inj ip 500 mg / 100m1 39. bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) 40. leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 41. methotrexate inj ip 50 mg / 2 ml 42. paclitaxel inj ip 260 mg 43. paclitaxel inj ip 100 mg 44. enoxaparin sodium inj ip 60 mg 45. ethamsylate inj 250 mg / 2m1 ( 1m / iv ) 46. heparin sodium inj ip 5000 iu / m1 ( 1m / iv use ) 47. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) or amiodarone hydrochloride inj 50mg / m1 i.; digoxin inj ip 0.25 mg / ml 50. dobutamine inj ip 50mg / m1 / 250mg ( vial / ) dobutamine inj ip 250 mg / 5m1 ( amp ) 51. dopamine hydrochloride inj ip 40 mg / ml 52. magnesium sulphate inj. ip 500mg / m1 ( 50%w / v ) 53. nitroglycerin inj 5 mg / ml 54. diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 55. gadodiamide inj. 0.5mml / m1vial 56. furosemide injection ip 10mg / mi ( im and iv use ) 57. mannitol inj ip 20% w / v 58. dicyclomine inj ip 10 mg / m1 59. hyoscine butylbromide inj ip 20 mg / ml 60. metoclopramide inj ip 10mg / 2m1 61. ondansetron inj ip 2mg / mi 62. pentoprazole inj 40mg 63. ranitidine hcl injection ip 50mg / 2m1 64. biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) 65. carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 66. hydroxyprogesterone inj ip 250mg / m1 67. isophane insulin inj ip 40 iu / m1 68. progesterone inj 200 mg / 2m1 69. insulin injection ip ( soluble insulin / neutral nsu . j . 1 .dna • • 70. human anti d immunoglobulin injection 300mcg ( im use ) 71. atracurium inj 10 mg / ml 72. glycopyrrolate inj ip 0.2 mg / ml 73. midazolam inj ip 1 mg / ml 74. neostigmine inj ip 0.5 mg / ml 75. succinylcholine _ inj. ip 50 mg / ml ( iv use ) 76. valethamate bromide inj 8mg / ml 77. isoxsuprine inj ip 5 mg / ml 78. methylergometrine inj ip 0.2 mg / ml 79. oxytocin inj ip 5 iu / m1 80. diazepam inj ip 10mg / 2m1 ( 1m / iv use ) 81. aminophylline inj ip 25 mg / ml 82. compound sodium lactate inj. ip 83. dextrose inj ip 25% w / v 84. dextrose inj ip 10% 85. dextrose in ] ip 5% 86. multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 87. multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 88. potassium chloride inj. 0.15 gm / ml 89. sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 90. sodium chloride in ] ip 500 ml 91. calcium gluconate inj ip 10% ( iv use ) 92. vitamin b complex inj nfi 93. sodium bicarbonate inj ip 7.5% w / v 94. water for inj ip 95. labetalol hci in } ip 20mg / 4m1 96. betamethasone sod phos inj ip 4mg / m1 97. vecuronium bromide for injection 4mg ( freeze dried ) 98. phenobarbitone inj ip 200mg / m1 99. hyaluronidase injection ip each vial contains hyaluronidase ip 1500i.u. 100. piperacillin + tazobactum for injection ip 4gm+500mg 101. torsemide inj 10 mg / ml y .02. meropenem inj. ip 1gm 103 lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 104. iron sucrose injection usp / bp 20mg / m1 ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 105. 106. acetylcystine solution usp ( injection ) 200 mg / ml amikacin inj ip 250 mg 107. amoxicillin and potassium clavulanate inj ip 1.2gm 108. artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1m1 ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5mlampoule ) 109. aztreonam injection usp 500 mg 110. linezolid inj 200mg / 100m1 111. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 112. carboplatin injection ip 150 mg 113. carboplatin injection ip 450 mg 114. cisplatin inj ip 10 mg / 10 ml 115. adenosine injection ip 6 mg / 2m1 116. isoprenaline injection ip 2mg / ml 117. noradrenaline injection ip 2 mg / ml 118. sodium chloride injection ip 100 ml 119. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 120. neostigmine injection ip 2.5mg / sml vitamin k 1 ( phytomenadione ) ip 1mg / 0.5m1 injection with syringe ( detail in rc ) 121. 122. atropine sulphate injection 0.6mg / m1 123. fentanyl citrate injection 50mcg / m1 124. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous 0........, solution 350 mg iodine / ml. lir levetiracetam injection 500mg / 5m1 126 aztreonam injection 1gm 4 , , , clindamycin phosphate injection ip 300 mg 128. polymixin sulphate b injection usp 5 lac i.u. 129. meropenem injection ip 250 mg 130. colistimethate injection ip 1m iu powder for solution 131. n butyl alcohol injection 0.26mg / smi, citric acid 2.5mg / 5m1 and sod. chloride solution 5 ml size 132. tranexamic acid injection ip 100mg / m1 5misize 133. i esmolol hydrochloride injection 10mg / m1 10mi size 134. i hepatitis b immunologlobin injection ip 200 i.0 135. hepatitis b immunologlobin injection ip 100 i.0 136. human chorionic gonadotropin injection ip 5000 i.u. 137. ferric carboxymaltose injection 50 mg / ml 10 ml size 138. caffeine citrate usp injection 20mg / m1 ( equivalent to 10 mg caffeine base / mi ) 3mi size 139. amino acid 10% injection 100mi size 140. amino acid 10% injection 250m1 size 141. inj poractant alpha 80 mg / mil in pack of 1.5 ml ( detail in rc ) 142. human immunoglobulin inj with 12%igm, 12%iga, 76%i gg in pack of 10m1 ( 0.5gm ) 143. human immunoglobulin inj with 12%igm, 12%ig4, 76%1 gg in pack of 10m1 ( 0.5gm ) 144. kabalyte ( multipal electrolyte inj ) 145. inj mephentermine 146. amphotericin b inj . ( iiposonal ) 147. fluconazole inj .48. 149. inj propfol with mct+ict isolyte —p inj 150 inj teicoplain 151. 152. inj sidenafil 10mg !nj prostagladine 500mg 153. inj placentrax 154. inj sodium chloride 1000m1 155. inj insulin detemir / levemir ( long aceting ) 156. inj tt 0.5 ml 157. inj leuprolide 158. inj xylocard 159. inj metoprolol 160. inj fentanyl 161. inj esmlol 162. progesterone injection 50 163. glyceryl trinitrate injection, diluted 5mg / m1 164. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50m1 165. polymyxin b for injection 1 million 166. potassium chloride for injection 167. sodium bicarbonate injection 168. inj. dopamine 169. inj.adrenaline 170. inj.dobutamine 171. inj.phenobarbitone 172. inj.midazolam 173. inj.calcium gluconate 174. inj.caffine citrate 175. inj.amikacin 177 inj amphoterlcin b ( liposomal ) inj.surfactant ( porectent ) 179 inj.human albumin 180. inj.prostoglandin 181. inj.linazolid 182. inj.ciplox 183. inj.levofloxacin 184. polygeline 3.5% solution with electrolytes for i.v. infusion 185. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 186. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 187. vancomycin for intravenous infusion ip 500 mg 188. vancomycin for intravenous infusion ip 1 gm 189. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 190. hepatitis b immunoglobulin 2001110.4mi. im / sc pfs vial 191. paracetamol infusion ip 1% w / v 100m1 size 192. instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 193. medical device sterlizat►on solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499 2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 194. enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 90012015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio 195. nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12. 5% c18 10% 68%c12, 32% c14 10% inert ingredient 80% usepa registration number mandatory usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 :2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. 196. antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 197. ringer acetate infusion 500 ml itnioil sot ( infusion set ) with airway m1, 1 needle ( paediatric llie ) ster110 111110%.111le 1111thioti ••i %%fill alk roc.. ) starlio 1.11 to amy sodium 1. 111011, 1r and 0extrose 0 .0.. ) , immo!, won, pal a, et.ilika illtml, , 11 410 n►g with both i empri e idollt ‘ aw. ..tilay 10% 1`, 11, 1 ( ot.ffilol tiltwooli i000 rug with both i olupel e% mott caps spray 10% ki161% al spirit ip ( 100 ml ) . 204• surgical spirit ip ( 500 ml ) 205. savalon 11. 206, savlon 500 ml 207. dextrose with sod.chlorlde polypack 5% soomi 208. distilled water 10m1 209. 210. distilled water 500m1 distilled water 5 ltr — 211. sodium chloride and dextrose 0.45% infusion 500m1 212. folinic acid 200mg / vial 213, sodium chloride 3% 100m1 214. prostaglandin 500mcg / m1 215. azithromycin 10 ml vial equalvelent to 500 mg 216. caffeine cirate 20mg / mi 217. carbetocin 1m1 / 100micro. 218. ceftriaxone and sulbactam 1.5g 219. clindamycin 600mg / 4m1 220. compound sodium lactate ( ringer lactate ) in glass bottle 500m1 221. folinic acid 200mg / vial 222. azithromycin 10 ml vial equaivelent to 500 m 223. fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography 224. folic acid +methylcobalamine 10 ml pack fsh 150 ill gdw 5% glass bottle / 500m1 228. glyceryl trinitrate injection, diluted 5mg / m1 229. hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu 230. insulin aspen 231. insulin lispro 232. i invert sugar 10% ( fructodex 10% ) 500 cc 233. