University of Rajasthan - Rajasthan

34054037 supply of chemicals, laboratory accessories and outsourcing servicing supply of chemicals, laboratory accessories and outsourcing servicing at botany department, uor, jaipur , chemical items : , 2(4 iodophenyl) 3 (4 nitrophenyl) 5 phenyl 2h tetrazolium chloride (int) 98% , 1 kb dna ladder , 1,10 phenanthroline , 1,2 dichloroethane, hi lr , 100 bp dna ladder , 10x mops buffer , 1 amine 2 napthol 4 sulfonic acid , 1n hydrochloric acid , 1 naphthaleneacetic acid; , 2,3,5 triphenyl tetrazolium chloride , 2,4 dichlorophenoxyacetic acid , 2,4 dinitrophenylhydrazine, hi ar , 20 bp dna ladder(50 ?g) , 2 mercaptoethanol , 2 oxoglutarate , 2 thiobarbituric acid , 3,3’ diaminobenzidine , 3,3 diaminobenzidine tetrahydrochloride (dab hcl) , 5,5 dithiobis (2 nitrobenzoic acid) (dtnb) , 50 bp dna ladder 50ln (150?l) , 50 x tae buffer , 500 bp dna ladder , 5 bromo 4 chloro 3 indolyl phosphate disodium salt (bcip) extrapure, 98% , 5 bromo 4 chloro 3 indolyl ? d galactopyranoside(x gal) 98% , 6 benzylaminopurine , 6x gel loading buffer , 6x orange gel loading buffer , abscisic acid , acetic acid glacialextrapure, 99.5% , acetic acid glacial, hi ar™ , acetone hplc grade 99.9% , acetone pure 99% , acetone, hi ar , acrylamide , adenosine 5 triphosphate , adonitol (ad, sugar discs , agar powder, bacteriological , agarose special, low eeo (nuclease and protease free) , amikacin (ak 10mcg), antibiotic discs , ammonium acetate for hplc, 99% , ammonium dihydrogen phosphate , ammonium ferrous sulphate hexahydrate extrapure, 98% , ammonium molybdate tetrahydrate , ammonium molybedate tetrahydrate extrapure ar, 99% , ammonium persulfate(aps) , ammonium sulphate , amoxyclav (amc 30mcg), antibiotic discs , a napthylamine , andrade’s indicator , aniline blue , anisaldehyde , arabinose (ar), sugar discs , arsenic acid sodium salt heptahydrate , ascorbate oxidase , atp , barium chloride , beef extract powder , betaine , biscrylamide , boric acid , boric acid extrapure, 99.5% , bovine serum albumin , bovine serum albumin ph 7.0 , bromo thymol blue , bromocresol green sodium salt (water soluble) acs (3,3”,5,5 tetrabromo mcresolsulfonphthalein sodium salt) dye content — 90% , buffer capsule ph 4 , buffer capsule ph 7 , buffer capsule ph 9 , butanol extra pure , calcium carbonate extrapure 98% , calcium chloride anhydrous , calcium chloride dihydrate , calcium chloride dihydrate extrapure ar,99.5% , calcium nitrate tetrahydrate , calcium phytate , carbenicillin (cb 100mcg), antibiotic discs , carboxy methyl cellulose sodium , carboxymethyl cellulose , casein enzyme hydrolysate, type i (tryptone type i) , casein hydrolysate , catechol , ceftriaxone (ctr 30mcg), antibiotic discs , cellobiose (ce), sugar discs , chaps buffer extrapure, 99% , chitosan (high mw) , chitosan (low mw) , chitosan (medium mw) , chloroform : isoamyl alcohol (24:1) , chloroform extrapure , cholorodinitrobenzene , ciprofloxacin (cip 10mcg), antibiotic discs , citric acid anhydrous extrapure, 99% , cobalt chloride hexahydrate , colloidal chitin , congo red , coomassie® brilliant blue g 250 , coomassie® brilliant blue r 250 , copper (ii) chloride anhydrous , copper (ii) sulphate pentahydrate , copper(ii) sulfate (cuso4) , cotrimazine (cm 30mcg), antibiotic discs , cotrimoxazole (cot 25mcg), antibiotic discs , ctab , cu nanopowder , cycloheximide , cysteine , d (+) glucose anhydrous , d biotin , deacetylated chitin (high mw extrapure,90% da) , deacetylated chitin (low mw extrapure10 150m.pas, 90% da) , deacetylated chitin (medium mw extrapure, 150 500m.pas, 90% da) , dextrose (de), sugar discs , diethyl pyrocarbonate , diethylpyrocarbonate (depc) , diphenylamine , diphenylamineextrapure ar, 99% , di potassium hydrogen ortho phosphate , di sodium hydrogen phosphate dihydrate, hi ar , disodium phosphate (na2h po4) , disodium phosphate (na2h po4) , dithio nitrobenzoic acid , dithiothretiol (dtt), molecular biology grade , dl dopa , d mannitol, for molecular biology , dnase i, rnase free , dntp mix, 10 mm (2.5 mm each) , dpph , dpta , dulcitol (du), sugar discs , ecori, 5000 units , edta , electrophorsis kitone kit , ethanol (absolute) 500ml , ethidium bromide , ethyl acetate , evans blue dye , ferric chloride anhydrous , ferrous ammonium sulphate , ferrous sulphate heptahydrate, hi ar/acs , ferrric chloride (fecl3) , first strand cdna synthesis kit , fluorescein diacetate , folin ciocalteu reagent , formaldehyde sol 37 41%, hi ar , formamide 500ml , formic acid , fructose (fc), sugar discs , galactose (ga), sugar discs , gallic acid , gelatin bacteriological , gentamicin (gen 10mcg), antibiotic discs , gibberellic acid , glucosinolate , glutathione , glutathione oxidized , glutathione reduced , glutathione reductase , glycerol , glycine , guaicol , h2so4 , hemocytometer , hexane , hi pure a soil dna extraction kit , hydrogen peroxide , hydroxyl amine , hydroxylamine hydrochloride (nh2oh.hcl) , imidazole , indole 3 acetic acid (iaa); , indole 3 butyric acid(iba); , inositol (is), sugar discs , inulin (in), sugar discs , iodine , iodine resublimed , isopropyl alcohol extrapure , kanamycin (k 30mcg), antibiotic discs , kinetin , kovac’s indole reagent , l glutamic acid , l glutamine , l (+) tartaric acid, , labolene phosphate free , lactophenol , lactose (la), sugar discs , l ascorbic acid, a.r , levofloxacin (le 5mcg), antibiotic discs , lithium chloride 100gm , litmus milk , l methionine , l phenylalanine , l tryptophan , magnesium chloride anhydrous500 gm , magnesium sulphate 500gm , magnesium sulphate. 7h2o , maleic acid , maltose (ma), sugar discs , manganese (ii) sulfate tetrahydrate (500gm) , manganese (ii) sulphate monohydrate, hi ar™/acs , mannitol 500gm , mannitol, sugar discs , mannose (mo), sugar discs , melibiose (mb), sugar discs , mercuric chlorideextrapure ar, acs, exiplus, multi compendial, 98% , mercury(ii) oxide (hgo) , mesitylene extrapure, 98% (1,3,5 trimethyl benzene) , methanol , methanol extrapure , methanol pure 99% , methoxyamine hydrochloride , methyl jasmonate , methyl red sodium salt (water soluble) acs, 95% , methyl viologen , mo nanopowder , monosodium phosphate (nah2po4) , m phosphoric acid sticks, hi ar™/acs , ms medium w/cacl2& vitamine , mspi (hpaii), 3000 units , murashige and skoog (m.s) media 5lt , n(1 napthyl) ethylene diaminedihydrochloride , nadh , nadph , nano2 , naoh , napthyl etylene diamine dihydrochloride , nessler’s reagent , netillin (net 30mcg), antibiotic discs , nicotinic acid , ninhydrin , nitrobluetetrazolium chloride (nbt) , nitrofurantoin (nit 300mcg), antibiotic discs , n methyl n (trimethylsilyl) trifluoroacetamide (mstfa) , nuclease free water , nutrient agar , o dianisidine (25 g) , ofloxacin (of 5mcg), antibiotic discs , orthophosphoric acid , orthophosphoric acid extrapure, 85% (phosphoric acid) , oxalic acid , oxidase discs , p amino benzoic acid , pcr master mix 100r (2.5ml) , pda , pectin pure , peptone bacteriological grade , perchloric acid , phenol crystals 100gm , phenol saturated with 10mm tris hcl ph8.0, 1mm edta , phenol, saturated w/10% water500ml , phenol: chloroform: isoamyl alcohol mixture , phenylmethanesulphonyl fluoride , phosphate bufferph 7.2 (apha) , phytase agar media , picloram , picric acid , pikovskaya’s agar , p nitrophenol , p nitrophenyl phosphate disodium , polyethylene glycol mw6000 , polyvinyl pyrrolidone (pvp) k 30 , potassium biphosphate, hi ar , potassium chloride , potassium chloride 99.5% , potassium chromate, , potassium dichromate pure, 99.5% , potassium dihydrogen orthophosphate extrapure ar, 99.5% , potassium dihydrogen phosphate (kh2po4) , potassium hydrogen phosphate (k2h po4) , potassium hydroxide pellets , potassium iodide , potassium nitrate , potassium permanganate , potassium permanganate extrapure, 99% , potassium sulfate (k2so4) , prestained protein ladder , proline 99% , protein loading dye , psti, 3000 units , putrescine dihydrochloride , pvpp , pyridine, hi ar/acs , pyridoxal 5’ phosphate anhydrous, hi lr , pyrogallol , quercetin , raffinose (rf), sugar discs , restriction digestion kit , revertaid reverse transcriptase, 10,000 u , rhamnose (rh), sugar discs , ribitol , riboflavin , rna gel loading dye (0.25ml) , rnase100mg , rnase inhibitor (20 u/?l) 2500 units , rnasezap , rochelle salt(na k tartrate) , salicin (sa), sugar discs , salicylic acid , schffs reagent , selenium dioxide (seo2) , silver nitrate, hi lr , silver sulphate pure, 98.5% , simmons citrate agar , sio2 powder , skim milk powder , sodium acetate 100g , sodium acetate 3m , ph 5.2 5.4 , sodium acetate anhydrousfor hplc & uv spectroscopy, 99% , sodium acetate trihydrate , sodium acetate trihydrate , sodium azide (nan3) , sodium bicarbonate , sodium bisulphite , sodium carbonate anhydrous, hi ar/acs , sodium chloride , sodium chloride extrapure ar, 99.9% , sodium citrate anhydrous , sodium citrate tribasic dihydrate extrapure ar, 99% , sodium citrate, 3.8% w/v , sodium dithionite , sodium dodecyl sulphate, ultrapure , sodium fluoride , sodium fluoride pure, 98% , sodium hydrogen sulphite, hi ar/acs , sodium hydroxide pellet , sodium hydroxide pellets extrapure ar, 98% , sodium hypochlorite , sodium hypochlorite, hi ar™/acs(4% w/v solution) , sodium molybdate dihydrate, hi ar™/acs , sodium phenolate , sodium phosphate dibasic anhydrous extrapure ar, 99% , sodium phosphate monobasic anhydrous extrapure ar, 99% , sodium sulfite, hi ar/acs , sodium sulphite , sodium tetraborate , sorbitol (sb), sugar discs , spermidine , spermine , stannous chloride dihydrate dihydrate pure, 97% , starch soluble , streptomycin (s 10mcg), antibiotic discs , sucrose (su), sugar discs , sulfosalicylic acid , sulphanilic acid, purified , sulphosalicylic acid (3%) , taq dna polymerase (3 u/?l) (includes enzyme: 1 vial; 10x taq buffera : 4 vials; 25 mm mgcl2: 4 vials), 1000units , taq polymerase (5 units/?l) , temed , tetra chloroacetic acid , tetracycline (te 30mcg), antibiotic discs , thiamine hydrochloride , thiobarbituric acid (tba) , thiourea, hi ar/acs , titanium (?) oxysulfate hydrate , tlc silica gel 60 f254 , toluene , toluene extrapure ar, 99.5% , toluene, rectified, l.r. , trehalose (te), sugar discs , trichloroacetic acid extrapure ar, acs, 99.5% , triclogel , triclogel dispenser bottle , trimethylsilane (tms) , tris (hydroxylmethyl) aminomethane , tris base , tris buffer ar, acs for molecular biology, 99.9% , tris hydrochloride , tris hydrochloride (tris hcl) extrapure ar, 99% , triton x 100 , trizol reagent® , trypan blue dye , tryptone, certified (casein enzyme hydrolysate) , turbo dna freetm kit , tween 20 , urea extrapure ar, 99.5% , urea extrapure, 99% , xylose (xy), sugar discs , yeast extract 500gm , yeast mannitol broth , zeatin , zinc chloride 500gm , zinc dust , zinc oxide, hi ar™500gm , zinc sulphate heptahydrate , zn nanopowder , glassware items : , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , beaker, glassware , beaker, glassware , beaker, glassware , beaker, glassware , bottles, reagent, graduated with screw cap, glassware , bottles, reagent, graduated with screw cap, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim, glassware , conical flask narrow mouth with rim,amber, glassware , cover glass, square, glassware , funnel, glassware , funnel, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , measuring cylinder, glassware , microscopic glass slides, plain, ground edges, glassware , petri plats glass, 90mm, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , reagent bottles, amber color, glassware , stirring rod, glassware , test tubes with rim, glassware , watch glasses, borosil s line, 150 ml, glassware , plasticware items : , applied biosystems™ microamp™ optical fast well reaction plate with barcode & optical adhesive films , art™ gel loading pipette tips (20 ?l) , carboy with stopcock ( liquid storage container), 10li , centrifuge tube conical bottom sterile 15 ml (pack of 500) , centrifuge tube conical bottom sterile 50 ml (pack of 500) , conical centrifuge tube rack , draining tray , drying rack , eppendorf tubes (1.5) (pack of 500) , eppendorf tubes (2 ml) (pack of 500) , funnel, 100 mm , funnel, 50 mm , ice bucket , ice tray (1 l) , ice tray (4 l) , junior 4 way tube rack , measuring cylinder class b, material: pp autoclavable 10 ml , pcr rack with cover (pack of 6) , pcr tubes (0.2 ml) (pack of 1000) , pcr tubes box for 0.2 ml , petri plates 100 mm (pack of 12) , pipette tips 0.2 10 ?l(pack of 1000) , pipette tips200 1000 ?l(pack of 500) , pipette tips2 200 ?l (pack of 1000) , plastic pots , polygrid test tube stand , rack for micro tube , test tube basket with cover 180x170x160 , tip box for 200 1000 ?l(pack of 10) , tip box for 5000 ?l (pack of 2) , tip box of 2 200 ?l (pack of 10) , utility tray, material: pp autoclavable; 320x260x100 , utility tray, material: pp autoclavable; 320x260x70 , utility tray, material: pp autoclavable; 360x310x130 , wash bottle new type (750 ml) , wash bottles plastic, 250ml; , wash bottles plastic, 500ml; , other items : , 1kg gross aluminium silver kitchen foil roll paper , 3 step interlocking micro tube rack (24x0.2 ml,14x0.5 ml and 12x1.5 ml tubes) (pack of 6) , autoclavable bags (pack of 100) , casting tray , cheese cloth , comb set (pack of 2) , conical centrifuge tube rack (pack of 4) , cryo cube box , cryo tags , cryocan ba 11 liquid nitrogen container (20l capacity) , cryo cube box1.8ml (pack of 8) , falcon tubes (15 ml) (pack of 500) , falcon tubes (50 ml) (pack of 500) , hand protector grip , hands on™ nitrile examination gloves , hijama surgical blades size 11 , liquid nitrogen flask , magnetic stirrer bar (round) 8x30 mm (pack of 10) , magnetic stirrer bar (round) 8x50 mm (pack of 10) , microcentrifuge tubes box for 1.5 ml(pack of 4) , microchattaway spatula , mortar and pestle (suitable for crushing of plant sample in liquid nitrogen) , multipurpose labelling tape , nitrile gloves powder free large , nitrile gloves powder free medium , non absorbent cotton , nylon membrane filter , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , one end flate and one end spoon, spatula , parafilm tape (size in inches 4 x 125) , pcr rack with cover; 96 well , pipette rack horizontal , pointer spatula (6) , purple nitrile gloves (medium size) , qualitative filter paper grade 1: 11um 150 mm 100/pk , quartz cuvette; capasity; 1.0 ml;190 nm to 2500nm , quartz cuvette; capasity; 3.5 ml;190 nm to 2500nm , romino® silicone heat resistant cooking pinch mitts , round magnetic stirrer bar 8x30 mm , round magnetic stirrer bar 8x50 mm , spatula; 200mm , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, blunt end , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , stainless steel forceps, pointed , sterial scalpel blade no.22 , syringe filter 4 mm, 0.2 micron (sterile) 100/pack , syringe filter holder, pc (reusable), 13 mm , test tube stand 12 tubes(pack of 4) , tissue roll , tough tags , vertical gel casting system, 18 x 18 cm (glass plates dimension) , whatman® qualitative filter paper, grade 2 , out sourcingservicingitems : , mrna sequencing , small rna/ micro rna sequencing , sequencing of pcr products...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Jawaharlal Nehru Medical College - Rajasthan

