Medical And Health Services - Rajasthan

34186864 provide of hb meter , hcg , multi parameter urine strip test , blood sugar gluco meter code free , maleriya rapid card test , hiv rapid card test , dengu rapid card test , visual inspretion sticker , hbsag rapid card test , smear for filaria test kit , rapid test kit syphillis , test for iodine salt solution , water testing by strip metod , sputm for afb as per fdsi guideline....

National Rural Health Mission - Rajasthan

34183867 bids are invited for hb meter , hcg , multi parameter urine strip test , blood sugar gluco meter code free , maleriya rapid card test , hiv rapid card test , dengu rapid card test , visual supply of medical items to 420 sub center inspretion sticker , hbsag rapid card test , smear for filariatest kit , rapid test kit syphillis , test for iodine salt solution, water testing by strip metod , sputm for afb as per fdsiguideline. total quantity : 31080...

Medical Health And Family Welfare - Rajasthan

34133215 bids are invited for hcg , multi parameter urine striptest , blood suger glucometer , strips for glucometer , malaria rapid test card , hiv rapid card test , dengue rapid test card , visual inspection board for distance vision light illuminated eye testing drum wall mount , psm near vision drum , hbsagrapid test card , rapid test kit syphillis , water testing bystrip mothod , test for iodine in salt , sputum for afb asper fdsi guideline , lancet total quantity : 431200...

National Rural Health Mission - Rajasthan

34079267 bids are invited for hcg , multi parameter urine strip test , malariya rapid card test , hiv rapid card test , dengu rapid card test , visual inspretion sticker , hbsag rapid card test , smear for supply of medical item to 368 sub centres filaria test kit , rapid test kit syphillis , test for iodine saltsolution , water testing by strip method , sputum for afbas per fdsi guideline total quantity : 26496...

Medical Health And Family Welfare - Rajasthan

34079201 bids are invited for hb meter , hcg , multi parameter urine strip test , blood sugar gluco meter code free , malariya rapid card test , hiv rapid card test , dengu rapid card test , visual supply of medical item to 383 sub centres inspretion sticker , hbsag rapid card test , smear forfilaria test kit , rapid test kit syphillis , test for iodine saltsolution , water testing by strip method , sputum for afbas per fdsi guideline total quantity : 14136...

Medical And Health Services - Rajasthan

34077620 supply of lab regents vdr1, rapid test strips 1 2 i1w rapid test kit 3 widal slide test kit 4 1111sik 5 pregnancy test card & strips 6 1, ucols iodine 7 cover slips tiro diploc ( urine reagent strips ) iq c b 9 mo wi. 10 wbc fluid gimasa stainilisumais stain 12 glass slides 3511 1 3511 11 15 filter paper 16 capillary tube blood group kit a b d , 18 i glucose kit 19 urea kit 20 i creatinine kit 21 i billrubin kit 22 i scot kit 23 i sgpt kit 24 alkaline phosphate kit 25 i total protien kit 26 i s. albuminal kit 27 i cholestrol kit 28 i t.g. kit 29 11dl cholestrol 30 gluneo lite ( gluco strips ) 31 opti1111► strips ( cluco strips ) 32 digital 1111 strips ( llemocue ) 11b 301 33 blood lencet 34 crc paper roll 35 sodium citrate 3.8 % 36 esr cuff 37 blue tips 35 yellow lips 39 euta vial k3 40 plain vial 41 urine contanior 42 glco spqrk strips 43 hypo chloridesolution 44 1113 sag rapid test card 45 i minidil 20 lit 46 lysbio 1 lit 47 clener 1 lit 48 cotton roll 500 gm 49 disttild water 5 lit. ecg group 50 ecg 8108 view z fold paper bpl ....

Medical Health And Family Welfare - Rajasthan

33936449 bids are invited for hcg , multi parameter urine strip test , malariya rapid card test , hiv rapid card test , dengu rapid card test , hbsag rapid card test , rapid test kit syphillis , test for iodine salt solution , water testing by strip method...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical And Health Services - Rajasthan

33872013 supply of rmrs chc sawa lab and xray reagent and equipment 1 ecg gelly 2 s. alkaline phosphatase kit 3 s.glucose reagent 4 total protine reagent 5 s. albumin reagent 6 tlc fluid 7 abo rh kit 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastik knob 11 urine suger / alubmine 12 urine preg. test stripe 13 hiv rapid test kit 14 h c l n / 10 500m1 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol 20 s. hdl 21 s. triglyceride 22 serum creatnine 23 serum bilirubin t, d 24 sgot 25 sgpt 26 vdrl rapid test kit en urine complete by strip , 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6108t ) 38 ecg pper roll ( cardiofax ce1023 ) esr pipet 150mm 39 40 sugar strip ( glucose ) test tube glass 41 42 test tube glass 43 glass beaker 44 test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) 47 cbc roll paper 48 phenyl for hospital use 49 fibsag rapid card 50 cottan roll 51 torniqut 52 x ray film ( digital ) 10*12 53 x ray film ( digital ) 8 10 54 esr test cap 55 crp kit quantitative 56 glass slide 57 blood clot activater vail 58 blood lancet steel 59 abx cleaner 60 abx lysebio 61 abx minidil 62 abx minocular 63 capillary tube 64 cover slip ( micro scop cover glass 22mm 65 micro pipette ( 10 100u1 ) micro tips 66 micro pipette ( 10 1000ui ) micro tips , 67 tips stand 68 test tube plastic 69 sahils hemoglobin meter 70 urine container 71 pera film 72 weight machine baby 73 weight machine baby digital 74 weight machine adult 75 b.p instrument digital 76 b.p. instrument mercury 77 ecg roll 50*20 78 stetho scope 79 glucometer with 25 strip 80 cotton roll 81 micro pipete 82 micro pipete 83 micro pipete 84 blue tips 85 yellow tips....

Medical Health And Family Welfare - Rajasthan

33773985 bids are invited for hcg , multi parameter urine strip test , malariya rapid card test , hiv rapid card test , dengu rapid card test , hbsag rapid card test , rapid test kit syphillis , test for iodine saltsolution , water testing by strip method total quantity : 24570...

Rajasthan Mobile Surgical Unit - Rajasthan

33645272 supply of lab and x ray items etc. s. bilirubin kit ( 6 *50 ml ) drect reagent: 1o0 ml toa m.algfwnt 100 d red nit s ml motaantr4e sml l_ 2 s. ooiestroi kit ( 1 *10 ml ) 3__— s. creatinine kit ( 1*10o ml ) _ 4 hdi kit 5 ldlkit 6 t.gkit 7 v.ld.l kit 8 — s. urea kit ( 1 *10o ml ) ( urease bun kinetic dry powder ) . dry powder base urea ( bun ) urea reagent 5 x 20 ml aqua 4 1x 100 ml standard 5o me / dla 9 sgot kit ( kinetic dry powder ) ( ix10o ml ) . dry powder vial 10 sgpt kit ( kinetic dry powder ) ( 1*100 ml ) __ dry powder vial 11 s. glucose kit ( 1x 100 ml ) ( god pod dry powder ) 12 uric acid test ( 1 *5o ml ) r13 ra factor test ( 1 x 3o test ) 14 capillary tubes 15 glass slide gold coin 16 filter paper ( whatman no.1 ) 17 cedar wood oil ( 1x1o0 ml ) 18 disposable needle no.22 ( lxloo ) 19 n / b hci. ( 1x50o ) 20 semen diluting fluid ( 125 ml ) 21 micro pipette tips ( yeliow or white ) ( 1x1o0o ) 22 micro pipette tips ( blue ) ( 1x 50o ) 23 sodium citrate 3.8% ( 1 x50o ml ) 24 disposable blood collection tube with screw ( lx 10o ) 2s edta vials powder coated ( 1x 1oo ) plain ( analysing tubes ) ( 1x 1oo ) urine collection vial ( 1x 1oo ) 26 28 w.b.c. fluid ( 1 xsoo ml ) l29 r.b.c. fluid ( 1 xsoo ml ) hbsag kit ( rapid ) ( 1 x3o test ) — i — a1 malarea antigen card test ( 1 xso test ) 32 urine pregnancy test kit xaup? 33 vdrl rapid test kit ( 1 x 1.0 test ) 34 widal slide test kit ( 1 30 ) 3s giuco strips ( glucose strips ) 1x50 36 disposable esr tubes plastic ( n. x 1o0 pa ) nestimaton cuveteschenocuiijijj himo smarking pen ( blue red ) jjssueiapr roll reporung ) n 41 sodium hypocti0rite salution s itr . :.u 42 1trwfdmfcf powder ( 9 w _ ‘43 x raw film deweloper powder ( 9lirs ) _ 44 hblac 4s flow cwalfer oluton for semi auto analyser i j ( 1*50m1 ) 46 mjnocjalr solution for cbc machine 0.5 ltr b cbc minidil2o ltr ( for horiba mic ) 48 cbc lysebeo one ltr ( for horiba m / t ) 49 cbc cleaner 1 ltr ( for horiba m / c ) so control for 3 part hematology analyserhoriba _ ( smallest pacu s_ml ) si cbc diatro dpiuent2o ltr ( ior abacus m / c ) 52 cbc lysebio one itr ( for abacus m / c ) cbc cleaner 1 ltr ( for abacus m / c ) 4 54 control for 3 part hematology analyser abacus 380 ( smallest pack 3 ml ) 55 control for seml auto analyser clinical chemistry analyse ( 1 x5o ml ) $6 antiaub&d0 multistix ( 1 x 100 ) 57 58 uristix ( lx1oo ) 59 hemocheck hemoglobin color scale who 60 i x ray films blue sensutive polyster base — size: / 12”xlso 61 x ray fiims blue sensitive polyster base size:1o’rxlyo 62 63 65 m 66 x ray rilms blue sensitive polyster base size: 8’ x 10 carestream digital film 11 x14 carestream digital film io”x12 carestream digital film 8 x1o dispo syringe 2ml m z distilled water ampules ecg gel ecg paper roll 80 mm 106 mm etc...

Medical And Health Services - Rajasthan

33628691 supply of chc ghatiywali dist chittorgarh reagents required ecg gelly — 2 s alkaline phosphatase kit — s glucose reagent — total protein reagent s. albumin reagent 6 tlc fluid 7 abo rh kit — 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastic knob urine sugar / alubmine l 2 urine pregnancy test stripe 13 hiv rapid test kit 14 hcl n / io 500ml 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol — — 21 s. hdl s. triglyceride 22 serum creatnine — 23 serum bilirubin t,d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip _ method 2ss total rbc fluide 29 oil emersion 30 disil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 3o1 (iiacmocue) 35 h13 pipet 20 mic.ltr — 36 hb test tube ecg paper roll(caard1vt6 i 08t) 8 ecg pper roll icartmofax ce 1o23) esr pipet 15omm 40 sugar sthp (glucose) 41 test tube glass tcst tube glass 43 glass beaker ‘ test tube stand 45 glass pipete 46 sodium hypochioride solution jj0°/o) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll torniqut 52 x ray film(digjtal j1092 53 x ray film(digital j? l0d 54 55 esr test cap crp kit quantttative 56 57 glass slide blood clot activa(er vail 58 blood lancet steel 59 abx cleaner 60 abxlysebio 61 abxminidii. 62 abxminocular 63 capillary tube 64 cover slip (micro scop cover glass 22mhmo micro pipette micro tips 67 tips stand 68 test tube plastic 69 sahil’s hemoglobin meter 70 urine container li.perafilm? 72 — .weight muchine baby 73 weight machine baby digital 74? — weight machine adult 75 b.p instrument oigital 76? — b.p. instrument mercury — 77 ecg roll 5020r 78? stetho scope 79 glucometer with 2s strip 80? — cotton roll micro pipette ...

Jawaharlal Nehru Medical College - Rajasthan

33577350 supply of blood bank lab items 2 anti a antisera, monoclonal blood grouping lgm antibody for slide and tube method for abo blood grouping. 3 anti–b antisera, monoclonalbloodgroupinglgm antibody for slide and tube method for abo blood grouping 4 anti ab antisera, monoclonal blood grouping lgm antibody for slide and tube method for abo blood grouping . 5 anti –d antisera, lgm and lgg combination, , monoclonal lgm and lgg blood typing antibody for slide and tube method 6 anti –d antisera, monoclonal lgg only, antibody only for tube method 7 anti a1 , lectin antisera, monoclonal lgm antibody for tube method 8 anti – h lectin antisera, monoclonal lgm antibody for tube method. 9 anti–humanglobulin ( coombssera ) polyspecific, containing anti – lgg and anti c3d to detect lgg antibodies as in cross matching, dat and iat tests 10 bovine serum albumin 22% solution for serological applications, protein concentration and ph should be adjusted to 22% and 7.1 ( + / 0.2% ) respectively 11 fourthgenerationelisakitforanti hcv .microplate coated with recombinant / synthatic peptide antigens for core ns3, ns4 & ns5 and antibody to hcv core antigen. 12 fourth generation elisa kit for detection of hiv p24 antigen & anti hiv 1 / 2 antibody 13 fourthgeneration elisa kit for hepatitis b surface antigen. 14 rapidtestkitsanti hivfourthgenerationforp24 antigen & antibody detection. 15 fourth gen. hiv rapid test kits enzyme immunoassay based on sandwich immunoassay with flow through technology for detection of hiv 16 rapid test kits for hcv antibody ( should be solid phase / particle coated with recombinant and / or / synthetic peptide antigen for core. ns3, ns4, ns5 ) 17 rapid test kits for hepatitis b surface antigen ( should be solid phase / particle coated with monoclonal antibodies to hbsag ) 18 rapid test kit for malaria antigen pf / pan ( hrp ii pf / pldh pan ) . sensitivity:100% , and specificity:99% for both p. falciparum & p. vivax 19 tpha rapid immune chromatography test kit. sensitivity:100% , and specificity: 99.8% antibody [ lgg and lgm ] detection [ 1*25 ] 20 single blood collec tion bag 350 ml ( cpda ) 21 triple blood collection bag 350 / 450 ml ml ( sagm ) 22 quadruple blood collection bag 450 ml ( sagm ) 23 dengue rapid test kit should be solid phase immunochromatographic principle for qualitative detection of dengue ns1 antigen with detection of igg and igm antibody to dengue virus in human serum / plasma. ( 1 x 10 test ) 24 elisa kit for dengue ns1 ( pack size 1 x 96 test ) 25 elisa kit for covid 19 igg 26 elisa kit for syphilis 27 elisa kit for pan ( ldh ) malaria 28 cuvettes for rapid haemoglobin test hb301 ( 1 x 200 pc ) ( should be compatible with make hemocue model 301 ) 29 evacuated blood collection ( plastic ) tube with silica clot activator for serum chemistry with red safety cap 30 evacuated blood collection ( plastic ) tube with spray dried k2 edta / k3 edta with lavender safety cap 31 evacuated sodium citrateblood collection ( gamma irradiated glass ) tube for coagulationtest ( withna citrate 0.109 m / 3.2% ) with light blue safety cap. 32 disposable evacuated blood collection needle with / without flash 22g.*1 inch. gamma sterilize with certificate proof of previous training record [ 1*100 ] 33 evacuatedtubebloodcollectionneedleholdersfor holding needle and tube. 34 variable volume multichannel micro pipette ( 8 channels ) 5 50 μl 35 variablevolume multichannel micro pipette ( 8 channels ) 100 μl 36 variable volume single channel micro pipette ( 20 200 μl ) 37 variablevolumesinglechannelmicropipette ( 5 50μl ) 38 fixed volume single channel micro pipette 100 μl 39 fixed volume single channel micro pipette 1000 μl 40 disposable micropipette tips up to 5 50 μl ( yellow colour ) . ( 1×1000 ) 41 disposable micropipette tips up to 20 200 μl ( yellow colour ) . ( 1×500 ) 42 disposable micropipette tips up to 100 1000 μl ( blue colour ) . ( 1×500 ) 43 test tube stand 96 holes, 13mm diameter in two shelves fully autoclavable . 44 test tube stand 48 holes, 13mm diameter in two shelves fully autoclavable. 45 dropper plastic short size 1 ml capacity ( 1 x 100 pc ) 46 forceps plastic big ( 1 x 10 pc ) 47 glass slides 75x25x1.35 mm ( slide made up of high quality transparent and color less glass with ground edges and parallelism betweenthe surfaces and should be isi marked. ( 1×50 ) . 48 id coombs card for cross matching by gel technology compatible with microprocessor controlled micro typing centrifuge machine and incubator ( 1 x 288 test ) ( make bio rad ) 49 id diluents 2 for gel technology compatible with microprocessor controlled micro typingcentrifuge machine and incubator ( 1 x 500 ml ) make bio rad ) 50 id forward and reverse grouping card for gel technology compatible with microprocessor controlled micro typing centrifuge machine and incubator ( 1 x 48 test ) make bio rad ) 51 id forward group card for gel technology compatible with microprocessor controlled micro typing centrifuge machine and incubator ( 1 x 96 test ) make bio rad ) 52 id new born grouping by gel technology compatible with microprocessor controlled micro typing centrifuge machine and incubator ( 1 x 48 test ) make bio rad ) 53 id gel card for extended rh phenotyping ( c, e, c, e&k with ctl. ) compatible with microprocessor controlled micro typing centrifuge machine and incubator ( ( 1 x 48 test ) ) make bio rad ) 54 id 3 cell panel ( 0.8% cell suspension ) for irregular antibody detection. ( 3 x 10 ml ) should be sterile pyrogen free. should be ce mark / civd approved. traceability certificate should be available and minimum expiry date should be 3 4 weeks at the time of supply 55 id 11 cell panel ( 0.8% cell suspension ) for irregular antibody detection. ( 11 x 4 ml ) should be sterile pyrogenfree.shouldbecemark / civdapproved. traceability certificate should be available and minimum expiry date should be 3 4 weeks at the time of supply 56 labeled disposable plastic test tube for cross matching: size – 13x100 mm: capacity 5 ml. ( 1×100 ) 57 labeled disposable plastic test tube for cross matching: size – 13x75 mm: capacity 5 ml. ( 1×100 ) 58 lancet with sharp tip & smoothmargins. batch wise sterility / pyrogenicity / toxicity certificate should be given. ( 1×200 ) demonstration of item is must for final technical approval. 59 medicated adhesive tape for blood donors. . ( 1×50 ) . demonstrationofitemismustforfinaltechnical approval. 60 re agents for blood cell counter 3 parts ( make celtak ) as pack available ct lyse reagent ( 1 x 50 ml ) ( a ) ct dilunet reagent ( 1 x 500 ml ) ( b ) ct detergent reagent ( 1 x 20 ltr ) 61 thermal paper roll ( 57 mm x 20 mt ) 62 thermal paper roll ( 110 mm x 20 mt ) 63 roll of tissue paper 64 sod. hypo chloride solution [ 6% ] [ 1*5 liter ] 65 sta balls ( 1x 1850 balls ) 66 sta cuvettes ( 4 x 150 ) 67 fin tips forst art4, make stago ( proprietary item ) ( 1 x 100 ) 68 staneoptimal5forpttest ( 6x5ml ) makestago ( proprietary item ) 69 sta deficient viii ( 6 x 1 ml ) 70 unicalibrator ( 6 x 1ml ) 71 system control ( 12 x 2 x 1 ml ) 72 sta owren koller ( 24 x 15 ml ) 73 sta liq. fib ( 12 x 4ml ) make stago ( proprietary item ) 74 c.k. prest for apttmake stago ( proprietary item ) ( 6 x 2ml ) 75 sta cacl2 for factor viiitest make stago ( proprietary item ) ( 24 x 15ml ) 76 d.m. water ( 1 x 5 liter ) 77 pressuresensitivethermographforbbr&platelet agitator ( terumo penpol ) ( 1 x 50 ) 78 pressure sensitive thermo graph for deep freezer ( terumo penpol ) ( 1 x 50 ) name of item 79 normalthermographforbbr&plateletagitator ( terumo penpol ) ( 1 x 50 ) 80 normal thermo graph for deep freezer ( terumo penpol ) ( 1 x 50 ) 81 normalthermographforbbr&plateletagitator ( remi ) ( 1 x 50 ) 82 writing pen for normal thermo graph ( 1 x 5 ) 83 bulb for micro scope 6 volt, 20 watt 84 chewable calcium with vitamin d3 tablets for sdp donors ( 1 x 30 ) 85 monalisa hbsag ultra ( 4th ) gen ( pack size 480 x 1 test ) 86 genscreen hiv ag ab ( 4th gen ) ( pack size 480 x 1 test 87 syphilis total antibody assay ( pack size 480 x 1 test ) 88 monalisa hcv ag b ( 4th gen ) ( pack size 480 x 1 test ) 89 conductive tips 300μl ( sample tips ) ( pack size 17280 x 1 tips ) 90 conductive tips 1100μl ( reagent tips ) ( pack size 9600 x 1 tips ) 91 exchange set 92 sterile connecting device wafers ( 140 wafers per pack ) proprietary item...