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50 ml 234. isolyte p 10% 500 ml 235. levofloxacine 500mg / 100 ml 236. lignocaine ( preservative free ) 2% 237. low molecular wt. heparin 0.4mg 238. mephentermine 50mg / m1 239. methylene blue 240. metotrexate 15mg ( preservative free ) 241. midazolam 5mg / m11 ml 242. multivitamin 10 ml 243. nandrolone decanoate 100mg 244. nandrolone decanoate 50 mg 245. normal saline 500 nil glass bottle 246. normal saline 1000 ml glass bottle 247. paracetamol infusion 500 mg with both temper evident caps spray 10% 248. paracetamol infusion 1000 mg with both temper evident caps spray 10% 249. procaine penicillin fortified 2 lack 250. teicoplanln 200 mg 251. teicoplanln 400 mg 7 vitt / min 0 ( 600000 iu ) insulin glargine 100 iu per mlinrefilled pen ____ _. insulin. 50 / 50 — as human albumin 20% in 50 ml vial 25 8. tetanus vaccine ( adsorbed ) ip in 0.5 ml 257. in ) . propofol mctact with olelcacid in ) . iv 258. in ) . paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag 259. inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 260. inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 261. in ) . ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag_ 262. int ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 263. inj.5% dextrose 500 ml in 100% .., , r tail biodegradable non dehp double sterilized polyolefin closed system bag 264. inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 265. inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 266. inf. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin 267. inj. hydroxy ethyl 6%o tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin ablets 268. amlodlpine tab ip 2.5 mg 269. amiodipine tablets ip 5 mg 270. atenolol tab ip 50 mg 271. atorvastatin tab ip 10 mg 272. clopidogrel tab ip 75 mg digoxin tab ip 0.25 mg. 274. diltiatem tabs ip 30 mg film coated 27, enalaprll maleate tab ip 5mg — 276. enalaprll maleate tab ip 2.5mg 277. isosorbide dlnitrate tab ip 5 mg 278. isosorblde mononitrate tabs ip 20 mg 279. usinopril tab ip 5mg 280. losartan tab ip 50 mg 281. methyldopa tab ip 250mg film coated 282. propranolol tab ip 40 mg 283. verapamil tab ip 40 mg film coated 284. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 285. frusemide tab ip 40 mg 286. hydrochlorthiazide tab ip 12.5 mg 287. torsemlde tab 10 ip mg 288. antacid tablets.formula, each chewable tablet contains magnesium trisllicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 289. blsacodyl tab ip 5mg 290. dicyclomine tab ip 10 mg 291. domperldone tab ip 10 mg 292. loperamide tab ip 2 mg 293. metoclopramide tab ip 10 mg 294. ranitidine tab ip 150mg 500. glimepiride tab ip 1mg 301. metformin tab ip 500 mg ( film coated ) 302. norethisterone tab ip 5 mg 303. thyroxine sodium tablets ip 100mcg 304. thyroxine sodium tablets ip 50mcg 305. neostigmine tab ip 15 mg 306. isoxsuprine tab ip 20 mg 307. methylergometrine tab ip 0.125 mg 308. misoprostol tab ip 200 mcg 309. alprazolam tab ip 0.25 mg 310. alprazolam tab ip 0.5mg 311. salbutamol tablet ip 4 mg 312. salbutamol tab ip 2 mg 313. theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 314. theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 315. tinidazole tab ip 300 mg 316. tinidazole tab ip 500 mg 317. ranitidine tab ip 300mg 318. dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 319. aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 320. metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 211 athaffnern;n 1 liselrnekinrirla ici ietaineta • release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) 322. glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 323. losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 324. losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 325. amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine smg, atenolol 50mg ) 326. atenolol tab ip 25 mg 327. hydrochlorthiazide tab ip 25mg 328. losartan tab ip 25 mg 329. ascorbic acid tab ip 500 mg 330. ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 331. ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 332. folic acid tab ip 5 mg 333. multivitamin tablets nfi formula sugar coated vit a 2500 iu vit 81 2mg vit b6 0.5mg vit c 50mg calcium pantothenate lmg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 334. vitamin b complex tablet nfi ( prophylactic ) 81 2mg 82 2mg 86 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 335. labetalol tab ip 100mg 336. nitrofurantoin tab ip 100mg 337. hyoscine butyl bromide tablets ip 10mg 338. drotaverine tab ip 40 mg 339. zinc sulphate dispersible ta blets ip elemental zinc 10 mg 340. diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 341. aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 342. mefenamic acid tablets bp 500 mg 343. 344. cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab levofloxacin tablets ip 250 mg 345. linezolid tablets ip 600 mg 346. ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 347. methotrexate tablets ip 10 mg 348. bromocriptlne tablets ip 2.5 mg 349. atorvastatin tablets ip 40 mg 350. clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 351. metoprolol tablets ip 25 mg 352. metoprolol succinate extended release tablets ip 50 mg 353. telmisartan tablets ip 40 mg 354. finasteride tablets ip 5 mg 355. flavoxate tablets ip 200 mg ( coated tablet ) 356. drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 357. lactic acid bacillus tab 60 million spores 358. ondansetron orally disintegrating tablets ip 4mg 359. ursodeoxycholic acid tablets ip 300 mg 360. medroxyprogesterone acetate tablets ip 10 mg 361. chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 362. mifepristone tab ip 200mg 363. calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 364. ramipril tablets ip 2.5 mg 365. levoceitrizine tablet 5mg 366. montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 367. levetiracetam tablet ip 500 mg 368. levetiracetam oral solution / suspension 100mg / m1 369. co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) 370. tenaligliptin tablet ip 20mg 371. levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 372. letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 373. ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 374. rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) 375. rosuvastatin tablet 10 mg 376. doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 377. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 378. cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 379. diclofenac+ parcetamol+ serratiopeptidsase tab 380. dehydrogestrone tab 381. estradiol tab 382. povidon vaginal pessaries tab 383. vit b 12 tab 384. tab levtiracetcetam 500 mg 385. tab conjugated estrogen 386. tab mirabegum 387. tab derifenacin 388. tab propar 389. tab alone / ramloxifene 390. tab cyproterone acetate & ethinyloestradiol 391. tab centchronam 392. tab dinogest 393. progestron only pills 394. tab chymoral forte 395. lasix tab 396. tab lactare 397. faskit ( fluconazole / azthomycine & secnidazole tab 398. tab telmisarton +hidrocylorthiaozide 399. tab mefenamic acid +dicyclomine hydro 400. coq 300mg ( capsule of coenzyme 010 with lycopene, selenium & omega 3 fatty acid ) 401. clindamycin capsule ip 150mg 402. clindamycin capsule ip 300 mg 403. oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 404. oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 405. oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 406. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 407. vitamin e capsule 400 mg 408. coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) 409. aceclofenac+paracetamoi+ serratiopeptidase ( 100+325+15 mg ) 410. cefpodoxime 200mg cefpodoxime cv 375 cyproheptadine 4mg 411. 412. 413. cyproterone acetate 2 mg +ethynil estradiol. 035mg 414. dienogest 2mg 415. dydrogesterone 10mg 416. estradiol valerate 2 mg 417. ethynil estradiol 0.02mg+ tab desogestral 0.15mg 418. inositol + myoinositol 1000rng 419. levetiracetam ip 250 mg 420. mirabegeron 25 mg 421. mifepristone 25mg 422. nifidipine 20mg 423. paracetomol 650 mg 424. progesterone only pills 425. propranolol 40 mg sr 426. rosuvastatin 10mg + fenofibrate 160mg 427. serratiopeptidase 10mg 428. serratiopeptidase 20 mg 429. tramadol 37.5mg + paracetamol 325mg 430. trypsin chymotripsin 431. ulipristal 5mg 432. hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l•aspartate 150mg pyridoxine hydrochloride 3 mg 433. spores of polyantibiotic resistant bacillus clausii 2 billion capsules 434. iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mg eq. to elemental iron 30mg phospholopid 167 mg eq. to phosphatidylserine 100 mg 435. cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen 436. telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet contain telmisartan40mg + hydroclrothaizide 12.5 mg 437. telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet contain telmisartan80mg + hydroclrothaizide 25 mg 438. 