33551774 supply of micro lab items kits chemical reagent glassware 1 microbiology lab reagents / kits / chemical / glassware / polyware etc items year 2022 24 2 10% lactic acid solution 3 aerosol free tips 10 μl 4 aerosol free tips 20 μl 5 aerosol free tips 100 μl 6 aerosol free tips 200 μl 7 aerosol free tips 1000 μl ( 1x96 ) 8 agar agar media 9 agininine 10 albert stain a 125ml 11 albert stain b 125 ml 12 albert’s metachromatic stains kit 125 ml 13 alkaline peptone 14 aluminium foil 15 amikacin dose 30mcg 16 amino acid disc 17 amoxyclav 20 / 10mcg 18 ampicillin 10mcg 19 ampicillin / sulbactam 10 / 10mcg 20 ascospore agar 500 gm 21 autoclavable specimen bag ( yellow and red color beg ) 22x30 22 aztreonam 30mcg 23 azithromycin 15mcg 24 bacitracin 10 units 25 bhi supplemented w / 0.05% sps 20ml 26 bhi supplemented w / 0.05% sps 70ml 27 bile esculin hivegtm agar base / 100 gm / 500gm 28 bird seed agar 100 gm 29 bromocresol purple blue 500 gm 30 buffered glucose hivegtm broth 500gm 31 buffer hiveg tm peptone water 32 carbenicillin 100mcg 33 carbogen rpr 34 cefepime 30mcg 35 cefixime 10mcg 36 cefoperazone 75mcg 37 cefoperazone / sulbactam 75 / 10mcg 38 cefotaxime 30mcg 39 cefoxitin 30mcg. 40 cefoxitin cloxacillin 30 / 200 mcg. 41 ceftazidime 30 mcg 42 ceftazidime / clavulanic acid 30 / 10 mcg 43 ceftriaxone 30 mcg 44 cefuroxime 30 mcg 45 cephalothin 30mcg 46 chloramphenicol 30mcg 47 chocolate agar plate 1x50 48 ciprofloxacin 30mcg. 49 cled agar powder 50 cled agar w / browothymol blue plate 1x50 51 clindamycin 2mcg 52 colistin sulphate10mcg 53 cooked meat medium 54 corn meal agar 500gm 55 co trimoxazole 25mcg. 56 cryotubes ( 1.8 ml ) 57 cysteine tellurite agar base 500 gm 58 czapexdox agar ( granulated ) 500gm 59 dengue ns1 ( elisa ) 1x96 60 dengue igm ( elisa ) 1x96 61 deoxycholate citrate agar, hivegtm 500gm 62 dermato supplement 5vl 63 dermatophyte test media 500gm 64 dimethyl amino benzaldehyde anhydrous 100gm 65 dises for carbohydrate fermentation test dises 66 disposable loops carbohydrate 5x100 67 disposable wire 5x100 68 doxycycline hydrochloride 30mcg 69 erythromycin 15mcg 70 ethanol 500ml 71 filter paper rim 46 x 57 cm 72 ferric chloride 1x500 gm 73 fluconazole 25mcg. 74 gentamicin 10mcg 75 gentamicin disc 120 mcg. 76 grams stain kit 100 ml 77 hand sanitizer 500 ml ( pump / spray ) 78 haemoglobin powder 50 gm, 79 h2 o2 ( hydrogen peroxide ( 3% ) 500 ml ) 80 hbsag hbs ag 81 hcv tridot 1x100 82 hiv combaids rs advantage 1x96 83 hiv tridot 84 hi culture transport swab w / amies medium w / charcoal 85 hi mrsa tm confirmation agar base 500 gm 86 hydrochloric acid 87 imipenem 10 mcg 88 imipenem etda 10 / 750mcg 89 iodine resembled 500 gm 90 iso amyl alcohol 91 isopropyl alcohol 500 ml 92 lysine 100 gm 93 maccartney bottle screw tight 30 ml 94 macconkey agar 500 gm 95 malachite green powder 500 gm 96 malt extract agar base 500 gm 97 mannitol salt hiveg tm agar base 100 / 500gm 98 mc farland standard set 10 ml 99 medium 10 wilson and blairs bbs agar 100 meropenem 10mcg 101 methanol 500ml 102 microcentrifuge tube ( 1.5 ml ) 103 microscopic cover glass 22x50mm 10gm no. 01 104 micro cover glass square 20mm x 20 mm 105 micro slide 75 mm x 25mm ( 1x50 ) 106 micropipette variable volume range 100 1000ul 107 micropipette variable volume range 5 50ul 108 molecular grade ethanol 109 mr vp hiveg tm medium 2x100 110 nitrate discs 111 iso propyl alcohol 112 screw cap vial 2 ml 113 microcentrifuge tubes 1.5 ml 114 glass slide 115 spirit 500ml 116 pcr plates compatable to biorad cfx96 with sealing film 1x50 117 8 well strips 0.1 mlwith caps 1x120 118 tissue paper rolls 119 kiwipes lint free tissue paper 120 pipette variable volume 0.5 10μl 121 pipette variable volume 1 20μl 122 pipette variable volume 10 100μl 123 pipette variable volume 100 1000μl 124 multi channel pipette 8 channel 5μl 50μl 125 multi channel pipette 8 channel 30 μl 300μl 126 multi channel pipette 8 channel 100μl 1250μl 127 reagent trough v shape for multi channel pipette 128 viral transport media with swab 129 rt pcr kit swine flu ( h1n1 ) 130 reagent trough v shape for multi channel 100 131 moeller decor boxy lase hiveg broth base 132 mueller hinton hivegtm agar no. 2 500gm 133 nafcillin 30mcg 134 nutrient agar 500gm 135 nutrient broth 500 gm 136 nutrient hivegtm agar no. 02 500gm 137 of basal media 138 onpg 150 mcg 139 optochin ( 5mcg ) 140 ornithine 141 oxacillin 1mcg 142 oxacillin sodium salt monohydrate 5gm 143 parafilm m250 144 penicillin g 10 units disc 145 phenylanine agar 100gm 146 phenol red base 147 piperacillin / tazobactam30 / 6mcg 148 pipette tips, yellow 250 ml 149 plain vials 100 pc 150 polymyxin –b 100 unit 151 potassium hydroxide pallets 152 potassium dichromate 15x500 gm 500gm 153 potassium tillurite 1% ( 1ml / v ) 25 vials 5 / 25 ml 154 potassium dihydrogen phosphate anhydrous 155 potato dextrose agar 500 gm 156 polyester wipes 1x50 157 rhelax aslo 1x100 158 rhelax crp 1x100 159 rhelax rf 1x100 160 roberston cooked meat media 500gm 161 sabouraud dextrose agar 500 gm 162 sabouraud dextrose agar with chloramphenicol 500gm 163 sabouraud dextrose agar with chloramphenicol & cyclohexamide 100gm 164 sabouraud dextrose broth 500 gm 165 screw cap tubes with ‘o’ ring 166 scrub typhus igm ( elisa ) 1x96 167 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 168 selenite f broth ( t ) 169 sheep blood agar plate 1x50 170 spirit lamp 171 simmons critrate agar 100gm 172 sodium hypochlorite 4% 5lts. 173 sodium hypochlorite 5% 5lts. 174 sterile disposable petri plates 120 mm 175 sterile disposable petri plates 90 mm 176 sterile micro tube 2 ml with looped screw 177 sterile screw cap 10 ml 178 straight wire 179 syringe driven filter mse 180 stool o / b 181 sulphuric acid conc 500 ml 182 swab applicator in tube, plastic ( sterilized ) 5 or 6 individual pack 183 swab applicator plastic ( sterilized ) 6 individual pack 184 tcbs hiveg tm agar ( selective ) 500 gm 185 teicoplanin 30mcg 186 thermo rolls pack 187 tigecycline 15ml g 188 tissue paper rolls 189 tobramycine 10 ml g 190 triple sugar iron hivegtm agar 100gm 191 upt ( device / card ) test 1x100 192 urea hiveg tm agar 100 gm 193 urine / stool sample collection container made with nontoxic polypropylene. cap. 35ml. with screw cap. air tight 194 vancomycin 30mcg 195 vitamino growth supplements 5 vials 196 voriconazole vrc 25 ugm mlg 1x100 197 widal slide / tube 1x100 198 96 well microplate 1x50 199 96 well microplate certified to contain 0.005 eu / ml 1x100 200 xld hiveg tm agar 500 gm 201 xylene sulphur free 250 ml 202 zn stain solution 100 ml / 500 ml 203 platelia aspergillus ag ( bio rad ) 204 fungitell1, 3 beta d glucan ( fungitell kit ) 205 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

District Hospital - Rajasthan

33545252 supply of kits, chemical, reagents, glassware items 1 m1 10% lactic acid solution 2 m2 aerosol free tips 10 pl 3 m3 aerosol free tips 20 pl 4 m4 aerosol free tips 100 pl 5 ms aerosol free tips 200 pl 6 m6 aerosol free tips 1000 pl ( 1x96 ) 7 m7 agar agar media 8 m8. agininine albert stain a 125m1 9 m9 10 m10 albert stain 8 125 ml 11 m11 alberts metachromatic stains kit 12s ml 12 mu alkaline peptone 13 m13 aluminium foil 14 m14 amikacin dose 30mcg 15 m15 amino acid disc 16 m16 amoxyclav 20 / 10mcg 17 m17 ampicillin 10mcg 18 m18 ampicillin / sulbactam 10 / 10mcg 19 m19 ascospore agar soo gm 20 m20 autoclavable specimen bag ( yellow and red color bag; 22x30* 21 m21 aztreonam 30mcg 22 m22 azithromycln 15mcg 23 m23 bacitracin 10 units 24 m24 bill supplemented w / 0.05% sps 20m1 25 m25 bill supplemented w / 0.05% sps 70m1 26 m26 bile esculin hivegtm agar base / 100 gm / 500gm 27 m27 bird seed agar 100 gm 28 m28 bromocreso! purple blue soo gm 29 m29 buffered glucose hivegtm broth 500gm 30 m30 buffer hiveg tm peptone water 31 m31 ca rbenicillin 100mcg 32 m32 ca rbogen rpr 33 m33 cefepime 30mcg 34 m34 cefixime l0mcg 35 m35 cefoperazone 75mcg 36 m36 cefoperazone / sulbactam 75 / 10mcg 37 m37 ccfotaxime 30mcg 38 m38 cefoxitin 3omcg. 39 m39 cefoxitin cloxacillin 30 / 200 mcg. 40 m40 ceftazidime 30 mcg 41 m41 ceftazidime / clavulanic acid 30 / 10 mcg 42 ceftriaxone 30 mcg v. i. , 43 m43 cefuroxime 30 mcg 44 m44 ce halothm 30mc 45 m45 chloramphenicol 30mcg 46 m46 chocolate agar plate 1x50 47 m47 ciprofloxacin 30mcg 48 ma cled agar powder 49 m49 cled agar w / browothymol blue plate imo 50 m50 clindamycin 2mcg 51 m51 colistin sulphatelomcg 52 m52 cooked meat medium 53 m53 corn meal agar 500gm 54 m54 co trimoxazole 25mcg. 55 m55 cryotubes ( l8 ml ) 56 m56 cysceine tellurite agar base 500 gm 57 m57 czapexdox agar ( granulated ) 500gni 58 m58 dengue ns1 ( elisa ) 1x96 59 m59 dengue igm ( ehsa ) 1x96 60 m60 deoxycholate citrate agar, ilivegtm 500gm 61 m61 dermato supplement svl 62 m62 dermatophyte test media 500gm 63 m63 dimethyl amino benzaldehyde anhydrous 100gm 64 m64 dises for carbohydrate fermentation test dises 65 m65 disposable loops carbohydrate 5x100 66 m66 disposable wire 5x100 67 m67 doxycycline hydrochloride 30mcg 68 m68 erythromycin 15incit 69 m69 ethanol 500m1 70 m70 filter paper rim 46 x 57 cm 71 m71 ferric chloride lx500 gm 72 m72 fluconazole 25mcg. 73 m73 gentamicin 10mcg 74 m74 gentamicin disc 120 mcg. 75 m75 grams stain kr 100 ml 76 m76 hand sanitizer 500 ml ( pump / spray ) 77 m77 haemoglobin powder 50 gin, 78 m78 h2 02 ( hydrogen peroxide ( 3% ) 500 ml ) 79 m79 hbsag hbs ag 80 m80 hcv tridot 1x100 81 m81 hiv combalds rs advantage 1x96 82 m82 hiv tridot 83 m83 hi culture transport swab w / amies medium w / charcoal 84 m84 hi mrsa tm confirmation agar base 500 gm 85 m85 hydrochloric acid 86 m86 lmipenem 10 mcg 87 m87 imipenem vida 10 / 750mcg 88 m88 iodine resembled 500 gm 89 m89 iso amyl alcohol 90 m90 isopropyl alcohol soo ml 91 m91 lysine 100 gm a_ 92 m92 maccartney bottle screw tight 30 ml 93 m93 mact:onkey agar sod gm 94 m94 malachite green powder 500 gm 95 m95 malt extract agar base 500 gm 96 m96 mannitol salt hiveg tm agar base 100 / 500gm 97 m97 mc farland standard set 10 ml 98 m98 medium 10 wilson and b ] alrs bbs agar 99 m99 meropenem lonicg 100 m100 methanol 500m1 101 m101 microcentrifuge tube ( 1.5 ml ) 102 m102 microscopic cover glass 22x5omm 10gm no. 01 103 m103 micro cover glass square 20mm x 20 mm 104 m104 micro slide 75 mm x 25mni ( i x50 ) 105 m105 micropipette variable volume range 100 1000u1 106 m106 micropipette variable volume range 5 50u1 107 m107 molecular grade ethanol 108 m108 mr vp hiveg tm medium 2x100 109 m109 nitrate discs 110 m110 !so propyl alcohol 111 m111 screw cap vial 2 ml 112 m112 microcentrifuge tubes 1s ml, 113 m113 glass slide 114 m114 spirit 500m1 115 m115 pcr plates compatable to blorad cfx96 with sealing bin 1x50 116 m116 8 well strips 0.1 ml with caps 1x120 117 m217 tissue paper rolls 118 m118 kiwipes lint free tissue paper 119 m119 pipette variable volume 0.5 104 120 m120 pipette variable volume 1 204 121 m121 pipette variable volume 10 1000, 122 m122 pipette variable volume 100.10004 multi channel pipette 8 channel 54 5011 123 m123 124 m124 multi channel pipette 8 channel 30 4 300pl 125 m125 multi channel pipette 8 channel 100pl 12504 126 m126 reagent trough v shape for multi channel pipette 127 m127 viral transport media with swab 12.8 m128 rt pcr kit swine flu ( 111n1 ) 129 m129 reagent trough v shape for multi channel 100 130 m130 moeller decor boxy lase hiveg broth base 131 m131 mueller hinton ilivegtm agar no. 2 500gm 132 m132 nafcillin 30mcg 133 m133 nutrient agar 500gm 134 m134 nutrient broth 500 gm 135 m135 nutrient ilivegtm agar no.02 500gm 136 m136 of basal media 137 m137 onpg 150 mcg 138 m138 optochin ( 5mcg ) 139 m139 ornithine 140 m140 oxacillin lmcg 141 m241 oxacillin sodium salt monohydrate 5gm 142 m142 parafilm m250 143 m143 penicillin 0 10 units disc 144 m144 phenylanine agar 100gm phenol red base 145 m145 146 m146 piperacillin / tazobactam30 / 6mcg 147 m147 pipette tips, yellow 250 ml 148 m148 plain vials 100 pc 149 m149 polymyxin 13100 unit 150 m150 potassium hydroxide pallets 151 m151 potassium dichromate 15x500 gm 500gm 152 m152 potassium tillurite 1% ( 1mi / v ) 25 vials 5 / 25 ml 153 m1.53 potassium dihydropen phosphate anhydrous 154 m154 potato dextrose agar 500 gm 155 1 m155 polyester wipes lx50 156 m156 rhelax a51.0 lx1 00 157 m157 rhelax crp lx100 158 m158 rhelax rf lx100 159 m159 roberston cooked meat media 500gm 160 m160 sabouraud dextrose agar 500 gm 161 m161 sabouraud dextrose agar with chloramphenico! 500gm 162 m162 sabouraud dextrose agar with chloramphenicoi 84. cyclohexamide 100gm 163 m163 sabouraud dextrose broth 500 gm 164 m164 screw cap tubes with 0 ring 165 m165 scrub typhus 1gm ( elisa ) 1x96 166 m166 selective agar, improved ( twin pack ) salmonella shigella selective agar, improved ( twin pack ) 167 m167 selenite f broth ( t ) 168 m168 sheep blood agar plate lx50 169 m169 spirit lamp 170 m170 simmons critrate agar 100gm 171 m171 sodium hypochlorite 4% slts. 172 m177 sodium hypochlorite 5% 5lts. 173 m173 sterile disposable petri plates 120 mm 174 m174 sterile disposable petri plates 90 mm 175 m175 sterile micro tube 2 ml with looped screw 176 m176 sterile screw cap 10 ml 177 m177 straight wire 178 m178 syringe driven filter mse 179 m179 stool 0 / 13 180 m180 sulphuric acid conc 500 ml 181 m181 swab applicator in tube. plastic ( sterilized ) 5 or 6 individual pack 182 m182 swab applicator plastic ( sterilized ) 6 individual pack 183 m183 tcbs hiveg tm agar ( selective ) 500 gm 184 m184 teicoplan in 30mcg thernto roll pack 185 m185 186 m186 tigecycline 15ml g 187 m187 tissue paper rolls 188 _ m188 tobramycine 10 ml g , 189 m189 triple sugar iron hivegtm agar 100gm 190 m190 upt ( device / card ) test lx100 191 m191 urea hiveg tm agar 100 gm 192 m192 urine / stool sample collection container made with nontoxic polypropylene. cap. 35m1. with screw cap. air tight 193 194 m193 va neomycin 30mcg m194 vitamino growth supplements 5 vials 195 m195 voriconazole vrc 25 ugm mig 1x100 widal slide / tube lx100 196 m196 197 1 m197 96 well microplate 1x50 198 m198 m199 96 well microplate certified to contain 0.005 eu / ml 1x100 199 xld hiveg tm agar 500 gm 200 m200 xylene sulphur free 250 ml 201 m201 zn stain solution 100 ml / 500 ml 202 m202 platelia aspergillus ag ( bio kad ) 203 n1203 fungite111, 3 beta u glucan ( fungitell kit ) 204 m204 cryptococcal antigen latex aggulation kit ( meridian bioscience europe ) ...