District Hospital - Rajasthan

33561919 supply of blood bank lab items anti a b ab d a1 antisera anti human globulin coombs sera , bovine serum albumin etc anti a b ab d a1 antisera anti human globulin coombs sera , bovine serum albumin fourth generation elisa kit for anti hcv microplate coated with recombinant synthetic peptide angigens for core ns3 4 5 and antibody to hcv core antigen , fouth generation elisa kit for detection of hiv p24 antigen and anti hiv 1/2 antibody for hepatitis b surface antigen , rapid test kits anti hiv foutrth generation for p24 antigen and antibody detection , fouth gen hiv rapid test kit enzyme immunoassy based on sandwich imunoassay with flow through technology for detection of hiv , rapi test kits for hcv antibody hepatitis b suurface antigen for malaria antigen pf pan hrp ii pf pldh pan , tpha rapid immune chromatography test kit , single blood collection bag , triple blood collection bag , quadruple blood collection bag , dengue rapid test kit , elisa kit for dengue nsi , elisa kit for covid 19 igg elisa kit for syphillis , elisa kit for pan ldh malaria , cuvettes for rapid haemoglobin test hb 301 , evacuated blood collection plastic tube with silicaclot activator for serum chemistry with red safety cap , evacuated blood collection plastic tube with spray dried k2 edta k3 edta with lavender safety cap , evacuated sodium citrate blood collection tube gamma irradiated glass , disposable evacuated blood collection needle with without flash , evacuted tube blood collection needle holders for holding needle and tube , variable volume multichannel micro pipette variable volume single channel micro pipette , fixed volume single channel micro pipette , fixed volume single channel micro pipette , disposable micropipette tips , test tube stand 96 48 holes , dropper plastic , forceps plastic glass slides , id coombs card , id diluents 2 , id forward and reverse grouping card for gel technology compatible with microprocessorr controlled micro typing centrifuge machine and incubator , id new born grouping by gel technology , id gel card for extended rh phenotyping ce ee and k with , id 3 cell panel for irregular antibody detection should be sterile pyrogen free , id h cell panel for irregular antibody detection , labeled disposable plastic test tube for cross matching , laneet with sharp tip and smooth margins , batch wise sterility pyrogenicity toxielty certificate , medicated adhesive tape for blood donors demonstration of item , reagents for blood cell counter 3 parts make celtak , ct lyse reagent , ct dilunet reagent , ct detergent reagent ct detergent reagent , thermal paper roll , roll of tissue paper sod. hypo chloride solution , sta balls sta cuvettes , fin tips for st art4 , sta neoptimal 5 for pt test , sta deficient viii , unicalibrator , system control , sta owren koller , sta liq. fib , c.k prest for aptt , sta cael2 for factor viii test , d m water pressure sensitive thermo graph for bbr and platelet agitator terumo penpol , pressure sensitive thermo graph for deep freezer terumo penpol , normal thermo graph for bbr and platelet agitator normal thermo graph for deep freezer for bbr and platelet agitator , writing pen , bubl for microscope , chewable calciuum with vitamin d3 tablets for sdp donors monalisa hbsag ultra gen , genscreen hiv ag ab , syphillis total antibody assay , monalisa hcv ag b , conductive tips , conductive tips sample and reagents tips , exchange set , sterile connecting device wafers 140 wafers per pack proprietary item etc ...

Indian Army - Rajasthan

33523363 supply of drugs and pharmaceutical product , dydrogesterone 10mg tab , rabbies vaccine chick embryo vial of 1 ml , rabies immune globulin ( human ) usp, heat treated ampoule. ( ampoule containing not less than 150 iu / ml of human anti rabies immunoglobulin ) , 2 ml ampoule / pfs ) , vaccum blood collection tubes : edta 2ml / 3ml , vaccum blood collection tubes :sodium fluoride 20ml / 3 ml , vaccum blood collection tubes : sterile tube with gel 2ml / 5ml ( meterial plastic / glass ) , gauze surgical, open wove, unmedicated: 60 cm wide , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml ( 10 doses ) , film x ray38.1cm x 30.5cm ( 15 x 12 ) high speed , film x ray ( 17 x 14 ) high speed , trop t kit ( pkt of 5 test ) , tab sitagliptin 50mg , urine container sample , medical dry film di hl 20 x 25 ( pkt of 150 sheets ) ( material code no 16276338 ) fuji film , medical dry film di hl 20 x 30 ( pkt of 150 sheets ) ( material code no 16276340 ) fuji film , medical dry film di hl 35 x 43 ( pkt of 100 sheets ) ( material code no 16276364 ) fuji film , erba h360 diluent 20ltr , erba h360 lyse 500ml , inj influenza , inj meningococcal , inj hepatitis a , inj varicella , inj insulin lispro 100 unit , salmeterol 50mcg + fluticasone 250mcg accuhaler , inj tenecteplase 40mg , inj factor viii 1500 iu , pneumococal polysaccharide conjucated vaccine , inj haeemophilus influenza type b , inj typhoid conjugate vaccine , dengue rapid test kit ( ns1ag + igm + igg ) , bandage crepe:15 cm , pad abdominal swab 25 x 25 cm with tape 30 cm , pad abdominal ( swab ) 40 x 25 cm with tape, 30 cm => limited...

Medical Health And Family Welfare - Rajasthan

33466417 supply work of lab reagents and equipments supply work of lab reagents and equipments , fooj.k , glass slides 1x50 per box , cover slip 1x20 , tissue paper roll , n / 10 hcl 500 ml , vdrl test strip kit , hivtest card , hiv ivth generation test card , widal test kit agglutitaion method 4x5ml , serum total protein reagent , blood glucose reagent semi auto , blood urea reagent semi auto , bilibruine ragent semi auto , creatitine reagent semi auto , sgot reagent semi auto , sgpt reagent semi auto , serum uric acid semi auto , serum albumine semi auto , blood chlostrol semi auto , blood triglyceriode semi auto , blood crp test 100 test , hbsag card test0.1iu / mi sensitivity , mp test card ( antigen ) , gulcose test strips , gulcometer with strips ( 50 strips inpkt ) , xray film size 12x15 ( 1 pkt 50 pec. ) green , xray film size 12x10 ( 1 pkt 50 pec. ) green , xray film size 10x08 ( 1 pkt 50 pec. ) green , digital xray film size 12x15 ( 1 pkt 50 pec. ) , digital xray film size 12x10 ( 1 pkt 50 pec. ) , digital xray film size 10x08 ( 1 pkt 50 pec. ) , developer 22.05 lit powder , fixer 22.5 lit powder , needdle syringe destroyer ( electric ) , pricking needle , covid 19 ag card test , j.s.b. stain ist ( 1x500 ml ) , j.s.b. stain iind ( 1x500 ml ) , hiv / syphilis duo test strip , glass beakar ( 100ml ) , s.hdl ( direct ) , ldl ( direct ) , visual inspection , smear for filaria , rapid test kit syphillis , test for iodine in salt , water testing by strip method , sputum for afb as per fdsi guideline , auto pipet 10 to 100 ul , auto pipet 5 to 50 ul , auto pipet stand , bikar 100 ml , bikar 250 ml , droppar plastic 15 ml , e.d.t.a. vail ( double cork ) , e.s.r. filar , glass slides , glass test tube 10 x 75 mm , glass test tube 12 m x 100 mm , microscope cover silp 18mm x 1gm , ethnol liq.500 ml , field a500ml , field b500ml , filtar paper50 mm , lisman stain500 ml , oil immersion 30ml , mthnol liq.500 ml , vtm tube , w.b.c solution500ml , w.b.c. pipet , w.b.c. diluting acid 250ml , hb test filter paper scale book , bt ctt filter paper capallary , neuubar chamber , esr rack , microscope binocular , microscopedigital high definition , centrifuge machine , dlc conuter electric , roter shake...

Medical And Health Services - Rajasthan

33459518 supply of reagent , x ray film and equipment 1 ecg gelly — 2 s alkaline phosphatase kit — s glucose reagent — total protein reagent s. albumin reagent 6 tlc fluid 7 abo rh kit — 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastic knob urine sugar / alubmine l 2 urine pregnancy test stripe 13 hiv rapid test kit 14 hcl n / io 500ml 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol — — 21 s. hdl s. triglyceride 22 serum creatnine — 23 serum bilirubin t,d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip _ method 2ss total rbc fluide 29 oil emersion 30 disil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 3o1 (iiacmocue) 35 h13 pipet 20 mic.ltr — 36 hb test tube ecg paper roll(caard1vt6 i 08t) 8 ecg pper roll icartmofax ce 1o23) esr pipet 15omm 40 sugar sthp (glucose) 41 test tube glass tcst tube glass 43 glass beaker ‘ test tube stand 45 glass pipete 46 sodium hypochioride solution jj0°/o) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll torniqut 52 x ray film(digjtal j1092 53 x ray film(digital j? l0d 54 55 esr test cap crp kit quantttative 56 57 glass slide blood clot activa(er vail 58 blood lancet steel 59 abx cleaner 60 abxlysebio 61 abxminidii. 62 abxminocular 63 capillary tube 64 cover slip (micro scop cover glass 22mhmo micro pipette micro tips 67 tips stand 68 test tube plastic 69 sahil’s hemoglobin meter 70 urine container li.perafilm? 72 — .weight muchine baby 73 weight machine baby digital 74? — weight machine adult 75 b.p instrument oigital 76? — b.p. instrument mercury — 77 ecg roll 5020r 78? stetho scope 79 glucometer with 2s strip 80? — cotton roll ...

Medical And Health Services - Rajasthan

33454624 supply of laboratory reagent and equipment 1 glass slides 1x50 per box 2 cover slip 1x2o tissue paper roll 4 n / 1ohcl500mi vdrl test strip kit . 6 hiv test card hiv lvth generation test card 8 widal test kit agglutita ion method 4x5m1 serum total protein reagent 1o blood glucose reagent semi auto od urea reagent semi auto 12 bilibruine reagent semi auto . 13 creatitine reagent semi auio 14 sgot reagent semi auto prseenem i au to 16 serum uric acid semi auto 17 serum album inc semi auto 1 blood cholesterol semi auto 19 20 blood crp test 100 test hbsag card test 0.1iu / mi sensitivity 23 glucose test strips 24 j gulcometer with strips ( 50 strips in pit ) xray fiim size 12x15 ( 1 pkt 5o pec. ) green 12x10 ( 1 pkt 50 pec. ) green xray film size 10x08 ( 1 pkt 50 pec. ) green ray film size 12x15 ( 1 pkt 50 pec. ) 29 digital xray film size 12xi0 ( 1 pkt 50 pec. ) x ray film size 1ox08 ( 1 pkt 5o pec. ) develope 22 .05 l it powd ixer 22.5 lit powder 33 ag cardiste needle syringe destroy ( electric ) pricking needle _ j.s.b. stain 15t ( 1x500 ml ) j.&b.stainii’i ( 1x5oo m i ) __ | hivisyph iils duo test strip 39 glass beakar! ( 100ml ) 40 | s.hil ( direct ) 36 38 digital x ray film developer 22.05 lit powder fixer 22.5 lit powder , needle syringe destroyer , pricking needle , covid 19 ag card test jsb stain ist iind , hiv syphillis duo test strip , glass beaker , s.hdl direct , ldl direct visual inspection smear for filaria , rapid test kit syphillis test for iodine in salt , water testing by strip method sputum for afb as per fdsi guideline , auto pipet 10 to 100 ul 5 tto 50 ul auto pipet stand bikar 100 250 ml dropper plastic 15 ml glass test tube e.d.t.a. varl ( double cork ) lxl00 55 e.s.r. filar 1x500 56 glass slides 1x50 57 ) d i djt tus|, iu, ( / ) mm lxl00 58 | clnss testtube t2 m x too mm 59 i mrcroscope cover silp 18mm x igm 1x100 1x10 60 eti { nol lrq. 500 ml each 61 i freld a s00ml j i f ] eld b 5ooml i i nrlran paper so mm i i i ltsman lisman stain 500 ml 66 oil immersion 3oml 67 mthnol liq. 50o ml 68 vtm tube w.b.c solution 500ml . 7o4:b.cpipet ._ 71 w.b.c. diluting acid 25om1 72 jib test filter paper scale book 73 br ctt filter paper capallary | neuubar chamber — etc...

Medical And Health Services - Rajasthan

33335305 supply of lab reagents 1 ecg gelly 2 s. alkaline phosphatase kit 3 s.glucose reagent 4 total protine reagent 5 s. albumin reagent 6 tlc fluid 7 abo rh kit 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastik knob 11 urine suger / alubm ine 12 urine preg. test stripe 13 hiv rapid test kit 14 h c l n / 10 500m1 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol 20 s. hdl 21 s. triglyceride 22 serum creatnine 23 serum bilirubin t d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip method 28 total rbc fluide 29 oil emersion , 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6108t ) ecg pper roll ( cardiofax ce1023 ) esr pipet 150mm 38 39 40 sugar strip ( glucose ) 41 test tube glass 42 test tube glass 43 glass beaker 44 test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll 51 torniqut 52 x ray film ( digital ) 10*12 53 x ray film ( digital ) 8*10 54 esr test cap 55 crp kit quantitative glass slide 56 57 blood clot activater vail 58 blood lancet steel 59 abx cleaner 60 abx lysebio 61 abx minidil 62 abx minocular 63 capillary tube 64 cover slip ( micro scop cover glass 22mm 65 micro pipette ( 10 100u1 ) micro tips 66 micro pipette ( 10 1000u1 ) micro tips, 67 tips stand 68 test tube plastic 69 sahils hemoglobin meter 70 urine container 71 pera film 72 weight machine baby 73 weight machine baby digital 74 weight machine adult , 75 b.p instrument digital 76 b.p. instrument mercury 77 ecg roll 50*20 78 stetho scope 79 glucometer with 25 strip 80 cotton roll....

Medical Health And Family Welfare - Rajasthan

33281691 bids are invited for h b , hcg , multi parameter urine strip test , blood sugar gluco meter code free , maleriya rapid card test , hiv rapid card test , dengu rapid card test , visual inspretion sticker , hbsag rapid card test , smear for filaria test kit ,rapid test kit syphillis , test for iodine salt solution , watertesting by strip metod , sputm for afb as per fdsi guideline total quantity : 11625...

Medical College - Rajasthan

33181996 supply of reagents / test kits for blood testing ( blood bank ) part b supply of reagents / test kits for blood testing ( blood bank ) part b , 4thgeneration, hiv elisa test kits for 96 test , 4th hiv rapid test kits ( result must be obtained within 5 to 10 minutes ) , hcvtest kits elisa ( antibody detection kits ) , hcv test kits rapid method ( result must be obtained within 5 to 10 minutes ) , hbsag elisa for the detection of surface antigens of hbv ( 96 test kits ) , rapid hbsag for the detection of surface antigens of hbv result must be obtained 10 to 20 minutes. , rapid one step reagent test card for the testing of syphilis along with dispensing disposable droppers for sample , elisa malarial antigen detection test kits for 96 test , rapid malaria antigen detection test cards along with accessories ( disposable dropper & sprit swab ) , elisa test kit for ( syphalis ) anti body to trepenomal , reagent / test kits / card, including liss for coombs and saline cross match based on cat technology , reagent / test kits / card, including liss, for abo blood grouping of two persons. based on cat technology. two forward blood grouping with control / cooms, in same card, as a b d control a b d control / cooms...