439. mefonamic acid 250mg+ dicyclomine hydrochloride each tablet contain mefonamic acid 250mg+ dicyclomine hydrochloride cornbitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazolelsomg + azithromycin 1 gm 7 secnidazole 1 gm 440. zideovudine 60 + lamivudine 30 441. lung surfactent 1.2 ml ( 50 mg ) lypholised 442. amphotericin b lipid complex 10 mg 443. ionic solution of silver nutrate with tween twenty 100 ml :ream 444. 445. 446. 447. 448. 449. 450. clotrimazole cream ip 2% w / w acyclovir cream 5% cetrimide cream ip 15 gm fusidic acid cream ip 2% silver sulphadiazine cream ip 1% 50gm tube dinoprostone cream / gel 0.5 mg dinoprostone in syringe beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 451. betamethasone diproplonate cream ip 0.05% 452. silver sulphadiazine cream ip 1% 500 gm jar 453. framycetin sulphate cream 1 0 / 0 30gm pack 454. framycetin sulphate cream 10 / 0 100 gm pack 455. 456. 457. estradiol cream estrogen cream sumag cream 458. neomycin sulphate cream ointment 459. neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 ili / gm 460. lignocaine gel 1p 2% a 461. compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 0 / 0 462. ointment containing lidocaine ip 3 0 / 0 zinc oxide ip 5 ao , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ) 463. povidone iodine ointment 5% 15 gm 464. povidone iodine ointment usp 250 gm 465. coal tar 6% & salicylic acid 3% ointment 466. acyclovir eye ointment ip 3% w / w 5gm size 467. chloramphenicol 1% w / w eye ointment ip, 3gm size 468. thrombophobe ointment gel 469. i 470. f r` cc is antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil antacid liquid, each 5mi contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 471. diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 472. clindamycin phosphate gel usp 10 / 0 473. i metronidazole 1% and chlorhexidine gluconade 0.25% gel drops 474. ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / 0, enzocaine 2.7 0 / 0 , chlorbutol 5 olo, turpentine oil 15 o / o 475. domperidone oral drops 10mg / ml ( 10m1 ) 476. carboxymethylcellulos e eye drops ip 0.5% 477. phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% 478. kylometazoline nasal drops ip 0.1% 479. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) 480. ciprofloxacin eye drops ip 0.3 o / o w / v 481. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 482. multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 lmg, riboflavine phosphate sodium 2mg, d•panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl lmg, cyanocobalamin lmcg, lysine hcl 10mg 483. lactulose solution 484. i digoxin 0.25% solution 485. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 486. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 487. acetylcystine solution usp ( injection ) 200 mg / ml 488. colistimethate injection ip 1m iu powder for solution 489. n butyl alcohol injection 0.26mg / 5m1, citric acid 2.smg / smi and sod. chloride solution 5 ml size ecaffiene citrate oral solution human albumin solution ip 20% 490. x491. 492. povidone iodine solution ip 5 % 500 ml 493. formaldehyde solution ( 34.5 per. — 38 per. ) 494. gentian violet topical solution usp lob 495. gluteraldehyde solution 2% 496. hydrogen peroxide solution ip 6 % ( 20vol ) 497. lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 249 ] 498. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 499. dicyclomine hydrochloride oral solution ip 10mg / 5m1 500. ipratropium bromide nebulizer solution 250 mcg / ml 501. salbutamol nebuliser solution bp 5 mg / ml 502. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 503. chlorhexidine gluconate solution 5% 250 ml 504. povidone iodine solution ip 5% 100m1 bottle 505. potassium chloride oral solution u.s.p 500mg / 5m1 506. vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 507. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 508. povidone iodine solution ip 10 % 509. lactulose solution usp / bp 10gm / 15ml or 3.35 gm / sml 510. vitamin d3 oral solution 60000 iu 511. concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans 512. feracrylum 1% w / v sterile solution 100 ml 513 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5misize 514. balancesalt solution with ph.of 7.2 to 7.4 osrnolarity 292 to294 in 100% biodegradable bag with potyofin syrup 515. i cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, arlip ‘4. ) . 516. cough syrup / expectorant ( 50 ) ml 517. alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate 518. multi vitamin syrup 519. b. complex 520. calcium phosphate 200 ml 521. dextromethorphan hcl + chlorpheniramine 522. each 15 ml contains: milk of magnesia 11.25 ml• liquid paraffin 3.75 ml 170 ml 523. each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml 524. linezolid 100mg / 5m1in 30m1 525. sodium picosulphate oral suspension 526. sorbitol + tricholine citrate suspension 527. 528. 529. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) albendazole oral suspension 1p 400 mg / 10m1 domperidone suspension ip 5mg / 5m1 530. 531. budesonide nebulizer suspension 0.25mg / m1 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 532. 533. 535. surgical cap disposable ( for surgeons ) ampicillin cap ip 500mg pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets pregabalin cap ip 7s m8 536. tramadol cap ip 50 mg — _ 537. tramadol cap ip 50 mg 538. amoxycillin cap ip 250mg 539. amoxycillin cap ip 500mg 540. doxycycline cap ip 100 mg 541. itraconazole cap 100 mg 542. danazol cap ip 50 mg 543. deferiprone cap 250mg 544. deferiprone cap 500mg 545. nifedipine cap ip 5mg 546. omeprazole cap ip 20 mg 547. l•ornithine l•aspartate ( 150mg ) + pancreatin ( 100mg ) 548. nifedipine sublingual pessary 549. povidone iodine powder 550. infant milk formula term 400 gm 551. infant milk pre trem baby ( lbw ) 400 gm sachet 552. hmf for pretem 553. l arginine+proanthocynadine granules 3mg / 5 mg tablets and in cation 554. 1 l arginine 3 gm + proantho cyaniding 75 mg 555. tab dehydro epiondrosterone sr 75 mg 556. tab anastrozole 3. mg 557. tab letrozole 2.5 mg 558. inj. certrorelix acetate 0.25 mg 559. lnj. menotropin 150 re 0.5 nil 560. lnj. menotropin 225 iu / 0.75 ml 561. highly purified hmg 75 / 150 iu 562. highly purified follicle stimulating hormone 75 / 150 iu 563. highly purified hcg 2000 / 5000 / 7500 / 10000 iu 564. natural microhized progesterone soft caps 100 / 200 mg 565. natural microhized progesterone soft caps 200 / 400 mg 566. inj enoxaparin 40 mg et 567. estradiol & dydrogesterone tab. 1 / 5 mg 568. combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg 569. combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg 570. ubidecarenone capsules lisp 0100 / q300 ( co enzyme 010 ) 571. inj leuprolide acetate 3.75 mg 572. inj leuprolide acetate 1 mg / 0.5 ml 573. inj leuprolide acetate 4 mg / 4 ml 574. inj. buserlin acetate 0.5 mg / 0.5 ml 575. inj. buserlin acetate 7 mg / 7 ml 576. tab. diclofenac gastro resistant ip so mg 577. tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg 578. tab. ibuprofen ip 400 mg 579. tab. paracetamol ip 500mg 580. tab. paracetamol ip 650mg 581. cap. tramadol ipsomg 582. tab. chlorpheniramine maleate ip 4mg 583. tab. prednisolone ip smg 584. tab. acyclovir 200mg 585. tab. albendazole ip 400mg 586. tab. amoxycillin and potassium clavulamate ip 500mg+125mg 587. cap. amoxycillin ipsoomg 588. tab. azithromycin ip 500mg 589. tab. cefixime ip 200mg 590. tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated 591. tab. ciproflixacin ip 500mg 592. capometrazole ip 20mg 593. tab. clotrimazole vaginal ip 500mg 594. cap. doxycycline ip 100mg 4011frar 70 595. tab. fluconazone ip150mg 596. cap. itraconazole ip 100mg 597. tab. metronidazole ip 200mg 598. tab. metronidazole ip 400mg 599. tab. norfloxacin ip 400mg 600. cap nifedipine ip 5mg 601. tab. nitedipine ip 10mg 602. dinoprostone cream / gel 0.5mg dinoprostone in syringe 603. tab. trenexamic acid 604. tab. clindamycin 150mg 605. tab. clindamycin 300mg 606. inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg 607. inj. phenytoin 50mg 608. inj. cisplatin 50mg 609. inj. vancomycin 500mg 610. inj. vancomycin 1 gm 611. inj, normal human intravenous immunoglobuline 612. inj. surfactant 3m1 613. inj. feracrylum 1% w / v solution 614. dinoprostone gel 615. tab. ramipril tablets ip 5mg 616. cap. evening primosa 1000mg...