National Institute Of Ayurveda - Rajasthan

33123875 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux / bd ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux / bd ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500gm , amikacin ( himedia / sigma / biomerieux / bd ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux / bd ) 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux / bd ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux / bd ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux / bd ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux / bd ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux / bd ) 50 ml , cefipime ( himedia / sigma / biomerieux / bd ) 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) 1 vial , cefoxiti ( himedia / sigma / biomerieux / bd ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux / bd ) 1 vial , citrate agar ( himedia / sigma / biomerieux / bd ) 500gm , cled agar ( himedia / sigma / biomerieux / bd ) 500gm , clindamycin ( himedia / sigma / biomerieux / bd ) 1 vial , colistin ( himedia / sigma / biomerieux / bd ) 1 vial , coplin jar ( himedia / sigma / biomerieux / bd ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux / bd ) 1 vial , cotton roll ( himedia / sigma / biomerieux / bd ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux / bd ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux / bd ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux / bd ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux / bd ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux / bd ) 5 litr , doxycline ( himedia / sigma / biomerieux / bd ) 1 vial , dpx mount ( himedia / sigma / biomerieux / bd ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux / bd ) 125 ml , erythromycin ( himedia / sigma / biomerieux / bd ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux / bd ) 500 gm , forceps ( himedia / sigma / biomerieux / bd ) 1 pc , fosfomycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) 1 strip , giemsa stain ( himedia / sigma / biomerieux / bd ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux / bd ) 5 litr , glass slides ( himedia / sigma / biomerieux / bd ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux / bd ) 500 ml , grams iodine ( himedia / sigma / biomerieux / bd ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux / bd ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux / bd ) 500 ml , imipenem ( himedia / sigma / biomerieux / bd ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux / bd ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux / bd ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux / bd ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux / bd ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux / bd ) 500 ml , levofloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , linezolid ( himedia / sigma / biomerieux / bd ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux / bd ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) 1 holder , methanol ( himedia / sigma / biomerieux / bd ) 500 ml , methylene blue ( himedia / sigma / biomerieux / bd ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux / bd ) 125 ml , mrvp media ( himedia / sigma / biomerieux / bd ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux / bd ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux / bd ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux / bd ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux / bd ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux / bd ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux / bd ) 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , novabiocin ( himedia / sigma / biomerieux / bd ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux / bd ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux / bd ) 500gm , optochin ( himedia / sigma / biomerieux / bd ) 1 vial , oxidase discs ( himedia / sigma / biomerieux / bd ) 1 vial , penicillin g ( himedia / sigma / biomerieux / bd ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux / bd ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux / bd ) 1 vial , piperacillin ( himedia / sigma / biomerieux / bd ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux / bd ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux / bd ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux / bd ) 100ml , ria vials ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux / bd ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux / bd ) 125 ml , sim media ( himedia / sigma / biomerieux / bd ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux / bd ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux / bd ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux / bd ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux / bd ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux / bd ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux / bd ) 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) 1 vial , tobramycin ( himedia / sigma / biomerieux / bd ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) 500gm , urea agar base ( himedia / sigma / biomerieux / bd ) 500gm , urea solution 40% ( himedia / sigma / biomerieux / bd ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux / bd ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux / bd ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux / bd ) 500 ml , xylene ( himedia / sigma / biomerieux / bd ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Directorate Of Agriculture - Rajasthan

32675099 food testing laboratory sl. no. item description 1 utilities and auxiliary equipment 2 hot air ovan 3 drying ovan 4 analytical balance 5 distilled water plant 6 water bath 7 autoclave 8 microbiological incubator 9 refrigrator 10 deep fridge 11 colony counter 12 laminar flow chamber 13 bunsen burner 14 micro pipette 15 ph meter 16 brix refractometer 17 uv lamp 18 abbe refractometer 19 soxhlet appartaus 20 muffle furnance 21 kjeldal distillation unit 22 glasswares erienmeyer flask 23 conical flask 24 flat bottom flask 25 tlc plates consumbale 26 separating funnel 27 glassbeaker 28 distillation flask 29 burette 30 petri plates consumbale ...

State Agriculture Marketing Board - Rajasthan

32660485 food testing laboratory in gon mandi yard sohela. hot air oven , drying oven analytical balance distiled water plant , water bath autoclave microbio logical incubator , refrigerator , deep fridge , colony counter , laminar flow chamber bunsen burner micro pipette ph meter brix refractometer uv lamp , abbe refractometer , soxhlet apparatus , muffle furnance , kjeldal distilation unit , erlenmeyer flask , conical flask , flat bottom flask , tlc plates , separating funnel , glass beaker distillation flask , burette petri plates ...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

National Institute Of Ayurveda - Rajasthan

31740943 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Medical And Health Services - Rajasthan

31519266 supply of consumable reagent and glassware 1 acetic acid glacial a.r. 2 acetonitrile a.r. 3 acetone a.r. 4 amyl alcohol a.r. 11 calcium chloride fused a.r. 12 chloroform a.r. 14 copper acetate a.r. 15 copper sulphate a.r. 16 carbon tetra chloride a.r. 17 carbon di sulphide a.r. 19 d glucose (dextrose) a.r. 20 di methyl amino benzeldehyde a.r. 21 diethyl ether a.r. 22 di phenylamine a.r. 23 di phenyl carbazide a.r. 27 formaldehyde a.r. 28 furfural a.r. 29 ferric chloride a.r. 30 fehling a a.r. 31 fehling b a.r. 32 glycerol a.r. 33 hexane a.r. 34 hydrochloric acid a.r. 35 hexamethylene tetramine a.r. 36 hydrazine a.r. iodine mono chloride ampule a.r. 37 iodine crystal a.r. 38 lso propanol a.r. 41 liquid parafin light a.r. 42 lead acetate a.r. 43 liquor ammonia a.r. 44 methonal a.r. 45 nitric acid a.r. 46 ninhydrin a.r. 47 n butanol a.r. 49 petroleum ether(40 60) petroleum ether(g0 80) a.r. 52 potassium chromate a:r. 53 potassium dichromate a.r. 55 potassium hydroxide pellets pure a.r. 56 potassium iodide a.r. 59 potassium sulphate a.r. 61 peraphenylene diamine a.r. 64 pera di methyl amino benzeldehyde a.r. 65 phloroglucinol a.r. 68 phenol a.r. 70 rosalie acid a.r. 71 resorcinol a.r. 72 silver nitrate pure a.r. 73 sodium carbonate anhydrous a.r. 74 sodium bi carbonate anhydrous a.r. 75 sodium hydroxide flakes a.r. 77 sodium thie sulphate a.r. 78 stannous chloride a.r. 79 starch a.r. 80 sucrose pure a.r. 81 sulphur powder a.r. 82 sulphuric acid a.r. 83 sodium chloride a.r. 84 sodium hypo chloride a.r. 85 toluene a.r. 86 tartaric acid a.r. 87 trichloroacetic acid a.r. 88 tri sodium citrate a.r. 89 urea a.r. 90 vita a.r. 91 wijs solution (iodine mono chloride) in a.r. 92 zinc chloride a.r. 93 cobaltus chloride a.r. 94 ampule 0.ln oxalic acid a.r. /c 95 ampule 0.ln sodium hydroxide a.r. 96 ampule 0.1n sodium thiosulphate a.r. 97 ampule0.ln hydrochloric acid a.r. 98 aluminum oxide (active) neutral a.r. 99 glass wool colours 1 indigo carmine 2 brillant blue a.r./l.r. 3 fast green a.r./l.r. 4 rohdamine b a.r./l.r. 5 metanil yellow a.r./l.r. 6 di methyl yellow a.r./l.r. 7 metanil .yellow a.r./l.r. 8 am.aranth a.r./l.r. 9 caramel a.r./l.r. a.r./l.r. indicators 1 bromocresol green ph indicator 2 eriochrome black t metal (ph) indicator a.r./l.r. 3 bromophenol a.r./l.r. 4 bromothymol blue a.r./l.r. 5 methyl orange indicator a.r./l.r. 6 methylene blue (indicator) a.r./l.r. 7 murexide a.r./l.r. 8 phenol red (indicator) a.r./l.r. 9 phenolphthalein indicator a.r./l.r. 10 methyl red indicator a.r./l.r. glasswar es s.no. particular 1 volumetric flask (class a) with stoper size 1000 ml 2 volumetric flask (class a) with stoper 500ml 3 volumetric flask (class a) with stoper lo0ml 4 volumetric flask (class a) with stoper 250 ml 5 volumetric flask (reciver) rm ll0ml 6 volumetric flask (class a) with stoper 50 ml 7 measuring cylinder (class a) 500ml 8 measuring cylinder (class a) 250ml 9 measuring cylinder (class a) 100ml 10 measuring cylinder (class a) 50ml 11 measuring cylinder (class a) 25ml 12 conical flask lo0ml 13 conical flask 150 ml 14 conical flask 250ml 15 conical flask 500ml 16 conical flask 1000 ml 17 pipette (graduate) (class a) 50ml 18 pipette (graduate) (class a) 25 ml 19 pipette (graduate) (class a) l0ml 20 pipette ( graduate ) (class a) 5 ml 21 pipette (graduate) (class a) 2 ml 22 pipette (graduate) (class a) lml 23 pipette (graduate) (class a) 0.1 ml 24 pipette ( volumetric ) (class a) 100 ml 25 pipette ( volumetric ) (class a) 50ml 26 pipette (volumetric) (class a) 25 ml 27 pipette (volumetric) (class a) l0ml 28 burette (class a) with stand & clamp 50ml 29 butyrometer tube (class a) l0ml 30 butyrometer tube (plane) l0ml 31 butyrometer tube stand aluminium 32 tilth with 250 ml bottle lml 33 tilth with 250 ml bottle l0ml 34 butyrometer tube key aluminium 35 butyrometer tube lock stopper (rubber) 36 mojonnier fat extration tube 100 ml 37 both mouth open butyrometer tube (plane) lo0mi 38 beaker 1000 ml 39 beaker 500ml 40 beaker 250ml 41 beaker 100ml 42 beaker 50ml 43 beaker 25 ml l 44 iodine flask with stoper 45 46 iodine flask with stoper condensor tube with joint 1,/ rm set with joint condenser, flat bottom roud flak and steel over head (splash head) with lamp 47 and aluminium stand 48 flat bottom roud flak 49 flat bottom roud flak for rm 50 flat bottom roud flak for nvee oil extraction 51 flat bottom roud flak 52 flat bottom roud flak 53 condenser with joint soxhlet extraction appratus tube complete with joint, flat bottom roud flak and condenser 54 55 voletile oil apparatus (cleavenger) 56 moisture distillation unit (toluene) 57 reagent bottle 58 reagent bottle 59 filter paper whatman no 1 60 filter paper whatman no 40 61 filter paper whatman no 42 62 chromatography paper whatman no 1 sheet 63 crucible 64 tlc plate aluminium 65 tlc plate chamber glass 66 separating funnel 67 separating funnel 68 pipette pump 69 pipette pump 70 pipette bulb (rubber) 71 culture tubes with screw cap 72 test tube round bottom with screw 73 test tube round bottom with screw 74 testtube 12 x 75 75 test tube 18 x 150 76 test tube with joint graduated stopper 77 test tube stand aluminium 78 plastic funnel 79 funnel glass 80 funnel glass 81 thermometer (class a) 82 desicator with cap 30 mm 83 glass beads 84 wash bottle 85 micro slide 500ml 250 ml 1 meter 250ml 100ml 250 ml 250ml 500ml 1000 ml 250ml 500ml 250ml 50ml 250ml s00ml 10ml 50ml 20ml 50ml 30ml 25 ml 70mm 125mm q 1 petri plates ( glass) 90 tripode stand 91 droppi~g bottle glass 92 dropping bottle plastic 93 pipette stand vertlcle 94 pipette stand horizontal 95 morter pastel porcelin 96 durahms tube 97 dropper 98 glass rods 99 glass rods 100 condenser clamp 101 soxhlet clamp 102 toung (ss) 103 testtube holder 104 cover slip 105 mojonier tube 106 memberane filter assembly with pump and filters 107 volumetric pipette 108 nesslers tube 109 capillary tube 110 volumetric flask (plane) with stoper 111 volumetric flask (plane) with stoper 112 volumetric flask (plane) with stoper 113 volumetric flask (plane) with stoper 114 volumetric flask (plane) with stoper 115 volumetric flask (plane) with stoper 116 measuring cylinder(plane) 117 measuring cylinder(plane) 118 measuring cylinder(plane) 119 measuring cylinder(plane) 120 measuring cylinder(plane) 121 pipette ( graduate ) (plane) 122 pipette ( graduate ) (plane) 123 pipette (graduate) (plane) 124 pipette (graduate) (plane) 125 pipette (graduate) (plane) 126 pipette (graduate) (plane) 127 pipette (graduate) (plane) 20ml 12 6 250ml 10.75 50ml 1000 ml 500 ml l00ml 250 ml 110 ml 50 ml 500ml 250ml 100ml 50ml 25ml 50ml 25 ml 10 ml 5 ml 2 ml 1 ml 0.1 ml 128 pipette (volumetric) (plane) 129 pipette ( volumetric ) (plane) 130 pipette (volumetric) (plane) 131 pipette (volumetric) (plane) 132 hand tds mmr 133 hand ph meter 134 column chromr plain gl, stpk 135 suction flask 136 reagent bottle ...