Indian Army - Rajasthan

33126371 annual price agreement of 187 mh fy 2022 23 annual price agreement for procurement of medicines for 187 mh fy 2022 23 , list iii lab reagents and chemical , pencil, marking glass. , acetic acidglacial ( analar ) , alcohol dehydrated , anti nuclear antibody elisa detection kit with 96 wells. , benedict solution, qualitative. , blood agar base, pack of 0.5kg , chloroform ar ( analytical grade ) , drabkins solution ( diluting solution for haemoglobin estimation by cyanmet haemoglobin method ) , fructose , glycerine ar ( glycerol ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , stain leishmans powder. , stain methylene blue , stain neutral red , sudan iii , xylene ( xylol pure ) , rapid card screening for hbv , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , serum, agglutinating, bact abortus monospecific , salmonella typhi o , salmonella typhi v , salmonella typhi h , salmonella paratyphi a.h , serum anti d for saline tube test , lieshmen stain ( ready to use ) , gram stain ( ready to use ) ( hi media ) , zn stain ( ready to use ) ( hi media ) , urine strip, bott of 100 strip 2sg ( siemens ) , multistrip 10sg , bott of 100 strips ( siemens ) , kit widal, 4 x 5 ml ( tulip ) , typhoid igm / igg, pkt of 100 ( j mitra ) , malaria ag ( j mitra ) , pkt of 50 , hcv tridot , pkt of 100 ( j mitra ) , vdrl ( kit of 30 ) ( ctk ) , ra factor ( tuylip / coral ) , esr tube ( ready to use ) , swab stick ( hi media ) , sterile urine container , kit micro protein ( 1x50 ) ( erba ) , petri dish ( disposable ) ( hi media ) , blood culture bottle aerobic ( ready to use ) , ( bactech ) , ph strip , biored level 1 , biored level 2 , hiv 1&2 ( rapid tridot ) 1x100 test ( j mitra ) , hiv 1&2 ( rapid sd card ) 1x30 test ( j mitra ) , antibiotic disc ampicillin, pkt of 250 ( hi media ) , antibiotic disc gentamycin, pkt of 250 ( hi media ) , antibiotic disc amikacin, pkt of 250 ( hi media ) , antibiotic disc ciprofloxacin, pkt of 250 ( hi media ) , antibiotic disc norfloxacin, pkt of 250 ( hi media ) , antibiotic disc nalidixic acid, pkt of 250 ( hi media ) , antibiotic disc nitrofurontoin, pkt of 250 ( hi media ) , antibiotic disc imipenem, pkt of 250 ( hi media ) , antibiotic disc vancomycin, pkt of 250 ( hi media ) , antibiotic disc co trimaxazole, pkt of 250 ( hi media ) , antibiotic disc cefixime, pkt of 250 ( hi media ) , antibiotic disc ceftazidime, pkt of 250 ( hi media ) , antibiotic disc clindamycin, pkt of 250 ( hi media ) , antibiotic disc piperacillin, pkt of 250 ( hi media ) , antibiotic disc optichin, pkt of 250 ( hi media ) , antibiotic disc polymixin b, pkt of 250 ( hi media ) , cover glass 22x40 ( blue star ) , cover glass 22x50 ( blue star ) , macckonkey broth double strenght ( hi media ) , pack of 0.5kg , hbsag sd card ( 1x100 test ) sd , distilled water , hcv sd card , pkt of 100 ( sd ) , hbsag tridot ( 1x100 test ) ( j mitra ) , easylyte plus solution pack na / k / cl ( medica ) , easylyte cleaning solution bott of 90ml ( medica ) , easylyte plus wash solution bott of 50ml ( medica ) , easylyte plus urine diluent bott of 500ml ( medica ) , clead agar ( hi media ) , pack of 0.5kg , mha agar ( hi media ) , pack of 0.5kg , blood agar base ( hi media ) , pack of 0.5kg , nutrient agar ( hi media ) , pack of 0.5 kg , semen diluenting fluid, bott of 500ml , erba diluent h 360, pack of 20 ltr , erba lyse h 360, bott of 500ml , erba h clean h 360, bott of 50ml , erba printer roll 55mm, h 360 , erba control h 360 , microscopic slide pack of 50 ( blue star ) , watman filter paper 125mm x 100 circle , kit rapid pap biofix spray ( biolab ) , kit lipase , 1 x 20ml ( erba ) , ab &d antisera ( 3 x 10ml ) , ependorf tube , acidh2so4 ( sulphuric acid ) , kit t3 detection elisa kit 96 tests ( calbiotech ) , kit t4 detection elisa kit 96 tests ( calbiotech ) , microtips ( 1 200ul ) , microtips ( 500 1000ul ) , erba wash ( 5x 20 ml ) , ethanol , tmppd , kit abst tobramycin disc, pkt of 250 ( hi media ) , kit abst colistin disc, pkt of 250 ( hi media ) , kit abst meropenam disc, pkt of 250 ( hi media ) , kit abst ceftrixone disc, pkt of 250 ( hi media ) , kit abst piptaz disc, pkt of 250 ( hi media ) , kit abst cefazolin disc, pkt of 250 ( hi media ) , kit abst cefotoxime disc, pkt of 250 ( hi media ) , kit abst linezolid disc, pkt of 250 ( hi media ) , kit abst penicillian disc, pkt of 250 ( hi media ) , duram tube , india ink , sda media , lj media , lpcb , blood culture castaneda , tubing kit set ( medica easylite ) , glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g , micropipettes, tips for 1 200 ul , micropipettes, tips for 500 1000 ul , semi auto analyser, wash solution for , semi auto analyser, printing paper roll for , slide, microscope, thickness 1.15 to 1.35 mm size 75mm x 25 mm , acetone commercial , acid, sulphuricum ( sp. gravity 1.820 1.825 ) . , alcohol amyl , aluminium foils. , alcohol methyl , ( aso ) antistreptolysin o test latex agglutination principle, complete with control serum , cled agar ( with thymol blue ) , pack of 0.5kg , liquior formaldehyde 40% w / v , kit for estimation of hdl cholesterol ( 100 ml ) , hiv antibody 1 & 2 detection rapid test kit , keto diastix bott of 50 strips , kits for estimation of albumin , kits for estimation of cholestrol , kits for estimation of glucose , kits for estimation ofprotein , kits for estimation of urea , kits for estimation of uric acid , kits for estimation of creatinine , kits for estimation of alkaline phosphatase , kits for estimation of sgot ( ast ) , kits for estimation of sgpt ( alt ) . , macconkey agar , pack of 0.5kg , methylene blue , mueller hinton agar, pack of 0.5kg , prothrombin time reagents to give control of 10 14 secs , pttk reagent , sodium hypochlorite solution 10% , strips albumin and glucose bottle of 100 strips , tsi media / triple sugar iron agar, pack of 0.5 kg , kit for triglyceride estimation ( 100 ml ) , kit for ldl cholesterol by direct estimation , kit for estimation of bilirubin , kit for estimation of ggt ( gamma gluteryl transaminase ) ( 12 x 5 ml ) , kit for estimation of cpk mb ( 2.5 ml ) , kit for estimation of calcium ( 50 ml ) , kit for estimation of amylase ( 12 x 5 ml ) , kit for estimation of ldh ( 12 x 5ml ) , kit crp ( c reactive protein kit for 50 tests ) , pt reagent ( kit of 25 tests ) , serum haemaglutnating group a ( anti b monoclonal ) , serum haemagglutnating group b ( anti a ) monoclonal , serum heamaglutinating gp. o ( anti ab ) ( monoclonal ) ...

Medical And Health Services - Rajasthan

33059550 supply of consumable items malaria rapid test kit , multiparameter urine strip test, pregnancy test rapid card, hemoglobin by scale book ( 1x24 ) , blood sugar ( glucometer ) , hiv rapid card test , dengue rapid card test , visual inspection, hbsag rapid card test , smear for filaria , rapid test kit syphillis, test for iodine in salt , water testing by strip method, sputum for afb as per fdsi guideline....

Indian Army - Rajasthan

33022886 local purchase of blood bank chemicals and consumables local purchase of blood bank chemicals and consumables for mh jodhpur , medicines : , hepatitis b surface antigen ( hbsag ) detection rapid test card , hiv antibody 1 &2 detection rapid test kit , double blood bag of 350 ml with 49 ml cpd a anticoagulant made up of non toxic plastic , serum anti d igg + igm monoclonal , serum anti human glubulin ( ahg ) , serum haemoglutinating gp a ( anti b ) , serum haemoglutinating gp b ( anti a ) , serum haemoglutinating gp c ( anti ab ) , blood grouping serum anti a 1 for sub grouping , blood grouping serum anti h for sub grouping , blood grouping serum anti d ( igg ) for rh confirmation , micro tips ( 5 200 ul ) , micro tips ( 500 1000 ul ) , vdrl test , blood donor batch figer 1 , blood donor batch figer 2 , blood donor batch figer 3 , blood donor batch figer 4 , abo / rho ( d ) forward & reverse grouping card with auto control pack of 24 cards , abo / rho ( d ) forward conformation card pack of 24 cards , ahg ( coombs ) test card pack of ( 6x24 ahg card ) , forward grouping and cross matching card pack of 24 cards , forward grouping dat card pack of 24 cards , abo sub grouping card a1 pack of 24 cards , abo sub grouping card h pack of 24 cards , matrix diluents 2 pack of 500 ml pack ( liss ) , hepatitis c virus ( hcv ) detection rapid test card , vdrl ( syphilis ) rapid test card , malaria rapid test card , hav rapid test card , hev rapid test card , test tube 12x50 mm ( optic test tube ) , elisa reader thermal paper , thermograph ( temperature recording graph ) for blood storage cabinet helmer hhb 111 , thermograph ( temperature recording graph ) for blood storage cabinet electrolux mrb 280 , thermograph ( temperature recording graph ) for blood storage cabinet spencers ( model no : 1180 sfr 013 ) , bovin albumin 20% solution, bottle of 10ml => limited...

Medical And Health Services - Rajasthan

32777466 supply of lab x ray reagents stool for ova cyst kit , hb tube , distilled water , code free glucose strip , n / 10 hcl wbc fluid , lismal stain , jsbi jsb ii sodium citate , caplary tube , sugar kit 8 urea kit 9 s.creatinlinle kit 10 5j3ilirubifl kit ( t ) 11 s.billrubmn kit ( d ) 12 sgot kit 13 sgpt kit 14 15 s.aik.phos kit miimkit? hsdas.lf? 18f vdrl strip 20 i iiv rapid test kit 21 widal kit 22 uristick cell pack 24 lyzer 25 cleaner 26 mino cleaner 27 printer roll for cbc 28 urine stripe 29 serum cholesterol 30 s.hdl ppt 31 s.i idl ( direct ) 32 s.vldl ( direct ) trigi icride 34 — yello tips 35 — blue tips 36 cover slip 37 / < ripe 1’ / |38? 1 fãubi caps _ 41 n.s. nie hbsag kit malaria card kit antigen — pf / pv dengue nsl + antibody urine contener 46 test tube 12x75 glass 47 plastic plain tube 12x75 48 esr tube disposable? — 49 syringe 5 cc 50 syringe 2 cc 51 tissue paper carbon function , methalion blue , sulphuric acid , hb pipete 20 ui wbc pipete 20 ui code free strip glucose distilled water 10 ( test urocolor strip for urinalysis ) etc ...

Indian Army - Rajasthan

32507373 provide of hiv antibody12detection rapid test kit keto diastics bott of 50 strips kits for estimation of cholestrol kits for estimation of glucose kits for estimation of uric acid kits for estimation of creatinine kits for estimation of alkaline phosphatase kits for estimation of sgot ( ast ) pttk reagent with calcium chloride 4 ml paracheck for pv or pfkit of 50 kit for triglyceride estimation100 ml kit for estimation of calcium50 ml kit for estimation of amylase rapid card screening for hbvhbs ag rapid card screening for hcv pt reagent urine collection bottles electrolyte sodium potassium kit rapid test syphillisvdrl dengue ns1agigg igm rapid test blood grouping antisera combo kit cell pack syxmex 20 ltrpack stromatolyser syxmex typhi dot iggigm rapid test eight check control for cell counter haematology analyser g6pd qualitative test stool for occulet bloodhemospot kit microscopic slide 76mm26mm glass calibrater set sysmex xp100...

Medical Health And Family Welfare - Rajasthan

32464925 supply of chemicals and consumables for blood bank and lab at govt hospital jalore supply of chemicals and consumables for blood bank and lab at govt hospital jalore , anti human globulin , anti sera a , anti sera a1 , anti sera ab , anti sera b , anti sera d , anti sera d other make , aso test , blood collection beg , blood collection beg pead , blue tips , capillary tubes , cover slip , crp test , distilled water , esr tube set disposable , glass marking pencil , glass slide , glycerine , hb estimation card / hemocue , hb pipette 20 micro , hepatitis b card , hepatitis c card , hiv tridot kit / tri line , hytrogen proxide 30% , jsb 1 stain , jsb 2 stain , k 3 edta blood collection vial 5 ml tube , labopol , lancet , lugols iodine , malaria card test , methanol , microprotein , multistix ( alb + sug + spgravity + ph + b.salt / pigment ) , n / 10 hcl , parafin oil , ra test , sodium hydrochloride 10% , strip for aceton detection in urine , sulpher powder , test tube glass 10x100 mm , test tube glass 12x100mm , sahils hb tube round , test tube glass 12x80 mm , test tube plastic 12x100 mm screw capped , tissue paper roll , typhydot test , urine pregnancy test card , uristix ( alb+sug ) strip , vdrl test strip , widal test , xylene , yellow tips , hb meter ( squar bottom ) , hb tube ( squar bottom ) , filter paper , hiv kit for elisa , hbsag kit for elisa , vdrl kit for elisa , dengue kit for elisa igm sd , dengue kit for elisa ns1 , micro pipette 0&100 micro. lt. , micro pipette 100&1000 micro. lt. , micro pipette5 micro. lt. ( fix ) , micro pipette10 micro. lt. ( fix ) , micro pipette500micro. lt. ( fix ) , staining jar , scrub typhus rapid test kit , scrub typhus elisa kit , chikunguniya rapid test kit , chikunguniya elisa kit , plastic container for urine sample collection , dengue ns 1 igg & igm detection rapid test kit , slide dry rack , blood bag tripple , plastic test tube rack , timer , microscope blub 6 v 20wgu ( low voltage halogen lamp ) , reagents for sfri 5 part hematology analyzer , diluent , lyse , quench , clair 5.1 , blood troll high control22 , blood troll low control 22 , reagents for horiba 3 part hematology analyzer , diluent mini , lyse , cleaner , reagents for electrolyteprolyte , fluid pack , daily rinse kit , electrode , reagents for biosystems a 15 fully automated biochemistry analyser , a amylase – direct 11583 , sgpt m11533 , albumin m11573 , alkaline phosphotase ( amp ) m11593 , sgot m11531 , bilurubin ( total &direct ) m11515 , calcium arsenazo m91570 , cholesterol m11505 , cholesterol hdl direct 11557 , cholesterol ldl direct 11585 , creatinine m11502 , glucosem11538 , lipase 11793 , uric acid m11521 , cholesterol hdl 11523 , trigycerides m11529 , protein ( total ) m11500 , urea ( bun_uv ) m11517 , ha hypo clean mac90417 , reaction rotor for a 15 , system liquid for a 15 , washing for a 15 , reagents for erba machine , b. sugar , b. urea , creatinine kinase mb , s creatinine kinase ( ck nac ) , s.albumin , s.alk.phosphatase , s.amylase , s.bilirubin , s.calcium , s.cholesterol , s.creatinine , s.hdl cholesterol , s.hdl cholesterol ( direct ethod ) , s.ldh , s.triglyceride , s.uric acid , sgot , sgpt , total protein...

