Indian Army - Rajasthan

34107208 bids are invited for potato and onion grading and sorting machine (q3) total quantity : 1...

Shree Karan Narendra Agriculture University - Rajasthan

34072753 limited tender are invited from the reputed firms to arrangement of refreshment required for students training under the activities tea, mawa sweets, samosa/kachori, potato waffers, biscuit, namkeen bikaji....

Indian Army - Rajasthan

34071593 bids are invited for potato and onion grading and sorting machine (q3) total quantity : 1...

University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Indian Army - Rajasthan

33982177 bids are invited for vegetable cutter 1 hp motor multipurpose , meat cutting table 48x24x34 ss body , vegetable rack with 6 platic crates with ss jali , potato onion rack mild steel body , insulated tea and milk container20 ltrs , heavy duty mixer grinder 1400 watt 3 plus2 ltrs , food container 25 ltrs each , foodcontainer 40 ltrs each total quantity : 14...

Indian Army - Rajasthan

33918319 bids are invited for vegetable cutter 1 hp motor multipurpose , meat cutting table 48x24x34 ss body , vegetable rack with 6 plastic crates with ss jali , potato onion rack mild steel body , insulated tea plus milk container 20 ltr , heavy duty mixergrinder 1400 watts 3 plus 2 ltrs , food container 25 ltrs each, food container 40 ltrs each total quantity : 14...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

District Hospital - Rajasthan

33789736 supply of food items wheat grain , wheat flour mill , wheat daliya salt , jeera cumin , red mirch powder spices haldi powder , lentils dal , oil , sugar, green vegetable , mirch potato , onion hen eggs food items...

Medical College - Rajasthan

33785491 supply of food items wheat grain , wheat flour mill , wheat daliya salt , jeera cumin , red mirch powder spices haldi powder , lentils dal , oil , sugar, green vegetable , mirch potato , onion hen eggs ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33711452 supply of science lab furniture for govt sr. secondary school faachar, nimbahera supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710655 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school suwaniya, gangrar...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710651 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school kunwaliya, gangrar...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710647 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fernsupply of science lab furniture for govt sr. secondary school sadi, begun...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710645 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school dovni, kapasan...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710643 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school bhanuja, bari sadri...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33710481 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab furniture for govt sr. secondary school melana, nimbahera...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33709138 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab items for govt sr. secondary school barwada, nimbahera...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33708354 supply of science lab items vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree analysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’ psg 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i loader s lest lube stand 1 ) test tu be brush 10 stop watch needle with plastic handle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k. 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 injecrtion 115 octopus i 16 star fish labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern supply of science lab items for govt sr. secondary school bhanuja, bari sadri...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704237 supply of science lab items for govt sr. secondary school dhoriya, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704236 supply of science lab items for govt sr. secondary school melana, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704229 supply of science lab items for govt sr. secondary school kunwaliya, gangrar vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704227 supply of science lab items for govt sr. secondary school faachar, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704108 supply of science lab items for govt sr. secondary school megpura, begun vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704106 supply of science lab items for govt sr. secondary school jaliya, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704095 supply of science lab items for govt sr. secondary school dovni, kapasan vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33704091 supply of science lab items for govt sr. secondary school tai, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33703924 supply of science lab items for govt sr. secondary school nikumbh, bari sadri vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702399 supply of science lab items for govt sr. secondary school suwaniya, gangrar vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702393 supply of science lab items for govt sr. secondary school sadi, begun vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702381 supply of science lab items for govt sr. secondary school ajoliya ka kheda, gangrar vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702135 supply of science lab items for govt sr. secondary school devpura, bhainsroadgarh vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702128 supply of science lab furniture for govt sr. secondary school barwada, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702064 supply of science lab items for govt sr. secondary school govindpura, begun vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702038 supply of science lab items for govt sr. secondary school bangeda ghata, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702033 supply of science lab furniture for govt sr. secondary school dhoriya, nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33702030 supply of science lab items for govt sr. secondary school gadola nimbahera vernior calipers 2 screw guage 7 resistance wire maganin copper calorimeter ( cylinder ) 8 9 drawing boards 10 drawing pin 11 pendulum bob 12 stop clock 3 4 5 6 spherometer dcc wire resistance wire ( eureka ) resistance wire constantan 13 stop watch 14 thermometer 110 c 15 thermometer 360 c 16 thermometer room temp 17 themometer maximum minimum ... 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer 22 resonance apparatus 23 set of tuning fork 24 rubber pad . . 25 stand with clamp 26 plug key one way 27 plug key 2 way 28 resistance box 10000ohm — 29 resistance box l00ohm 30 resistance box 0.1oohm rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) 32 zinc rod 33 laclance cell laclance cell 34 deniel cell deniel cell porous pot charged porous pot empty 35 36 37 — 38 cell box2 cell ammeter 39 voltmeter 40 — galvonometer 41 42 43 44 45 induction coil bar magnet milliamrneter optical bench pn junction diodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 . lens holder 49 resistor / capacitors 50 51 campass both slide glass slotted weight set 2.5 kg. 52 inclined planes 53 hooks law apparatus 54 digital multimeter 55 parellogram law app. 56 battery eliminator i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 ( narrow mouth ) reagent bottle 30 ( narrow moulh ) reagent bottle 31 ( narrow mouth ) 32 reagent bottle ( wide mouth ) reagent bottle ( wide mouth ) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid _e_ 07 phenol_crptuls ( carbo’ic acid ) . 68 potassium lerrocyanide ( ii ) 69 potassiun_permangnute _ l 70 potassium_dichnomate . 71 potassium.carbonate.dnhydrnus . l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied .. potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33643969 supply of laboratory equipment i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 (narrow mouth) reagent bottle 30 (narrow moulh) reagent bottle 31 (narrow mouth) 32 reagent bottle (wide mouth) reagent bottle (wide mouth) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate (crystal) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme (dmg) sodium sulphate anhydrousl st.nnou chloride (tin ii) chende dehydrate 54 55 56 starch (potato) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls (carbo’ic acid) ._... _..... 68 potassium lerrocyanide (ii) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [r79 sodium.bicarbonate _ [_8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire (eureka) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter (cylinder) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat (assorted) 31 rheostat (assorted) rheostat (assorted) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer ,induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor/capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 (‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l)iscctii microscoj’e 3 lirccp (l arge) 4 llmxj1 (small) _______. 5 sdssor (small) scissor (1 .arge) 7 fest lube i lolder s lest lube stand 1) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc auanomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular (electric) 18 sphygmomnanomcter 19 stethoscope 20 1)issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring(‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o) hell jar (medium site) 4() speciman jar lmpt 4 1 i)roppiti bottle (ulass 42 wash bottle plastic 43 i)rojpcrpiutic 44 1)csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis (mammal) t.s. cylinder 50 overv(nlamrnal) t.s. 5 1 liver (mammal) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone (mammal) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i)icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i(nii ul i luinan i, iiir tluti i e svsicin )[ i luinan ( malc 4)w) k.piviiniii’.e %%%icin 4)1 i l111)1:11) (l iiiidl)1 i ,idii.r iii svsictn ol i liiiiiaii )2 itiniiiiai i is%lic% 9.1 i’l:)ili% ‘i i%%lics 94 i1w111c’t i .cai 95 i)icol i.cit 96 v1onocot slein 97 i)icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern ...