National Institute Of Ayurveda - Rajasthan

30729107 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Shri Karan Narendra Agriculture University - Rajasthan

30683533 open tender for chemicals and glassware 1. i , 2 dichioroethane 2. 1 naphthol ar 3. 2 3 5 tn phenyl tetrazolium chloride ( flc ) 4. 2, 4 d 5. 2, 4 dinitro phenyl hydrazine ( dnph ) 6. 2, 6. dicholorophenol mdophenol 7. 30% hydrogen peroxide ar grade 8. 5 sulphosalicylic acid dihydrate ar 9, absolute alcohol absorbant cotton 10. 11. acetic acid 12. acetic acid glacial ar 13. acetocarmine solutions — 14. acetone — 15. acetone ( hplc grade ) 16. acetone ar ( special grade ) 17. acetone ar grade 18. activated charcoal 19. acid fuchsine 20. acrylamide 21. activated charcoal ar grade 22. agar powder ( bacteriological grade ) 23. almuniumm chloride = 24. aluminium chloride hexahydrate extrapure ar, 99% — 25. aluminium foil — — 26. ammonia buffer solution — 27. ammonia solution sp. gr 0.91 — 28. ammonium acetate ar grade — 29. ammonium chloride — 30. ammoniunn dihydrogen ortho phosphate fermous sulphate ammonium hexahydrates 31. 32. 33. ammoniurn inolytxttearjradee ammonium molybdate tetrahydrate extrapure 34. ammonium oxalate monohydrate 35. 36. ammonium oxilate ugeiulphate ( iya ammonium sulphate 37. 38. anhydrous sodium carbonate 39. anthorne reagent 40, anthrone ar 41. apron coat 42. ascorbate 43. ascorbic acid 44. azoxystrobin 45. 46. azosystrobn + hexaconazole azoxystrobin +tebuconazole 47. bacillus subtilis 48. bap 49. 50, 51. 52. bap solution barium chloride dihydrate barium chloride solution ( 10% ) barium sulphate — 53. beer extract ar grade 54. benomyle 55. bis acrylamide = 56. blitox 50% wp ( coc ) — s7. borex 58. boric acid ( powder ) 59. bovine serum albumin ( bsa ) 60. bromocresol blue indicator 61. bromocresol_green 62. — bromocresol purple sodium salt 63. bromophenol blue ( bpb ) 64. bromothymol blue indicator powder 65. bsa ( bovine serum ) 66. buffer ampule ( set of 6 ) 67. buffer tablet of ph ( 4.0 ) 68. buffer tablet of ph ( 7.0 ) 69. cadmium chloride monohydrate 70. calcium nitrate tetrahydrate 71. calcium carbonate ar grade 72. calcium chloride 99% extra pure — 73. calcium chloride dihydrate 74. calcium sulphate anhydrous 75. calcium sulphate dihydrate 76. captan 77. carbandzim+ mancozcb 78. carboxin 37.5% + thiram 37.5% ( vitavaxepower ) 79. carmine powder 80. castor oil 81. catechol extrapure 99% 82. cedar wood oil medium chloroform ( ethanol stabilized ) 83. 84. chloroform ( hplc grade ) 85. chlorothalonil 86. chiortetracycline hydrochloride 87. citric acid 88. clove oil 89. cobalt chloride hexahydrate ( coci2.6h20 ) 90. cobaltus chloride 91. cobaltus nitrate hexahydrate 92. concentrated sulpburic acid 93. coomassie brilient blue r250 94. copper sulfate pentahydrate ( cuso4.5h20 ) 95. copper sulphate 96. corn meal media 97. cotton blue _, i • flflb%.its 98. cxystal violet ar grade 99. ctab ( cetyl thmethylammonium bromnide ) m 100. czapek”s dox agar 101. d ( + ) ribose 102. darco g 60 ( activated charcoal ) 103. detergent 104. dextrose 105. d fructose a / r 106. di sodium hydrogen arsenate 107. dibasic sodium phosphate 108. diehylene ti i amine penta acetic acid ( dtpa ) ear.grade 109. diethyl ether ar ( stabilised ) 110. diethyline tr amine penta actic acid ( dtpa ) 111. difenconazole 112. dinmethyl sulfoxide ( dmso ) 113. 114. diphenylamine indicator di sodium hydrogen arsenate 115. disodium tetrachloropalladat ( na2pdcl4 ) 116. dntps mix ( 10 mm ) 117. edta ( ethylenediaminetetraacetic acid disodium salt dehydrate ) 118. ethanol hplc grade 119. ethidiumn bromide 120. ethyl alcohol 121. ethyl meihanesulfonate ( ems ) 122. ethylene alcohol 123. ethylene dia minetetraacetic acid jna2 edta ) eucalyptus oil ferric.chloride 124. 125. 126. ferrion indicator 127. ferrous ammonium sulphate ar grade 128. ferrous sulphate ( feso4, 7h20 ) ar 129. ferrous sulphate hypt 130. filter paper sheet i jv. i ituci paper o.iueel? 131. folin & ciocalteus phenol ( fcp ) reagent ar 132. folins uric acid 133. formaldehyde 134. fosetyl al 135. gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) 136. glacial acetic acid 137. glucose ar grade 138. glutamic acid 139. glycerene 140. glycerol 141. glycine 142. gum acacia 143. haxen 144. hexaconazole 145. hexaconazole 4% + zincb 68% 146. hoaglands no. 2 basal salt mixture 147. huwasarn spray ( nanosilver & peroxide ) 148. hydrochloric acid 149. hydrochloric acid 0.5n aq. solution 150. hydrochloric acid lr hydrogen dichloroethan 151. 152. hydrogen peroxide 30% 153. hydrogen peroxide 6% 154. hydroguinone 155. hydroxyl amines ( ha ) 156. hydroxylamine hydrochloride 157. iaa 158. iaa solution 159. iba 160. iba solution 161. iodide crystals 162. iodine ar grade 163. iodine solution 1% w / v 164. iron sulphate iron tartrate isoamyl alcohol 165. 166. 167. isopropanol alcohol 168. kavach ( syngenta ) 169. kh2po4 170. laborine 171. lactic acid ar l ascorbic acid extrapure 172, 173. l glycine ( triglycine ) extrapure, 99% 174. linsecd oil 175. 176. linsced oil cake liquid nitrogen 177. l phenylalanine extrapure chr, 99% 178. l tyrosine for biochemistry 179. magnesium chloride 180. magnesium sulfate heptahydrate ( mgso4, 7h20 ) 181. malt agar 182. malts media 183. mancozeb 184. manganese sulfate monohydrate ( mnso4. h20 ) 185. manganese sulphate 186. manitol ar grade 187. martins mcdia 188. mercapto ethanol 189. mercuric chloride ar 190. metalaxyl m ( ridomil gold ) 191. metaphosphoric acid 192. methanol 193. methanol ( ar grade ) 194. methanol hplc grade 195. methionine 196. methyl blue indicator ar grade 197. methyl methanesulfonale ( mms ) 198. methyl orange indicator 199. methyl red indicator 200. mgcl2 201. molyclean ma 03 phosphate free 202. molysol ‘e’ ar 203. monobasic sodium phosphate 204. myclobutanil 205. n ( 1 naphthyl ) ethylene diamme hcl ( n ned ) 206. n n methylenebisacrylamide 207. n orthophosphoric acid 208. n propanol 209. n / 10 sodium hydroxide 210. na2co3 211. naa 212. naa solution 213. 214. 215. 212. naa solution 216. neem oil 217. nesseller reagent 218. nessler reagent ar grade 219. n hexane 99% ar 220. nicotinic acid 221 . ninhydrin ar ( 99% assay ) 222. nitric acid 223. nitro blue tetrazolium ( nbt ) 224. nutrient agar 225. nutrient agar readymade 226. oat meal media 227. 0 dianisidine methanol 228. orcinol 229. ortho pbosphodic acid 230. oxalic acid 231 . oxaloacetic acid / 232. p nitrophenyl sulphate naci nano2 naoh 233. pacelio uslilacinus 234. paraffin wax 235. pcnb ( pentachloromtrobenzene ) 236. pda readyinade 237. peg 6000 238. 239. peptone ar grade petroleum ether ( 60 1o0°c ) 240. petroleum elher 60 80c 241. phenophthalin indicator 242. phenol phenol crystalline extrapure ar 243. 244. phenol disalfonic acid 245. phenolphthalein indicator power 246. phosphoric acid 247. p nitrophenol phosphate ar grade 248. polyvenylpyrolidase 249. polyvinylpyrolidone ( pvp ) 250. potasium meta bi sulphite 251. potassium dicromnate 252. potassium hydroxide pellets — 253. potassium iodide 254. potassium acetate — 255. potassium chloride 256. potassium chromate ar 257. potassium dichromnate 258. — potassium dihydrogen phosphate 259. potassium femcyanide 260. potassium hydrogen sulphate 261. potassium iodide ( k! ) 262. potassium metabisuiphite 263. potassium oxalate potassium permanganate 264. 265. potassium permanganate ar grade 266. potassium permangnate 267. potassium sulphate 268. potassium titrate 269. potato dextrose brolh 270. pottassium hydroxide 85% ar pottassium nitrate 99% ar — propiconazole ( tilt ) 271. 272. 273. propineb ( antracol ) 70 w% 274. protein ladder marker ( mid range ) — 275. pyridoxine hc1 276. pyrogallol extrapure 277. rapd marker ( molecular markers different_series ) . 278. raxil ( bayer ) 279. resorcinol ar 280. rutin trihydrate pure 99% 281. saffranin 282. salicyclic acid 283. sesame oil 284. silver nitrate 285. sodium chloride 286. sodium acetate anhydrous 287. sodium acetate thhydrate 288. sodium arsanate 289. sodium azide 290. sodium benzoate 291. sodium bicarbonate 292. sodium chloride 293. — sodium chloride ar grade 294. sodium citrate 295. — sodium cobalt nitrite 296. sodium dthydrogen phosphate 297. — sodium dodicyl sulfate 298. sodium hydrogen carbonate ar 299. sodium hydroxide ar grade 300. sodium hydroxide extrapure ar 301. sodium hypochloride 302. sodium molybdate dihydrate ( na2moo42h2o ) 303. sodium nitrite 304. sodium phosphate 305. sodium potassium tartarate tetrahydrate 306. sodium silicate 307. sodium thiosuiphate 308. sodium tungstate dihydrate extrapure ar, _99% 309. stannous chloride dihydrate 310. streptocycline 311. streptomycin sulfate 312. sucrose 313. sulfex 315. suiphosalicylic acid 316. sulphuric acid 317. sulphuric acid 98% ar 318. tag buffer 319. taq polymerase ( su / pl ) 320. tebuconazole 321. temed 322. tergitol np 10 323. thiamine hcl 324. thiobarbituric acid 325. thiophanate methyl 7o% wp 326. toluene 327. total hardness indicator tablets 328. tri chioroacetic acid 329. trichoderma harzianum 330. tricyclozol8%+mancozeb62% 331. triethylamine ( tea ) 332. triphenyl formazan ( ipf ) ar grade 333. trishcl 334. triton x l00 335. universal indicator solution 336. v8 agar medium ( vinegar ) 337. vitavax power h2re338. wettable sulfur 339. xylene 340. yeast extract ar grade 341. zinc chloride 342. zinc oxide 343. zinc sulfate tetrahydrate ( znso4.4h20 ) 344. zinc sulphate heptahydrate 1. beaker ( graduated ) 25, 50, 100, 250, 500, 1000 ml capacity 2. bod bottle 125 ml, 300ml 3. reagent bottle reagent 100, 125, 250 ml 4. burettes 5otnl 5. conical flask graduated 50, 100, 150, 250, 500ml 6. conical flask standard ground mouth250, .500_ml 7. cotton ( in gm. ) 8. cover slip ( square ) 22 mm 9. cover slips ( round ) 22 mm 10. digestion flask 100 ml 11. dropping bottle 50 ml 12. dropping bottle 500 ml 13. filter paper ordinaryl2.5 cm ( 100 circle ) 14. filter paper sheet 15. filterpaperwhatmanno. 4112.5 cm ( 100 circles ) 16. funnel 17. glass road 18. glass tubes 19. kejldahl flask l0omi round bottom long nack 20. kejldahl flask 500ml round bottom long nack 21. laboratory tray plastic ordinary 22. measuring cylinder 50, 100, 250 ml capacity 23. measuring cylinder with pour out hexagonal base 1o0mi graduated — 24. measuring cylinder with pour out 25. measuring cylinder with pour out hexagonal base 250ml graduatcd 26. measuring cylinder with pour out hexagonal base 25ml graduated 27. measuring cylinder with pour out hexagonal base 500ml graduated 28. measuring cylinder with pour out hexagonal base soml graduated 29. measuring cylinder with pour out hexagonal base 5ml graduated 30. measuring mugs transparent 500 ml 31. micro pipette adjustable automatic 32. ocular micrometer 10mm with 100 divisions 33. permanent glass slide set of meiosis in plants 34. pemmanent glass slide set of mitosis in plants 35. permanent slide of all parts of root., leaf and_stem 36. _______ permanent slide of anatomy of dicot root 37. permanent slide of anatomy of dicot stem 38. permanent slide of anatomy of lear 39. pemmanent siide of anatomy of monocot.root 40. permanent slide of anatomy of monocot stem 41. pestle_&_mortal 42. petri culture dish 90 160 mm cover diameter 43. petri plates 5cm cover diameter 44. petri plates 10 cm cover diameter 45. petridish 46. pipette 1 ml graduated pipette 10 ml graduated pipette 2 ml graduated pipette 5 ml graduated 47. 48. 49, 50. plain slide 76x26 mm pre cleaned ready.for_use 51. reagent bottle 250rnl amber colour 52. reagent_bottle 500m1 53. reagent bottle 500ml amber colour 54. reagent bottles 125 ml 55. reagent bottlesl00 ml capacity 56. room themmometer in celsius 57. [ thermometer in celsius 58. round bottom flask 250 ml 59. slide storage tox for 25 pieces of slide 60. specimen glass jars ( 1 & 2 ltr. ) 6l stage micrometer ( l”x 3” ) 1 mm, 100 divisions 62. staining jar and rack for 24 pieces of slide 63. test tube 12 x 75 mm 64. test tube 15 x 125 mm test tube 16 x 16 x 16mm 65. 66. test_tube_25 x_100_mm 67. test_tube_25_x.200.mm 68. test tube stand 69. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , flat bottom 70. volumetric flask 100ml with stopper ( size 14 / 23 ) , flat bottom 71. volumetric flask 250m1 with stopper ( size 14 / 23 ) , flat bottom 72. volumetric flask 25ml with stopper ( size_10 / 19 ) , _flat bottom 73. volumetric flask 50ml with stopper ( size 10 / 19 ) , flat bottom 74. wash bottle 500m1 75. watch glass 65 mm dia 76. watch glass 80 mm 77. whatmnan no.40 filter paper 78. graduate pipette 79. graduate pipette 80. graduate pipette 81. graduate pipette 82. filter paper whatman 42 83. m wash bottle 84. test tube stand 85. pipette stand 86. polylab polypropaline test tube stand 87. pipette filler 88. pipette filler 89. pipette filler 90. burette 91. burette stand 92. slides 93. cover slips 94. petri plates 95. inoculation nddle 96. volumetric flask 97. tissue paper roll 98. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity. transperent ) 99. wide mouth reagent bottle, graduated with screw cap ( 500 ml capacity, transperent ) 100. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, transperent ) 101. wide mouth reagent bottle graduated with screw cap ( 2000 ml capacity, transperent ) 102. wide mouth reagent bottle graduated with screw cap ( 250 ml capacity, amber colour ) 103. wide mouth reagent bottle graduated with screw cap ( 500 ml capacity, amber colour ) . 104. wide mouth reagent bottle graduated with screw cap ( 1000 ml capacity, _amber_colour ) 105. round bottom soxhiet flask 250 ml 106. rnd bottom soxhiet flask 500 ml i 107. beaker low form, heavy wall with double capacity scale, 250, 500, 1000 ml 108. brush beaker 109. brush bottle 110. burettes, 100 ml capacity, division 0.1 ill. burette brush 112. quartz crucible with lid, tolerance upto 2000oc 113. crucible holders 114. measuring cylinder with hexagonal base, cap. 5, 10, 25, 50, 100, 250, 500, 1000, 2000 ml. 115. flask volumetric with pp stoper, 20, 25, 50, 100, 200 250, 500, 1000, 2000 ml capasity 116. brush flask 117. test tube stand made of polypropylene & polycarbonate ( 3 tier ) 25 mm x 24 tubes, 25mm x 18, 25mm x 36, 32mm x 12 tubes 118. spatula, stainless steel, one end spoon & one end flat, 125 mm, 200mm, 300mm 119. forceps, straight fine points, 100, 200, 300mm size 120. micropipettes, fully autoclavable, uv, resistance, digital volume setting, .volume_range v vnuttic iauigc 121. 100 1000 ul ( 5 ul increment ) , 500 5000 ul ( 50 ul increment ) 122. funnel 75 mm 123. pipette 1 ml graduated 124. pipette 10 ml graduated 125. pipette 2 ml graduated pipette 5 ml graduated 126. 127. conical flask standard ground mouth 250 ml 128. conical flask standard ground mouth 500 ml 129. absorbant cotton 130. filter paper ordinary 12.5cm ( 100 circle ) 131. filter paper sbeet 132. filter paper whatman no. 41, 12.5 cm ( 100 circles ) 133. filter paper whatman no. 42, 12.5 cm ( 100 circles ) 134. glass road — 135, glass tubes ( 18xl50 ) 136. petriculture dish ( 90 160 mm diam. ) with cover 137. petn plates ( 10cm diam. ) with cover 138. petridish_ ( 9cm ) 139. room thermometer in celsius 140. whatman no. 40 filter paper 12.5 cm ( 100_in_pies ) 141. beaker ( graduated ) 100 ml 142. beaker ( graduated ) 250 ml 143. beaker ( graduated ) 500 ml 144. beaker ( graduated ) 1000 ml 145. bod bottle 125 ml 146. bod bottle 300 ml 147. burettes 50 ml 148. burettes_stand 149. conical flask graduated 50 ml 150. conical flask graduated 25 ml 151. conical flask graduated 100 ml 152. conical flask graduated 250 ml 153. conical flask graduated 500 ml 154. cover slip ( square ) 22 mm 155. digestion flask 100 ml 156. digestion flask 250 ml 157. kejdahl flask 100 ml round bottom long neck 158. kegdahl flask 500 ml round bottom lojnecko 159. laboratory tray ( plastic ) ordinary 160. measuring cylinder 50 ml — 161. measuring cylinder 100 ml 162. measuring cylinder 250 ml measuring cylinder 50 ml 164. measuring cylinder with pour out hexagonal base 500 nil graduated 165. measuring cylinder with pour out hexagonal base 10 ml graduated 166. measuring cylinder with pour out hexagonal base 25 ml graduated 167. measuring cylinder with pour out hexagonal base 50 ml graduated 168. measuring cylinder with pour out hexagonal base 5 ml graduated 169. mortar & pestle 170. porcelain dish 171. reagent bottle 250 ml amber colour 172. reagent bottle 500 ml amber colour a’ ;iel;5 ;g ( i i;i.; 174. soxlet apparatus — 175. volumetric flask 1000 ml with stopper ( size 24 / 29 ) , plate bottom 176. volumetric flask 100 ml with stopper ( size 14 / 23 ) , plate bottom 177. — volumetric flask 500 ml with stopper ( size 14 / 23 ) , plate bottom 1 7q — £1 1 luppel size 1’f / 23 ) , piate bottomm — volumetric flask 250 ml with stopper ( size 14 / 23 ) , plate bottom 179. — volumetric flask 25 ml with stopper ( size 10 / 19 ) , plate bottom 180. volumetric flask 50 ml with stopper ( size 10 / 19 ) , plate botton 181. cuvette 182. hote plate 183. cleaning brush 184. tilt measuring bottle 1 ml 185. —w.. tilt measuring bottle 2 ml 186. tilt measuring bottle 5 ml 187. 188. tilt measuring bottle 10 ml apron coat 189. hand gloves 190. labolene 191. cavity block 192. tele counter 193. slide box plastic 194. 195. glass slides nematode 196. 178. sieve set 197. non absorbent cotton 198. absorbent cotton 199. round bottom flask 200. round bottom flask 20i. scalpel 202. spint lamp 2o3. trial tag plastic, aluminun 204. trial sticks 205. rubber bands 206. parafihim tape 207. inoculation needle 208. experinental diary 209. steel grip ( 3 meter, 5 meter ) 210. coconut pit ‘345. tissue paper roll etc...