Medical And Health Services - Rajasthan

32436045 blood bank and laboratory regents supply 1 anti human globulin 10ml 2 anti sera a 10ml 3 anti sera al 5ml 4 anti sera ab 10ml 5 anti sera b 10ml 6 anti sera 0 10ml 7 anti sera 0 other make 10ml 8 aso test 20 test 9 blood collection beg 350 ml 10 blood collection beg pead 100 ml 11 blue tips 500 nos 12 capillary tubes 100 tube 13 cover slip 1x20 14 crp test 20 test 15 distilled water 5 ltr 16 [ sr tube set disposable 100 tube one pkt 17 glass marking pencil each 18 glass slide 50 slide par pkt 19 glycerine 500 ml 20 hb estimation card / hemocue each 21 hb pipette 2d micro each 22 hepatitis b card 50 test 23 hepatitis c card 100 test tridot 24 hiv tridot kit / tri line 100 test tridot 25 hytrogen proxide 30% 100 ml 26 jsb i stain 500 ml 27 bb 2 stain 500 ml 28 k 3 edta blood collection vial 5 ml tube 5000 tube 29 labopol 5 ltr cane 30 lancet 4000 31 lugols iodine 100 ml 32 malaria card test each test 33 methanol 5 ltr 34 microprotein 1x50 ml 35 multistix ( alb + sug + spgravity + ph + b.salt / pigment ) 100 strips s.ditecho 36 n / 10 hcl 500 ml 37 parafin oil 500 ml 38 ra test 25 test 39 sodium hydrochloride 10% 5 ltr 40 strip for aceton detection in urine one kit 41 sulpher powder 100gm 42 test tube glass 10x100 mm 100 tube 43 test tube glass 12x100mm 100 tube i 44 sahils hb tube round eash _ 45 test tube glass 12x80 mm 100 tube 46 test tube plastic 12x100 mm screw capped 400 47 tissue paper roll each 48 typhydot test 25 test 49 urine pregnancy test card 100 test 50 uristix ( alb+sug ) strip 100 strips 51 vdrl test strip 50 test 52 widal test 4x5 ml 53 xylene 500 ml 54 yellow tips sod no. 55 hb meter ( squar bottom ) each 56 hb tube ( squar bottom ) each 57 filter paper 150 mm dia 58 hiv kit for elisa 96 test kit 59 hbsag kit for elisa 96 test kit 60 vdrl kit for elisa 96 test kit 61 dengue kit for elisa igm sd 96 test kit 62 dengue kit for elisa ns1 96 test kit 63 micro pipette 0 100 micro. it. each 64 micro pipette 100 1000 micro. it. each 65 micro pipette 5 micro. it. ( fix ) each 66 micro pipette 10 micro. it. ( fix ) each 67 micro pipette 500 micro. it. ( fix ) each 68 staining jar each 69 scrub typhus rapid test kit each 70 scrub typhus elisa kit each 71 chikunguniya rapid test kit each 72 chikunguniya elisa kit each 73 plastic container for urine sample collection each 74 dengue ns 1 igg & igm detection rapid test kit each 75 slide dry rack each 76 blood bag trippte 450 ml 77 plastic test tube rack each 78 timer each 79 microscope blub 6 v 20wgu ( low voltage halogen lamp ) each reagents for sfri 5 part hematology analyzer 80 diluent 20 ltr 81 lyse 5 ltr 82 quench 1 ltr 83 clair 5.1 60m1 84 blood troll high control 22 5 ml 85 blood troll low control 22 5 ml reagents for horiba 3 part hematology analyzer 86 diluent mini 20 ltr 87 lyse 400m1 88 cleaner 1 ltr reagents for electrolyte prolyte 89 fluid pack 1 90 daily rinse kit 1 91 electrode 1 reagents for biosystems a 15 fully automated biochemistry analyser 92 a amylase — direct 11583 5x5 m 93 sgpt m11533 lx200 ml 94 albumin m11573 1x250m1 95 alkaline phosphotase ( amp ) m11593 lx200 ml 96 sgot m11531 lx200 ml 97 bilurubin ( total &direct ) m11515 2+2x50 ml 98 calcium arsenazo m91570 4x50 ml 99 cholesterol m11505 1x200 ml 100 cholesterol hdl direct 11557 1x80 ml 101 cholesterol ldl direct 11585 1x80 ml 102 creatinine m11502 4x50 ml 103 glucose m11538 5x200 ml 104 lipase 11793 1x60 ml 105 uric acid m11521 lx200 ml 106 cholesterol hdl 11523 2x50 + 2x50 ml 107 trigycerides m11529 2x250 ml 108 protein ( total ) m11500 2x250 ml 109 urea ( bun_uv ) m11517 2x250 m1 110 ha hypo clean mac90417 4x100 ml 111 reaction rotor for a 15 lx10 nos 112 system liquid for a 15 lx1000 ml 113 washing for a 15 1x100 ml reagents for erba machine 114 b. sugar 2x200ml 115 b. urea 5x2om l 116 creatinine kinase mb 2x8 / 2x2 ml 117 5 creatinine kinase ( ck nac ) 5x2.2 ml 118 s.albumin 5x50 ml 119 s.alk.phosphatase 10x2.2 ml 120 5.amylase 6x6 ml 121 s.bilirubin 4x60 ml 12 2 s calcium 123 s.cholesterol 124 s.creatinine 125 s.hdl cholesterol 126 s.hdl cholesterol ( direct ethod ) 127 s.ldh 128 s.triglyceride 129 sairic acid 130 sgot 131 sgpt 132 total protein etc...

Indian Army - Rajasthan

32354273 purchase of medicines out of dglp fund for the fy 2022 23 , drugs , inj adrenaline , cap haematanic + vit b12 , tab fexofenadine 120 mg , chloroxylenol solution , antacid gel containing dried aluminium hydroxide gel + magnesium hydroxide gel + simethicone + oxetacaine , carboxy methyl cellulose eye drop , syp cough linctus paed ( tixylix ) , syp bromhexine , tab calcium carbonate 500 mg , injectable typhoid vaccine single dose , inj tetanus toxide, purified vial of 10 dose , hand gloves size 6.5 unsterile , hand gloves unsterile size 7 , hand gloves unsterile size 7.5 , gauze surgical open woven unmedicated ( 60cm x 18 meter ) pkt , vaccum blood collection tubes edta , vaccum blood collection tubes sterile with gel , vaccum blood collection tubes sodium fluoride , vaccum blood collection tubessodium citrate , hiv i and hiv ii rapid test kit 50 test , hbsag rapid test kit 30 test kit , hcv rapid test kit 50 test a span , sodium hypochloride 5% , erba blood glucose kit ( 1x 400 ml ) , erba cholesterol kit ( 1 x 100 ml ) , erba urea test kit ( 1 x 100 ml ) , erba creatinine kit ( 1 x 240 ml ) , erba sgot ( ast ) test kit ( 1 x 100 ml ) , erba sgpt ( alt ) test kit ( 1 x 100 ml ) , strips glucose and albumin bott of100 strips , alere kito diasticks 100 strips bott , tab amoxicylline 500 mg + clavulanic potassium 125 mg , povidone iodine oint , inj lorezapam , tab thyroxine 50 mcg , tab thyroxine 25 mcg , knee cap l , knee cap m , ls belt l, xl, xxl , silicon heel pad , micropipette tips 1000ul pkt of 500 tips , micropipette tips 20 200 ul pkt of 500 tips , sterile urine container , distilled water 5 ltr / can , erba triglyceride test kit ( 1 x 100 ml ) , erba total bilirubin test kit ( 1 x 240 ml ) , dengue test kit sd 10 test , widal test kit ( 1 x 20 ml ) tulip , sd malaria rapid test kit 50 test , vdrl test kit 50 test , drabkins solution , crp kit 100 test , ra factor 100 test , leishmensstain ready to use , diclofenac spray , uric acid kit erba 100 ml , microscope glass slide 75mm x 25mm , urine pregnancy kit 50 test , typhoid 50 test kit , aso 100 test kit , esr tube ( westergren method ) , diluent 25 / pack haematology analyser , rinse 10 / pack haematology analyser , lyse 500ml / pack haematology analyser , anti sera a bott of 10ml , anti sera b bott of 10ml , anti sera c bott of 10ml , lancets disposable , articulating paper , suture 3 0 vicryl ( 1 / 2 circle round body cutting ) 35 mm , suture 3 0 silk ( 1 / 2 circle round body cutting ) 35 mm , glocometer strips morpen bott of 50 strips , syp ofloxacin metronidazole , syp azithromycin , cap pre probiotic , tab methyl co balamine 1500mcg , tab nitrofurantoin 100mg , microscope glass slide 75mm x 50mm , alcohol based antimicrobial hand gel containing ethyl alcohol 60 70% / propanol 60 70% with an emollient / humectant / moisturiser , methylene blue aqueous ready to use , cuvette for portable mobile lab , cover slip for microscope , adjustable pipette size 10 200 , adjustable pipette size 500 1000 , leishmens powder , hdl estimation ( 2 x 25 ) kit erba , stain giemsa powder , filter paper size 9cm , abrasive mounted diamond fg 801 / 018 round , abrasive mounted diamond fg 807 inverted cone 807 / 016 , abrasive, mounted, diamond fg 805 inverted cone 805 / 018 , abrasive, mounted, diamond fg 835 cylindrical 835 / 012 , abrasive, mounted, diamond fg 837 cylindrical 837 / 014 , abrasive, mounted, diamond for ra cylindrical 836 / 014 , antiseptic pain relieving gel , lubricant spray bott of 300 ml , glass ionomer cement gc fuji , napkin dental box of 100 , tips saliva ejector pkt of 100 , bur surgical oral tapered fissure tungsten carbide, for straight hand piece , bur surgical oral round tungsten carbide, for right angle handpiece , broach nerve canal braded assorted size 12 , cleaner pulp canal set of 6 reamers 21 mm lenth 15 40, 45 80 , dental restorative kit photo cure complete consisting of 4 hybrid composite syringes of different shades ( 4.5 gm each ) 1 bottleadhesive for dental / enamel ( 6 ml ) , 1 bottletooth conditioner ( 6ml ) mixing pads spatula catridgescomplete with shade guide , 4%, gp points assorted size ( grater taper gp ) pack of 120 , 6%, gp points assorted size ( grater taper gp ) pack of 120 , hand and rotary niti multitapered cleaning and shaping system starter pack ( protper ) pack of 6 , lining cavity calcium hydroxide ( dycal ) , cavit g, temp filling material , stick tracing green soft , pop special dental , plaster calestone , haemostatic spongegel ( ab gel ) , file head storm size 15 40 ss , medicament root canal sodium hypo 2% ( bott of 500 ml ) , medicament root canal ( pulpril ) , oleum carryophilli ( clove oil ) , medicament root canal chelating , paste impression pkt of two tubes ( one white and one red ) , articulating paper , interdental brush proxa ns , dental floss , gluma desensitizer , rvg sensor sleeves , rolls, absorbent cotton dental assorted sizes in box of 500 , k file size 45 80 size , k file size 8, 21 mm , k file size 10, 21 mm , k file size 15, 21 mm , k file size 20, 21 mm , k file size 25, 21 mm , k file size 30, 21 mm , h file size 45 80 size, 21 mm , h file size 8, 21 mm , h file size 10, 21 mm , h file size 45 80 size , 21 mm , ketac molar , intraoral rvg sensor holder and paddles , gel for root canal ( edta ) ( septodent ) , cavity liner calcium hydroxide based self cure radio opaque two paste system tube of not less than 10 gms , benzocaine 20 % pectin based oral ointment tube , desensitising paste ( stannous fluoride / pottasium nitrate / sodium monofluro phosphate ) tube of 50 gm , chlorhexidine mouthwash 0.2% bott of 150 ml , post extraction dressing ( abgel ) , 2 propanol ip 1 propanol ethyl hexadecil ethyl sulphate ( sterillium ) , hydrogen peroxide solution , sealpex root canal sealer , povidone iodine 100 ml , inter dental brush ( thermoseal proxa ns ) , gum paint , antiseptic pain relieving gel , endo boxfor rct , matrizen / matrixes stainless steel sequivalent wide only bands , disposable face mask , teeth set comp ( set of 28 ) a2 , teeth set comp ( set of 28 ) a3...

Medical And Health Services - Rajasthan

32136574 supply of lab reagent & x ray film 1 ecg gelly 2 s. alkaline phosphatase kit 3 s. glucose reagent 4 total protein reagent 5 s. albumin reagent 6 tlc fluid m aborm kit widal slide test kit j sodiun citrate soiunoe 10 edtak3tub 1 1 urine suger / alubmn 12 urine prey. test stripe 133 h1v rapid test kit 14 rd. n / i0 500ml — 17 jsb2 18 blood urea 19. s. cholesterol . i 1idi_ 21 s. triglyceride 22 serum creatnine . 23 serum biiirutin t.d — 24 sgot 25 sgpt 26 vdrl rapid test kit — 27 txine complete by strip method 28 total rbc fluide . 29 oil emersion 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6 1 08t ) ecg pper roll ( cardiofax 38 ce1023 ) 39 esr pipet 150mm sugar strip. ( glucose ) 41 test tube class 42 test tube glass 43 glass beaker test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) cbc roll paper phenyl for hospital use libsag rapid card cottan roll _ torniqut _. 5 ray film ( digital ) l0*12 esr test cap crp kit quantitative 49 50 5! 54 55 glass slide 56 blood clot activater vail 57 jxray film ( digiial ) etc...

Indian Army - Rajasthan

32105238 local purchase of medicine for mh jodhpur , medicines : , alkaline phosphatase ( 2x44 / 2x11 ml ) , lipase ( 1x44 / 1x11 ml ) , albumin ( 10x44 ml ) , amylase ( 5x22 ml ) , bilirubin direct ( 6x44 / 3x22 ml ) , total bilirubin ( 6x44 / 3x22 ml ) , calcium ( 10x12 ml ) , cholesterol ( 10x44 ml ) , creatinine ( 5x44 / 5x11 ml ) , glucose ( 10x44 ml ) , hdl cholesterol ( 4x30 / 4x10 ml ) , ldl cholesterol ( 2x30 / 2x10 ml ) , total protein ( 10x44 ml ) , triglycerides ( 5x44 / 5x11 ml ) , urea ( 5x44 / 5x11 ml ) , uric acid ( 5x44 / 5x11 ml ) , ggt ( 2x44 / 2x11 ml ) , erba norm ( 1x5 ml ) , erba path ( 1x5 ml ) , erba xl multical ( 4x3 ml ) , cuvette for em 360 , ck mb ( 2x44 / 2x11 ml ) , ck nac ( 2x44 / 2x11 ml ) , ldh ( 2x44 / 2x11 ml ) , phosphorous ( 10x12 ml ) , micro protein ( 10x12 ml ) , sgpt ( 6x44 / 3x22 ml ) , sgot ( 6x44 / 3x22 ml ) , crp quantitative test ( 2x22 / 1x11 ml ) , ra factor quantitative test ( 1x22 / 1x5.5 ml ) , sample cups , pm kit ( em 360 ) , completetubing set ( em 360 ) , erba auto wash ( 10x100 ml ) , appen droff tube , biored biochemistry control ( level 1 ) , biored biochemistry control ( level 2 ) , cell pack solution ( 20 ltr ) , cell cleaner solution ( 50 ml ) , wbc / hgblysed reagent ( sromatolyser ) 500 ml , control ( 1x3 ) for sysmax kx 21 , printing paper 110 mm , calibrator for sysmax kx 21 , bact / alert blood culture infants , bact / alert blood culture adults ( aerobic ) , bact / alert blood culture adults ( an aerobic ) , crp ( 100 test / kit ) , ra factor ( 100 test / kit ) , aso ( 100 test / kit ) , widal ( 4x5 ml ) , dengue ( ns1, igg / igm ) rapid test , malaria parachek card ( 50 test ) , occultblood ( 50 test ) kit , pregnancy test card , h1n1 rapid test kit , viral transport media ( 50 test ) , esr tube , typhi dot igm ( 50 test ) , ketosticks ( 100 strips ) , uristickes ( 100 stripes ) , urine container ( 50 ml ) , sterile urine container ( 50 ml ) single packed , chloroform , microscopic cover glass ( 22x50mm ) , auto pipette multi channel , auto pipette ( 5 50 ul ) , auto pipette ( 50 200 ul ) , tissue paper roll , whatman filter paper no 1 , whatman filter paper no 4 , harris haematoxylin ( readymade stain ) , parafin wax with ceresin , perl stain , grocott stain , pas stain , reticulin stain , casette for tissue hilding , l mould , liquor ammonia , rapid pap stain , disposable blade ( art no 2840700 ) for microtome ( compatable with slee ) , durham tube ( 50 test ) , petridishes , sugar set for microbiological test lactose , sugar set for microbiological test maltose , sugar set for microbiological test glucose , sugar set for microbiological test urease , sugar set for microbiological test citrate , gram stain kit , zn stain kit , kovac reagent strip ( 25 strip / vial ) , lead acetate strip ( 25 strip / vial ) , oxidase disc ( 50 disc / vail ) , l j media ( readymade ) , mpo stain , spirit , band aid , litmus paper , procalcitonin rapid , gloves ( ancelle ) non latex , surgical blade 20’ , rna extraction kit ( containing:5x50 spins, carrier rna 1550 ?g, avl buffer 155ml, aw1 wash buffer 98 ml, aw2 wash buffer 66ml ) ( 250 tests in each kit ) , covid 19 one step rt pcr kit ( for orf1ab & n gene ) ( 50 test in each kit ) , strip indicators for sterilisation control ( for testing sterility of drums ) , vacutainer: edta 3ml , vacutainer sodium fluoride / sodium fluoride+k3edta , vacutainer sterile tube with gel 5ml , vacutainer sterile tube with out gel – 5ml , vacutainer sodium citrate – 3ml , agglutination tube ( felix ) 50 mmx12 mm , elisa reader thermal paper 110mm , glass cover microscopic , 22 x 30mm , glass cover 22x50 mm , paper filter round pkt of 100 , paper filter square ( 51cm x 51cm ) pkt of 100 , printing paper roll 55 mm for semiautoanalyser , acetone commercial , glacial acetic acid , hydrochloric acid. , alcohol dehydrated , alcohol methyl , d p x mounting med , prothrombin time , pttk reagent , xylene ( xylol pure ) , rapid coliform kit / water culture kit , meropenem 10ug ( pack of five vial ) , oxacillin 1 ug ( pack of five vial ) , ampicillin10ug ( pack of five vial ) , amoxyclav ( pack of five vial ) , imipenem ( pack of five vial ) , penicillin 10ug ( pack of five vial ) , tetracyclin 30ug ( pack of five vial ) , clindamycin ( pack of five vial ) , bacitracin 0.04ug ( pack of five vial ) , cefotaxim ( pack of five vial ) , ceftriaxone ( pack of five vial ) , ceftazidim / clavulanic acid ( pack of five vial ) , optochin ( pack of five vial ) , novobicin ( pack of five vial ) , ampi sulbactum ( pack of five vial ) , cefoxitin30ug ( pack of five vial ) , ceftazidim ( pack of five vial ) , chloramphenicol ( pack of five vial ) , colistin ( pack of five vial ) , streptomycin 300ug hls ( pack of five vial ) , linezolide ( pack of five vial ) , ticoplanin30ug ( pack of five vial ) , netilmycin ( pack of five vial ) , norfloxacin ( pack of five vial ) , nitrofurantoin ( pack of five vial ) , cefepime ( pack of five vial ) , amikacin ( pack of five vial ) , azythromycin ( pack of five vial ) , co trimoxazole ( pack of five vial ) , cefoperazone ( pack of five vial ) , ciprofloxacin ( pack of five vial ) , erythromycin ( pack of five vial ) , gentamicin ( pack of five vial ) , gentamicin 120ug hsg ( pack of five vial ) , levofloxacin ( pack of five vial ) , nalidixic acid 30ug ( pack of five vial ) , piperacillin 100ug ( pack of five vial ) , vancomycin 30ug ( pack of five vial ) , polymixin b ( pack of five vial ) , piperacillin / tazobactam ( pack of five vial ) , ofloxacin 5ug ( pack of five vial ) , cifran ( pack of five vial ) , ceftriaxone / sulbacta ( pack of five vial ) , augmentin ( pack of five vial ) , cefoparazone / sulbactum ( pack of five vial ) , tigicyclin ( pack of five vial ) , fluconazole ( pack of five vial ) , minocycline 30ug ( pack of five vial ) , ceftazidime avibactam ( pack of five vial ) , aztreonam 30ug ( pack of five vial ) , ertapenem 10ug ( pack of five vial ) , rifampicin ( pack of five vial ) , doxycycline 30ug ( pack of five vial ) , fosfomycin 200ug ( pack of five vial ) , pefloxacin ( pack of five vial ) , quinapristin dalfopristin ( pack of five vial ) , gatiflox 5ug ( pack of five vial ) , peflox 5ug ( pack of five vial ) , fostomycin 200ug ( pack of five vial ) , doripenem 10ug ( pack of five vial ) , ritampin 5ug ( pack of five vial ) , oinupeistin dalopristin 15ug ( pack of five vial ) , filter barrier tips ( 10?l ) pack of 960 , filter barrier tips ( 20?l ) pack of 960 , filter barrier tips ( 50?l ) pack of 960 , filter barrier tips ( 100?l ) pack of 960 , filter barrier tips ( 200?l ) pack of 960 , filter barrier tips ( 1000?l ) pack of 960 , 8 strip 0.1 ml tubes and flat optical strip caps ( each pkt contain 125 strip tubes +caps ) , kimtec wipes , molecular grade ethanol / bott of 500ml , absolute alcohol , falcon tube ( 50ml ) , micro centrifuge tube ( 2.0 ml ) pkt of 500 tube , eppendorf tube ( 1.5 ml ) pkt of 500 tube , rnase kil , covid 19 rapid ag test ( kit of 25 test ) , vtm kit ( kit of 50 test ) , d dimer fia ( porteblein sd biosensopr ) , pct fia ( porteblein sd biosensopr ) , drabkins sol for hb estimation , kit dengue serology ( ns1, igm / igg ) rapid test ( 10 test / kit ) , kit glucose 10x50 ml for semi auto analyzer , kit hdl 2x50 ml for semi auto analyzer , kit sgot for semi auto analyzer , kit sgpt for semi auto analyzer , kit t3 elisa , kit triglyceride 10x50 ml for semi auto analyzer , kit tsh elisa , kit urea 10x50 ml for semi auto analyzer , kit uric acid 10x50 ml for semi auto analyzer , kit cholestrol 2x50 ml for semi auto analyzer , microscope slide 75mm x 25 mm ( pkt of 50 ) , kit t4 elisa , vaccum blood collection tubes with needles : edta 3ml , vaccum blood collection tubes with needles : heparin 3ml , vaccum blood collection tubes with needles : sterile tube with gel 5ml ( material plastic / glass ) , vaccum blood collection tubes with needles and additives sodium fluoride / sodium fluoride+k3edta in tubes of vol 02 ml , solution erba wash 50 ( ml ) , pregnancy stip , kit paracheck sd ( green colourlebel ) no of 100 strip , mico tips ( 5 200ul ) , mico trips ( 500 1000ul ) , spirit , urostix ( 100 test per kits ) , urine dipstick 10 parameter ( sp gravity urobilinogen, nitrates, protine / albumine, glucose, kitones, ph, bilirubin, heme / rbc , vaccutainer plain , microscope cover slip 22 x 70mm , urine container disposable , lancet disposable ( pack of 100 ) , urine analysis strips ( bott of 50 strips ) , kit malaria paracheck ( antigen ) pack of 40 test , kit creatinine 10x50 ml for semi auto analyzer...