Sms Medical College - Rajasthan

33636877 rate contract for chemicals and media items for microbiology department ( nit 45 ) t , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

Medical College - Rajasthan

33634315 rate contract for chemical and media items for microbiology department rate contract for chemical and media items for microbiology department , chemicals , acetone ar , acid hydrochloric ar , acid sulphuric ( conc. ) ar , albert metachromatic stain kit –a , albert metachromatic stain kit –b , alpha –naphthol ar , alpha –naphthyl amine –ar , andrade’s indicator , arabinose , arginine , asculine lr , atcc strain , a. ) aspergillus brasiliensis atcc 16404 , a. ) aspergillus brasiliensis atcc 16404 , b. ) candida albicans atcc 90028 , b. ) candida albicans atcc 90028 , c. ) t. mentagraphyte atcc 9533 , c. ) t. mentagraphyte atcc 9533 , d. ) atcc staphylococcus aureus 29213 , e. ) atcc enterococcus faecalis 51299 , barium chloride powder ar , basic fuchsin ar , benomyl chloride powder , bleaching powder isi marked , bromo thymol blue ar , calcium chloride , calcofluor white , calcofluor white , charcoal , chromotrope 2r , congo red , cotton blue , creatinine powder , cresol red , crystal violet powder , charcoalagarbase , dettol , dulcitol , dextrin , dextrose anhydrous –ar , di ethyl ether ar , dimethyl sulfoxide ar , dipotassium hydrogen phosphate , disodium hydrogen phosphate , distilled water ( tds less than 3 ) , peptone , ethyl alcohol ar grade , ethanol moleucular grade , ferric ammonium citrate green –ar , formalin lr grade , glacial acetic acid ar grade , glucose , gluteraldehyde 2% , glycerol , gomori methanamine stain , gram’s stain ( crystal violet, iodine, decolourizer, basic fucshin / safranine ) sample required , gram’s stain iodine , glycogen , hydrogen peroxide 30% , india ink ( sample required ) , inulin ar certfide , iodine ar , isoamyl alcohol ( hplc grade ) , isopropanol ar , kovacs readymade reagent sample required , lactic acid ar grade , lacto phenol cotton blue ( sample required ) , lactosear , l arginine , l asparagine , leishman stain , leishman stain ( ready made ) with buffer , liquid ammonia ar , liquidparaffin heavy ar grade , l ornithine ( monohydrate ) , l rhamnose monohydrate ar , l xylene , lysine mono di hydrochloride ar , lysol lr , microscope lens cleaning wipes , malachite green certifde grade , maltose monohydrate –ar , mannitol , mannose , mcfarland standard 0.5, , melibiose –ar , methanol –ar , methyl red , methylene blue , molecular grade water sample required , n acetyl –l cysteine ( nalc ) , nigrosin ar grade , n, n, n, n tetramethyl p phenylenediamine dihydrochloride ar grade , normal saline , p dimethyl aminobenzaldehycle ar grade , periodic acid ar , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 8 10.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 5 7.5 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 3.5 6 , ph. indicator strip, non bleeding withgraduation with 0.5 ph units 6.5 9 , phenol crystals ar ( extra pureq ) , phenol red indicator powder ar grade , phenolphthalein indicator ar grade , phenyl isi marked , phenyl alanine ( bacteriological ) , phosphotungstic acid ( fast green ) , potassium chloride ( bact. ) , potassium di chromate ar grade , potassium dihydrogenortho phosphate , potassium hydroxide pellets , potassium iodide , potassium meta bisulphite ar grade , potassium permanganate , potassium tellurite ( extra pure ) bactrological grade 1% bacteriological , sodium pyruvic acid ar grade , raffinose , ribose , safranine , sod.taurocholate ( bacteriological ) , sodiumdeoxycholate , sodium acetate trihydate , sodium bicarbonate ar grade , sodium hydioxide crystals , sodium chloride , sodium citrate ar , sodium hydroxide pellets , sodium hypochlorite ( 4 5% w / v available chlorine ) lr grade , sodium thiglyollatebacteriological grade , sorbitol powder , spirit rectified ( lab use ) , starch soluble ar grade , sucrose –ar , sterilium , thymol ar grade , tincture iodine , tri sodiumcitrate , trypticase soya broth , tween 80 ( polysorbate 80 ) , trehalose , urea , xylene ar grade , xylose , gram staining readymade kit , agarose 100 gm low eeo , dna ladder 100bp , dna ladder 1kb , ecoshield , gel loading dye , gelred biotium , isopropanol mb grade , sterile normal saline , tae buffer 50x , pbs 10 x cell culture , media , agar agar – bactrological grade sample required , alkaline peptone water granulated , anaerobic agargranulated , anaerobic system envelope with palladium catalyst ( h2+co2 ) gas pak to be approved and purchased on demand , anaerobic thioglycollate medium base , antimycotic sensitivity test agar , bhi broth , bordet gengou agar base , bordetella selective supplement forbordet gangou agar base , brain heart infusion agar base granulated sample required , bovine serum ( fetal bovine serum ) , cary blair media , casein hydrolysate , chrome agar for identification of candida species , chromogenic uti agar sample required , corn meal agar sample required , corn meal agar without dextrose , cotton seed agar , cystine tellurite agar , czapek dox agargranulated , decarboxylase test medium base / sample required , dermatophyte test medium / sample required , deoxycholate citrate agar , dextrin ar grade , diphtheria virulence supplement kit ( a+b ) , drbc media dichloran rose bengal chloramphenicol granulated , dulcitol , dnase agar sample required , columbia blood agar base , proteose peptone , glucose phosphate broth , hippurate hydrolysis