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical And Health Services - Rajasthan

30657894 supply of laboratory reagents kits and other items 2 iiicullure tmansport swahs w / dcy engky neutrul broth 3 allahne saline pcplanc waler ( asi’w ) akernalive thioglyeollate medium ( nih thioglwllate broth ) ( thioglyeollatc broth, ahernaive ) s amies transport medium w / chircoal 6 apr medium m ( triple sugar. h on apr ) columbia blood apr base cooked meat medium ( revised as cooked m medium ) ( r c. medium ) reagan lwe medium hoyle medium base potassium telturite 3 s% ( i ml per vial ) loet!lcr medium base horse serum donor herd gamma irradiated sterile macconkey hli vegt apr wf cv, naci, 0 inj ls%agar s.no. items 1 i i,cuhuretn tranpcel swan wfamies medium (13) 2 llicuhure’ transmwt swan wil)cy lnpky neutralizitig broth 3 allalinc saline pq’ionc waler (aspw) 4 akernatnc thioglycolla*e jimkdpuin (nih nhiooiycollate broth) (thioiplycollate broth, akeriative) s aniies tmansport mediun wi charcoal 6 agar medium m (triple sugar, iron agtir) 7 cokumbia blood agar base j 8 cooled meal medium (revised as cooked m medium) (r c.medium) i 9 reagan lwemedium 10 hoy)e medium base i f 11 potassium tellurite 35%(t ml per vial) i f i f h f h fi 12 loefiler medium base 13 horse serum donoc herd (jamrna irradiated sterile filtered 14 macconkey hiveg agar wi cv,naci, 0003% nr and i5%agar 15 mycoplasma agar base (pplo agar base) 16 mycoplasma enrichment supplement h ii 17 nutrient broth wi 1% pcptone hi fi 18 nutrient agar wi 1% pep(onc iii fi — li i 19 nureni ajar, i 5% 20 peptone watcr 21 ryra7inam.dase apr 22 sckmnle f flrod (twin pack) medium 1 1(in accoedance with ip 20o7) 23 sluarn transporl medium w/o methykiw fliue iih charcoal 24 tellurile blood ajar base 25 ilaemoglobin powder 26 vitanerso growth supplement (twin pack) 27 potassium tellurite 1% (i ml per vial) 28 transport charcoal medium 29 transponl.quidmcdium 3o stuart tmansport medium (tmansport medium. sluarl) 31 tryptic soya agar 32 field’s tiyptic digest broth (tryptic digest broth) 33 tryptone tellurite agar base 34 potassium tellurite 1% (i ml per vial) 3s autoclavable petri plates polycarbonatc, clear, transparent and unbreakable, size 90 mm, diamcter x 1s mm. 36 makarthy tube, aluminium cap wih silicon rubber gasket, flat boitom vol. 20m1, dpm. : r 28x85mn, 1.0. 1.2mm, thick wall 37 wash bottle; capacity soomi 38 metaloop sl 39 sterile cotton swab / ieelcl in 10o ml hwilc ili :lil 41 s;eriswmipu l)i niectani vires si,c 7” 7” 42 lfnc1rvt1m i’lu il 1:i ii 1’l ii el 43 ixilcs. icngcni. li,niimlcm1 ‘iih sgrc cqp mnd l1iiriiig ring. looml 44 seir tle lure ‘iws’e swnh’ 45 mill. i!sbl. — 46 itsul multi ii i:, ii 47 48 49 ii f stes,n inndicatcr 1’are i iivibrjôthi identi(jcatio,i kit i iisalii1rm ib” idcinilication kit ii i: f f i:i 5o iiim(qilityl)4 flmcticmscii ku toe sgimone1ia iii 51 geobacilius ssoemmpl ft 5 anacro i3o s tr nspireni untwcakablc iolycarbonac lli boil. suie 19 ncms z i 3.7cmi z9cms. cajxuciiy: 2.s fu litre. acceswncs requird but not piovided. anserses pack 1.5 litrc (l.eoo2f) 1 no & anacro indieator tablet (t.e065) 53 anaerobic system mark v il’ ri 54 ilisalmoneibtu late,i test kit ili fi 55 mccwtnry bc*tk wi aluminiun cap neutral glass. i l autoclavable fi 56 sterile pure viscose swab ii fi 57 nasco sampling bag ii fi 58 thumb prenn l)espcnsing l)ropmri pasteur pipetics. stcrilc ii toual volune upto 3 m$ avaibble in individual iielile iil pock 59 iestiube nhoutkim.glasscap 3ss2oonrnc3oipia ii r 6o l,alwlcnv ncutrai p11 ii — 7iii dy. ii i | 61 plasticine i lw) mountant (tiw m.crmcopy) i 63 sq potassium ilydroude peliets 64 sq iiydropcn peroiude aolution 3o% w/ (100 volume,) 6s sq charcoal powcr activatcd 250 md 66 sçore strips (25 mnps’wck)) 67 sterule membrane syringe filters au. size 68 lugols lodme 69 grams iodine, siabdized 70 mcthyleine blue (aqueous) 71 safranin 05% w/v 72 grams crystal violet 73 albertva slain a kline concavity slides 8 concaviiies thickness: 3 mm, size 75 x 56 mm 74 alberts stain 13 75 gram’s decolourizer 76 conical flask erlenmeyer cap. 2soml 77 120 mi, capacity glass bottle witi i all(jmjniijt,4 cap 78 felix tube 79 dreyirs tuuber 80 pointed focei’s 6o/4i 81 ...

Shri Karan Narendra Agriculture University - Rajasthan

30409482 open tender for chemicals and glassware 1. 1,2 dichloroethane srl, qualig merck, sigin molichem, ranbaxy, ens, a, genetics, himedia, ranchem 2. 1 naphtholar 2 3 5 tn phenyl tetrazoliumn chloride (tic) 3. 4. 2,4 d 5. 2,4 dinitro phenyl hydrazine (dnph) 6. 2,6, dicholorophenol indophenol 7, 30% hydrogen peroxide ar grade 8. 5 sulphosalicylic acid dihydrate ar 9. absolute alcohol 10. absorbant cotton 11. acetic acid 12. acetic acid glacial ar 13. acetocarmine solutions 14. acetone 15. acetone (hplc grade) 16. acetone ar (special grade) 17. acetone ar grade 18. activated charcoal 19. acid fuchsine 20. acrylarnide 21. activated charcoal ar grade 22. agar powder(bacteriological grade) 23. almuniumn chloride 24. aluminium chloride hexahydrate extrapure ar, 99% 25. aluminium foil 26. ammonia buffer solution 27. ammonia solution sp. gr 0.91 28. ammonium acetate ar grade 29. ammonium chloride 30. ammonium dihydrogen ortho phosphate 72. calcium chloride 99% extra pure 73. calciun chloride dihydrate 74. calciun sulphate anhydrous 75. calcium sulphate dihydrate 76. captan 77. carbandzim+ mancozeb 78. carboxin 37.5% + thiram 37.5% (vitavax_power) 79. carmine powder 80. castor oil 81. catechol extrapure 99% 82. cedar wood oil medium 83. chloroform (ethanol stabilized) 84. chloroform (hplc grade) 85. chlorothalonil 86. chlortetracycline hydrochloride 87. citric acid 88, clove oil 89. — cobalt chloride hexahydrate (coci2.6h20) 90. cotaltus.chloride 91. nitrate hexahydrate 92. concentrated sulphuric acid 93. coomassie brilient blue r250 94. copper sulfate pentahydrate (cuso4.5h20) 95. copper sulphate 96. corm meal media 97. cotton blue 98. ciystal violet ar grade — 99. ctab (cetyl trimethylamxnonium bromide) 100, czapek”s dox_agar 101. d(+)ribose 102. darco g 6() (activated charcoal) detergent 104. dextrose 105. d fructose a/r 106. di sodium hydrogen arsenate — 107. dibasic sodium phosphate 108. diehylene tr i amine penta acetic acid (dtpa) ar grade 109. diethyl ether ar(stabilised) 110. diethyline tn amine penta actic acid (dtpa) hvdrxhloric acid hydruchloric acid 0.5n aq. solution 148. 149. 150. hydrochloric acid lr hydrogen dichioroethan hydrogen peroxide 30% 53. hydrogen peroxide 6% 54. hydroquinone m 55. hydroxyl amines (ha) hydroxylamine hydrochloride 157. iaa 158. iaa solution 159. iba 160. iba_solution 161. iodide crystals 162. iodine ar grade iodine solution 1% w/v iron sulphate 163. 164. 165. iron tartrate 166. isoamyl alcobol isopropanol_alcobol 167. 168. kavach (syngenta) 169. kh2po4 170. laborine 171. lacticacidar 172. l ascorbic acid extrapure 173. l glycine (triglycine) extrapure, 99% 174. linseed oil l phenylalanine extrapure chr, 99% l tyrosine for biochemistry magnesium chloride magnesium sulfate heptahydrate (mgso4. 71120) malt agar malts media mancozeb manganese sulfate munoh ir (mnso4.h20) manganese sulphate 77. 74. linseed oil 75. linseed oil cake 78. 79. 80. 181. 182. 183. 184. 185. 186, manitol ar grade 187. martin’s media 188. mercaptoethanol 233. pacelio uslilacinus 234. paraffin wax 235. pcnb (pentachloronitrobenzene) 236. pda readymade 237. peg 6000 238. peptone ar grade 239. petroleum ether (60 100°c) 240. petroleum ether 60 80c . 0 phenophthalin indicator phenol 241. 242. 243. phenol crystalline extrapure ar 244. phenol disalfonic acid 245. phcnolphthalein indicator power 246. phosphoric acid 247. p nitrophenol phosphate ar grade 248. polyvenylpyrolidase 249. polyvinylpyrolidone (pvp) 250. potasium meta bi sulphite 251. potassium dicromate 252. potassium hydroxide pellets 253. potassium_iodide 254. potassium acetate 255. potassium chloride potassium chromate ar 256. 257. potassium dichromate 258. potassium dihydrogen phosphate 259. potassium ferricyanide 260. potassium hydrogen sulphate 261. potassium iodide (ki) 262. potassium metabisuiphite . potassium_oxalate 263. 264. potassium permanganate 265. potassium permanganate ar grade 266. potassium permangnate 267. potassium sulphate 268. potassium titrate . r potato dextrose broth 269. 270. pottassium hydroxide 85% ar 271. pottassium nitrate 99% ar 272. propiconazole (tilt) 273. propineb (antracol) 70 w% 274. protein ladder marker (mid range) 275. pyridoxine hc1 comp sulphuric acid sulphuric acid 98% ar 319. tag polymnerase (su/pi) 320. tebuconazole 321. temed 322. tergitol np 10 323. thiamine hcl 324. thiobarbituric_acid 325. thiophanate methyl 70% wp 326. toluene 327. total hardness indicator tablets — 328. tri_chloroacetic.acid 329. trichoderma harzianum 330. oncyclozol 8% + mancozeb 62% 331. triethylamine (tea) 332. triphenyl formazan (tpf) ar grade 333. tnishcl 334. triton x 100 335. universal indicator solution 336. v8 agar rnedium(vinegar) 337. vitavax.power 338. wettable_sulfur 339. xylene 34o. yeast extract ar grade 341. zinc chloride 316. 317. 318. taq buffer 342 zinc oxide 341. zinc chloride 342. zinc oxide — 343. zinc sulfate tetrahydrate (znso4.4h20) 344. zinc sulphate heptahydrate table: 2. list of glasswares s.n. glats ares s1 1. beaker (graduated)25, 50,100, 250, 500, 1000 ml capacity b b la 2. bod bottle 125 ml, 300ml 3. reagent bottle reagent 100, 125,250 ml 4. 5. burettes 50ml conical flask graduated 50,100, ugn cn cnnwi0 37. permanent slide of anatomy of dicot s _____ stem ______ 38. penmanent slide of anatomy of leaf 5 39. permanent slide of anatomy of monocot root 5 40. permanent slide of anatomy of monocot stem 5 3 40 50 41. pestle & mortal 42. petri culture dish 90 160 mm cover diameter — 43. petri plates 5cm cover diameter 44. petri plates 10 cm cover diameter 201 101 45. petndish 46. pipette 1 ml graduated 101 47. pipette 10 ml graduated 25 48. pipette 2 ml graduated pipette 5 ml graduated plain slide 76x26 mm pie cleaned ready for use reagent bottle 250ml amber colour reagent bottle 500ml 101 101 49. 50. 10 51. 10 10 52. 53. reagent bottle 500ml anber colour 10 54. reagent bottles 125 nil 10 55. reagent bottlesl00 ml capacity 60. specimen glass jars (1 & 2 hr.) 61. stage micrometer (1”x 3”) 1 mm, 100 divisions 62. staining jar and rack for 24 pieces of slide 63. testtube12xl5mm 64. test tube_15 x_12s mm 65. testtube16x 16xu16mm? 66. test tube 25 x 100 mm 67. test tube 25 x 200 mm 68. test_tube_stand 69. volumetric flask 1000 ml with stopper (size 24/29), flat bottom 7u. volumetric flask l0oml with stopper (size 14/23), flat bottom 71. volumetric flask 250ml with stopper (size 14/23), flat bottom 72. volumetric flask 25ml with stopper (size_10/19),_flat bottom 73. volumetric flask 50inl with stopper 107. 108. beaier low form, heavy wall with double capacity scale, 250, 500, 1000 ml brush beaker 109. brush bottle 110. 111. burettes, 100 ml capacity, division 0.1 burettebrush 112. quartz cnucible with lid, tolerance upto 2000oc 113. crucible holders 114. measuring cylinder with hexagonal base, cap. 5, 10, 25, 50, 100,250, 500, 1000,200o.ml. 115. flask volumetric with pp sloper, 20, 25, 50, 100, 200 250, 500, 1000, 2000 ml capasity 116. brush flask 117. 118. test tube stand made of polypropylene & polycarbonate (3 tier) 25 mm x 24 tubes, 25mm x 18,25mnix36, 32mmrx 12 tubes spatula, stainless steel, one end spoon & one end flat, 125 mm, 200mnmn, 300mm forceps, straight fine points, 100, ‘m1v 1fl(h..... 119. 120. micropipettes, fully autoclavable, uv, resistance, digital volume setting, volume range 121. 100 1000 ul (5 ul increment), 500 5000 ul_(50_ul_increment) 122. funnel 75 mm — 123. pipette 1 ml graduated 124. pipette 10 ml graduated 125. pipette 2 ml graduated — 126. pipette 5 nil graduated 127. conical flask standard ground mouth 250 ml 128. conical flask standard ground mouth 500 ml 129. absorbant cotton 130. filter paper ordinary 12.5 cm (100 circle) — 131. filter paper sbeet 132. filter paper whatman no. 41, 12.5 cm (100 circles) 133. filter paper whatman no. 42, 12.5 cm(loocircles)174. soxlet apparatus 175. volumetric flask 1000 ml with stopper (size 24/29), plate bottom 176. volumetric flask 100 ml with stopper (size 14/23), plate bottom 177. volumetric flask 500 ml with stopper (size 14/23), plate bottom 178. volumetric flask 250 ml with stopper (size 14/23), plate bottom 179. volumetric flask 25 ml with stopper (size 10/19), plate bottom 180. volumetric flask 50 ml with stopper (ie 10/19), plate bottom 181. cuvette 182. hote plate 183. cleaning brush 184. tilt measuring bottle 1 ml 85. tilt mneasuring bottle 2 ml 187. tilt measuring bottle 10 ml 188. apron coat 189, 1 land_gloves 190. labolene 191. cavity block 192. tele counter 193. [ slide box plastic ina i f’i..... _e 194. glass slides 195. nematode counting disc 196. sieve set 197. non absorbent cotton 198. absorbent cotton 199. round bottom flask 200. round bottom flask 201. scalpel 202, pint lamp 203. trial tag plastic, aluminum 204. trial sticks 205. rubber bands 206. parafilim tape 207. inoculation needle 208. experimental diary 209. steel grip(3 meter, 5 meter) 210. coconut pit tissue paper roll etc 10 56. room thermometer in celsius 5 2 57. thermometer in celsius j 58. round bottom flask 250 ml 59. slide storage box for 25 pieces of 10 siide ...