Indian Army - Rajasthan

32092144 procurement of drugs and pharmaceuticals inj ketamine hcl 50 mg / ml vial of 2 ml , lignocaine hcl 2% jelly tube of 30gm , allopurinol 100 mg tab , tramadol hc 50 mg / ml inj , adrenaline tartrate ( 1:1000 ) , 1 ml inj , trihexyphenidyl hcl 2 mg tab , atenolol25 mg tab , digoxin 0.25 mg tab , losartan 25 mg tab , oral rehydration powder sachet of 20.5gm each containing sodium chloride ip 2.6g, anhydrous dextrose ip 13.5g, potassium chloride ip 1.5g & sodium citrate ip 2.9g to make 1 ltr mixture$ , oxytocin 5 oxytocic units per 0.5ml, 0.5ml inj , carbimazole 5 mg tab , glycopyrrolate 0.2 mg / ml, 1ml inj , succinylchloline chloride 50 mg / ml, 2 ml inj , vecuronium bromide4mg / ml, 1 ml inj , methyl cellullose 2% solution bottle of 5 ml , fluoxetine hcl 20 mg cap , sertraline 50 mg tab , sodium bicarbonate 7.5% amp of 10 ml inj , anti phlebitis cream tube of 15g / 20g , ascorbic acid 100 mg tab , calcium gluconate 10%, 10 ml inj , indicator sodalime , tab febuxostat 40 mg , adrenaline tartrate ( 1:1000 ) , 1 ml inj , tab rasagiline 1 mg , metoprolol 1 mg / ml, 5 ml inj , 0.5% w / v chlorhexidine gluconate in 70% v / v ethyl alcohol with moisturizer 500 ml bottle with dispenser , 10% povidone iodine solution, u.s.p. equivalent to 1% available iodine 500ml bottle , tab norflox 400mg + tinidazole 500mg , hydroxyprogesterone caproate 500 mg / 2 ml ( amp of 2 ml ) inj , chloridiazepoxide 10mg tab , tab clonazepam 0.5mg , duloxetine 20 mg tab , etophylline bp 84.7 mg and theophylline ip 25.3, per ml, 2 ml inj , povidone iodine 10% solution, bottle of 100 ml , resp ipratropium bromide , adhesive incise drape 25x30cm , adhesive incise drape 5x15cm , apparatus anaesthetic facemask with air cushiontransparent size 1paediatric , appratus anaesthetic face mask ( anitistatic ) with aircushion ( transparent ) size 2 medium , apparatus anaesthetic face mask ( antistatic ) with, air cushion ( transparent ) size 3 adult with valve , apparatusanaesthetic face mask ( antistatic ) withair cushion ( transparent ) size 4 , catheter suction endobronchial with terminaltransparentnon toxic pvc tubing sizefg 10, length 45 cm , catheter suction endobronchial with terminal transparent non toxic pvctubing sizefg 12 length 50 cm , catheter suction endobronchial size fg 14 , catheter suctionendobronchial with terminal transparent non toxicpvc tubling size fg 16 length 50 cm , combined epidural / spinal set , triple lumen catheter cannula with guide wire, introducing needle and dialator size 7f / 18 20 cms , ot pack large gamma irradition sterlised consisting of: operating gown large 1, operating gown medium 2, gloves size 7 2 pairs, gloves size 7.5 1 pair , towel 75 x75 cm, 5 , gauze 7.5 cm x7.5 cm 4 packs consisting of 6 nos in each pack, gauze pad 1, abdomina , ecg electrodes ( disposable ) , laryngoscope ( adult ) bulb for , laryngoscope ( infant ) bulb for , needle spinal anaesthesia size 25g , operating pack containing sheet large 3, trolley cover 2, surgeon gown 4 , pediatric anesthetic circuit complete , pressure monitoring line 100 cm / 200cm ( male / female ) , pressure infusion bags 500ml , pressure infusion bags 1000 ml , t piecein three sizes , tube endotrachealamoured styllet for , tube endotracheal nasal s 3.0 without cuff , tube endotracheal nasal with cuff s 5.0 , tube endotracheal nasal with cuff s 5.5 , tube endotracheal nasal with cuff s 6.0 , tube endotracheal nasal with cuff s 6.5 , tube endotracheal nasal with cuff s 7.0 , tube endotracheal nasal with cuff s 7.5 , tube endotracheal nasal with cuff s 8.0 , tube endo tracheal nasal size 8.5 with cuff , tube endo tracheal nasal size 9.0 with cuff , catheter foleys size 16 , syringe disposable 20 ml , tube suction , epidural set disposable 16g & 18g , antiseptic pain reliving gel ( fresora ) , bandage elastic adhesive, 6 cm x 3 metresoutstretched and 5 6 metres when stretched. , bandage open wovwn for plaster of paris 10cmx5m , bandage, open wove compressed:2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , bandage, plaster of paris 10 cm x 3 metres , bandage, plaster of paris 15 cm x 3 metres , bandage triangular , bandage comfortable casting dynacast pro 7.5 cm x 3.6 cm , bandage comfortable casting dynacast pro 12.5 cm x 3.6 cm , surgeons caps , surgeonsmasks , polypropylene blue monofilament 1 / 2 circle r.b, 30 mm ( heavy ) 70 cm, size 1 , polypropylene blue monofilament 1 / 2 circle r.b 30mm, 70cm, size 1 / 0. , vicryl rapid, undyed 70 cm, 26mm r cutting size 3 / 0 , polydioxanone size 1, 1.5cms loop, 1 / 2 circlerb needle 50 55 mm , polypropylene blue monofilament 70 75 cm size 3 / 0, 3 / 8 circle reverse cutting 12 mm , polypropylene blue monofilament 70 75 cm size 4 / 0, 1 / 2 circle rb25 mm double needle , silk braided size 1 / 0 70 76 cms taper cut 1 / 2 circle needle 25mm , silk braided size 1 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 2 / 0, 70 76 cm cutting 3 / 8 circle needle 45 mm , silk braided size 1 / 0, 70 76 cm rb 3 / 8 circle needle 45mm , silk braided size 3 / 0, 70 76 cm cutting 3 / 8 circle needle 45mm , silk braided 3 / 0 70 76 cm rb 3 / 8 circle needle 45 mm , tube feeding smooth plastic infant 38 cm long, 8 f with red flexible connector ( for nasogastric feeding ) , tube feeding smooth plastic infant 38 cm long, 5 f with red flexible connector ( for nasogastric feeding ) , kits for estimation of sgot ( ast ) 100 ml erba , kits for estimation of sgpt ( alt ) . 100 ml erba , kit for estimation of cpk mb ( 2.5 ml ) erba , kit for estimation of ldh ( 12 x 5ml ) , rapid card screening for hbv kit of 50 test , rapid card screening for hcv kit of 50 test , developer x ray film fast to make 9 ltr of soln ( pulv ) , tab bisoprolol 5mg , tab baclofen xr 30mg , tab divalporex sodium 250mg# , tab nitrofurantion 100mg , oint luliconazole , vit d3 oral solution ( cholecalciferol ) 60000 i.u , tab pantoprazole 40 mg+domperidon 10 mg , cap rabeprazole +domperidone ( 20+30 ) , tab rabeprazole 20 mg , tab tamsulosin 0.4 mg+dutasteride 0.5 mg , lotion sunscreen , tab thyroxine 75 mcg , tab methotrexate 7.5 mg , urine strips bott of 100 ( glucose + albumin ) , widal test kit of 20 ml , ra factor , i gel size 1 , i gel size 1.5 , i gel size 2 , i gel size 2.5 , i gel size 3 , i gel size 4 , i gel size 5 , extension line with threeway stop cock 10cm length , extension line with threeway stop cock 150cm length , aborh blood grouping kit ( 10 ml x 3 ) , tab premiprexol 0.25 , inj benzathin penicillin 12lac , erba h360 calibrator high , erba h360 calibrator normal , erba h360 calibrator low , glucose powder , white transparent microtip 0 iu to 200 iu , microtip 200 iu to 1000 iu , chest drainege catheter size 16 , chest drainege catheter size 24 , chest drainege catheter size 28 , chest drainege catheter size 32 , mucus extractor , disposable presure transducer kit single channel with edward connector , nasopharyngeal airway size 6.0 , nasopharyngeal airway size 7.0 , hiv i & ii rapid test kit , plastik test tube ( 5 ml ) => limited...

Medical And Health Services - Rajasthan

31989159 lab items lab items , lab item name , a.s.l.o test kit , auto pipette tips ( yellow ) ( 5 20 ul vol. ) , auto pipette tips ( belue ) ( 200 100 ul vol. ) , abx minidil lmg ( diluent ) 10 l ( for 3 part horiba ) , abx cleaner 1l ( for 3 part horiba ) , abxlyse blo 0.4l ( for 3 part horiba ) , c.r.p kit , combistix for urine ( ph, sg, alb, sugar ) , keto diastix ( bayers ) , dengue rapid igg, igm, ns1 ( sd diagnostics ) , dengue rapid igg, igm ( sd diagnostics ) , glucometer strips ( clever chek ) , edta vaccutainer blood collection tube , plain vaccutainer blood collection tube , multiple sample needl 22*1 ( bd avccutainer ) , e.s.rpipette disposable , blood group anti sera ( a+b+d ) 10ml , hemospot occult blood cards , hcgcards , hbsag cards , lancet for glucometer , malaria antigen card , p.s.a. test kit ( elisa test kit ) , r.a. factor test kit , sodium citrate 308% 1000ml ( for esr ) , glass slide , ft3 test kit ( elisa test kit ) , ft3 test kit ( plastic ) , t.s.h. test kit third generation ( plastic ) , vit.b12 test kit ( plastic ) , vit.d3 test kit ( plastic ) , test tube with cap 3’’ ( plastic ) , test tube plain for analyzer ( plastic ) , monoclair for 3 part horiba heamatology cell counter ( mnjy ) 500ml ( cleaning agent for service / mantinance ) , abxminotrol 16 ( n ) 2*2.5ml ( for 3 part horiba ) , abxminotrol 16 ( l ) 2*2.5ml ( for 3 part horiba ) , abxminotrol 16 ( h ) 2*2.5ml ( for 3 part horiba ) , widal test kit , marking pen black , urin sample container , minical for horiba micros es60 ( 1x2.5ml ) , chikungunya igm card , h.iv. rapid test , v.d.r.l rapid test kit , mulitistix for urine test , tissue paper for lab use , troption t card , bloting paper , sodium hypochlorite 3% ( 500ml ) , torniqute , randox no / reagents , r100 0004 ( randox ) , d200 0014 ( randox ) ( 1 / e ) , d200 0015 ( randox ) ( 1 / e ) , d200 0016 ( randox ) ( 1 / e ) , d200 0017 ( randox ) ( 1 / e ) , rx4000 ( randox ) ( 1 / e ) , rx3949 ( randox ) ( 1 / e ) , ex 4003 ( randox ) ( 1 / e ) , rx3936 ( randox ) ( 1 / e ) , rx3962 ( randox ) ( 1 / e ) , rx3963 ( randox ) ( 1 / e ) , ws 3853 ( randox ) ( 1 / e ) , albumin ( liquid ) ( 1845 ) , alt ( gpt ) ( liquid ) ( 1968 ) , ast ( got ) ( liquid ) ( 1968 ) , bilieubin ( firect ) ( liquid ) ( randox ) ( 316 ) , bilieubin ( total ) ( 582 ) , calcium ( liquid ) mono reagent ( randox ) ( 2637 ) , cholestrol ( liquid ) ( 2232 ) , hsl ( randox ) cholestrol ( liquid ) ( 1023 ) , ldl ( randox ) cholestrol ( liquid ) ( 867 ) , glucose ( liquid ) ( randox ) ( 2232 ) , hba1c ( liquid ) ( randox ) ( 426 ) , total protein ( liquid ) ( mono reagent ) ( randox ) ( 2232 ) , triglycerides ( liquid ) ( randox ) ( 1488 ) , uric acid ( liquid ) ( randox ) ( 1668 ) , urea ( liquid ) ( randox ) ( 1880 ) , calibration sera level3 ( randox ) ( 20x5 ) , hdl / ldl cholestrol calib ( randox ) ( 3x1 ) , hba1c calib series ( randox ) ( 1x8, 5x2 ) , hba1c control level a and level 2 ( randox ) ( 2x2x0.5 ) , human assayed multi sera level 3 ( randox ) ( 20x5 ) , creatinine ( liquid ) ( randox ) ( 1953 ) , name of instument / item , auto pipette variable volume 5 50 ( for biochemistry check ) , auto pipette variable volume 10 100 ( for biochemistry check ) , auto pipette variable volume100 1000 ( for biochemistry check ) , adjustable multichannel auto pipette 30 300 ( elisa check up ) , adjustable multichannel auto pipette 5 50 ( elisa check up ) , formilline...

Medical And Health Services - Rajasthan

31981764 supply of laboratory items for laboratory aslo test kit, auto pipette tips, abx cleaner, crp kit, keto diastix, dengue rapid, glucometer strips, edta vaccutainer blood collection tube, plain vaccutainer blood collection tube, multiple sample needle, blood group anti sera, hcg cards, lancet for glucometer, psa test kit, malaria antigen card, sodium citrate, ft3 test kit, vit b12 test kit, test tube with cap, abx minotrol, widal test kit, marking pen black, urine sample container, hiv rapid test kit, multistix for urine test, bloting paper, sodium hypochlorite, torniqute, albumin, alt, calcium mono reagent, cholestrol, total protein, calibration sera, calib, human assayed, auto pipette variable volume, adjustable multi channel auto pipette, formaline. etc ...