broth , horse serum gamma irradiated , hoyles medium base , hugh leifson glucose media , hugh leifson media , loffler’s media base , lowenstien jensons medium base ( w / o glycerol ) , mac conkeys agar without crystal violet &nacl but with 0.5% sodium taurocholate –sample required , mdr candida auris selective agar media , mueller hinton agar sample required , mueller hinton broth –cations adjusted sample required , motility indole ornithine medium , neo peptone , nitrate broth , nutrient agar sample required , parazinamide media mgit 7ml 120x25 box , peptone bacteriological ( grannular ) sample required , pnb ( para nitro benzoic acid ) – formula wt 167.12, ma 99% , potassiumtellurite supplement for cystine tellurite agar base , potato dextrose agar , pyr agar base , pyr broth , pyr reagent , ready made media plates sheep blood agar sample required to be supplied on demant in installments , ready made media plates tcbs agar sample required , ready made media plates xld agar sample required , robertsons cooked meat media readymade sample required , rpmi 1640 broth , saborauds dextrose agar granulated sample required , sda broth , sda with chloramphenicol sample required , sda with chloramphenicol and cycloheximide sample required , selenite f broth sample , sim media , simmon citrate agar , soyabean casein digest broth , stock culture agar , t.c.b.s. agar , tellurite blood agar base , thyoglycolate broth granulated , tinsdale base , transport swab with amies medium with charcoal in polystyrene tube sterile , transport swab with cary blair medium in polystyrene tube sterile , triple sugar iron medium granulated , urea base , vancomycin resistant enterococci agar base , vancomycin supplement for vancomycin resistant enterococci agar base , yeast extract powdergranulated , yeast nitrogen base without ammino acids sample required , yeast nitrogen base without ammino acids sample required , mueller hinton agar / modified with 2% glucosewithout methylene blue , agar agar – bactrological grade sample required...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33629345 supply of laboratory equipment i beaker 100ml 2 beaker 3 beaker . 250ml 500m1 •1 •y•m 4 flask conical 250ml 5 flask conical 500m1 6 flaskflat bottom . 500m1 7 dropper 10tmil 8 glassrod 9 platinium wire 35x0.2mm 10 wire guage 15x1 5cm. 11 12 13 crusible tong universal clamp boss heads 14 tripod stand 15 chinadish 16 bumner 17 pipettes 18 burette 19 test tube 20 test tube 21 22 test tube funnel 23 funnel 24 test tube holder 2 — test tube stand 26 27 spatula sprit lamp — 28 wash bottles reagent bottle 29 (narrow mouth) reagent bottle 30 (narrow moulh) reagent bottle 31 (narrow mouth) 32 reagent bottle (wide mouth) reagent bottle (wide mouth) 34 dropping — ___ bottle 35 glass tube centhfuge — machine — 38 centrifuge machine filter paper — sheet 40 filter paper — pkt. 41 water wath 42 cork borer 43 pastel & mortars f pastel o mortars 45 weighing machine 46 cylinder 47 cylinder . 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage 47 cylinder 48 condenser 49 seprating funnel 50 gas generator 51 therometer 0 ‘00.c 52 therometer 0 200_c 53 therometer 0 360 cm 54 thermometer jndus. 55 pipette stand ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate (crystal) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme (dmg) sodium sulphate anhydrousl st.nnou chloride (tin ii) chende dehydrate 54 55 56 starch (potato) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls (carbo’ic acid) ._... _..... 68 potassium lerrocyanide (ii) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [r79 sodium.bicarbonate _ [_8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire (eureka) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter (cylinder) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat (assorted) 31 rheostat (assorted) rheostat (assorted) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer ,induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor/capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 (‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l)iscctii microscoj’e 3 lirccp (l arge) 4 llmxj1 (small) _______. 5 sdssor (small) scissor (1 .arge) 7 fest lube i lolder s lest lube stand 1) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc auanomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular (electric) 18 sphygmomnanomcter 19 stethoscope 20 1)issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring(‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o) hell jar (medium site) 4() speciman jar lmpt 4 1 i)roppiti bottle (ulass 42 wash bottle plastic 43 i)rojpcrpiutic 44 1)csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis (mammal) t.s. cylinder 50 overv(nlamrnal) t.s. 5 1 liver (mammal) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone (mammal) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i)icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i(nii ul i luinan i, iiir tluti i e svsicin )[ i luinan ( malc 4)w) k.piviiniii’.e %%%icin 4)1 i l111)1:11) (l iiiidl)1 i ,idii.r iii svsictn ol i liiiiiaii )2 itiniiiiai i is%lic% 9.1 i’l:)ili% ‘i i%%lics 94 i1w111c’t i .cai 95 i)icol i.cit 96 v1onocot slein 97 i)icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern beekar watch glass rctangular glass plate , lens convex assorted , lens concave assorted , prism glass slab , mirror convex assorted mirror convcave assorted allpin , ammoinum chloride copper sulphate etc ...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