National Institute Of Ayurveda - Rajasthan

30241226 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm...

Department Of Atomic Energy - Rajasthan

28595472 bids are invited for laboratory beakers is:2619 , laboratory flask is 1381 , glass bottles , seperating funnels , volumetric pipettes is1117 , petri plates or dishes , funnel total quantity : 1020...

University of Rajasthan - Rajasthan

27614339 supply of chemical, glassware and plastic ware. conical flask, beaker with spout, micropipette with tips, round botton boiling flask, short neck, interchangeable joint, glass plant tissue culture bottles, micropipette tip box, micropipette tips, trays drying heavy wall, distilling apparatus with friendrichs condenser interchangeable joint and stoopeper, essemtoa; po; deter, omatopm a [ [ aratis, extractors, soxhlet interchangeable joint, funnels angle, watch glasses s line, microscope slides plain ground edges, cover glass square, test tube stand , z shape test tube stand, micro centrifuge tubes , test tube without rim with stand, smart blue plus viewing glasses, polycarbonate safety goggles, ph strips, flask chromatography sprayers, flask chromatography sprayers, petri plates with covers, desssicators, tongs for beakers, petri plates, aluminiumdissection pan with wax, metallic feeding needle cannula, rodent pellet diet, string rod, bottles reagent, graduated with screw cap, glass sochelet extraction apparatus complete, whatman extraction thimbles, retort stand with clamp and boss haed clamp pack, filter funnel buchner, polypropylene in two piece with perforated filter plate in base of top part autoclavable , witeg glass graduated, measuring cylinder graduated class, magnetic stirrer bar, micropipette stand , microscope slide box, glass dropper, microscopic glass slides, plain ground edges, wash bottles, stainless steel forceps, one end flat and one end spoon, utility tray , unbreakable plastic empty hand wash sanitizer spray bottle, test tube basket with cover hijama surgical blades, pruner, funnel, autoclavable bags, spirit lamps, inoculating loops and needles, l shape spreader, petridishes, eppendorff tubes with stand, eppendorff tubes with stand, soxhlet extractino apparatus complete, non absorbent cotton, centrifuge tubes...

University of Rajasthan - Rajasthan

27541417 supply of chemical, glassware and plastic ware. conical flask, beaker with spout, micropipette with tips, round botton boiling flask, short neck, interchangeable joint, glass plant tissue culture bottles, micropipette tip box, micropipette tips, trays drying heavy wall, distilling apparatus with friendrichs condenser interchangeable joint and stoopeper, essemtoa; po; deter, omatopm a [ [ aratis, extractors, soxhlet interchangeable joint, funnels angle, watch glasses s line, microscope slides plain ground edges, cover glass square, test tube stand , z shape test tube stand, micro centrifuge tubes , test tube without rim with stand, smart blue plus viewing glasses, polycarbonate safety goggles, ph strips, flask chromatography sprayers, flask chromatography sprayers, petri plates with covers, desssicators, tongs for beakers, petri plates, aluminiumdissection pan with wax, metallic feeding needle cannula, rodent pellet diet, string rod, bottles reagent, graduated with screw cap, glass sochelet extraction apparatus complete, whatman extraction thimbles, retort stand with clamp and boss haed clamp pack, filter funnel buchner, polypropylene in two piece with perforated filter plate in base of top part autoclavable , witeg glass graduated, measuring cylinder graduated class, magnetic stirrer bar, micropipette stand , microscope slide box, glass dropper, microscopic glass slides, plain ground edges, wash bottles, stainless steel forceps, one end flat and one end spoon, utility tray , unbreakable plastic empty hand wash sanitizer spray bottle, test tube basket with cover hijama surgical blades, pruner, funnel, autoclavable bags, spirit lamps, inoculating loops and needles, l shape spreader, petridishes, eppendorff tubes with stand, eppendorff tubes with stand, soxhlet extractino apparatus complete, non absorbent cotton, centrifuge tubes...

Bhagwan Mahavir Hospital - Rajasthan

27414824 supply of medical items 1 auto active 8 enzymatic cleaner (srs) 2 abg cassettes (b lac) (25 nos.) 3 ro sponge 30cmx30cm 12ply (tulip) 4 bowie & dick test (srs) 5 mgp paper packing roll 100mm x 200mtr. (srs) 6 biopsy needle magnum mn1816 (bard) 7 documentation label steam (srs) 8 formaldehyde solution (fisher scientific) 9 gauze plain 7.5cmx7.5cm 12ply (tulip) 10 gauze than 16 mtr. x 80cm. tulip surgical 11 package monitoring indicator class iv (srs) 12 package monitoring indicator class vi (srs) 13 shoe cover 14 abg gas cylinder 15 biopsy gun (mc 1816) (bard) 16 bms strip steam (srs) 17 mgp paper packing roll 300mm x 200mtr. (srs) 18 truguide coaxial biopsy needle c1816b (bard) 19 acetone 25 ltr. (fisher scientific) 20 bandage 6 (14cm. x 4.5 mtr.) (tulip) 21 face mask 3 ply 22 gloves sterile 7.5 primecare p/f 23 gloves sterile 7½ truskin 24 handshield rub 500ml pink (microgen) 25 micro cover glass 22x50 no 0 blue ribbon 26 ro gauze 10cmx10cm 12 ply (tulip) 27 skin prep chg+ipa 500ml 2% (3m) 28 xylene 25 ltr. (fisher scientific) 29 anti a blend (10ml) (diagast) 30 anti b (10 ml) (diagast) 31 anti d blend (10ml) (diagast) 32 bandage 4 (9cm. x 4.5 mtr.) (tulip) 33 blood bag 450ml quadruple with sagm (t.penpol) 34 cap disposable (surgeon) (3m) 35 gloves examination medium size (sykacare) 36 gloves non sterile 7½ (truskin) 37 isoflurane 250 ml (abott) 38 microslides (blue ribbon) 72 pc 39 syringe 20 ml 21g (b. braun) 40 vdrl test card biocard syphilis 41 anti abd 3x12ml (tulip) 42 biopsy gun mc 1410 (bard) 43 blood bag 450 ml (triple) with sagm (t. penpol) 44 digital temprature & hygrometer 45 embedding cassettes white colour (imported)(sapsun) 46 ethylene oxide gas cartridge 100gms. (ernix) 47 gastrolek 100ml (lekar) 48 gloves examination medium size (instacare) 49 gloves non sterile 7 (truskin) 50 gloves sterile 8 primecare p/f 51 omnipeque inj 300mg 100ml 52 procalcitonin (pct q) 25 test (thermo 53 tab. anastroz 1mg 54 truguide coaxial biopsy needle c1816a 55 3m surgical paper tape 2 without cutter 56 acd solution 500ml (t.penpol) 57 autoclave tape (srs) 58 blood bag 350 ml (triple) with sagm (t. penpol) 59 cap disposable male 60 cotton 500 gm (tulip) 61 d 256 ( didecyl dimethyl ammonium chloride 8.70% +alkyl diethyl benzyl ammo. cholo. 8.19 62 face mask 3ply (3m) 63 gloves nitrile lavndra (medium) (halyard) 64 gloves non sterile 6½ (truskin) 65 gloves sterile 7 primecare p/f 66 isopropyl alcohol 25 lts (fisher scientific) 67 microshield 4 (747) 500 ml (schulke) 68 microshield pvp (727) 500 ml (schulke) 69 microsteril 500ml blue (microgen) 70 nitric acid 500ml (fisher scientific) 71 paraffin wax (fisher scientific) 72 povidone iodine solution 10% (handshield) 500ml (microgen) 73 sevoflurane (sevorane) 250ml (abott) 74 synthes® maintenance spray 400ml (05.001.098) 75 trima kit (terumo penpol 80300) 76 urine culture vial 50ml 77 3m surgical paper tape 3 without cutter 78 blood lancet (naulakha) 100 nos. 79 cap disposable female 80 di sodium hydrogen orthophosphate anhydrous 500gms. (fisher scientific) 81 gloves gammex 7 (ansell) 82 gloves gammex 7.5 (ansell) 83 gloves microptic encore 7.5 (ansell) 84 gloves nitrile lavndra (small) (halyard) 85 gloves sterile 6½ 86 grams stain kit hi media (k 0001) 125ml 87 hbsag card j mitra 88 hydrogen peroxide 400 ml (kaytee) 89 jamshedi needle 11g 90 mgp paper packing roll 150mm x 200mtr. (srs) 91 microgen d 125 1ltr. 92 sd code free gluco strips (100 strips) 93 soda lime mx50050 5 ltr. (drager) 94 sodium di hydrogen phosphate (di hydrate crystal pure) fisher 500gms. 95 surgical blade 15 (surgeon) 96 top & bottom bag inline filter bag 450 ml 97 zn acid fast stain kit (hi media) (a001) 125ml 98 dpx mountant 250 ml (fisher scientific) 99 ecg paper rim schiller at 2 100 embedding cassettes yellow colour 101 eosin yellow staining powder (water 102 gloves examination small size (sykacare) 103 glutaraldehide monitor strip (r&w) 104 hbsag elisa (96 test) labsystem 105 hcv elisa (96 test) labsystem 106 hiv elisa (96 test) labsystem 107 petri plates autoclable 90mm (sapsun) 108 sheep blood agar plate 1301 109 sodium hypochlorite 4% 5 ltr. (fisher 110 spinal needle 20g bd 111 surgical blade 22 (surgeon) 112 tab. zutam 20mg 113 transfer bag 300ml (t.penpol) 114 veneport 22g single way romsons 115 x ray film 14 x 17 (50 sheet) green base (kodak) 116 1292e attest rapid eur 3 hr. r.o. steam bio ind sterile 50/box 117 absolute alcohoal 500 ml 118 ambu bag silicon adult 119 appron plastic (jackson) 120 asepti lubricant 121 biopsy gun mc 1616 (bard) 122 digital weighing scale 123 ecg gel 250ml (suja) 124 ecg paper 6108t ( 50mm x 20 mtr) 125 gentlepore 2 without cutter 126 gentlepore 3 without cutter 127 giemsas stain solution 100ml (fisher scientific) 128 gloves nitrile lavndra (large) (halyard) 129 gloves protecto (romsons) 130 gloves sterile 6.5 primecare p/f 131 glutihyde 2.45% 5 ltr. (raman & well) 132 hcv card (j mitra) 133 hiv tridot card (j mitra) 134 leishman stain solution 250ml (fisher 135 methanol 2.5 ltr. (fisher scientific) 136 scalp vein set 20 (romsons) 137 sono jelly 250 ml 138 stethoscope microtone 139 surgical blade 11 (surgeon) 140 surgical blade 20 (surgeon) 141 syringe 5 ml (b.braun) 142 tips blue 1000 tips (sapsun) 143 tips white 1000 tips (sapsun) 144 aliquotis 145 barbour linen thread 40 146 barbour linen thread 60 147 biological indicator steam (srs) 148 clinieupore 2 with cutter 149 clinieupore 3 with cutter 150 cuvettes for hemocue hb301 151 documentation label eo 152 dressing scissor 6 s/b straight 153 flask 1 ltr. 154 gloves examination large size (sykacare) 155 gloves sterile 7 (truskin) 156 harmonic handpiece 220 v (hpblue) 157 hbsag elisa 96 test (meril) 158 hcv elisa 96 test (meril) 159 hiv elisa 96 test (meril) 160 laryngoscope with 4 blade 161 macconkey agar 500gms. (hi media) 162 malaria strip (pv/pf) meriscreen (meril) 163 mgp paper packing roll 200mm x 200mtr. (srs) 164 mgp paper packing roll 350mm x 200 mtr. (srs) 165 monarch 1153 label gun ink 166 nutrient agar 500gms. (hi media) 167 paraffin liquid 400 ml (allied) 168 potassium alum 500 gms. (fisher scientific) 169 reticulocytes 25ml (biolab) 170 ro sponge 40cmx40 8ply (tulip) 171 stylet set of 3 anaesthetics 172 suture needle cutting 11 (sab.) 173 syringe 10ml (b.braun) 174 syringe 5 ml (dispovan) 175 typbar 2.5ml multidose 176 visipaque 270mg 100ml 177 anti a (10ml) tulip 178 anti b (10ml) tulip 179 anti d (10ml) igm tulip 180 anti h lectin 5ml (tulip) 181 bab cock 6 ( iskon ) 182 bactorub pink handrub 500ml (raman & 183 barbour linen thread 20 184 biopsy gun (mc1825) (bard) 185 bms strip eto 186 bowl steel small regular 187 c t injector syringe 200ml (b) high pressure t connecting 188 cap disposable romsons (female) 189 chiba needle 22g x 20cm (cn 2220) 190 chiba needle 22g x 25cm (cn 2020) 191 cled agar himedia mv792 500gms. 192 clinieupore 1 with cutter 193 cuscos speculam medium 194 cyto brush 195 elastic adhesive bandage 10cm 3m 196 elastic adhesive bandage 8cm 3m 197 esr pipettes (unique) 198 filter paper 11cm (whatman) 199 formalin tab 200 gloves examination large size (instacare) 201 gloves examination small size (instacare) 202 gloves microptic encore 8 (ansell) 203 gloves sterile 7 (truskin) 204 gold (iii) chloride trihydrate 1gm 205 hbsag card test (meril) 206 hcv tredro card test (meril) 207 hiv quadro card test (meril) 208 hydrochloric acid 500ml (fisher scientific) 209 kidney tray medium 210 kiran 5 hanger mounted wall rack 211 laryngoscope with 2 blade 212 magnum needle bard 1410 213 malaria strip (pv/pf) biocard 214 maygrauwald stain solution 125ml (loba) 215 merbromin solution (400 ml) 216 microscope lense 100x labomed 217 microscope lense 40x labomed make 218 mouth piece for ndd spirometer 219 nibp cuff 220 pa coliform kit 221 patients id bands orange colour with 222 pregnancy strip (one step) 223 renovate plus instrument cleaner (srs) 224 spinal needle 22g bd 225 steple removal 226 suture needle cutting 10 (sab.) 227 suture needle rb 14 (sab.) 228 syringe 10 ml (dispovan) 229 syringe 200ml stellant (medrad) 230 test tube without cap plastic (1x500) (sapsun) 231 tourniquet cuff small 232 vascular forceps 10 (iskon) 233 vdrl test card meril syphilis 234 10 lead ecg patient cable bpl 235 1294 attest rapid readout eo bio ind sterile 236 adson non tooth forcep 5 237 alies forcep 8 (iskon) 238 ambu bag silicon child 239 ammonia solution 25% 500ml (fisher 240 anti human globulin 10ml tulip 241 artery forcep 6 curved 242 atr forceps de bakey 2mm 20cm (kls martin) 243 atr forceps de bakey 2mm 25cm (kls martin) 244 att af02 legend f2 (b 1) 2.4mm stem 245 b.p. handle no.4 246 bab cock 7 (iskon) 247 bacillol spray bottle (250ml) (raman & well) 248 barbour linen thread no. 100 249 benzoin tincture 400 ml 250 blood bag penta pack 450ml with sagm 251 bowl steel large regular 252 bp bulb silicon 253 calibration cassettes src level 3 (opti) 254 carmine staining powder 5gms. (fisher 255 castrovejo calipers 256 chart paper for sanyo refrigerator 2 6 d. 257 citrosterle 5 ltr. (fresenius) 258 clinieupore 1 without cutter 259 coupling jar plastic 260 curved artery 6.5 261 curved artery full sarated f 10 (iskon) 262 curved artery full sarated f 8 (iskon) 263 curved mosquito 5 (iskon0) 264 cuscos speculam large 265 dca media (deoxycholate citrate agar) hi media 266 deionized water 5 ltr 267 dfm 100 ecg paper roll 268 diasafe plus filter 269 disecting forcep 6 270 disposable biopsy forcep with spike for broncho fb 231d 271 disposable blanket for patient warmer 272 diss. forceps, adson 1x2 t. 15cm (kls martin) 273 dissecting forceps plain 6 274 dissecting forceps toothed 6 275 double sided kiran lead appron 0.50/0.25mmpb 276 doynes mouth geg. medium. (iskon) 277 dressing drum 9 x 11 (ss 304 grade) 278 dressing forceps adson 15cm (kls martin) 279 dressing scissor 8 straight 280 ecg clip 281 embedding cassettes red colour (sapsun) 282 face mask 3 ply (jackson) 283 fan for blood gas analyzer 284 fergusen mouth geg medium (iskon) 285 forceps overholt mini 15cm (kls martin) 286 forceps overholt mini 20cm (kls martin) 287 frame of stethoscope 288 gafchromic rtqa2 1010p film 289 gafchromic rtqa2 1417 film 290 gigasept opa 5 ltr. (schulke) 291 gigly saw handle. medium. (iskon) 292 gloves gammex 6.5 (ansell) 293 gloves microptic encore 6.5 (ansell) 294 gloves nitrile powder free n30 (small) 295 halfround plate ( laproscopy system karl stroz ) 296 harmonic ace laparoscopic shears 36cm har36 297 harmonic focus shears 9cm length har9f 298 harmonic probe ace 36e ( johnson ) 299 harmonic probe focus 17f ( johnson ) 300 harmonic probe focus 9f ( johnson ) 301 harmonic probe har17f 302 height scale 303 hemospot 304 hub cutter (crystal care) 305 hydrocholoric acid 1000ml 306 ice box container 307 infrared thermometer with lcd display 308 insulated metel outer tube with luer lock connector size 5 mm length 36cm (karl 309 jamshedi needle 13g 310 kidney tray small 311 kiran 3 hanger mounted wall rack 312 lead appron 0.5mm (kiran) 100 x 60cm 313 lens tissue holding forcep 6 (iskon) 314 lens tissue holding forcep 7.5 (iskon) 315 lobolene 5 ltr. (fisher scientific) 316 lugol iodine 5% 317 machanical stage for vision 2000 318 machintosh sheet 319 magills forcep adult 320 magnum needle bard 1825 321 malleable retractors (iskon) 322 me acetonitrile 500ml emparta (1.07031.0521) 323 me ammonium acetate emparta 500gms. (1.93217.0521) 324 me ph indicator paper ph 1.0 14.0 (6177060001) 325 me sodium hydroxide pellets emparta 500gms. (1.93102) 326 me water for chromatography 1 ltr. (6176501000) 327 mega soft universal (0845) with megasoft 328 mgp paper packing roll 250mm x 200mtr. (srs) 329 micro cover glass 18x18 no 0 blue ribbon 330 microbar hd powder 300gms. 331 micropipette fixed volume 1000ul 332 mosquito artery forceps 5 curved 333 mosquito artery forceps curved armour 334 nebulizer oxymed hepa 335 needle holder 6 336 needle holder 7 337 needle holder 8 (iskon) 338 needle holder 9 (iskon) 339 nibp cuff adult large size 340 nontooth adson forceps 5 (iskon) 341 nst red forceps ang bl 1,0 mm 20cm ( kls martin ) 342 nst red forceps bay downw b 0,1 mm 23cm ( kls martin ) 343 nst red forceps bay str bl 0,6 mm 23cm ( kls martin ) 344 nst red forceps str bl 1,0 mm 20cm ( kls martin ) 345 oxygen sensor for ventillator ( philips ) 346 perforated tray 12,15 (iskon0 347 perforator cutter (medtronic) 348 periostem elevator blunt . medium. (iskon) 349 peristaltic pump for blood gas anlyzer 350 proctoscope adult 351 punch biopsy forcep armour 352 r control board endoflator ( karl stroz ) 353 r pressure manifold with high pressure ( karl stroz ) 354 rubber ring ( laproscopy system karl stroz ) 355 seal bonnet 50/2.6 ( laproscopy system karl stroz ) 1 x 10 pcs set 356 sealing cap for trocars size 11mm 60/10 ( laproscopy system kal stroz ) 1 x 10 pcs 357 silicon face mask no. 1 358 silver nitrate 25gms. (fisher scientific) 359 skin hook 4 no (iskon) 360 sodium di hydrogen phosphate (di hydrate 361 spo2 extension cable 362 sponge holder 10 (iskon) 363 sponge holder forcep 8 364 ss hammer with fibber handle 700gms. 365 sterile hi culture collecting device 150mm x 366 straight faspators medium.(iskon) 367 straight mosquito 5 (iskon0 368 surgical blade 10 369 surgical blade 23 (surgeon) 370 suture cutting scissor 371 suture needle cutting 12 (sab.) 372 suture needle rb 12 (sab.) 373 syringe 2 ml (b. braun) 374 syringe knob 375 tc dissecting scissors curved 17.5cm (kls 376 tc dissecting scissors curved 23cm (kls 377 tc dissecting scissors curved 28.5cm (kls 378 tc dress.forceps potts smith 20cm (kls 379 tc dress.forceps potts smith 25cm (kls martin) 380 tc dressing forceps adson 15cm (kls martin) 381 tc forceps micro adson 1x2 t 15cm (kls martin) 382 tc needle holder de bakey 23cm (kls martin) 383 tc needle holder de bakey 31cm (kls martin) 384 tc needle holder hegar 20cm (kls martin) 385 tc needle holder mayo hegar 24cm (kls martin) 386 test tube without rim 12x75m glass 387 thermal paper roll 55 mm 388 tips yellow (sapsun) 389 tool 14ba30 legend 14cm 3mm ba (medtronic) 390 tool 14mh30 legend 14cm 3mm (medtronic) 391 tool 9ba30 legend 9cm 3mm ba (medtronic) 392 tool 9ba30d legend 9cm 3mm ba diam (medtronic) 393 tool 9ba40 legend 9cm 4mm ba fluted (medtronic) 394 tool f2/8ta23 legend 8cm 2.3mm taper (medtronic) 395 tooth adson forceps 5 (iskon) 396 tourniquet cuff large 397 towel clip 5 (iskon) 398 transpore 1 (3m) 399 urinal pot 400 vascular forceps 7 (iskon) 401 vascular forceps 8 (iskon) 402 x ray developer 13.5 ltr (premier) 403 xld agar m031f 100gram 404 yaunkers suction canula .medium. (iskon) 405 dry imaging film 10x12 (150 sheets} 406 dry imaging film 14x17 (100 sheets) 407 dry imaging film 8x10 (150 sheets)...