Medical Health And Family Welfare - Rajasthan

31551104 lab reagents and equipment lab reagents and equipment , fooj.k , glass slides 1x50 per box , cover slip 1x20 , tissue paper roll , n/10 hcl 500 ml , vdrl test strip kit , hivtest card , hiv ivth generation test card , widal test kit agglutitaion method 4x5ml , serum total protein reagent , blood glucose reagent semi auto , blood urea reagent semi auto , bilibruine ragent semi auto , creatitine reagent semi auto , sgot reagent semi auto , sgpt reagent semi auto , serum uric acid semi auto , serum albumine semi auto , blood chlostrol semi auto , blood triglyceriode semi auto , blood crp test 100 test , hbsag card test0.1iu/mi sensitivity , mp test card(antigen) , gulcose test strips , gulcometer with strips ( 50 strips inpkt ) , xray film size 12x15 (1 pkt 50 pec.) green , xray film size 12x10 (1 pkt 50 pec.) green , xray film size 10x08 (1 pkt 50 pec.) green , digital xray film size 12x15 (1 pkt 50 pec.) , digital xray film size 12x10 (1 pkt 50 pec.) , digital xray film size 10x08 (1 pkt 50 pec.) , developer 22.05 lit powder , fixer 22.5 lit powder , needdle syringe destroyer (electric) , pricking needle , covid 19 ag card test , j.s.b. stain ist (1x500 ml) , j.s.b. stain iind(1x500 ml) , hiv/syphilis duo test strip , glass beakar (100ml) , s.hdl (direct) , ldl (direct) , visual inspection , smear for filaria , rapid test kit syphillis , test for iodine in salt , water testing by strip method , sputum for afb as per fdsi guideline...

Medical And Health Services - Rajasthan

31539781 supply of laboratory item reagent 1 hb 2 hcg 3 multiparameter urine strip test 4 blood sugar (glucometer) 5 malaria rapid card test 6 hiv rapid card test 7 dengue rapid card test 8 visual inspection 9 hbsag rapid card test 10 smear for filaria 11 rapid test kit syphillis 12 test for iodine in salt 13 water testing by strip method 14 sputum for afb as per fdsi guideline ...

Medical And Health Services - Rajasthan

31539775 supply of laboratory item reagent 1 hb..? 2 hcg 3 miiltiparameter urine strip test 4 blood sugar (glucometer) 5 malaria rapid card test 6 h1v rapid card test 7 dengue rapid card test 8 visual inspection 9 hbsag rapid card test 10 smear for filaria 11 rapid test kit syphillis 12 test for iodine in salt 13 water testing by strip method — 14 sputum for afb as per fdsi guideline ...

Medical And Health Services - Rajasthan

31502580 provide of medical reagents hb, hcg, multiparameter urine strip set, blood sugar, rapid card test, rapid test kit, water testing by strip method, sputm container....

Medical And Health Services - Rajasthan

31492250 blood bank and laboratory reagents item supply 1 antihuman globulin loml 2 anti sera a loml 3 anti sera a1 5ml 4 anti sera ab loml 5 anti sera b loml 6 anti sera d loml 7 antisera d other make loml i aso test 20 test i blood collection beg 350 ml 10 blood collection beg pead 1oo ml 11 blue tips 500 nos 12 capillary tubes 1oo tube 13 cover slip 1x20 14 crp test 20 test 15 distilled water 5 ltr 16 esr tube set disposable 100 tube one pkt 17 glass marking pencil each 18 glass slide 50 slide par pkt 19 glycerine 500 ml 20 hb estimation card/hemocue each 21 hb pipette 20 micro each 22 hepatitis b card 50 test 23 hepatitis c card 1oo test tridot 24 hiv tridot kitflri line 1oo test tridot 25 hytrogen proxide 30% 1oo ml 26 jsb 1 stain 5oo ml 27 jsb 2 stain 5oo ml 28 k 3 edta blood collection vial 5 mltube 5000 tube 29 labopol 5 ltr cane 30 lancet 4000 31 lugols lodine 1oo ml 32 malaria card test each test 33 methanol 5 ltr 34 microprotein 1x50 ml 35 multistix (alb + sug + spgravity + ph + b.salt /pigment) 1oo strips s.d./techo 36 n/l0 hcl 5oo ml 37 parafin oil 5oo ml 38 ra test 25 test 39 sodium hydrochlorid e 70% 5 ltr 40 strip for aceton detection in urine one kit 41 sulpher powder 100gm 42 test tube glass 10x100 mm 100 tube 43 test tube glass 12x100mm 100 tube 44 sahils hbtube round eash 45 test tube glass 1.2x80 mm 100 tube 46 test tube plastic 12x100 mm screw capped 400 47 tissue paper roll each 48 typhydot test 25 test 49 urine pregnancy test card 1oo test 50 uristix (alb+sug) strip 1oo strips 51 vdrl test strip 50 test 52 widaltest 4x5 ml 53 xylene 5oo ml 54 yellow tips 500 no. 55 hb meter (squar bottom) each 56 hb tube (squar bottom) each 57 filter paper 150 mm dia 58 hiv kit for elisa 96 test kit 59 hbsag kit for elisa 96 test kit 60 vdrl kit for elisa 96 test kit a 61 dengue kit for elisa lgm sd 96 test kit 62 dengue kit for elisa ns1 96 test kit 63 micro pipette 0 100 micro. it. each 64 micro pipette 100 1000 micro. lt. each 65 micro pipette 5 micro. lt.(fix) each 66 micro pipette 10 micro. lt. (fix) each 67 micro pipette 500 micro. lt (fix) each 68 staining jar each 69 scrub typhus rapid test kit each 70 scrub typhus elisa kit each 71 chikunguniya rapid test kit each 72 chikunguniya elisa kit each 73 plastic container for urine sample collection each 74 dengue ns 1 lgg & tgm detection rapid test kit each 75 slide dry rack each 76 blood bag tripple 450 ml 77 plastic test tube rack each 78 timer each 79 microscope blub 6 v 20wgu (low voltage halosen lamo) each for sfri 5 part hemato ana 80 diluent 20 ltr 8l lyse 5 ltr 82 quench 1 ltr 83 clair 5.1 60ml 84 blood troll high control 22 5ml 85 blood troll low control 22 5ml reagents for horiba 3 part hematology analyzer 86 diluent mini 20 ltr 87 lyse 400m1 88 cleaner 1 ltr reagents for electrolyte prolyte 89 fluid pack l ( 90 daily rinse kit i t 91 electrode i t reagents for biosysteqrs a 15 fully automated biochemistry analyser 92 a amylase direct 11583 5x5 ml 93 sgpt m11533 1x200 ml 94 albumin m11573 1x250ml 95 alka line phosphotase (am p) m11593 1x200 ml 96 sgot m11531 1x200 ml 97 bilurubin(total &direct) m11515 2+2x50 ml 98 calcium arsenazo m91570 4x50 ml 99 cholesterol m11505 1x200 ml 100 cholesterol hdl direct 11557 1x80 ml 10l cholesterol ldl direct 11585 1x80 ml 102 creatinine m11502 4x50 ml 103 glucose m11538 5x200 ml 104 lipase 77793 1x50 ml 105 uric acid m11521 1x200 ml 106 cholesterol hdl 11523 2x50 + 2x50 ml 107 trigycerides m11529 2x250 ml 108 protein(total) m11500 2x250 ml 109 urea(bun_uv) m11517 2x250 ml 110 ha hypo clean mac90417 4x100 ml lll reaction rotor for a 15 1x10 nos 1,12 system liquid for a 15 1x1000 ml 113 washing for a 15 1x100 ml reagents for erba machine 114 b. sugar 2x200ml 115 b. urea 5x20ml 116 creatinine kinase mb 2x8 / 2x2 ml 117 s creatinine kinase (ck nac) 5x2.2 ml 118 s.albumin 5x50 ml 119 s.alk. phosphatase 10x2.2 ml 120 s.amylase 6x6 ml 121 s.bilirubin 22 s.calcium 2x5o ml 123 s.cholesterol 5x2o ml 124 s.creatinine 4x6o ml 125 s.hdl cholesterol 2x5o ml 126 s.hdl cholesterol (direct ethod) one kit 127 s.ldh 5x6.5 ml 128 s.triglyceride 5x2o ml 129 s.uric acid 5x6.5 ml 130 sgot 5x20 ml 131 sgpt 5x20 ml 132 total protein ...

Medical Health And Family Welfare - Rajasthan

31460650 equipment surgical and various general item rate contract for surgical, equipment and various general items , rate contract for equipment, surgical and various general etc.) , airway guedel or berman, autoclavable rubber, set of 6 , anterior vaginal wall retractor stainless , bag, breathing, sell inflating, anti static rubber, set of 4 , ball, donor squeeze, rubber dia 60 mm , bath, water serological with racks, cover thermostat 240v , battery cells for item 24 , battery dry cell 1.5 v `d` type for item 7g , bone, forceps, mesnard 280 mm, stainless steel , bovine albumin 20% testing, agent, box of 10 x 5ml , bowl, metal sponge, 600 ml , bowl, sponge, 600ml, stainless steel , breathing tubes, hoses, connections for item 1, antistatic , c arm x ray machine , cap. operation, surgeon`s 36 x 46 cm , catheterurethral nelaton solid tip one eye 14 fr , catheterurethral nelaton solid tip one eye 16 fr , catheterurethral nelaton solid tip one eye 18 fr , catheter, endotracheal w/cuff, rubber set of 4 , catheter, endotracheal, open tip, funnel end rubber 12fr , catheter, mucus, rubber, open ended tip, size 14fr , catheter, suction, rubber, size 8fr , catheter, urethral, 14fr. solid tip, one eye, soft rubber , catheter, urethral, nelaton set of five ( fr 12 20) rubber , catheter, urethral, rubber, foley`s 14 er , catheter, urethral, stainless steel, set of 8 in case , cathter, nasal rubber, open tip, funnel end size 8fr , cells for item 3 , cells for item 6 (laryngoscope) , centrifuge, angle head for 6 x 1.5 ml tubes, 240 volt , chc standard surgical set iii , clam intestinal, doyen straight, 225 mm, stainless steel , connectorsm catheters, straight/curverd, 3,4,5 mm (set of 6) , cotton wool absorbent non sterilize 5oo g , cpda anti coagulent, pilot bottle 350 ml for collection , cranioclast, braun, stainless steel, 365 mm long , crash card trolly , cuff, sphygmomanometer, set of two sizes child/adult , cuffs for endotracheal catheters spare for item 4 , curette,uterine, sim`s blunt, 26 cm x 11 mm size #4 ss , curette,uterine, sim`s blunt, 26 cm x 9 mm size #3 ss , dengue rapid test card , dental chair withoutassessories (dental chair plain) , dextromsticks , dilator,uterine, double ended hegar, setof 5 ss , drum, sterilizing cylindrical 275 mm dia x 132 mm, ss , ecg machine , face mask, plastic w/rubber cushion & headstrap, setof 4 , folwer bed with matters , forceps artery, pen straight, 160 mm, stainless steel , forceps artery, straight, pean, 160mm , forceps hysterectomy, curved, 22.5 mm , forceps obstetric, wrighley`s 280mm, stainless steel , forceps spong holding, 22.5 cm straight ss , forceps sponge holding straight 228 mmh semken 200 mm , forceps tissue 160 mm , forceps uterinetenaculum duplay dbl cvd, 280 mm , forceps uterinevulsellum curved, museux, 240 mm , forceps uterine tenaculum duplay dbl cvd, 280mm , forceps, artery, curved pean, 200 mm, stainless steel , forceps, artery, spencer well`s straight, 140mm ss , forceps, artery, spencer wells, straight, 180 mm ss , forceps, artery, spring type, serrated tips, 160 mm , forceps, artery, straight pean, 160 mm stainless steel , forceps, backhaus towel, 130 mm stainless steel , forceps, backhuas towel, 130 mm, stainless steel , forceps, catheters, straight, magill, adult and child sizes, set of 2 , forceps, cranial, gouss, straight, 295 mm ss , forceps, hemostat curved mosquito halsteads, 130mm , forceps, hemostat, curved, kelly, 125 mm, stainless steel , forceps, hemostat, straight, kelly, 140 mm, stainless steel , forceps, hemostatic, halsteads mosquito, straight, 125mm ss , forceps, obstetric, barnes neville, with traction, 390 mm , forceps, obstetric, neville barnes, w/traction 390 mm , forceps, ovum, krantz, 290mm stainless steel , forceps, scalp flap, willet`s 190mm ss , forceps, spong holding, 228 mm , forceps, spong holding, straight 225mm, stainless steel , forceps, spong holding, straight 228 mm, stainless steel , forceps, sterilizer, cheatle, 265 mm, stainless steel , forceps, tenaculum, teale`s 230 mm graduations , forceps, tissue , spring type, 1 x 2 teeth, 160 mm , forceps, tissue allis, 150 mm, stainless steel, 4 x 5 teeth , forceps, tissue spiring type, serrated ups, 160 mm ss , forceps, tissue spring type, 160 mm, stainless steel , forceps, tissue spring type, 250 mm, stainless steel , forceps, tissue, 6 x 7 teeth, thomas allis, 200 mm ss , forceps, tissue, backcock, 195 mm, stainless steel , forceps, tissue, spring type, 1 x 2 teeth, semkins, 250 mm , forceps, tissue, spring type, 145mm, stainless steel , forceps, tissue, spring type, 1 x 2 teeth, 160 mm ss , forceps, tissue, spring type, serrated tips,160 mm ss , forceps, uterine, tenaculum, 280 mm stainless steel , forceps, vulsellum, duplay double curved, 180 mm ss , forceps, vulsellum, duplay double curved, 240 mm ss , furniture three seater chair , gauze absorbent non sterile 200 mm x 6 m , general surgery instruments set , gloves surgeon, latex sterilizable size 6 to 8 , gown, operation, cotton , hbsag rapid test card , hcg , hiv rapid test card , holder, needle straight, mayo hegar, 175 mm ss , holder, needle straight, mayo hegar, narrow jaw, straight 175 mm ss , hook, crochet, obstertric 300 mm, smelline, stainless steel , hook, decapitation, braun, 300 mm, stainless steel , hook, obstetric, smellie, stainless steel , illuminator , infantometer measuring range 33 100 cm , intravenous set in box , iud insertion kit (essential) , iv canulas (22g and 24 g) , iv infusion sets (adult and pediatric) , knife blade for minor surgery no. 10, pkt of 5 , knife blade for minor surgery, size 11, pkt of 5 , knife blade surgical, size 11 for minor surgey, pkt of 5 , knife blade surgical, size 122 for major surgey, pkt of 5 , knife blade surgical, size 15 for minor surgey, pkt of 5 , knife handle for minor surgery no. 3 , knife handle surgical for major surgery # 4 , knife handle surgical for minor surgery # 3 , lamp, ultra violet (heat source) with floor stand , laproscope , larynoscope, infant, w/three blades and spare bulbs , larynoscope, set with infant, child, adolescent blades , lateral mask with ventillatory bag, infant size , led surgical ot light twi , macintosh, operation, plastic , malaria rapid test card , mask, face, surgeon`s cap of rear ties : b) beret type with elastic hem , microscope binocular inclined 10 x 40 x 100x magnificent , multiparameter urine strip test , nasal prongs , nasogastric tube (8,10,12 fg) , nebuliser , nebulisers/mdi , needle blood collection disposable, 17g x 1 1/3 box of 100 , needle holder, mayo, straight, narrow jaw, 175 mm ss , needle holder, straight narrow jaw mayo heger, 175 mm , needle hypodermic, luer 22g x 11/4, box of 12 , needle hypodermic, luer 250g x 3/4, box of 12 , needle suture straight, 5.5 mm, trianglur point, pkt of 6 , needle, mayo, % circle, taper point, size 6, pkt of 62 , needle, spinal, stainless set of 4 , needle, suture, mayo circle, taper point no. 6, pkt of 6 , needles, hypodermic 20g x 1 1/2 box of 12 , needles, suture traingular point 7.3cm, pkt of 6 , needles, suture, round bodied, 3/8 circle no.12 pkt of 6 , normal delivery kit , nsv kit , oropharyngeal airway (000 4 guydel size) , ot table c arm with orthopedic attachments fully electric , oxygen cylinders , patients cardiac monitor , peak expiratory flow rate (pefr) meter (desirable) , perforator, smellie, 250 mm, stainless steel , photo therapy unit , pipette volumetric set of six 1 ml/2ml/3ml/5ml/10ml/20ml , plastic/disposable syringes including tuberculin , portable pulse oximeters , proctoscope mcevedy complete with case , radiant warmers , rapid test kit syphillis , resuscitator, automatic, basinet type , retactor, double ended abdominal, beltouis, set of 2 , retractor abdominal deaver, 25 mm x 3 cm, stainless steel , retractor abdominal richardson eastman, dbl ended, set 2 , retractor abdominal, balfour 3 blade self retaining , retractor, abdominal, deavers, size 3, 2.5 cm x 22.5 cm , scalp vein set no. 22 and 24 , scissors ligature spencer 130 mm, stainless steel , scissors ligature, spencer straight, 130 mm, stainless steel , scissors operating curved, 170 mm, blunt/blunt ss , scissors operating straight, 140 mm, blunt/blunt ss , scissors operating, straight 145 mm, blunt/blunt , scissors, episiotomy, angular, braun, 145 mm, stainless steel , scissors, gauze, straight, 230mm, stainless steel , scissors, ligature, angled on flat, 140 mm, stainless steel , scissors, ligature, spencer, 130 mm, stainless steel , scissors, operating curved mayo blunt pointed170 mm , scissors, operating straight, blunt point, 170 mm , scissors, operating, straight 140mm, blunt/points ss , slides, microscope plain 25 x 75 mm clinical, box of 100 , smear for filaria , sound uterine simpson, 300 mm graduated ub 20 mm , specelum vaginal bi valve graves, medium, stainless steel , speculum vaginal bi valve cusco`s graves medium ss , speculum vaginal bi valve cusco`s graves small ss , speculum vaginal bi valve, cusco medium, stainless steel , speculum vaginal double ended # 3 , speculum, vaginal sim`s double ended, size # 3 ss , speculum, vaginal, hamilton bailey , speculum, vaginal, sim`s double ended # 3 ss , speculum, vaginal, wieghted auvard, 38 x 75 mm blade ss , sputum for afb as per fds guidline , stadiometer measuring range 60 20 cm , standard surgical set 1 instruments fru , standard surgical set ii (essential) , steel sterilization tray with cover size 300 x 220 x 70 mm, s/s, ref; is:3993 , sterilizer, instrument 200 x 100 x 60 mm with burner ss , stiletter, curved for stiffening tracheal catheter ss , suction tube, 225 mm, size 23 f , syringe 5ml, spare for items 13 , syringe anaesthetic control, luer 5ml glass , syringe, anaesthetic (control), 10ml, luer glass , syringe, anesthetic, control 5ml luer mount glass , syringe, hypodermic, 10 ml glass, spare fot item 3 , syringe, hypodermic, luer 5ml, glass , table instrument adjustable type with tray ss , test for iodine insalf , test tube without rim 75 x 12 mm hrg , test tube without rim150 x 16mm, hrg , thermometers , torch without batteries , towel glove , towel, trolley 84 cm x 54 cm , tray instrument curved, 225 x 125 x 50 mm, stainless steel , tray instrument with cover 450 mm (l) x 300 mm (w) x 80 mm (h) , tray instruments/dressing with cover, 310 x 200x600mm ss , tray, instrument/dressing with cover, 310 x 195 x 63 mm , trolley, dressing carriage size 76c, long x 46 cm wide and 84 cm high , usg machine , uterine elevator (ranathlbod), stainless steel , vaccum extractor, malastrom , valve, inhater, chrome plated brass, y shape , vaporiser, ether or methoxyflurane, wick type , vaporiser, halothane, dial setting , visual inspection , ward bed with matters , water testing by strip methord , 5 kv solar inverter...