33403621 school lab items for physics lab, biology lab and chemistry lab. 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate ( crystal ) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme ( dmg ) sodium sulphate anhydrousl st.nnou chloride ( tin ii ) chende dehydrate 54 55 56 starch ( potato ) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls ( carbo’ic acid ) ._... _..... 68 potassium lerrocyanide ( ii ) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [ r79 sodium.bicarbonate _ [ _8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire ( eureka ) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter ( cylinder ) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat ( assorted ) 31 rheostat ( assorted ) rheostat ( assorted ) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer , induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor / capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 ( ‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l ) iscctii microscoj’e 3 lirccp ( l arge ) 4 llmxj1 ( small ) _______. 5 sdssor ( small ) scissor ( 1 .arge ) 7 fest lube i lolder s lest lube stand 1 ) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc au anomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular ( electric ) 18 sphygmomnanomcter 19 stethoscope 20 1 ) issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring ( ‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o ) hell jar ( medium site ) 4 ( ) speciman jar lmpt 4 1 i ) roppiti bottle ( ulass 42 wash bottle plastic 43 i ) rojpcrpiutic 44 1 ) csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis ( mammal ) t.s. cylinder 50 overv ( nlamrnal ) t.s. 5 1 liver ( mammal ) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone ( mammal ) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i ) icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i ( nii ul i luinan i, iiir tluti i e svsicin ) [ i luinan ( malc 4 ) w ) k.piviiniii’.e %%%icin 4 ) 1 i l111 ) 1:11 ) ( l iiiidl ) 1 i , idii.r iii svsictn ol i liiiiiaii ) 2 itiniiiiai i is%lic% 9.1 i’l: ) ili% ‘i i%%lics 94 i 1w111c’t i .cai 95 i ) icol i.cit 96 v1onocot slein 97 i ) icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern beekar watch glass rctangular glass plate , lens convex assorted , lens concave assorted , prism glass slab , mirror convex assorted mirror convcave assorted allpin , ammoinum chloride copper sulphate etc...