Sms Medical College - Rajasthan

26754831 supply of disposable and glassware items for microbiology department autoclavable petridish , disposable latex gloves , sterile disposable petri plate , polystyrene optically clear , disposable sterile swab sticks individual packed , disposable sterile swab sticks with test tubes individual packed ,plastic trays , syringe needle sterile disposable, sterile disposable test tube with screw cap and label sample , disposable sterile containers wide mouth with screw caped individually packed for sputum , urine without spoon self standing with conical bottom , disposable micropipette tips yellow blue , sterile disposable test tube with screw cap and label , cover slips , glass slides , test tube glass ,etc ...

Medical College - Rajasthan

26745232 supply of disposable and glassware for microbiology department 1 autoclavable petridish 90mm x15mm ( 4 ) ( sample required ) 2 disposable latex gloves ( non sterile in pack of 25 to 50 pairs ) size 6.5 3 disposable latex gloves ( non sterile in pack of 25 to 50 pairs ) size 7 4 disposable latex gloves ( non sterile in pack of 25 to 50 pairs ) size 7.5 5 sterile disposable petri plate, polystyrene optically clear size 90mm dia x 15mm ( 4 ) individually packed sample required 6 disposable sterile swab sticks individual packed size ( 150 mmx 12mm ) sample required 7 disposable sterile swab sticks wth test tubes individual packed size ( 150 mmx 12mm ) sample required 8 plastic trays 1 ½’ x1 ½’x 6” 9 syringe needle sterile disposable 2ml 10 sterile disposable test tube with screw cap and label sample required 10ml 11 disposable sterile containers wide mouth with screw caped individually packed ( for sputum, urine ) without spoon 30 ml self standing with conical bottom sample required, steriled by gamma radiation 12 disposable micropipette tips yellow ( 10 200μl ) 13 disposable micropipette tips blue ( 100 1000μl ) 14 sterile disposable test tube with screw cap & label 5 ml 15 cover slips –small ( 22 x 22 mm, no. 1, 10 gm each pack made of borosilicate glass 16 glass slides dimension app. 75x26mmoptically flat polishededges, lint free packuy thickness ± 0. 1mm 17 test tube glass round bottom 18x150mm 18 test tube glass round bottom 15x125mm 19 test tube glass round bottom 12x100mm...

Shri Karan Narendra Agriculture University - Rajasthan

26744195 open tender for chemical and glassware. 1,2 dichlorethane, acetic acid glacial, acetone, acetone ar, acryclamide, ammonia chloride hexahydrate extrapure ar, ammonia buffer solution, ammonium sulphate, barium chloride, beef extract, boric acid, bsa, buffer ampule, calcium sulphate anhydraus, cobaltus chloride, copper standard, detergent, dextrose, ethanol, dmso, dried nacl, dtpa solution, ethidium bromide, ferrion indicator, ferrous sulphate, folins uric acid, gallic acid, glycine, hydraulic acid, iba solution, iron sulphate, labolene, lactic acid, lead standard, manganese sulphate, methanol for hplc, methionine, potassium iodide, chlorite, oxalate, potassium sulphate, rose bengal, rutin, sodium acetate, siilver nitrate, sodium bicarbonate, sodium citrate, sodium hydroxide, sulpghuric acid, tolene, trichioracetic acid, tris, universal indicator solution, urea, yeast, zinc chloride, zinc sulphate, beaker, bod bottle, conical flask, cover slip, digestion flask, dropping bottle, filter paper ordinary, filter paper sheet, heat resistant gloves, glass tubes, measuring cylinder with pour out hexagonal base, pestle and mortal, petri culture dish, petri plate, plain side, porcelain dish, specimen glass jars, soxhlet apparatus, test tube, test tube stand, volumetric flask, watch glass, whatman no 40 filter paper ...

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Sms Medical College - Rajasthan

26575794 purchase of consumable and kits for mdru lab ( cat no 9 ) i pipe tissue extraction kit 2 rt pcr kit for egfr mutation 3 pcr tube 0.2 ml ( dnase, rnase & pyrogen free ) 4 pcr cap 0.2 mi ( dnase, rnase & pyrogen free ) 5 1p19q probe 6 sheep blood agar plate 7 mac conkey agar plates 8 anaerobic blood agar plate 9 sterile cotton swab stick with tube ( polypropylene tube, cotton bud w / polypropylene stick ) individually packed. size 150mm in 12 mm diameter tube 10 gram staining kit contains a. grams crystal voilet b. grams decolourizer c. grams iodine d. safranin 0.5% or basic fuchsin 0.1% w / v 11 thioglycollate broth ( dehydrated ) 12 straight wire 13 metal loop holder 14 sterile disposable petri plates polystyrene, size 90mm diameter x 15 mm individually:packed 15 autoclavable test tube, size 150mm x 25mm 16 test tube stand ( 12places for 25 mm ) 17 nitrite examination gloves large size, non•owdered 18 n 95 mask ( without valve ) 19 disposable triple layer mask 20 hand sanitiier 21 black pen marker permanent 22 a 4 size rim 23 ball pen • 24 gn test vtk 2 25 gp test vtk 2 26 yst test kit vtk 2 27 anc test kit 28 ast n280 29 ast n281 l; ii 30 ast p628 31 ast sto3 test kit 32 130 gas pak ez anaerobic anaerobic atmosphere generator with anaerobic indicators 33 edta vacutainers _...

Sms Medical College - Rajasthan

26262163 supply of disposable and glassware for microbiology department ( nit 186 ) 1. autoclavable petridish 90mm xl5mm ( 4 ) ( sampte required ) 2. disposable latex gloves ( non sterile in pack of 25 to 50 pairs ) size 6.5 3. disposable latex gloves ( non sterile in pack of 25 to 50 pars ) size 7 4. disposable latex gloves ( non sterile in pack of 25 to 50 pairs ) size 7, 5 sterile disposable petri plate, polystyrene optically clear size 90mm dia x 15mm ( 414 ) individually packed sample required 6, disposable sterile swab sticks individual packed size ( 150 mmx 12mm ) sample required 7, disposable sterile swab sticks vvth test tubes individual packed size ( 150 mmx 12mm ) sample required 8, plastic trays 1 w x1 wx 6 9. syringe needle sterile disposable 2m! 10 . sterile disposable test tube with screw cap and label sample required 10m1 11. disposable sterile containers wide mouth with screw caped individually packed ( for sputum, urine ) without spoon 30 ml self standing with conical bottom sample required, steriled by gamma radiation 12. disposable micropipette tips yellow ( 10 200p1 ) 13 . disposable micropipette tips blue ( 100 1000p1 ) 14. sterile disposable test tube with screw cap & label 5 ml glassware items is cover slips —small ( 22 x 22 mm, no. 1, 10 gm each pack made of borosilicate lass 16. glass slides dimension app. 75x26mmoptically flat polishededges, lint free packuy thickness ± o. lmm 17. test tube glass round bottom 18x150mm 18 . test tube glass round bottom 15x125mm 1 9. test tube glass round bottom 12x100mm...

Medical College - Rajasthan

26246788 supply of disposable and glassware for microbiology department 1 autoclavable petridish 90mm x15mm(4)(sample required) 2 disposable latex gloves (non sterile in pack of 25 to 50 pairs) size 6.5 3 disposable latex gloves (non sterile in pack of 25 to 50 pairs) size 7 4 disposable latex gloves (non sterile in pack of 25 to 50 pairs) size 7.5 5 sterile disposable petri plate, polystyrene optically clear size 90mm dia x 15mm (4) individually packed sample required 6 disposable sterile swab sticks individual packed size(150 mmx 12mm) sample required 7 disposable sterile swab sticks wth test tubes individual packed size (150 mmx 12mm) sample required 8 plastic trays 1 ½’ x1 ½’x 6” 9 syringe needle sterile disposable 2ml 10 sterile disposable test tube with screw cap and label sample required 10ml 11 disposable sterile containers wide mouth with screw caped individually packed (for sputum, urine) without spoon 30 ml self standing with conical bottom sample required, steriled by gamma radiation 12 disposable micropipette tips yellow (10 200µl) 13 disposable micropipette tips blue (100 1000µl) 14 sterile disposable test tube with screw cap & label 5 ml 15 cover slips –small (22 x 22 mm, no. 1, 10 gm each pack made of borosilicate glass 16 glass slides dimension app. 75x26mmoptically flat polishededges, lint free packuy thickness ± 0. 1mm 17 test tube glass round bottom 18x150mm 18 test tube glass round bottom 15x125mm 19 test tube glass round bottom 12x100mm ...