Medical College - Rajasthan

33970279 tender invited for supply of generic drug and medicine at zenana hospital, jaipur , bupivacaine inj. ip 0.5% , drotavering hydrochloride inj 40 mg / 2 ml , inj.halothane bp , inj.isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , fentanyl citrate injection ip 2 ml , morphone sulphate inj ip 10mg / ml , paracetamol inj, 150 mg / ml , pentazocine inj ip 30 mg / ml ( im / iv use ) , adrenaline injection ip 1mg / ml im / iv use , dexamethasone inj ip 8mg / 2ml , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , pheniramine inj ip 22.75 mg / ml , promethazing inj ip 25mg / ml , naloxone inj ip 0.4mg / ml , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amphotericin b inj ip50 mg , ampicillin injection ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 500 mg / 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , gentamycin injection ip 80mg / 2ml ( im / iv use ) , meropenem inj ip 500 mg , meropenem inj ip 250 mg , metronidazole inj ip 500 mg / 100ml , bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , methotrexate inj ip 50 mg / 2 ml , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , amiodarone hydrochloride inj 50mg / ml , digoxin inj ip 0.25 mg / ml , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , nitroglycerin inj 5 mg / ml , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , furosemide injection ip 10mg / ml ( im and iv use ) , mannitol inj ip 20% w / v , dicyclomine inj ip 10 mg / ml , hyoscine butylbromide inj ip 20 mg / ml , metoclopramide inj ip 10mg / 2ml , ondansetron inj ip 2mg / ml , pentoprazole inj 40mg , ranitidine hcl injection ip 50mg / 2ml , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , human anti d immunoglobulin injection 300mcg ( im use ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , isoxsuprine inj ip 5 mg / ml , methylergometrine inj ip 0.2 mg / ml , oxytocin inj ip 5 iu / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , aminophylline inj ip 25 mg / ml , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , calcium gluconate inj ip 10% ( iv use ) , vitamin b complex inj nfi , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , labetalol hcl inj ip 20mg / 4ml , betamethasone sod phos inj ip 4mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , phenobarbitone inj ip 200mg / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , piperacillin + tazobactum for injection ip 4gm+500mg , torsemide inj 10 mg / ml , meropenem inj. ip 1gm , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , acetylcystine solution usp ( injection ) 200 mg / ml , amikacin inj ip 250 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , linezolid inj 200mg / 100ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , adenosine injection ip 6 mg / 2ml , isoprenaline injection ip 2mg / ml , noradrenaline injection ip 2 mg / ml , sodium chloride injection ip 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , neostigmine injection ip 2.5mg / 5ml , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection with syringe , atropine sulphate injection 0.6mg / ml , fentanyl citrate injection 50mcg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , levetiracetam injection 500mg / 5ml , aztreonam injection 1gm , clindamycin phosphate injection ip 300 mg , polymixin sulphate binjection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , tranexamic acid injection ip 100mg / ml 5ml size , esmolol hydrochloride injection 10mg / ml 10ml size , hepatitis b immunologlobin injection ip 200 i.u , hepatitis b immunologlobin injection ip 100 i.u , human chorionic gonadotropin injection ip 5000 i.u. , ferric carboxymaltose injection 50 mg / ml 10 ml size , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , amino acid 10% injection 250ml size , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , kabalyte ( multipal electrolyte inj ) , inj mephentermine , amphotericin b inj . ( liposonal ) , fluconazole inj , inj propfolwith mct+lct , isolyte –p inj , inj teicoplain , injsidenafil 10mg , inj prostagladine 500mg , inj placentrax , inj sodium chloride 1000ml , inj insulin detemir / levemir ( long aceting ) , injtt0.5 ml , inj leuprolide , inj xylocard , inj metoprolol , inj fentanyl , inj esmlol , progesterone injection 50 , glyceryl trinitrate injection, diluted 5mg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50ml , polymyxin b for injection 1 million , potassium chloride for injection , sodium bicarbonate injection , inj. dopamine , inj.adrenaline , inj.dobutamine , inj.phenobarbitone , inj.midazolam , inj.calcium gluconate , inj.caffine citrate , inj.amikacin , inj.polymixin b , inj.amphotericin b ( liposomal ) , inj.surfactant ( porectent ) , inj.human albumin , inj.prostoglandin , inj.linazolid , inj.ciplox , inj.levofloxacin , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , hepatitis b immunoglobulin 200iu 0.4ml im / sc pfs vial , paracetamol infusion ip 1% w / v 100ml size , instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 , medical device sterlization solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous. it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio , nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12, 5% c18, …….10% 68%c12, 32% c14………10% inert ingredient ………80% usepa registration number mandatory. usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory. product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. , antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , ringer acetate infusion 500 ml , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , sodium chloride and dextrose 0.45% infusion 500ml , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , savalon1 l , savlon 500 ml , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , distilled water 500ml , distilled water 5 ltr , sodium chloride and dextrose0.45% infusion 500ml , folinic acid 200mg / vial , sodium chloride 3% 100ml , prostaglandin 500mcg / ml , azithromycin 10 ml vial equaivelent to 500 mg , caffeine cirate 20mg / ml , carbetocin 1ml / 100micro. , ceftriaxone and sulbactam 1.5g , clindamycin 600mg / 4ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , folinic acid 200mg / vial , azithromycin 10 ml vial equaivelent to 500 mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , folic acid +methylcobalamine 10 ml pack , fsh 75 iu , fsh 150 iu , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu , insulin aspart , insulin lispro , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , isolyte p 10% 500 ml , levofloxacine 500mg / 100 ml , lignocaine ( preservative free ) 2% , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , methylene blue , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , multivitamin 10 ml , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , normal saline 500 ml glass bottle , normal saline 1000 ml glass bottle , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , procaine penicillin fortified 2 lack , teicoplanin 200 mg , teicoplanin 400 mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in0.5 ml , inj. propofol mct / lct with oleicacid inj. iv , inj. paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag , inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 1000 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , inj. hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10 mg , clopidogrel tab ip 75 mg , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , methyldopa tab ip 250mg film coated , propranolol tab ip 40 mg , verapamil tab ip 40 mg film coated , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , frusemide tab ip 40 mg , hydrochlorthiazide tab ip 12.5 mg , torsemide tab 10 ip mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , domperidone tab ip 10 mg , loperamide tab ip 2 mg , metoclopramide tab ip 10 mg , ranitidine tab ip 150mg film coated , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , ethinyloestradiol tabs ip 50 mcg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , thyroxine sodium tablets ip 100mcg , thyroxine sodium tablets ip 50mcg , neostigmine tab ip 15 mg , isoxsuprine tab ip 20 mg , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , salbutamol tablet ip 4 mg , salbutamol tab ip 2 mg , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , tinidazole tab ip 300 mg , tinidazole tab ip 500 mg , ranitidine tab ip 300mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , hydrochlorthiazide tab ip 25mg , losartan tab ip 25 mg , ascorbic acid tab ip 500 mg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , labetalol tab ip 100mg , nitrofurantoin tab ip 100mg , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mgand paracetamol 325 mg , mefenamic acid tablets bp 500 mg , cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , methotrexate tablets ip 10 mg , bromocriptine