Medical Health And Family Welfare - Rajasthan

33349004 rate contract tender for supply of consumables item , acetic acid , calcium chloride fused , boric acid , hydrogen per oxide , hydrochloric acid , phospho molybdic acid , sudan ii , nitric acid , sulphuric acid , acetone , ammonium molybdate , di ammonium hydrogen phosphate , iso amyl alcohol , ammonium hydroxide solution , antimony ( iii ) chloride , ammonium ferric sulphate , acetonitrile , bismuth subnitrate , bromocresol green indicator ar , chloroform , carbon tetra chloride , petroleum ether 60 80 , phloroglucinol , phenol , paraffin liquid , resorcinol , sodium hydroxide pelletes , diethyl ether , fehling solution a , furfural , glycerol , xylene , methyleneblue solution indicator , methylorange indicator , fehling solution b , silver nitrate , di phenyl carbazide , petroleum ether 40 60 , phenopthaline indicator , cobalt sulphate , fast red ( allura red ) colour , alkali blue 6 b indicator , rosaniline acetate , zinc acetate , potassiumhydroxide , benzene , hexane , n heptane , potassium iodide , sudan i , sudan iii , sudan iv , sodium hydoxide solution , silica gel , toluene , furfuraldehyde , aluminum oxide ( al2o3 ) , tartrazine color , sunset yellow color fcf , carmosine color , ponceau 4rcolor , brilliant blue color , fast green fcf color , metanil yellow color , iodine monochloride ampules , ninhydrine , potassium chromate , potassium dichromate , starch soluble , sulphur powder , tri sodium citrate , ampules 0.1n sodium hydroxide of 6 , ampules 0.1n sodium thiosulphate of 6 , ampules 0.1n hydrochloric acid of 6 , ampules 0.1n silver nitrate of 6 , iodine crystal , sodium potassium tartrate , di methyle amino banzaldehyde , copper sulphate , potassium sulphate , edta powder , sodium carbonate , copper acetate , bromine ampule , carbon di sulphide , phenol , methyl red indicator , phenol red indicator , phenolphthalien indicator , eriochrome black t indicator , di mehtyel yellow , bromothymol blue indicator , bromophenol indicator , di mehtyel yellow colour , caramel colour , rhodamin b , amaranth colour , erythrosine colour , acid yellow colour , sucrose pure , acid orange ( orange grade ) color , butter yellow color , methanol ms optima grade , acetonitrilms optima grade , ethyl acetate ms optima grade , acetic acid ms optima grade , aluminum ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , antimony ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , arsenic ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , barium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , bismuth ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , cadmium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , calcium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , chromium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , copper ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , germanium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , gold ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , iron ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , lead ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , magnesium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , manganese ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , mercury ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , nickel ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , potassium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , rhodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , scandium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , selenium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , silver ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , sodium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tellurium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , tin ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , vanadium ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , zinc ( icpms grade ) traceable to srm from nist ( 1000 mg / l ) , customized gc pesticide mix nist certified crm ( compound list enclosed ) , customizedlc pesticide mix nist certified crm ( compound list enclosed ) , curcumin nist certified crm ( 1000 mg / l ) , 37 component fame mixcrmfor fatty acid , vitamin a ( 1000 mg / l ) , vitamin d ( 1000 mg / l ) , vitamin b12 ( 1000 mg / l ) , vitamin b3 ( 1000 mg / l ) , vitamin c ( 1000 mg / l ) , potassium hydrogen phthalate , sodium carbonate , mustard oil , ground nut oil , potassium di chromate , sodium chloride , sucrose , oryzonol , argemone oil reference standard , castor oil reference standard , mineral oilreference standard , cotton seed oilreference standard , turmeric with lead chrome reference standard , potassium di chromate reference standard , potassium hydrogen phtallatereference standard , sodium carbonatereference standard , sodium chloridereference standard , sand particle size pass through 500 micron is seive size and retained on 180 micron is seive , standard is seive set ofaperture size size 4 mm, 3.35 mm, 1.70 mm, 1.0 mm with solid bottom pan each , vitamin a reference standard , nutrient brothw / 1%peptone , nutrient agar , mac conkey broth w / nurtral red , mac conkeys agar , plate count agar ( pca ) , bairedparkes agar medium , yeast extract dextrose chloramphenicol agar medium , potato dextrose agar , m r vp medium , bismuth sulphide agar medium , thermometer 0 to 1000c , cedar wood oil / immersion , forcepsss , tray plastic , kovacsindole reagent , grams stain kit , steam indicator tape , dry heat chemical process strips , stereothermophilus ampoule , disposable shoe cover , ph paper strips , autoclavable disposable bags , brown paper , uv lamp for sterilization , autoclavable micropipette ( 1000 fixed volume, 500 5000 variable volume, 50 200 microlitre , micropipette tip box , scissors small , labels and taps , aluminum foil , butter paper , hand gloves ( small and large ) , slippers , liquid soup solution for glassware washing 5 ltr pack , lens paper , beaker , beaker , beaker , beaker , beaker , burret , burret , butyrometer tube for milk testing , dropping bottle plastic , dropping bottle plastic , dropping bottle plastic , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , measuring cylinder , cover slip , condenser for rmset , crusible quartz without lid , diamond pencil , flask conical , flask conical , flask conical , flask conical , flask iodine stopper , funnel glass , funnel plastic , separating funnel , glass rod all type , rubber bulb medium size , rubber bulb size big , pipettes graduated , pipettes graduated , pipettes graduated , pipettes volumetric , pipettes volumetric , pipettes volumetric , pipettes volumetric , test tube with stopper , petri dish pair ( glass ) , volumetric pipette , caplliry tube , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , long neck volumetric measuring flask with stopper , density bottle , soxhlet flask , glass beads , glass slide for microscopy , heating mantal net for 250ml , heating mantal net for 