Medical And Health Services - Rajasthan

31440516 tender for surgical and various general items airway guedel or berman, autoclavable rubber, set of 6, anterior vaginal wall retractor stainless, bag, breathing, sell inflating, anti static rubber, set of 4, ball, donor squeeze, rubber dia 60 mm, bath, water serological with racks, cover thermostat 240v , battery cells for item 24, battery dry cell 1.5 v `d` type for item 7g, bone, forceps, mesnard 280 mm, stainless steel bovine albumin 20% testing, agent, box of 10 x 5ml, bowl, metal sponge, 600 ml, bowl, sponge, 600ml, stainless steel, breathing tubes, hoses, connections for item 1, antistatic, c arm x ray machine, cap. operation, surgeon`s 36 x 46 cm, catheter urethral nelaton solid tip one eye 14 fr, catheter urethral nelaton solid tip one eye 16 fr , catheter urethral nelaton solid tip one eye, fr 18 catheter, endotracheal w / cuff, rubber set of 4 catheter, urethral, nelaton set of five ( fr 12 20 ) rubber catheter, urethral, rubber, foley`s 14 er 25 catheter, urethral, stainless steel, set of 8 in case 26 cathter, nasal rubber, open tip, funnel end size 8fr 27 cells for item 3 , cells for item 6 ( laryngoscope ) centrifuge, angle head for 6 x 1.5 ml tubes, 240 volt 30 chc standard surgical set iii 31 clam intestinal, doyen straight, 225 mm, stainless steel connectorsm catheters, straight / curverd, 3, 4, 5 mm ( set of 6 ) 33 cotton wool absorbent non sterilize 5oo g 34 cpda anti coagulent, pilot bottle 350 ml for collection 35 cranioclast, braun, stainless steel, 365 mm long 36 crash card troll cuff, sphygmomanometer, set of two sizes child / adult 38 cuffs for endotracheal catheters spare for item 4 39 curette, uterine, sim`s blunt, 26 cm x 11 mm size #4 ss 40 curette, uterine, sim`s blunt, 26 cm x 9 mm size #3 ss 41 dengue rapid test card 42 dental chair without assessories ( dental chair plain ) 43 dextromsticks 44 dilator, uterine, double ended hegar, set of 5 ss 45 drum, sterilizing cylindrical 275 mm dia x 132 mm, ss 46 ecg machine face mask, plastic w / rubber cushion & headstrap, set of 4 48 folwer bed with matters 49 forceps artery, pen straight, 160 mm, stainless steel 50 forceps artery, straight, pean, 160mm 20 catheter, mucus, rubber, open ended tip, size 14fr 21 catheter, suction, rubber, size 8fr 22 catheter, urethral, 14fr. solid tip, one eye, soft rubber catheter, urethral, nelaton set of five ( fr 12 20 ) rubber 24 catheter, urethral, rubber, foley`s 14 er 25 catheter, urethral, stainless steel, set of 8 in case 26 cathter, nasal rubber, open tip, funnel end size 8fr 27 cells for item 3 28 cells for item 6 ( laryngoscope ) 29 centrifuge, angle head for 6 x 1.5 ml tubes, 240 volt 30 chc standard surgical set iii 31 clam intestinal, doyen straight, 225 mm, stainless steel 32 connectorsm catheters, straight / curverd, 3, 4, 5 mm ( set of 6 ) 33 cotton wool absorbent non sterilize 5oo g 34 cpda anti coagulent, pilot bottle 350 ml for collection 35 cranioclast, braun, stainless steel, 365 mm long 36 crash card trolly catheter, urethral, nelaton set of five ( fr 12 20 ) rubber 24 catheter, urethral, rubber, foley`s 14 er 25 catheter, urethral, stainless steel, set of 8 in case 26 cathter, nasal rubber, open tip, funnel end size 8fr 27 cells for item 3 28 cells for item 6 ( laryngoscope ) 29 centrifuge, angle head for 6 x 1.5 ml tubes, 240 volt 30 chc standard surgical set iii 31 clam intestinal, doyen straight, 225 mm, stainless steel 32 connectorsm catheters, straight / curverd, 3, 4, 5 mm ( set of 6 ) 33 cotton wool absorbent non sterilize 5oo g 34 cpda anti coagulent, pilot bottle 350 ml for collection 35 cranioclast, braun, stainless steel, 365 mm long 36 crash card trolly cuff, sphygmomanometer, set of two sizes child / adult 38 cuffs for endotracheal catheters spare for item 4 39 curette, uterine, sim`s blunt, 26 cm x 11 mm size #4 ss 40 curette, uterine, sim`s blunt, 26 cm x 9 mm size #3 ss 41 dengue rapid test card 42 dental chair without assessories ( dental chair plain ) 43 dextromsticks 44 dilator, uterine, double ended hegar, set of 5 ss 45 drum, sterilizing cylindrical 275 mm dia x 132 mm, ss 46 ecg machine 47 face mask, plastic w / rubber cushion & headstrap, set of 4 48 folwer bed with matters 49 forceps artery, pen straight, 160 mm, stainless steel 50 forceps artery, straight, pean, 160mm forceps hysterectomy, curved, 22.5 mm 52 forceps obstetric, wrighley`s 280mm, stainless steel 53 forceps spong holding, 22.5 cm straight ss 54 forceps sponge holding straight 228 mmh semken 200 mm 55 forceps tissue 160 mm 56 forceps uterine tenaculum duplay dbl cvd, 280 mm 57 forceps uterine vulsellum curved, museux, 240 mm 58 forceps uterine tenaculum duplay dbl cvd, 280mm 59 forceps, artery, curved pean, 200 mm, stainless steel 60 forceps, artery, spencer well`s straight, 140mm ss 61 forceps, artery, spencer wells, straight, 180 mm ss 62 forceps, artery, spring type, serrated tips, 160 mm 63 forceps, artery, straight pean, 160 mm stainless steel 64 forceps, backhaus towel, 130 mm stainless steel forceps, backhuas towel, 130 mm, stainless steel 66 forceps, catheters, straight, magill, adult and child sizes, set of 2 67 forceps, cranial, gouss, straight, 295 mm ss 68 forceps, hemostat curved mosquito halsteads, 130mm 69 forceps, hemostat, curved, kelly, 125 mm, stainless steel 70 forceps, hemostat, straight, kelly, 140 mm, stainless steel 71 forceps, hemostatic, halsteads mosquito, straight, 125mm ss 72 forceps, obstetric, barnes neville, with traction, 390 mm 73 forceps, obstetric, neville barnes, w / traction 390 mm 74 forceps, ovum, krantz, 290mm stainless steel 75 forceps, scalp flap, willet`s 190mm ss 76 forceps, spong holding, 228 mm 77 forceps, spong holding, straight 225mm, stainless steel 78 forceps, spong holding, straight 228 mm, stainless steel forceps, sterilizer, cheatle, 265 mm, stainless steel 80 forceps, tenaculum, teale`s 230 mm graduations 81 forceps, tissue , spring type, 1 x 2 teeth, 160 mm 82 forceps, tissue allis, 150 mm, stainless steel, 4 x 5 teeth 83 forceps, tissue spiring type, serrated ups, 160 mm ss 84 forceps, tissue spring type, 160 mm, stainless steel 85 forceps, tissue spring type, 250 mm, stainless steel 86 forceps, tissue, 6 x 7 teeth, thomas allis, 200 mm ss 87 forceps, tissue, backcock, 195 mm, stainless steel 88 forceps, tissue, spring type, 1 x 2 teeth, semkins, 250 mm 89 forceps, tissue, spring type, 145mm, stainless steel 90 forceps, tissue, spring type, 1 x 2 teeth, 160 mm ss 91 forceps, tissue, spring type, serrated tips, 160 mm ss 92 forceps, uterine, tenaculum, 280 mm stainless steel forceps, vulsellum, duplay double curved, 180 mm ss 94 forceps, vulsellum, duplay double curved, 240 mm ss 95 furniture three seater chair 96 gauze absorbent non sterile 200 mm x 6 m 97 general surgery instruments set 98 gloves surgeon, latex sterilizable size 6 to 8 99 gown, operation, cotton 100 hbsag rapid test card 101 hcg 102 hiv rapid test card 103 holder, needle straight, mayo hegar, 175 mm ss 104 holder, needle straight, mayo hegar, narrow jaw, straight 175 mm ss 105 hook, crochet, obstertric 300 mm, smelline, stainless steel 106 hook, decapitation, braun, 300 mm, stainless steel hook, obstetric, smellie, stainless steel 108 illuminator 109 infantometer measuring range 33 100 cm 110 intravenous set in box 111 iud insertion kit ( essential ) 112 iv canulas ( 22g and 24 g ) 113 iv infusion sets ( adult and pediatric ) 114 knife blade for minor surgery no. 10, pkt of 5 115 knife blade for minor surgery, size 11, pkt of 5 116 knife blade surgical, size 11 for minor surgey, pkt of 5 117 knife blade surgical, size 122 for major surgey, pkt of 5 118 knife blade surgical, size 15 for minor surgey, pkt of 5 119 knife handle for minor surgery no. 3 120 knife handle surgical for major surgery # 4 knife handle surgical for minor surgery # 3 122 lamp, ultra violet ( heat source ) with floor stand 123 laproscope 124 larynoscope, infant, w / three blades and spare bulbs 125 larynoscope, set with infant, child, adolescent blades 126 lateral mask with ventillatory bag, infant size 127 led surgical ot light twi 128 macintosh, operation, plastic 129 malaria rapid test card 130 mask, face, surgeon`s cap of rear ties : b ) beret type with elastic hem 131 microscope binocular inclined 10 x 40 x 100x magnificent 132 multiparameter urine strip test nasal prongs 134 nasogastric tube ( 8, 10, 12 fg ) nebuliser 136 nebulisers / mdi 137 needle blood collection disposable, 17g x 1 1 / 3 box of 100 138 needle holder, mayo, straight, narrow jaw, 175 mm ss 139 needle holder, straight narrow jaw mayo heger, 175 mm 140 needle hypodermic, luer 22g x 11 / 4, box of 12 141 needle hypodermic, luer 250g x 3 / 4, box of 12 142 needle suture straight, 5.5 mm, trianglur point, pkt of 6 143 needle, mayo, % circle, taper point, size 6, pkt of 62 144 needle, spinal, stainless set of 4 145 needle, suture, mayo circle, taper point no. 6, pkt of 6 146 needles, hypodermic 20g x 1 1 / 2 box of 12 147 needles, suture traingular point 7.3cm, pkt of 6 148 needles, suture, round bodied, 3 / 8 circle no.12 pkt of 6 normal delivery kit 150 nsv kit 151 oropharyngeal airway ( 000 4 guydel size ) 152 ot table c arm with orthopedic attachments fully electric 153 oxygen cylinders 154 patients cardiac monitor 155 peak expiratory flow rate ( pefr ) meter ( desirable ) 156 perforator, smellie, 250 mm, stainless steel 157 photo therapy unit 158 pipette volumetric set of six 1 ml / 2ml / 3ml / 5ml / 10ml / 20ml 159 plastic / disposable syringes including tuberculin 160 portable pulse oximeters 161 proctoscope mcevedy complete with case 162 radiant warmers rapid test kit syphillis 164 resuscitator, automatic, basinet type 165 retactor, double ended abdominal, beltouis, set of 2 166 retractor abdominal deaver, 25 mm x 3 cm, stainless steel 167 retractor abdominal richardson eastman, dbl ended, set 2 168 retractor abdominal, balfour 3 blade self retaining 169 retractor, abdominal, deavers, size 3, 2.5 cm x 22.5 cm 170 scalp vein set no. 22 and 24 171 scissors ligature spencer 130 mm, stainless steel 172 scissors ligature, spencer straight, 130 mm, stainless steel 173 scissors operating curved, 170 mm, blunt / blunt ss 174 scissors operating straight, 140 mm, blunt / blunt ss 175 scissors operating, straight 145 mm, blunt / blunt 176 scissors, episiotomy, angular, braun, 145 mm, stainless steel scissors, gauze, straight, 230mm, stainless steel 178 scissors, ligature, angled on flat, 140 mm, stainless steel 179 scissors, ligature, spencer, 130 mm, stainless steel 180 scissors, operating curved mayo blunt pointed 170 mm 181 scissors, operating straight, blunt point, 170 mm 182 scissors, operating, straight 140mm, blunt / points ss 183 slides, microscope plain 25 x 75 mm clinical, box of 100 184 smear for filaria 185 sound uterine simpson, 300 mm graduated ub 20 mm 186 specelum vaginal bi valve graves, medium, stainless steel 187 speculum vaginal bi valve cusco`s graves medium ss 188 speculum vaginal bi valve cusco`s graves small ss 189 speculum vaginal bi valve, cusco medium, stainless steel 190 speculum vaginal double ended # 3 speculum, vaginal sim`s double ended, size # 3 ss 192 speculum, vaginal, hamilton bailey , speculum, vaginal, sim`s double ended # 3 ss , speculum, vaginal, wieghted auvard, 38 x 75 mm blade ss , sputum for afb as per fds guidline , stadiometer measuring range 60 20 cm , standard surgical set 1 instruments fru 198 standard surgical set ii ( essential ) , steel sterilization tray with cover size 300 x 220 x 70 mm, s / s, ref; is:3993 200 sterilizer, instrument 200 x 100 x 60 mm with burner ss 201 stiletter, curved for stiffening tracheal catheter ss 202 suction tube, 225 mm, size 23 f , syringe 5ml, spare for items 13 , syringe anaesthetic control, luer 5ml glass syringe, anaesthetic ( control ) , 10ml, luer glass , syringe, anesthetic, control 5ml luer mount glass , syringe, hypodermic, 10 ml glass, spare fot item 3 , syringe, hypodermic, luer 5ml, glass, table instrument adjustable type with tray ss , test for iodine insalf , test tube without rim 75 x 12 mm hrg , test tube without rim 150 x 16mm, hrg thermometers , torch without batteries, towel glove, towel, trolley 84 cm x 54 cm , tray instrument curved, 225 x 125 x 50 mm, stainless steel , tray instrument with cover 450 mm ( l ) x 300 mm ( w ) x 80 mm ( h ) , tray instruments / dressing with cover, 310 x 200x600mm ss, tray, instrument / dressing with cover, 310 x 195 x 63 mm, trolley, dressing carriage size 76c, long x 46 cm wide and 84 cm high , usg machine, uterine elevator ( ranathlbod ) , stainless steel, vaccum extractor, malastrom , valve, inhater, chrome plated brass, y shape , vaporiser, ether or methoxyflurane, wick type, vaporiser, halothane, dial setting visual inspection, ward bed with matters , water testing by strip methord , 5 kv solar inverter...