tablets ip 2.5 mg , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , telmisartan tablets ip 40 mg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , ondansetron orally disintegrating tablets ip 4mg , ursodeoxycholic acid tablets ip 300 mg , medroxyprogesterone acetate tablets ip 10 mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , mifepristone tab ip 200mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , ramipril tablets ip 2.5 mg , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) , tenaligliptin tablet ip 20mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) , rosuvastatin tablet 10 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , diclofenac+ parcetamol+ serratiopeptidsase tab , dehydrogestrone tab , estradiol tab , povidon vaginal pessaries tab , vit b 12 tab , tab levtiracetcetam 500 mg , tab conjugated estrogen , tab mirabegum , tab derifenacin , tab propar , tab alone / ramloxifene , tab cyproterone acetate & ethinyloestradiol , tab centchronam , tab dinogest , progestron only pills , tab chymoral forte , lasix tab , tab lactare , faskit ( fluconazole / azthomycine & secnidazole tab , tab telmisarton +hidrocylorthiaozide , tab mefenamic acid +dicyclomine hydro , coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , vitamin e capsule 400 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , cefpodoxime 200mg , cefpodoxime cv 375 , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dienogest 2mg , dydrogesterone 10mg , estradiol valerate 2 mg , ethynil estradiol 0.02mg+ tab , desogestral 0.15mg , inositol + myoinositol 1000mg , levetiracetam ip 250 mg , mirabegeron 25 mg , mifepristone 25mg , nifidipine 20mg , paracetomol 650 mg , progesterone only pills , propranolol 40 mg sr , rosuvastatin 10mg + fenofibrate 160mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , tramadol 37.5mg + paracetamol 325mg , trypsin chymotripsin , ulipristal 5mg , hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l aspartate 150mg pyridoxine hydrochloride 3 mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mgeq. to elemental iron 30mg phospholopid 167 mgeq. to phosphatidylserine 100 mg , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen , telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet containtelmisartan40mg + hydroclrothaizide 12.5 mg , telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet containtelmisartan80mg + hydroclrothaizide 25 mg , mefonamic acid 250mg+ dicyclominehydrochloride each tablet contain mefonamic acid 250mg+ dicyclominehydrochloride , combitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm , zideovudine 60 + lamivudine 30 , lung surfactent1.2 ml ( 50 mg ) lypholised , amphotericin b lipid complex 10 mg , ionic solution of silver nutrate with tween twenty 100 ml , clotrimazole cream ip 2% w / w , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , silver sulphadiazine cream ip 1% 50gm tube , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , betamethasone dipropionate cream ip 0.05% , silver sulphadiazine cream ip 1% 500 gm jar , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , estradiol cream , estrogen cream , sumag cream , neomycin sulphate cream , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , lignocaine gel ip 2% , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ] , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , coal tar 6% & salicylic acid 3% ointment , acyclovir eye ointment ip 3% w / w 5gm size , chloramphenicol 1% w / w eye ointment ip, 3gm size , thrombophobe ointment , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , clindamycin phosphate gel usp 1 o / o , metronidazole 1% and chlorhexidine gluconade 0.25% gel , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , domperidone oral drops 10mg / ml ( 10ml ) , carboxymethylcellulos e eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , xylometazoline nasal drops ip 0.1% , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , ciprofloxacin eye drops ip 0.3 o / o w / v , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , lactulose solution , digoxin 0.25% , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , acetylcystine solution usp ( injection ) 200 mg / ml , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , caffiene citrate oral solution , human albumin solution ip 20% , povidone iodine solution ip 5 % 500 ml , formaldehyde solution ( 34.5 per. – 38 per. ) , gentian violet topical solution usp 1o / o , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 % ( 20vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) [ 249 ] , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol nebuliser solution bp 5 mg / ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , chlorhexidine gluconate solution 5% 250 ml , povidone iodine solution ip 5% 100ml bottle , potassium chloride oral solution u.s.p 500mg / 5ml , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , povidone iodine solution ip 10 % , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , vitamin d3 oral solution 60000 iu , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans , feracrylum 1% w / v sterile solution 100 ml , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , balancesalt solution with ph.of 7.2 to 7.4 osmolarity 292 to294 in 100 % biodegradable bag with polyofin , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate , multi vitamin syrup , b. complex , calcium phosphate 200 ml , dextromethorphan hcl + chlorpheniramine , each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin3.75 ml 170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen100 mg 60 ml , linezolid 100mg / 5ml in 30ml , sodium picosulphate oral suspension , sorbitol + tricholine citrate , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , albendazole oral suspension ip 400mg / 10ml , domperidone suspension ip 5mg / 5ml , budesonide nebulizer suspension 0.25mg / ml , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , ampicillin cap ip 500mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , pregabalin cap ip 75 mg , surgical cap disposable ( for surgeons ) , tramadol cap ip 50 mg , tramadol cap ip 50 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , doxycycline cap ip 100 mg , itraconazole cap 100 mg , danazol cap ip 50 mg , deferiprone cap 250mg , deferiprone cap 500mg , nifedipine cap ip 5mg , omeprazole cap ip 20 mg , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , nifedipine sublingual , povidone iodine , infant milk formula term 400 gm , infant milk pre trem baby ( lbw ) 400 gm , hmf for pretem , l arginine+proanthocynadine granules 3mg / 5 mg , l arginine 3 gm + proantho cyaniding 75 mg , tab dehydro epiondrosterone sr 75 mg , tab anastrozole 1 mg , tab letrozole 2.5 mg , inj. certrorelix acetate 0.25 mg , inj. menotropin 150 iu / 0.5 ml , inj. menotropin 225 iu / 0.75 ml , highly purified hmg 75 / 150 iu , highly purified follicle stimulating hormone 75 / 150 iu , highly purified hcg 2000 / 5000 / 7500 / 10000 iu , natural microhized progesterone soft caps 100 / 200 mg , natural microhized progesterone soft caps 200 / 400 mg , inj enoxaparin 40 mg , estradiol & dydrogesterone tab. 1 / 5 mg , combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg , combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg , ubidecarenone capsules usp q100 / q300 ( co enzyme q10 ) , inj leuprolide acetate 3.75 mg , inj leuprolide acetate 1 mg / 0.5 ml , inj leuprolide acetate 4 mg / 4 ml , inj. buserlin acetate 0.5 mg / 0.5 ml , inj. buserlin acetate 7 mg / 7 ml , tab. diclofenac gastro resistant ip 50 mg , tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg , tab. ibuprofen ip 400 mg , tab. paracetamol ip 500mg , tab. paracetamol ip 650mg , cap. tramadol ip50mg , tab. chlorpheniramine maleate ip 4mg , tab. prednisolone ip 5mg , tab. acyclovir 200mg , tab. albendazole ip 400mg , tab. amoxycillin and potassium clavulamate ip 500mg+125mg , cap. amoxycillin ip500mg , tab. azithromycin ip 500mg , tab. cefixime ip 200mg , tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated , tab. ciproflixacin ip 500mg , capometrazole ip 20mg , tab. clotrimazole vaginal ip 500mg , cap. doxycycline ip 100mg , tab. fluconazone ip150mg , cap. itraconazole ip 100mg , tab. metronidazole ip 200mg , tab. metronidazole ip 400mg , tab. norfloxacin ip 400mg , cap nifedipine ip 5mg , tab. nitedipine ip 10mg , dinoprostone cream / gel 0.5mg dinoprostone in syringe , tab. trenexamic acid , tab. clindamycin 150mg , tab. clindamycin 300mg , inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg , inj. phenytoin 50mg , inj. cisplatin 50mg , inj. vancomycin 500mg , inj. vancomycin 1 gm , inj, normal human intravenous immunoglobuline , inj. surfactant 3ml , inj. feracrylum 1% w / v solution , dinoprostone gel , tab. ramipril tablets ip 5mg , cap. evening primosa 1000mg...