500ml , automatic tilt with 250ml bottle , automatic tilt with 250ml bottle , soxhletcondensor medium , aluminium dishes , reagent bottle , reagent bottle , reagent bottle amber coloured , reagent bottle amber coloured , mojonnier fat extraction tube , pipette stand plastic verticle , air condenser with joint 100cm , dean & stark apparatus 10.0ml , auto pippete sucker , suction flask , colum chomrplaingl, stpk for colour estimation , thermometer zeel , lactometerzeel , centrifuge tube glass with stopper , butyrometer tube aluminium stand , volatile oil clanveger type , lighter thanwater , desicator with cap , toungue ss , soxhlet clamps , with boss head , asbestosed wire gauge , mortar & pestal , volumetric flask ( rm reciever ) , membrane filtration assemboly with pump & filters , beaker , beaker , iodine flask , butyrometer key , butyrometer tube cork , filter paper sheet 1 ( 46*57cm ) , filter paper no. 1 diameter 125mm , filter paper no. 2 diameter 125mm , filter paper no. 4 diameter 125mm , filter paper no. 42 dimeter 125mm , centrifuge tubes ( pp tubes ) 50mlpkt , centrifuge tubes ( pp tubes ) 15mlpkt , nylon syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , ptfe syring filter 0.25mm ( dia ) 0.22 um ( poure size ) , nitril gloves ( medium size ) , nitril gloves ( small size ) , brush for butyrometr test tube brush , tong 12 ss , spatulla 8 ss , auto sampler vials with cap and septa 1x100 , 100 1000 micro litre tips universal graduated ( 1x1000 ) , 10 100 micro litre tips , 1 5 ml tips ( 1x100 ) , tissue rolls , lens paper , disposable lab coat , non absorbant cotton roll500gm , nitrogen gas cylinder 47 litre ( 99.999% purity ) , argon gas cylinder47 litre ( 99.999% purity ) , helium gas cylinder47 litre ( 99.999% purity ) , hydrogen gas cylinder47 litre ( 99.999% purity ) , zero air gas cylinder47 litre ( 99.999% purity ) , membrane filter ( 0.45 ) um ( millipore ) , aluminum foil food grade ( extra hygiene ) rolls , tlc plate aluminium ( 20x20 cm ) , coloumn for vitamin analysis c 18 1.8?m, 2.1x100mm , coloumn for vitamin analysis c 18 2.6?m, 2.1x100mm , gc coloum 105 mtr. capillary tg 5ms, 105mtr. lenth x0.25 pore size for fatty acid profile , alpha. amylase 100 gm , sodium acetate500 gm , ammonium formate 100 gm , di potassium hydrogen phosphate 500 gm...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32948604 supply of science laboratory equipment 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate (crystal) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme (dmg) sodium sulphate anhydrousl st.nnou chloride (tin ii) chende dehydrate 54 55 56 starch (potato) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls (carbo’ic acid) ._... _..... 68 potassium lerrocyanide (ii) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [r79 sodium.bicarbonate _ [_8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire (eureka) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter (cylinder) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat (assorted) 31 rheostat (assorted) rheostat (assorted) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer ,induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor/capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 (‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l)iscctii microscoj’e 3 lirccp (l arge) 4 llmxj1 (small) _______. 5 sdssor (small) scissor (1 .arge) 7 fest lube i lolder s lest lube stand 1) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc auanomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular (electric) 18 sphygmomnanomcter 19 stethoscope 20 1)issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring(‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o) hell jar (medium site) 4() speciman jar lmpt 4 1 i)roppiti bottle (ulass 42 wash bottle plastic 43 i)rojpcrpiutic 44 1)csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis (mammal) t.s. cylinder 50 overv(nlamrnal) t.s. 5 1 liver (mammal) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone (mammal) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i)icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i(nii ul i luinan i, iiir tluti i e svsicin )[ i luinan ( malc 4)w) k.piviiniii’.e %%%icin 4)1 i l111)1:11) (l iiiidl)1 i ,idii.r iii svsictn ol i liiiiiaii )2 itiniiiiai i is%lic% 9.1 i’l:)ili% ‘i i%%lics 94 i1w111c’t i .cai 95 i)icol i.cit 96 v1onocot slein 97 i)icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern beekar watch glass rctangular glass plate , lens convex assorted , lens concave assorted , prism glass slab , mirror convex assorted mirror convcave assorted allpin , ammoinum chloride copper sulphate etc ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32935132 supply of science laboratory equipment 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate (crystal) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme (dmg) sodium sulphate anhydrousl st.nnou chloride (tin ii) chende dehydrate 54 55 56 starch (potato) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls (carbo’ic acid) ._... _..... 68 potassium lerrocyanide (ii) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [r79 sodium.bicarbonate _ [_8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire (eureka) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter (cylinder) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat (assorted) 31 rheostat (assorted) rheostat (assorted) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer ,induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor/capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 (‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l)iscctii microscoj’e 3 lirccp (l arge) 4 llmxj1 (small) _______. 5 sdssor (small) scissor (1 .arge) 7 fest lube i lolder s lest lube stand 1) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc auanomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular (electric) 18 sphygmomnanomcter 19 stethoscope 20 1)issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring(‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o) hell jar (medium site) 4() speciman jar lmpt 4 1 i)roppiti bottle (ulass 42 wash bottle plastic 43 i)rojpcrpiutic 44 1)csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis (mammal) t.s. cylinder 50 overv(nlamrnal) t.s. 5 1 liver (mammal) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone (mammal) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i)icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i(nii ul i luinan i, iiir tluti i e svsicin )[ i luinan ( malc 4)w) k.piviiniii’.e %%%icin 4)1 i l111)1:11) (l iiiidl)1 i ,idii.r iii svsictn ol i liiiiiaii )2 itiniiiiai i is%lic% 9.1 i’l:)ili% ‘i i%%lics 94 i1w111c’t i .cai 95 i)icol i.cit 96 v1onocot slein 97 i)icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern beekar watch glass rctangular glass plate , lens convex assorted , lens concave assorted , prism glass slab , mirror convex assorted mirror convcave assorted allpin , ammoinum chloride copper sulphate etc ...