Medical And Health Services - Rajasthan

31320572 rate contract for supply for lab reagents item at govt. district hospital, kekri 1 blood sugar kit 2 blood urea kit 3 screatnine kit 4 sibilurubintt 5 s biliwbin d 6 sgot 7 sgpt 8 aukaine phosphatase 9 total protein kit 10 serum albumin 11 serum calcium 12 senum amytase 13 serumuricacidd 14 serumtg 15 serum cholesterol e l 16 serum hdl 17 serum ldl 18 wash solution 1 19 wash solution 2 20 cal 3 21 control 22 serum hdl calbration 23 serum ldh calbration 24 serum ldh kit 25 s. tropinin 26 blood sugar kit 27 bloodurea|kit? 28 s creatnine kit 29 , — s bilurubin kit p 30 ajkaline phosphatase 31 serum amyase 32 cpkmp 33 sgpt kit 34 sgot kit 35 ldh kit 36 urine strip for anwlyser ( laura dekhaphwn ) erba 37 ck nac kit 38 dengueelsans 1 39 dengue elisaigm 40 crp quantmtative kit 41 d dimmer test 42 horiba abx minidil 20 lit 43 horiba abx lysebio 1 lit 44 horibaa8xcleaner1 lit 45 horba minodear 500 ml 46 horiba control m 47 cbc horiba printer roll 48 sfri diluent 20 iit 49 sfri lyse 5 iit 50 sfri quench 1 iitr 51 sfri clair 60 ml 52 alatgptfskjta 53 albumin kit 54 kl phasphoras kit 55 asat gotfs kit 56 bilirljbbin bdirect kit 57 cholestrol fs kit 58 cretinine fs kit 59 blood glucose kit 60 ldh dgkc kit 61 total protien kit 62 serumtg 63 uric acid tbhba 64 serum hdl 60 ml and 20 ml 65 serum ldl 60 ml and 20 ml 66 crp fs kit 67 serum calclum 68 d dimmerufs? 69 alkaline cleaner 70 antibect cleaner 71 serum procalcitonin 72 trucalu 73 trubaln 74 tru cal d dimer 75 trucalcrp 76 tru cal upid 77 aso rapid test card 78 crp 100 test latex slide 79 dengue card lgg, lgm, ns1 rapid card 80 edta solution 1 liter 81 giemsastajnases 1 uter 82 hbs ag test device strip 50 test 5 % 83 k3edtavialr.s. 12% with cap 84 plain blood collection vial with cap 85 methanol lr 5 litre 86 micro capillary for bt ct 87 mlcro glass slides 76 mm*26mm*1mm 88 micro pipette channel one 10to 100 89 microtips 50 to 100 microliter 90 micro11ps 100 to 1000 microliter 91 mpcardtets 92 paraffin oil 500 ml 93 r.a test rapid 94 sodium citrate 3:2:1 500 ml 95 sodlum hypochlorite solution 96 sterile water 500 ml 97 test tube glass 12 mm x 75mm 98 tissue paper roll 99 urine colledion sample container 100 urine keton body test strip 101 urine pregnancy test card 102 urine test strip albumin sugar ( accustmx ) 103 vdrl test kit 104 widal rapid test strip 105 ratestkit 106 anti a sera 107 anti b sera 108 antidsera 109 antiabsera 110 anti d seraqgm÷lgg ) polyspecitlc 111 anti human globulin 112 anti sera 113 bovine albumin 22% 5ml 114 coombsera 115 disposable needle 22 no. 116 hbs ag elisa kit ( 4 gen. ) 117 hbs ag rapid test kit 118 hcveusakit 119 hcv rapid card 120 hemocue hb 301 121 thermo pen thermograph 122 hiv elisa kit ( 4 gen. ) 123 hiv rapid card 124 sterile water 5|lt.h 125 ptinr 126 dengue rapid testns1, igg, igm 127 dengue 1gm elisa rapid test 128 chikengunia icg, 1gm, rapid test 129 cover slip 130 esr tubes ( sodium citrate ) 131 jsb staln solution 1st 500 ml 132 jsb staln solution ilnd 500 ml 133 blood bag cpda 109350 ml singal 134 blood bag cpda 100 ml singal 135 theramacol box size 5 liter each 136 theramacol box size 10 liter each 137 theramacol box s|ze 20 liter each 138 theramacol box s|ze 30 liter each 1 plazmax sterilzing agent trop t i card test 2 lypase for semi auto analyzer , sample cup for erba fully automated analyzer sodium citrate test tube vial , clot activator gel test tube , glucose strip code free , urine strip , keton strip etc...

Indian Army - Rajasthan

30952718 8513a/ms/dglp/lte 05/21 22 drugs and pharmaceutical product , lignocaine hcl 2% jelly tube of 30gm , ibuprofen syp 100mg bott of 50ml , adrenaline tartrate (1:1000), 1 ml inj , pralidoxime 500mg/20ml inj , oxcarbazepine 150 mg tab , lorazepam 2mg/ml, 2 ml inj , phenytoin sodium 100mg inj , lamotrigine 25 mg tab , sumatriptan 50 mg tab , trihexyphenidyl hcl 2 mg tab , heamatinic tab/cap containing ferrous fumarate vit b 12 folic acid and vit c, strength: 300mg, 1.5mg, 75mg min , isosorbide dinitrate10 mg tab , isosorbide 5 mononitrate20 mg tab , dopamine hcl40 mg/ml, 5ml inj , amlodipine besylate 5 mg tab , chlorohexidine mouthwash 0.2% bott of 150ml , hydrogen peroxide 500 ml bott , bisacodyl5 mg tab , povidone iodine 200 mgm pessary , magnesium sulphate 50% w/v inj , alprazolam0.25 mg tab , fluoxetine hcl 20 mg cap , olanzapine 10 mg tab , sertraline 50 mg tab , dextrose 50%,25 ml inj , dextrose inj 25%,25 ml inj , sodium bicarbonate 7.5% amp of 10 ml inj , capsacain gel tube of 20 gm , paracetamol 150mg/ml,2 ml inj , promethazine hcl 2.5%, 25mgm/ml, 2 ml inj , tab divalproate 500 mg , tab oxcarbazepine 300 mg , lamotrigine 50 mg tab , tab rasagiline 1 mg , tab topiramate 50 mg , atenolol50 mg tab , enalapril maleate10 mg tab , frusemide 20mg + spironolactone 50 mg tab , cap probiotic (multibacilary 4 or more organisms) , metoclopramide hcl 5mg/ml, 2ml inj , drop anti spasmodic , hydroxyprogesterone caproate 500 mg/2 ml (amp of 2 ml) inj , linctus cough paediatric bottle of 500 ml , iron drops paediatric (up to 20 mg elemental iron) with lysine, b12 folic acid bottle of 15 ml , syrup calcium phosphate (80 mg/5 ml) 200ml bottle , tab clonazepam 0.5mg , chlorpromazine (im and iv)25 mg/ml,2ml inj , haloperidol deconate 50 mg/ml inj , haloperidol 5 mg tab , imipramine 25 mg tab , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bottle of 120ml , tab micronised purified flavonoid fraction 500 mg ( daflon) , b1, 50 mg inj , b 12, 500 mcg/ml inj , vitamin e 200 mg cap , ibuprofen gel tube of 20gm , nimesulide gel tube of 20gm , tetanus toxoid, purified absorbed rubber capped, vial of 5 ml (10 doses) , pressure monitoring line 100 cm/200cm(male/female) , foleys balloon catheter 2 way, silicon16 g , foleys balloon catheter 2 way silicon 20 g , catheter foleys silicon 2 way5 ml size 16 fg , syringe disposable, plastic,sterile, 2 ml with needle , syringe disposable, plastic, sterile, 5 ml with needle , syringe dosposable, plastic sterile,10 ml with needle , vaccum blood collection tubes with needles : heparin 2ml/3ml , vaccum blood collection tubes with needles : sterile tube with out gel 3ml/5ml , vaccum blood collection tubes with needles : sodium citrate 3ml , antiseptic pain reliving gel(fresora) , bandage, open wove compressed:2.5 cm x 4 metres , bandage open wove uncompressed: 6 cm x 4 metres , bandage open wove uncompressed 10 cm x 4 metres , surgeons caps , tube feeding smooth plastic infant 38 cm long, 8 f with red flexible connector (for nasogastric feeding) , tube feeding smooth plastic infant 38 cm long, 5 f with red flexible connector ( for nasogastric feeding) , u drain male incontinence device made of soft, light weight latex sheath size larg35 mm. , u drain male incontinence device made of shoft, right weight latex sheath size medium 30 mm. , naso gastric tube adult 100cm long 14g , naso gastric tube adult 100cm long 16g , naso gastric tube adult 100cm long 18g , naso gastric tube adult 100cm long 20g , hiv i & ii rapid test kit , kits for estimation cholesterol 100 ml erba , kits for estimation of glucose 100 ml erba , kits for estimation of alkaline phosphatase 100 ml eraba , kits for estimation of sgpt (alt). 100 ml erba , rapid card screening for hcv kit of 50 test , film x ray30.5cm x 25.4cm(!2 x 10 ) highspeed , film x ray38.1cm x 30.5cm(15 x 12) high speed , ultrasound jelly tube of 250 gm. , tab sodium valporate500mg , inj thiamine 100 mg , waxole ear drop (clear wax) , oint luliconazole , tab telmisartan 20mg , ursodexycholic acid 300mg , syp azithromycin , syp chlorpheniramine maleate+phenylepherine) , ferrous fumarate 300 mg+folic acid 1.5 mg+vit b12 15 mcg , cap vit e 400 mg , lotion sunscreen , tab dutasteride 0.5 mg , tab methotrexate 7.5 mg , lotion aloe vera 2%+glycerine 5.2%+jajoba oil 0.025%50 gm , tab biotin 5mg , nebulizer mask , urine container sample , ra factor , soft cervical coller , knee cap (m) , knee cap (l) , knee cap (xl) , foleys balloon catheter 2 way 18g , tab chymoral forte , covid 19 rapid antigenpoint of care test with sample collection swab individually packed (kit of 100 tests) , cannula iv size 20g , cannula iv size 22g , glucose solution 5% in non toxic disposable plastic bott of 500ml ffs or equivalent technology , sodium lactate compound solution (ringer lactate solution) in nontoxic disposable plastic bottle of 500ml ffs or equivalent technology , sodium hypochlorite 5% , normal saline 500 ml self collapsible pressure infusion having separate administration port, with recessed membrane and plastic sterility barrier self sealing inj port , budesonide 1mg respules , hdl d cholesterol direct test kit (erba) 100 ml , hbsag rapid test kit , urine strips (bott of 100 strips) , aborh blood grouping kit (10 x 3 ml) , inj pentazocin , oxygen mask paed , oxygen mask adult , distilled water , erba h360 qc (high) , erba h360 qc(medium) , erba h360 qc (low) , laptospyra rapid test kit , tab amisulpride 50 mg , tab esmoprazole + domperidone , tab talvapton 15 mg , tab rosuvastatine 10 mg , tab premiprexole 1 mg , taylor brace xl , tab levosulpride 25 mg , tab resperidone 2 mg , tab fluoxatine 40 mg , inj typhoid vaccine conjucated , inj ppd , nrbn mask => limited...

Medical And Health Services - Rajasthan

30827712 laboratory reagent / consumable for district hospital sirohi supply of laboratory reagent / consumable for district hospital sirohi laboratory 1 bloodsugarkit 2 blood urea kit 3 screatnine kit 4 sibilurubintt 5 s biliwbin d 6 sgot 7 sgpt 8 aukaine phosphatase 9 total protein kit 10 serum albumin 11 serum calcium 12 senum amytase 13 serumuricacidd 14 serumtg 15 serum cholesterol e l 16 serum hdl 17 serum ldl 18 wash solution 1 19 wash solution 2 20 cal 3 21 control 22 serum hdl calbration 23 serum ldh calbration 24 serum ldh kit 25 s. tropinin 26 blood sugar kit 27 bloodurea|kit? 28 s creatnine kit 29 , — s bilurubin kit p 30 ajkaline phosphatase 31 serum amyase 32 cpkmp 33 sgpt kit 34 sgot kit 35 ldh kit 36 urine strip for anwlyser ( laura dekhaphwn ) erba 37 ck nac kit 38 dengueelsans 1 39 dengue elisaigm 40 crp quantmtative kit 41 d dimmer test 42 horiba abx minidil 20 lit 43 horiba abx lysebio 1 lit 44 horibaa8xcleaner1 lit 45 horba minodear 500 ml 46 horiba control m 47 cbc horiba printer roll 48 sfri diluent 20 iit 49 sfri lyse 5 iit 50 sfri quench 1 iitr 51 sfri clair 60 ml 52 alatgptfskjta 53 albumin kit 54 kl phasphoras kit 55 asat gotfs kit 56 bilirljbbin bdirect kit 57 cholestrol fs kit 58 cretinine fs kit 59 blood glucose kit 60 ldh dgkc kit 61 total protien kit 62 serumtg 63 uric acid tbhba 64 serum hdl 60 ml and 20 ml 65 serum ldl 60 ml and 20 ml 66 crp fs kit 67 serum calclum 68 d dimmerufs? 69 alkaline cleaner 70 antibect cleaner 71 serum procalcitonin 72 trucalu 73 trubaln 74 tru cal d dimer 75 trucalcrp 76 tru cal upid 77 aso rapid test card 78 crp 100 test latex slide 79 dengue card lgg, lgm, ns1 rapid card 80 edta solution 1 liter 81 giemsastajnases 1 uter 82 hbs ag test device strip 50 test 5 % 83 k3edtavialr.s. 12% with cap 84 plain blood collection vial with cap 85 methanol lr 5 litre 86 micro capillary for bt ct 87 mlcro glass slides 76 mm*26mm*1mm 88 micro pipette channel one 10to 100 89 microtips 50 to 100 microliter 90 micro11ps 100 to 1000 microliter 91 mpcardtets 92 paraffin oil 500 ml 93 r.a test rapid 94 sodium citrate 3:2:1 500 ml 95 sodlum hypochlorite solution 96 sterile water 500 ml 97 test tube glass 12 mm x 75mm 98 tissue paper roll 99 urine colledion sample container 100 urine keton body test strip 101 urine pregnancy test card 102 urine test strip albumin sugar ( accustmx ) 103 vdrl test kit 104 widal rapid test strip 105 ratestkit 106 anti a sera 107 anti b sera 108 antidsera 109 antiabsera 110 anti d seraqgm÷lgg ) polyspecitlc 111 anti human globulin 112 anti sera 113 bovine albumin 22% 5ml 114 coombsera 115 disposable needle 22 no. 116 hbs ag elisa kit ( 4 gen. ) 117 hbs ag rapid test kit 118 hcveusakit 119 hcv rapid card 120 hemocue hb 301 121 thermo pen thermograph 122 hiv elisa kit ( 4 gen. ) 123 hiv rapid card 124 sterile water 5|lt.h 125 ptinr 126 dengue rapid testns1, igg, igm 127 dengue 1gm elisa rapid test 128 chikengunia icg, 1gm, rapid test 129 cover slip 130 esr tubes ( sodium citrate ) 131 jsb staln solution 1st 500 ml 132 jsb staln solution ilnd 500 ml 133 blood bag cpda 109350 ml singal 134 blood bag cpda 100 ml singal 135 theramacol box size 5 liter each 136 theramacol box size 10 liter each 137 theramacol box s|ze 20 liter each 138 theramacol box s|ze 30 liter each 139 leishmanin stand 140 auto clave indicator micropippte 20 200 mcl autoclave single 141 channel coupirable with universal tips 142 micropippte 0 100 mcl mul11channel 143 micropippte 20 200 mcl singlechannel 144 micropippte 200 1000 mcl uultichannel etc...

Medical Health And Family Welfare - Rajasthan

30822611 supply of laboratory reagent / consumable for district hospital sirohi laboratory 1 bloodsugarkit 2 blood urea kit 3 screatnine kit 4 sibilurubintt 5 s biliwbin d 6 sgot 7 sgpt 8 aukaine phosphatase 9 total protein kit 10 serum albumin 11 serum calcium 12 senum amytase 13 serumuricacidd 14 serumtg 15 serum cholesterol e l 16 serum hdl 17 serum ldl 18 wash solution 1 19 wash solution 2 20 cal 3 21 control 22 serum hdl calbration 23 serum ldh calbration 24 serum ldh kit 25 s. tropinin 26 blood sugar kit 27 bloodurea|kit? 28 s creatnine kit 29 , — s bilurubin kit p 30 ajkaline phosphatase 31 serum amyase 32 cpkmp 33 sgpt kit 34 sgot kit 35 ldh kit 36 urine strip for anwlyser ( laura dekhaphwn ) erba 37 ck nac kit 38 dengueelsans 1 39 dengue elisaigm 40 crp quantmtative kit 41 d dimmer test 42 horiba abx minidil 20 lit 43 horiba abx lysebio 1 lit 44 horibaa8xcleaner1 lit 45 horba minodear 500 ml 46 horiba control m 47 cbc horiba printer roll 48 sfri diluent 20 iit 49 sfri lyse 5 iit 50 sfri quench 1 iitr 51 sfri clair 60 ml 52 alatgptfskjta 53 albumin kit 54 kl phasphoras kit 55 asat gotfs kit 56 bilirljbbin bdirect kit 57 cholestrol fs kit 58 cretinine fs kit 59 blood glucose kit 60 ldh dgkc kit 61 total protien kit 62 serumtg 63 uric acid tbhba 64 serum hdl 60 ml and 20 ml 65 serum ldl 60 ml and 20 ml 66 crp fs kit 67 serum calclum 68 d dimmerufs? 69 alkaline cleaner 70 antibect cleaner 71 serum procalcitonin 72 trucalu 73 trubaln 74 tru cal d dimer 75 trucalcrp 76 tru cal upid 77 aso rapid test card 78 crp 100 test latex slide 79 dengue card lgg, lgm, ns1 rapid card 80 edta solution 1 liter 81 giemsastajnases 1 uter 82 hbs ag test device strip 50 test 5 % 83 k3edtavialr.s. 12% with cap 84 plain blood collection vial with cap 85 methanol lr 5 litre 86 micro capillary for bt ct 87 mlcro glass slides 76 mm*26mm*1mm 88 micro pipette channel one 10to 100 89 microtips 50 to 100 microliter 90 micro11ps 100 to 1000 microliter 91 mpcardtets 92 paraffin oil 500 ml 93 r.a test rapid 94 sodium citrate 3:2:1 500 ml 95 sodlum hypochlorite solution 96 sterile water 500 ml 97 test tube glass 12 mm x 75mm 98 tissue paper roll 99 urine colledion sample container 100 urine keton body test strip 101 urine pregnancy test card 102 urine test strip albumin sugar ( accustmx ) 103 vdrl test kit 104 widal rapid test strip 105 ratestkit 106 anti a sera 107 anti b sera 108 antidsera 109 antiabsera 110 anti d seraqgm÷lgg ) polyspecitlc 111 anti human globulin 112 anti sera 113 bovine albumin 22% 5ml 114 coombsera 115 disposable needle 22 no. 116 hbs ag elisa kit ( 4 gen. ) 117 hbs ag rapid test kit 118 hcveusakit 119 hcv rapid card 120 hemocue hb 301 121 thermo pen thermograph 122 hiv elisa kit ( 4 gen. ) 123 hiv rapid card 124 sterile water 5|lt.h 125 ptinr 126 dengue rapid testns1, igg, igm 127 dengue 1gm elisa rapid test 128 chikengunia icg, 1gm, rapid test 129 cover slip 130 esr tubes ( sodium citrate ) 131 jsb staln solution 1st 500 ml 132 jsb staln solution ilnd 500 ml 133 blood bag cpda 109350 ml singal 134 blood bag cpda 100 ml singal 135 theramacol box size 5 liter each 136 theramacol box size 10 liter each 137 theramacol box s|ze 20 liter each 138 theramacol box s|ze 30 liter each 139 leishmanin stand 140 auto clave indicator micropippte 20 200 mcl autoclave single 141 channel coupirable with universal tips 142 micropippte 0 100 mcl mul11channel 143 micropippte 20 200 mcl singlechannel 144 micropippte 200 1000 mcl uultichannel etc...