Medical Health And Family Welfare - Rajasthan

33963400 supply of mnjy laboratory consumable item supply in govt hospital nathdwara mnjy laboratory consumable item supply in govt hospital nathdwara , category : laboratory , n / 10 hcl ( aspen ) , hb meter , hb tube ( square ) , hb pipette , whatmansfilter paper ( cirular ) , lanscet , capillary tube fine , wbc diluting fluid , neubars chamber , wbc pipette , methanol , field stain 1x500 ml a, 1x500ml b , glass slides , oil cedar wood , platelate count fluid , reticulocyte count fluid , esr stand with marking and disposal cup and pipettes ( top tech ) , for esr testcup ( plastic ) top tech , esr pipette ( glass ) top tech , esr pipette with blub ( disposal auto suck ) , tri sodium citrate 3.8% ( solution ) ( aspen ) , stop watch , k3 edta tube ( double cap ) , urine albumin / sugar , urine cover slip , urine pregnancy test card , lugols idoine , benedict reagent , 3% sulfosalicylic acid , modified rothrasnitroprysside , 33% acetic acid , 5% barrium chloride powder , fouchets reagent , sulpherpowder , hydrogen peroxide , benzidine powder , hepatitis b ( hbsag ) card ( aspen / sd / merilisa ) , hepatitis c ( hcv ) card , vdrl strip ( aspen / sd / merilisa ) , blood vdrl test kit , hiv card ( aspen / sd / merilisa ) , hiv tridot , hiv combaids / elisa , dengue cardantigen +antibody , dengue elisa , malaria card ( aspen / sd / merilisa ) , widal test kit ( vials ) ( to, th, ah, bh ) , abo rh a, b, d, vials ( tulip / eryclone ) , coombs reagent , bovine albumin 22% , asoreagents vials , rfreagent vial , jsb i & ii , jsb i & ii , z.n. stain rapid kit , sprit lamp , test tube 4 for all serology glass / plastic , blood sugar ( erba ) , kinetic system pack for xl 300 urease gldh , urea forsemi auto urease ( erba ) , creatinine for semi auto ( initial rtae ) ( erba ) , sgot without pyridoxal phosphate for semi auto ifcc method ( erba ) , sgpt without pyridoxal phosphate for semi auto ifcc method ( erba ) , alkaline phosphates for semi auto kinetic ( pnpp ) ( erba ) , total protein sermi auto analyzer ( erba ) , albumin semi auto analyzer ( erba ) , bilirubin total for semi auto for total & direct biluribin ( erba ) , bilirubin direct for semi auto for total & direct biluribin ( erba ) , serum uric acid semi auto analyzer ( mono vial ) ( erba ) , serum calcium semi auto analyzer ( mono vial ) ( erba ) , serum ldh semi auto analyzer ( erba ) , ckmb semi autoanalyzer ( erba ) , cknac semi autoanalyzer ( erba ) , serum amlyase semi autoanalyzer kinetic ( erba ) , cholestrolsemi auto ( erba ) , hdl cholestrol semi auto analyzer ( erba ) , serum triglyceride forsemi auto urease end point ( erba ) , crp , trbc reagent , bio medical waste bucket blue with sieve , bio medical waste bucket red with sieve , micro pipette 0 to 50 micro ltr fix , micro pipette 0 to 10 micro ltr fix , micro pipette 0 to 1000 micro ltr fix , micro pipette 10 to 100 micro ltr varaible , micro pipette 20 to 200 micro ltr varaible , micro pipette 100 to 1000 micro ltr varaible , gloves latex disposable lms , gloves latex 6 6½ 7 , hand wash liquid , 3 parts dilucel plus , 3 parts lycel plus , 3 parts rincel plus , cemical h 560 five parts dilucel plus , cemical h 560 five parts lycel plus , cemical h 5605 parts rincel plus , auto pipet , mp staend , test tube 5 ul , test tube badi , test tube stand , test tube holdar , sprit , sfri 5 parts dilucel plus , sfri 5 parts lycel plus , sfir 5 parts rincel plus , sodium hypo chlorite 5% , test tube rack plastic ( 1x48 wells ) , test tube rack plastic ( 1x24 wells ) , slide tray aluminum for 20 slides , needle 18 20 22 gauge , csf diluting fluid , semen diluting fluid , keton diastix , hemo spot test for occult blood , disposable syringe with needle10cc , disposable syringe with needle5cc , disposable syringe with needle2cc , blue tips , yello tips , tissue paper ( j.k., apple etc ) , d.i. water , glass marking pencil , black permanent marker pen , cotton , sample cup plastic , staining box glass , coplin jar , dropper plastic , disposable cap , dispo mask , cpd beg 350 ml ( polymed ) , cpd beg 100 ml ( peadiatric bag ) , formaline soul , gloves powder , suger strip ( accusure ) , blood sugar strip rapid accucheck go , blood sugar strip rapid accucheck proforma , blood sugar strip rapid accucheck sensor , blood sugar strip rapid accucheck active , blood sugar strip rapid abbot optium , blood sugar strip rapid easy touch , coomb’s test , prothrombin test ( tulip ) , hdl direct method ( arba ) , ldl direct method ( arba ) , electrolyte solution pack ( na, k, cl ) , daily rinse kit , quality control , print roll , leshmin stain , e.d.t.a. solution , gla. acitic acid , gram iodine , erba wash , printer roll ( 56mm ) , adhesive roll cloth , tonikete , slide , hb stripe, hemocue , multistix ( urine strip for multiple test ) , p.t. reagent , bulb for microscope , plain vail ( aspen ) , a / 1 antigen ( tulip / eryclone ) , vovine albumin 22% ( tulip / eryclone ) , coomb sera ( tulip / eryclone ) , anti h ( tulip / eryclone ) , anti d ( polyclonp ) , anti ab ( polyclonp ) , hcv card ( aspen / sd / merilisa ) , hbsag elisa ( aspen / sd / merilisa ) , hiv elisa ( aspen / sd / merilisa ) , hcv elisa ( aspen / sd / merilisa ) , betadine solution , phenyle solution , anti d ( polyclonp ) , anti ab ( polyclonp ) , adhesive papper , liquid paraffin , giemsa stain , chikunganya , scrub typhus card , swine flue vtm , test tube brush , plastic dropping bottle , semi auto anaiyzer p.m. kit , ayres spatula , slide fixative , oil ermersion lence ( 100x ) , edta solution ( aspen ) , sodium citrate vail ( aspen ) , anti a1 lectine ( tulip ) , anti human comb sera , anti h lactin , blood collection bag adult , blood collection bag pediatric , blood bank bandage / hansaplast , blood heamochek , esr tube , ethanol bottle , preventive and maintance kit for lab earba , hydrocloride acid , bbr graph paper...

Pandit Madan Mohan Malviya Hospital - Rajasthan

33952145 supply of jadi buti ayurved drug raw material & general items akarkara, arlu chal, ashvagandha, bowl, kachur, seed, tagar, dhaniya, nagkesar, patol patra, bilvgiri, lemethi, methidana, ral, vacha, sugar, etc....