RAJASTHAN COUNCIL OF SCHOOL EDUCATION - Rajasthan

32933991 supply of science laboratory equipment 1 junior medical compound microscope 2 dissecting microscope 3 forceps ( large ) 4 forceps ( small ) 5 scissor ( small ) 6 scissor ( large ) 7 test tube holder 8 test tube stand 9 test tube brush 10 stop watch 11 needle with plastic handle 12 dissecting brush 13 arc.auxanometers 14 staining rack 15 tripod stand wire mess 17 water bath rectangular ( electric ) 18 sphygmomanometer 19 stethoscope, 20 dissecting tray, 21 electric balance digital 1 2 test tube watch glass 3 petridis 4 slides plane 5 watch glass 6 cavity slides 7 cover slips 8 petri dish 9 beaker 10 beaker 11 measuring cylinder 12 measuring cylinder 13 conical flask 14 funnel 15 ganongpotometer 16 respirometer 17 bell jar ( medium size ) 18 specimen jar empty 19 dropping bottle glass, 20 wash bottle plastic 21 dropper plastic 22 desicator 23 thermometer clinical 24 thermometer 25 funnel glass pvc 26 sprit lamp 1? — testis_ ( mammal ) _t.s. 2 ovary ( mammal ) t.s. 3 tiver ( mammal ) t.s. 4 blastulat.s. 5 skeletal muscles 6 cardiac muscles 7 unstraited muscles 8 t.s. of bone ( mammal ) 9 t.s. of cartilage ( mammal ) 10 epithelium tissue 11 nervous tissue 12 cell division mitosis set 13 cell division mitosis set 14 entamoebahistolitica 15 plasmodium w.m. 16 sperozoite plasmodium — 17 trophozoiteplasmodium 18 hydra w.m. 19 spirogyra w.m 20 ulothrixw.m. 21 funeria t.s. of monocot leaf 23 t.s. of dicot leaf 24 t.s. of monocot stem 25 t.s. of dicot stem 26 t.s. of monocot root 27 t.s. of dicot root 28 ti of monocot root 1 amoeba 2 dissected frog anatomy 3 eye 4 ear 5 brain ls. 6 human skeleton 1 hemophilia pedigree anatysis 2 colour blindness pedigree analysis 3 excretory system of human 4 respiratory system of human circulatory system of human 5 6 reproductive system of human ( male ) 7 reproductive system of human ( female ) 8 endocrine system of human 9 animal tissues 10 plants tissues 11 monocot leaf 12 dicot leaf 13 monocot stem 14 dacot stem 15 monocot root 16 dicot root 17 digestive system of human 18 life cycle of angiosperm plants 1 sicyon 2 — tape worm 3 liver fluke 4 ascaris male s ascaris female 6 earthworm 7 leech 8 scorpion 9 silk worm life cycle 10 cancer 11 centipede 12 pila 13 unio 14 15 16 octopus star fish — labeo 17 scoliodon 18 ranatigrina hyla 19 20 draco bat hyd ri ha 21 22 23 valisnaria 24 cycas male & female cone 25 pinus male & female cone 26 fern ( pteridium ) 1 monocot leaf 2 dicot leaf 3 filter paper 4 phpaper 5 saffranine 6 eosin . n 7 glycerin 8 methyl blue 9 fast green 10 xylem 11 formalin 12 chloroform 13 14 .. acetocormine benedict solution 15 felling solution a 16 feeling solution b 17 potassium hydroxide 18 sodium hydroxide 19 sudan iv 20 picric acid 21 ethyl alcohol 22 canada balsam — 23 starch powder 24 sucrose — 2s cobalt chloride — 2s iodine solution 27 boric acid 28 potassium chloride 29 blood testing kit 30 sprit , acetone napthol aceticacid , ammoniumm hydroxide ammonium chloride , ammonium thloyanate sulphocyanide , ammonium oxalate monohydrax ammonium ferrous sulphate , ammonium carbonate powder , , ammonium hepta molybdate tetrahydrate , ammonium sulphide yellow solution , aluminium chloride anhydrous barium carbonate , barium chloride dehyohated , broumine ampule , calcium hydroxide , n7 chlorine water 18 choper chloride 19 copper metal turnine 20 cadmlum chloride dried 21. calcium rncychlonde or calciumhypochlorklc? 22 cadmium charbonah’ 23 chromium carbonate 24 hydro chioric acid 2s iodine crystals _ 26 iron metal powder 27 lead chromate. 28 ledd acetate 29 litmussti. red lilmu, 501 glue 31 molischu1n_ . 32 methanol _ — 33 magnesiun metal ribbon toil 34 methyl orange ph indicator 3s magnesium carbonate basis light 36 uagnese dioxide 37 magnesunnitrah 38 mercuric chloride __ 39 manecium sulphate heptahydidle 40 magnesium nitrate 41 magnesium chloride 42 m.dinitro benzene 43 ethanol 44 ethyl acetate 45 rerroussulphide broken sticks 46 rerrous sulphate (crystal) 47 rehling 5o1. a 48 fehllngsoib c3lycerwc or glyeerol amhydrou cemncammonium nitrate 49 so s1 52 53 dectroseanhydrolus diethy ether gb dlmethylglyoxinme (dmg) sodium sulphate anhydrousl st.nnou chloride (tin ii) chende dehydrate 54 55 56 starch (potato) pure 57 silver nitrate 58 sodium nltroprusslde 59 sodium metal 60 sodium phosphate disodium hydrogen or tetraphosphate 61 schiffs rca ent for aldehydc 62 sulphuric acid concentrate £4 nitric acid concentrate etc. nesscers reagent 66 oxalic acid __________e_ 07 phenol_crptuls (carbo’ic acid) ._... _..... 68 potassium lerrocyanide (ii) ...... _______ 69 potassiun_permangnute ...._ ______ l 70 potassium_dichnomate ____.. _____. 71 potassium.carbonate.dnhydrnus ____.. _..... l 72 phenolpthlin lndicatnrl 73 sslum_sulphate puriiied ..... ......___._ potassium chromate l potnssiuni i 76jsodiiim acetate l 77 carbonate_anhidwus 7r sodium hydroxide.pelsets [r79 sodium.bicarbonate _ [_8a strnncium tarhondt . . 81. sodium sulphate ..... 82 sodium sulphide fluy titan yellow sol. _ 84 urea for inalysis 85 zinc metal grant lsr powder zinc chloride 87 linc acetate dehydrnte _... 