Medical Health And Family Welfare - Rajasthan

33938693 bids are invited for glass slide , pregnancy card , uristik albumine sugar , hiv test card , hbsag card test , maleria pv pf , needdle syringe destroyer , pricking needle lancet , dengu card , sputumcontainer , mb kit , plain vial with cap total quantity : 21960...

Medical And Health Services - Rajasthan

33926279 supply of lab regents and x ray 1 preg. card ( mankind ) 2 multi uristix ( mission ) 3 blood group reagent ( tulip ) 4 esr tube disposable 5 sample vial with clotapplicator 6 k 3 vial ( double cap ) 7 sugar kit ( equacheck / dibascan ) 8 widal test kit ( becon / span ) / arkray 9 glass slide 10 cover sleep 11 urea test kit ( erba ) ( 5x20m1 ) 12 erba sgot test kit ( erba ) ( 5x20m1 ) 13 erba sgpt test kit ( erba ) ( 5x20m1 ) 14 sarum alkaline phosphatase test kit ( erba ) ( 10ax2.2m1 ) 15 lancet 16 bilrubin test kit erba ( direct & total ) 17 creatinine test kit ( erba ) 18 cholesterol test kit ( erba ) 19 vdrl test kit ( sd ) 20 hbsag test kit / card ( sd ) 21 analyzer. cleaner solution ( erba ) 22 hdl cholesterol direct mahtod ( erba ) 23 tri glicride test kit ( erba ) 24 mp card ( sd ) antigen 25 dengue card ( j mitra ) 26 total protien ( erba ) 27 utistix a / s 28 gluco strip ( accu check ) / one touch 29 hb pipette 30 leishman stain ( tanbaxy ) 31 rbc diluting fluid 500m1 32 wbc diluting fluid 500m1 33 auto pipette tips 100 to 1000u1 blue 34 auto pipette tips ( 1 to 100u1 ) yellow 35 sodium citrate 500m1 36 n / 10 hcl 500m1, 37 i xyiene 500m1 38 urine container 39 sprit ( 5ltr. ) 40 test tube without cat ( riavial ) 41 touriquet 42 distilled water ( 5ltr. ) 43 jsb 1st 44 jsb 2nd 45 capillary tube •• 46 hemoglobin strip ( hemocue ) 47 hb scale strip ( hemocheck ) 48 analyzer printer roll 49 fillter paper _... 50 serum allvumin kit ( erba ) 51 marker pencil 52 parmanent marker 53 liqued hand wash ( 5ltr. can ) 54 abxlyse bio ( 1 ltr. ) ( horriba ) 55 abxcleaner ( 1 ltr. ) ( horriba ) 56 minoclair ( 0.5 ltr. ) ( horriba ) 57 minidil lmg ( 20 ltr. ) 58 albumin kit ( erba ) 59 vldl kit ( erba ) 60 hydro chloric acid solution 61 cader wood oil 62 facemask ( n 95 ) 63 sharp container 64 glassware container 65 glass beaker ( 1000m1 / 200m1 ) ....

Sms Medical College - Rajasthan

33903081 tender for supply of lab reagents and other consumables items alk. phosp. kit , 1. r.a. factor ( 1 x 100 test ) 2. aslo slide test kit 3. widal test kit ( 1x100 ) 4. crp test kit ( 1 kit x 100 test ) 5. hdl kit ( 1 x 200 ml ) 6. s. cholesterol kit ( 500 ml ) 7. triglyceride test kit ( 1 x 500 ml ) 8. 9. in ldh test kit ( 1 x 500 ml ) total protein kit ( 1000 ml ) albumin test kit it 12. sgpt kit kinetic method ( 1 x 50c ml ) 13. 14. 15. i 16. 17. 18. sgot kit kinetic method ( 1 x 50 ( ml ) uric acid kit ( 1 x 500 ml ) s. creatinine kit ( 1000 ml ) blood urea kit ( 1 x 500m1 r1 & r each ) blood sugar kit ( 1 x 500m1 ) tissue roll , 19, printing roll for cell counter 52 mm x 30 mtr. 20. pregnancy test card 21. cedar wood oil ( 60 ml ) 22. anti a 23. anti b 24. anti d 25. anti human serum 10 mi 26. bovine serum albumin 05m1 22% 27. cpda singal blood bag 28. triple blood bag ( 350 ml ) cpd + sagam 29. double blood bag ( 350 ml ) cpd + sagam 30. double blood bag ( 450 ml ) cpd + sagam 31. quadruple blood bag ( 450 ml ) ( top & bottom ) cpd + sagam 32. distil water 33. disposable dropper ( plastic ) 34. glass slide 35. elisa hiv kit 4th gen. 36. elisa hbs ag kit 37. elisa hcv kit 38. spot hiv card 4th gen. 39. spot hbs ag card 40. spot hcv card liss coombs card liss diluents 41. 42. 43. malaria card 44. plastic vial plain with cap ( non vacutainer ) 45. e.d.t.a vial ( non vacutainer ) tu. i...miss niue ( irnrnicimmnixbu ) 47. vacutainer needle holder 48. disposable sterile plastic lancets 49. test tube without cap 5m1 50. micro tips ( 5 micro l 200 micro l ) 51. micro tips ( 100 micro l 1000 micro l ) 52. serum sample cup ( cuvette ) ( 2.5 3 ml ) 53. micro cover glasses ( 22x22mm ) 1 x 10gm ) 54. micro cover glasses ( 22x50mm ) 55. leishman stain ( 1 x 500 ml ) 56. urine alb + sugar ( 1 x 100 ) 2 parameter 57. disposable vacutaner blood collection ( plastic ) tube with spray dried k2 edta 1.8 mg / ml. 3 ml. 58. disposable vacutaner blood collection ( plastic ) tube for serum 59. disposable vacutaner blood collection ( plastic ) tube with 3.2% buffered sodium citrate for coagulation studies and tube technology sealed from the top to avoid citrate leakage from the top with hemogard closure 2.7 ml. 60. disposable blood collection vacutaner needle 22 g xl inch ( 0.7x2.5 mm. ) 61. n / 10 hcl 62. dengue card combo / duo ( igg / igm+ ns 1 antigen ) 63. filter paper 64. micro capillary b.t. c.t. 90 mm length 65. reagent bilirubin ( total ) 66. reagent bilirubin ( direct ) 67. reagent calcium 68. band aid ( rounded ) 69. vdrl card 70. sponge ball 71. tourniquet 72. dengue rapid test 73. hb scale book 74. bilirubin kit ( t&d ) ( ( 1 x 500 rn1+500 ml each ) 75. serum calcium kit ( 1 x 1000 ml ) 76. vacutainer edta k 2 vial 77. micro pipette fixed volume 78. micro pipette variable volume ( 0 50 ul ) 79. micro pipette variable volume ( 50 500 ul ) 80. micro pipette variable volume ( 500 1000 ul ) 81. non vacutainer soudim citrate 3.2% 82. plastic container for urine / semen 83. test tube stand ( plastic ) 1x50 84. test tube stand ( plastic ) 1x30 85. b.p. cuff 86. b.p. bulb with lock 87. transfer blood bag 88. micro pipette fixed 100 hr 89. glycerin 90. normal saline 0.9% 91. naphthalene ball 92. paper roll 57mm for ( 9 part ) 93. sdp kit 94. wafer ( bag connecter ) 95. calibrator sera cal 3 20x5m1 ( randox ) 96. human assy control level 2 97. human assy control level 3...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical College - Rajasthan