8n zanc nitrnte hexahydrate 89 potassium nitrate potassium iodate stronsium nitrate silica gel h for tlc , chloroform exrtra pure chromato graphy paper , acetone for chromato graphy methanol for chromatography zinc powder , copper sulphate , beaker beaker 3 rubber cork 4 crucib’e tongs s test tube holder with brush 6 tripod stand metal 7 wire gauge s spatula 9 1o sprit lamp metal thick superior 11 scientist poteriate 12? shite board 13 measuring cylinders 14 core borare set 15 measuring cylinders 16 periodic table chart 17 wash bottle 18 regent bottle 125 ml 19 regent bottle 125 ml 20 burrette stand with clamp 21 burette 22 pipette volumetric 23 test tube stand 24 ‘pipette stand 25 atomic model with ball and stick 26 induction plate cooker 27 metal strips ( zn, cu.fe ) 28 dropper with rubber bulb 29 camical balance 30 termameter 31 compound microscope 32 dissecting microscope 33 plane slide 34 cover slips watch glass 36 petri dish 37 magnifying glass 38 fort’psg — 4.2 blood testing kit 43 ph meter with soil testing 44 painting brush 45 dropping bottle — zoological specimens ascaris earthworm cockroacch honyebee silk moth pila roha , botanical specimen opuntia calotropis hydrilla valisnaria bryophyllim leaf laaf tendril pea tuber patato rhizome ginger racemose inflorescenece , human skeleton first aid box , fibre chart , model earth globe volcano earth quake dinasoure roket dna, stethoscope , respirometer , thermometer , blood pressure monitor , galvno meter dc with stand , voltmeter dc with stand , ameter dc with stand , rheostat resostance wire , key one way meter scale bridge , lachlanche cell denial cell resistance box , battery eliminator , optical bench with two pin and lense holder concave and convex lens , concave and convex mirror , concave and convex mirror , travelling microscope , glass slab iron stand with universal clamp , drawing board , two way key , vernier calipers stainless steel , spherometer , screw gauge , weight set with fractional weight , iron bob varous radius or diameter with hook , sprit level wooden base , stop clock mechanical , tunning fork set with rubber pad , bar magnate , compass , electric motor , t ransformer , iron nails , hammer , spring pen drive , t hermometer practical demonsration cd , prizm , calory meter copper with wooden box and sterer , lead accumelator cell 1 vernior calipers 2 screw guage . 3 spherometer 4 dcc wire 5 resistance wire (eureka) 6 resistance wire constantan 7 resistance wire maganin 8 copper calorimeter (cylinder) drawing boards drawing pin pendulum bob stop clock stop watch thermometer 110 c 166 thermometer room temp 17 themometer maximum minimum 18 sonometer 19 meter scale 20 meter bridge 21 potentiometer? 22 rcsoninct appir1itus 23 set of tuning fork 24 rubber pad 25 stand with clamp 26 plug key one way f27 plug key2 way resistance box 10000ohm 29 resistance box 1o0ohm 30 resistance box 0m10ohmn rheostat (assorted) 31 rheostat (assorted) rheostat (assorted) laclance cell induction coil celldeniel cell porous pot charged porous pot empty , cell box , ammeter , voltmeter galvonometer ,induction coil , bar magnet 43 milliammeter 44 optical bench 45 pn junction oiodech.app. 46 transistor charactorstic app. 47 zenor diode ch.app. 48 lens holder 49 nesistor/capacitors 5o campass both slide glass 1 slotted weight set 2.5 kg. 52 inclined planes 53 54 55 56 — hooks law apparatus digital multimeter parellogram law app. battery elimanator 1 beaker 2 beaker 3 beaker 4 (‘onical 5 flask conical flask flat iiotton 6 flask hat bottom _ flask bottom t:lask flat i3otton 6 bottom bottom dropper glass rod , platinium wire , wire guage , crusible tong , universal clamp , boss heads , tripod stand china dish , burner , pipettes , burette test tube , funnel , test tube holder test tube stand , spatula sprit lamp , wash bottles , reagent bottle , dropping bottle, glass tube , fusion tube , centrifuge machine , filter paper sheet packet , water wath , corck borer , pastel and mortas mortars , weighing machine , cylinder , condenser seprating funnel , gas generator , therometer thermometer , industrial , pipette stand , 1 1 i‘ ouihi 1icroscopc 2 l)iscctii microscoj’e 3 lirccp (l arge) 4 llmxj1 (small) _______. 5 sdssor (small) scissor (1 .arge) 7 fest lube i lolder s lest lube stand 1) l’est 1ube brush 10 stop watch nccdle with plastic ______ i landle 12 dissecting brush 1 3 arc auanomcters 14 staininy rack 1s tripod stand 16 wirc mess 1 7 water bath rectangular (electric) 18 sphygmomnanomcter 19 stethoscope 20 1)issecting tray 21 electric balance digital 22 test tube 23 watch glass — 24 petridish 25 slides plane 26 watch glass 27 cavity slides 28 cover slips 29 petridish 31 beaker 500mnl 32 measuring(‘otiical i’lask 250nil 3 llii1flli 37 ( mnlu1ipoeon1ctcr 3s respirometer 3o) hell jar (medium site) 4() speciman jar lmpt 4 1 i)roppiti bottle (ulass 42 wash bottle plastic 43 i)rojpcrpiutic 44 1)csicator 45 thernomctcr clinical 46 iliermomcter 47 glass pvc 48 sprit lamp .__. 4q testis (mammal) t.s. cylinder 50 overv(nlamrnal) t.s. 5 1 liver (mammal) t.s. 52 blastula t.s. 53 skeltal muscles 54 cardiac muscles 55 unstraited muscles 56 t.s. of bone (mammal) t s of cartrilage , epithelium , nervous hass cell division mitosis set , entamocbalistoltica plasmodium wm sperozoite plasmodium , trophozoitc plasmodium , hydra w m , spirogyra wm ulothrix wm , funeria , 30 beaker 250ml 71 t.s.ofmonlcot i.cai 72 1.s. of i)icot i.caft 73 t.s. of monocot stcm 74 t.s. of dicot stem 75 t.s. of monocot root 76 77 t.s. of dicot root t.s. of monocost root 78 amoeba 79 dissected frog anatomy 80 eye 8 ear 82 brain l.s. 83 human skeleton 84 hemophillia pedigree analysis 85 colour blindness pedigree analysis 86 excretory system of human 87 respiratory system of human ( ‘iirculaor sv%i(nii ul i luinan i, iiir tluti i e svsicin )[ i luinan ( malc 4)w) k.piviiniii’.e %%%icin 4)1 i l111)1:11) (l iiiidl)1 i ,idii.r iii svsictn ol i liiiiiaii )2 itiniiiiai i is%lic% 9.1 i’l:)ili% ‘i i%%lics 94 i1w111c’t i .cai 95 i)icol i.cit 96 v1onocot slein 97 i)icot stcmn 98 mionocot root 99 dicot root 10 digestive system or human i 101 life cycle or angiosperm plants i 102 sicyon 103 iapc wormm1 104 liw flukci 105 ascaris male 106 ascaris female 107 iarth worm l0 l.ccch 1u9 scorpion iilc yck i 1 i cancer 112 tcrntipcdc 1m13 l’ila 114 ijnj 115 octopus i 16 star fish ii? labco i 18 scoliodon 119 kana iiprna? i 20 1 lyla i21 draco 122 bat 122 bat 123 ilydrila 124 valisanaria 125 cycas male & j:cmaic cone i ‘6 pinus male & remaie cone 127 fern beekar watch glass rctangular glass plate , lens convex assorted , lens concave assorted , prism glass slab , mirror convex assorted mirror convcave assorted allpin , ammoinum chloride copper sulphate etc ...