33900281 tender invited for supply of lab reagents and other consumable items tender invited for supply of lab reagents and other consumable items , r.a. factor ( 1 x 100 test ) , aslo slide test kit , widal test kit ( 1x100 ) , crp test kit ( 1 kit x 100 test ) , hdl kit ( 1 x 200 ml ) , s. cholesterol kit ( 500 ml ) , triglyceride test kit ( 1 x 500 ml ) , ldh test kit ( 1 x 500 ml ) , total protein kit ( 1000 ml ) , albumin test kit , alk. phosp. kit , sgpt kit kinetic method ( 1 x 500 ml ) , sgot kit kinetic method ( 1 x 500 ml ) , uric acid kit ( 1 x 500 ml ) , s. creatinine kit ( 1000 ml ) , blood urea kit ( 1 x 500ml r1 & r2 each ) , blood sugar kit ( 1 x 500ml ) , tissue roll , printing roll for cell counter 52 mm x 30 mtr. , pregnancy test card , cedar wood oil ( 60 ml ) , anti a , anti b , anti d , anti human serum 10 ml , bovine serum albumin 05ml 22% , cpdasingal blood bag , triple blood bag ( 350 ml ) cpd + sagam , double blood bag ( 350 ml ) cpd + sagam , double blood bag ( 450 ml ) cpd + sagam , quadruple blood bag ( 450 ml ) ( top & bottom ) cpd + sagm , distil water , disposable dropper ( plastic ) , glass slide , elisa hiv kit 4th gen. , elisa hbs ag kit , elisa hcv kit , spot hivcard 4th gen. , spot hbs ag card , spot hcv card , liss coombs card , liss diluents , malaria card , plastic vial plain with cap ( non vacutainer ) , e.d.t.a vial ( non vacutainer ) , glass slide ( 75mmx25mm ) ( 1x50 ) , vacutainer needle holder , disposable sterile plastic lancets , test tube without cap 5ml , micro tips ( 5 micro l 200 micro l ) , micro tips ( 100 micro l 1000 micro l ) , serum sample cup ( cuvette ) ( 2.5 3 ml ) , micro cover glasses ( 22x22mm ) ( 1 x 10gm ) , micro cover glasses ( 22x50mm ) , leishman stain ( 1 x 500 ml ) , urine alb + sugar ( 1 x 100 ) 2 parameter , disposable vacutaner blood collection ( plastic ) tube with spray dried k2 edta 1.8 mg / ml. 3 ml. , disposable vacutaner blood collection ( plastic ) tube for serum ( with silica clot activator ) 4 ml. , disposable vacutaner blood collection ( plastic ) tube with 3.2% buffered sodium citrate for coagulation studies and tube technology sealed from the top to avoid citrate leakage from the top with hemogard closure 2.7 ml. , disposableblood collection vacutaner needle 22 g x1 inch ( 0.7x2.5 mm. ) , n / 10 hcl , dengue card combo / duo ( igg / igm+ ns 1 antigen ) , filter paper , micro capillary b.t. c.t. 90 mm length , reagent bilirubin ( total ) , reagent bilirubin ( direct ) , reagent calcium , band aid ( rounded ) , vdrl card , sponge ball , tourniquet , dengue rapid test , hb scale book , bilirubin kit ( t&d ) ( ( 1 x 500 ml+500 ml each ) , serum calcium kit ( 1 x 1000 ml ) , vacutainer edta k 2 vial , micro pipette fixed volume , micro pipette variable volume ( 0 50 ?l ) , micro pipette variable volume ( 50 500 ?l ) , micro pipette variable volume ( 500 1000 ?l ) , non vacutainer soudim citrate 3.2% , plastic container for urine / semen , test tube stand ( plastic ) 1x50 , test tube stand ( plastic ) 1x30 , b.p. cuff , b.p. bulb with lock , transfer blood bag , micro pipette fixed 100 hr , glycerin , normal saline 0.9% , naphthalene ball , paper roll 57mm for ( 9 part ) , sdp kit , wafer ( bag connecter ) , calibrator sera cal 3 20x5ml ( randox ) , humanassy control level 2 , humanassy control level 3...

Navodaya Vidyalaya Samiti - Rajasthan

33894860 bids are invited for basmati rice india gate , wheat flour atta , soyabean refined oil , arahar dal , massore dal red , chana dal , moong mogar dal , moong chhilka dal , kala chana , suji , besan , born vita , salt , haldi powder , mirchi powder , dhaniya powder , jeera , rai dana , daliya , rice poha big size , moongfali dana , ajwayan , biscuits parle g , biscuits parle g cream , biscuits 20 20 , happy happy biscuits , kismis , hari ilaichi , kabuli chana white , rajma lal , chawla white , maithi daana , namkin bhujia bikaji , washing powder , sugar , tea , sounf , meetha rang for sweet , amchoor powder , sabut dhaniya , baking poweder , kaju tukdi...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33891480 supply of tourism and hospitality tourism and hospitality , tables , dining chairs , side station , bar counter ( front and back bar ) , hostess desk , storage cabinet , computer , dinner plate 11 , dessert plate 9 , b&b plate , tea cup , tea saucer , soup bowl , soup bowl 4.5 chinese , soup spoon chinese , service bowl 1 port 6 , service bowl 2 port 7 , service platter 1 port 10 , service platter 2 port 12 , pasta plate 11 , cereal bowl , chutney bowl small , tea spoon , dessert ( a.p ) spoon , dessert ( a.p ) fork , soup spoon with bowl , dessert knife , table service spoon , table service fork , tea strainer , tea set , water jug , salt and pepper set , tooth pick holder , straw holder , sugar sachet holder , napkin holder , finger bowl large with under liner , entree dish round with lid ( 1 portion ) , entree dish round with lid ( 2 portion ) , oval platter , reserved , round service tray , rectangular service tray , ash tray , tom collins ( glass ) , hi ball , pilsner , decanter small , decanter large , wine glass , table cloths , table napkins , bar tool kit , cocktail shaker , frist aid kit...

Department of School Education - Rajasthan

33886196 bids are invited for wheat, flour atta fssai approved , rice tukadi 40 no. , refined soyabin oil , sugar mota dana , dal moong chilka sortex clean , dal chana sortex clean , dal arahar sortex clean , dal masoor sortex clean , dal moong mogar sortex clean , kala chana sortex clean , kabuli chana big size , jeera machine clean good quality , rai sabut machine clean good quality , poha big size , suji, good quality , peanut , wheat daliya sortex clean , rajma red big size , besan packing , mixed pickle , dry green peas , bournvita , jalzeera packet 500g , kaju tukdi good quality , kismisgood quality , hing , garam masala powder agmarka , saltidozied , red chilly powder , turmeric powder , corianderpowder , krack jack , parle cream biscuit , sunfeast creambiscuit , pappad masala , bikaneri bhujia , washing powder , rashgulla , rajbhog kesharbati , gulab jamun , ajwain , kastoori maithi , kitchen king , degimirch total quantity : 20176...

Medical And Health Services - Rajasthan

33872013 supply of rmrs chc sawa lab and xray reagent and equipment 1 ecg gelly 2 s. alkaline phosphatase kit 3 s.glucose reagent 4 total protine reagent 5 s. albumin reagent 6 tlc fluid 7 abo rh kit 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastik knob 11 urine suger / alubmine 12 urine preg. test stripe 13 hiv rapid test kit 14 h c l n / 10 500m1 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol 20 s. hdl 21 s. triglyceride 22 serum creatnine 23 serum bilirubin t, d 24 sgot 25 sgpt 26 vdrl rapid test kit en urine complete by strip , 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6108t ) 38 ecg pper roll ( cardiofax ce1023 ) esr pipet 150mm 39 40 sugar strip ( glucose ) test tube glass 41 42 test tube glass 43 glass beaker 44 test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) 47 cbc roll paper 48 phenyl for hospital use 49 fibsag rapid card 50 cottan roll 51 torniqut 52 x ray film ( digital ) 10*12 53 x ray film ( digital ) 8 10 54 esr test cap 55 crp kit quantitative 56 glass slide 57 blood clot activater vail 58 blood lancet steel 59 abx cleaner 60 abx lysebio 61 abx minidil 62 abx minocular 63 capillary tube 64 cover slip ( micro scop cover glass 22mm 65 micro pipette ( 10 100u1 ) micro tips 66 micro pipette ( 10 1000ui ) micro tips , 67 tips stand 68 test tube plastic 69 sahils hemoglobin meter 70 urine container 71 pera film 72 weight machine baby 73 weight machine baby digital 74 weight machine adult 75 b.p instrument digital 76 b.p. instrument mercury 77 ecg roll 50*20 78 stetho scope 79 glucometer with 25 strip 80 cotton roll 81 micro pipete 82 micro pipete 83 micro pipete 84 blue tips 85 yellow tips....