Government Medical College - Rajasthan

25696328 supply of chemical test kits , reagents , media and glass ware items for microbiology 2 acetamide 3 acetic acid glacial 4 acetone ar 5 acridine orange 6 aerogas pack ( accessories for anaerobic system ) 7 albert stain –kit 8 ammonia 9 ammonium oxalate ar 10 andrade indicator 11 aniline 12 b. sterothermophilus spore strips 13 basic fuchsin 14 benzamide 15 calcofluor white m2r 16 carbamide 17 carbol fuchsin 18 catalase peroxidase kit for mycobacterium 19 catalase test kit for mycobacterium 20 catechol 21 cedar wood oil 22 charcoal powder 23 chlorazole black e 24 chromotrope zr 25 conc. hydrochloric acid ar 26 conc. sulphuric acid ar 27 coper ii chloride dihydrate 28 crystal violet 29 cycloheximide ( actidione ) 30 cynogen bromide 31 deionised water ( dw ) 32 di sodium hydrogen phosphate anhydrous 33 dpx mount 34 edta ar 35 eosin 2% 36 ethyl acetate ar 37 ethyl alcohol 38 fast green 39 ferric chloride ar 40 field stain a 41 field stain b 42 formaldehide 43 formalin tablets 44 formamide 45 gelatin 46 giemsa stain 47 glycerol ar 48 hcl 30% 49 hydrogen peroxide 30% ar 50 iodine crystals ar 51 iso amyl alcohol 52 koh 53 kovac indole reagent 54 lactophenol cotton blue 55 leishman stain 56 light green sf 57 liquid paraffin heavy 58 liquid paraffin light 59 loeffler methylene blue 60 lugol iodine 61 malachite gtreen 1% w / v 62 mangnese sulphate ar 63 mercurous chloride ( mgcl2 ) 64 methyl alcohol 65 methyl red indicator 66 methylated sprit 67 methylene blue pure 68 n.n. dimethyl formamide 69 neutral red 70 niacin detection kit w / syringe k047 kt 71 niacin strip 72 nigrosine 73 nitrate reduction test kit for mycobacterium 74 normal saline 75 omeara reagent 76 p nitrobenzoic acid 77 paraffin wax 78 periodic acid schiff ( pas ) 79 ph paper 0 – 13 80 phenol crystals ar 81 phenol red certified 82 phosphotungestic acid 83 polyivinyl alcohal a cold water soluble 84 b hot water soluble 85 potassium di hydrogen phosphate anhydrous 86 potassium dichromate ar 87 potassium iodide ar 88 potassium nitrate 89 potassium permangnate – ar 90 pyrazinamidase test kit for mycobacterium 91 pyrazinamide 92 saffranine crystal 93 schaeffer & fulton’s spore stain kit 94 schiffs fuchsin sulph reagent 95 sodium acetate 96 sodium chloride ar 97 sodium dihydrogen phosphate 98 sodium hydroxide – ar 99 sodium hypochlorite 4% 100 sodium hypochlorite 10% 101 sodium polyanetholsulphonate ( sps ) 102 sodium taurocholate 103 sulphanilic acid ar 104 sulphuric acid 105 teepol 106 tetramethyl p phenylene diamine dihydrochloride ( oxidase reagent ) 107 thiomersmal 108 thiophene carboxylic hybrazide test kit mycobacterium 109 toluidine blue 110 tripotassium phenophthlin di sulphate 111 twine 80 112 urea powder ar 113 xylene ar 114 zinc dust 115 zinc sulphate heptahydrate 116 ? nephthol ar 117 ? nephthylamine ar 118 antibiotic sensitivity disc 119 amikacin ( 30μg ) 120 amoxicillin + clavulanic acid ( 20 / 10μg ) 121 ampicillin ( 10 μg ) 122 ampicillin + sulbactam ( 10 / 10μg ) 123 azithromycin ( 15μg ) 124 aztreonam ( 30μg ) 125 bacitracin ( 10 unit ) 126 carbenicillin ( 100μg ) 127 cefaclor ( 30μg ) 128 cefadroxyl ( 30μg ) 129 cefepime ( 30μg ) 130 cefixime ( 5μg ) 131 cefoperazone ( 75μg ) 132 cefoperazone + sulbactam ( 75μg ) 133 cefotaxime ( 30μg ) 134 cefotaxime / clavulanic acid ( 30 / 10μg ) 135 cefotaxime + sulbactum 136 cefotetan ( 30μg ) 137 cefoxitin ( 30μg ) 138 cefpodoxime ( 10μg ) 139 ceftazidime ( 30μg ) 140 ceftazidime / clavulanic acid ( 30 / 10μg ) 141 ceftizoxime ( 30μg ) 142 ceftriaxone ( 30μg ) 143 cefuroxime ( 30μg ) 144 cephalexin 145 cephalothin ( 30μg ) 146 chloramphenicol ( 30μg ) 147 ciprofloxacin ( 10μg ) 148 clarithromylin 149 clindamycin ( 2μg ) 150 co trimoxazol ( 25μg ) 151 colistin ( 10 mcg ) 152 cefepime + tazobactam ( 30 / 10μg ) 153 cefalexin 30μg 154 cefazolin 30μg 155 cefprozil 30μg 156 cefixime + clavulanic acid ( 5 / 10μg ) 157 ceftrixone + sulbactam 30 / 15μg 158 ceftrixone + tazobactam 30μg 159 doxycyline ( 10μg ) 160 dicloxacilline ( 1μg ) 161 gemifloxacin ( 5μg ) 162 ertapenem ( 10μg ) 163 erythromycin ( 15μg ) 164 furazolidone ( 50μg ) 165 gentamicin ( 10μg ) 166 imipenam ( 10μg ) 167 imipenam + cilastin ( 10 / 10μg ) 168 lincomycin ( 15μg ) 169 levofloxacin ( 5μg ) 170 lincomycin 171 linezolid ( 30μg ) 172 meropenam ( 10μg ) 173 methicillin 174 moxifloxacin ( 5μg ) 175 nalidixic acid ( 30μg ) 176 netilmicin ( 30μg ) 177 nitrofurantoin ( 200μg ) 178 norfloxacin ( 10μg ) 179 novobiocin ( 5μg ) 180 ofloxacin ( 2μg ) 181 onpg 182 optochin ( 5μg ) 183 oxacillin ( 5μg ) 184 piperacillin ( 100μg ) 185 piperacillin +tazobactam ( 100 / 10μg ) 186 polymyxin b ( 10 unit ) 187 polymyxin b ( 300 unit ) 188 pristinomycin ( 15μg ) 189 prulifloxacin ( 5μg ) 190 rifampicin ( 5μg ) 191 roxithromycin ( 30μg ) 192 sisomicin ( 10μg ) 193 tetracycline ( 30μg ) 194 teicoplanin ( 30μg ) 195 tobramycin ( 10μg ) 196 ticarcillin ( 75μg ) 197 ticarcillin + clavulanic acid ( 75 / 10μg ) 198 tigecycline 199 voriconazole ( 1μg ) 200 vancomycin 201 anti fungal 202 fluconazole ( 10μg ) 203 ketoconazole ( 10μg ) 204 itraconazole ( 10μg ) 205 amphotericin b ( 100 unit / disk ) 206 nystatin ( 100 unit / disk ) 207 clotrimazole ( 10μg ) 208 miconazole ( 30μg ) 209 sugar 210 adonitol 211 arabinose 212 cellobiose 213 dextrose 214 dulcitol 215 fructose 216 galactose 217 inositol 218 inulin 219 lactose 220 maltose 221 mannitol 222 mannose 223 melibiose 224 raffinose 225 rhamnose 226 salicin 227 sorbitol 228 sucrose 229 trehalose 230 xylose 231 culture media 232 alkaline peptone water 233 agar powder bacteriological 234 air sampler agar strip n ( a ) tsa agar for toral count sd 235 ( b ) sabourund dextrose agar sb 236 andrade peptone water 237 arginine dihydrolase broth 238 bacttec myco / f lytic 239 bacttec peds plus / f 240 bacttec plus + anaerobic 241 bacttec plus aerobic / f+ 242 bacttec standard 10 aerobic / f 243 bacttec standard 10 aerobic / f 244 balamuths aqueous egg yolk medium 245 bbl mgit tubes 7 ml 246 bcttec lytic / 10anaerobic / f 247 beef extract agar 248 beef extract broth 249 bile esculin agar 250 bile salt agar 251 bird seed agar 252 diphenyl supplement 253 blood agar base 254 boek and dr. bohlavs 255 brain heart infusion broth 256 cary blair medium 257 cetrimide agar 258 cled media 259 congo red agar 260 cooked meat medium ( r.c. medium ) 261 corn meal agar 262 decarboxylase base without amino acids 263 deoxycholate citrate agar 264 dermatophyte test agar base dermato supplement 265 emb agar levine 266 glucose broth 267 glucose phosphate broth 268 hichrome improved salmonella agar 269 hichrome salmonella shigella agar 270 hicrome candida differential agar 271 lactose monohydrate bacteriological grade 272 locke egg serum ( les ) medium 273 loeffler serum medium base 274 lowenstein – jensen media base 275 lysine decarboxylase broth 276 lysine iron agar 277 mac conkey agar 278 mueller hinton agar 279 nnn medium 280 nutrient agar 281 nutrient broth 282 of basal medium 283 ornithine decarboxylase broth 284 peptone bacteriological 285 peptone water 286 phenolphthalein phosphate agar 287 phenyl alanine agar 288 potassium tellurite agar 289 potato dextrose agar 290 rpmi 1640 agar w / mops & 2% glucose w / o sodium carbonet ( twin pack ) 291 sabouraud chloramphenicol agar 292 sabouraud dextrose agar 293 sda with cycloheximide & chloramphenicol 294 selenite f broth twin pack ( medium 11 ) 295 simmons citrate agar 296 sulphide lndole motility ( sim ) medium 297 tcbs agar 298 tetra thionate broth 299 thioglycollate medium fluid 300 thioglycollate agar ( anaerobic ) 301 trichophyton agar 1 302 triple sugar iron agar 303 trypticase soy broth 304 tyi s 33 medium ( trypaticase, yeast ) 305 urea agar base christensen base urea 40% ( 5 ml / vial ) 306 uti chrome agar 307 wilson & blair’s bbs agar medium 9 308 xld agar 309 yeast carbon base agar 310 yeast nitrogen base agar 311 brain heart cc agar 312 c zapek dox agar 313 sabouraud dextrose agar base ( emmons ) 314 general item 315 aluminium foil 316 carbon paper 317 cellophane tap 33x22mm 318 cotton roll ( non absorbent ) 319 cotton roll ( absorbent ) 320 diamond pencil 321 disinfectant solution lysol / labolene 322 disposable bags larg size ( yellow, black, blue, red ) 323 disposable gloves 7 324 disposable gloves 7.5 325 disposable mask 326 dustbin 327 filter paper sheets 328 gauze pads 329 glass marking pencil ( white, blue, red ) 330 hand disinfectants 331 kling films 332 match box 333 nicrome loop wire d 4 ( hendal with 10 loop ) 334 nicrome straight wire ( hendal with 10 wire ) 335 permanent marker pen 336 plastic dropper 337 reagent droping bottels 338 reagent pipetts bulb 339 rubber teats 340 screw capped bottles 100ml 341 self adhesive autoclave tapes 342 self adhesive dry heat la 412 343 slide staining stand 344 soap 345 stainless steel forceps blunt 8inch 346 stainless steel forceps pointed 347 sterile container 35 ml. 348 sterile disposable swab stick with container 349 sterile disposable petri plates 120mm 350 sterile disposable petri plates 150mm 351 sterile scalpal blade no. 20 352 surf ( washing powder ) 353 syringes 2ml, disposable 354 syringes 5ml, disposable 355 syringes 10ml disposable 356 teasing needles 357 test tube holder 358 test tube rack ( 12 holes ) for medium sized tubes 359 thumbpress dropper 360 tissue rolls 361 uncoated micro titre plates ( 96 wells ) 362 hiv 363 vidas hiv duo ultra sensitive ( cat. no. 30117 ) 364 hepatitis 365 vidas anti hav total cat. no. 30312 ) 366 vidas hbs ag ultra cat. no. 30317 ) 367 antigen detection 368 vidas chlamydia ( cat. no. 30101 ) 369 serology 370 vidas h. pylori ig g ( cat. no. 30192 ) 371 vidas rub ig g ii ( cat. no. 30221 ) 372 vidas rub ig m ( cat. no. 30214 ) 373 vidas toxo ig g ii ( cat. no. 30210 ) 374 vidas toxo ig m ( cat. no. 30202 ) 375 serology 376 crp – latex kit ( latex agglutination method ) 377 ra – factor kit ( latex agglutination method ) 378 widal test kit ( a ) tube method 379 ( b ) slide method 380 aslo titre kit ( latex agglutination method ) 381 hbs ag card test ( dipstick method ) 382 rpr test for syphilis 383 m.test 384 antiseras 385 shigella dysenteriae polyvalent 386 shigella flexneri polyvalent 387 shigella boydii polyvalent 388 shigella sonnei polyvalent 389 shigella dysenteriae type i ( shiga ) 390 vibrio cholera : 01 antiserum polyvalent 391 subtype b ( ogawa ) , c ( inaba ) , 0:139 392 salmonella o antiserum polyvalent ( a z & vi ) 393 o factor antiserum 0:2 ( a ) , 0:4 ( b ) , 0:7 ( c1 ) , 0:9 ( d ) , 0:13 ( g ) , vi 394 h factor antiserum h:a, h:b, h:i, h:g, h:m, h:z 395 polyvalent o antiserum for enterotoxigenic strains of e.coli 396 miscellaneous items slide of dog’s brain showing negri bodies. 397 lyophilized culture of standard stain bacteria 398 salmonella typhi 399 salmonella paratyphi a 400 salmonella paratyphi b 401 shigella 402 s. dysenteriae 403 s. flexneri 404 s. boyedii 405 s. sonnie 406 vibrio, classical 407 swine flu laboratory kits 408 1 step real time rt pcr kit for sw h1n1 2009 including cdc validated. primers probes. enzyme mix, nuclease free water, master mix etc.with rt pcr reaction strips with cap for real time pcr kit completes. 409 viral rna extraction kit complete ( qiagen only ) as per cdc protocol of real time rtpcr for detection & characterization to extract sw h1n1version2009 viral rna also. 410 viral tranaport media 411 micro pipettes ( variable ) 0.5 10μl, 412 10 100μl, 413 100 1000μl 414 micro amp fast 48 well tray ( aplied bio system ) 415 powder free gloves medium size 416 powder free gloves large size 417 other items 418 ethanol of anhydrous denaturated biotechnically grade of mw 46.07 compatable for rna extraction of including sw h1n1 ( 2009 ) 419 iso propanol molecular grade 420 water, diacetyle dimethyl chloride, fatty amine oxide, alkyl dimethyl ammonium chloride, edta sodium, ethyl alcohol 421 silverised h2o2 ( h2o2 11% w / v with silver nitrate sol. 0.01 % w / v compatible for fumigation with aerosol generator fogger machine ) 422 liquid soap with dispenser 423 sodium hypochlorite 4 % 424 lysol 5 % 425 hand – sanitizer 426 lonza 427 ecoshield 428 formaline 429 amonia liquid 430 ethanol 431 nuclease eliminators for rna / dnase 432 consumable aerosol free tips 433 0 – 10 ul 434 0 – 100 ul 435 100 – 1000 ul 436 micro centrifuge tube 1.5 ml 437 micro centrifuge tube 1.5 ml 438 autoclavable 20 um thickness, plastic bags for b.m.w. management approval by pollution control board ( yellow& red color with biosafety symbols ) 439 screw cap serum storage vials with “o” rings ( 3 ml capacity ) 440 plastic tubes rack with 96 holes 441 cotton rolls 442 tissue paper rolls absorbent 443 o.h.p. marker pen blue, red, green 444 glass beaker borrosilicate 2000 ml 445 measuring glass cylinder ( rim ) ( 500 ml capacity ) 446 paper a4 size 447 jump suit with head over & shoe cover disposable 448 goggles disposable 449 n – 95 mask 450 glassware 451 petri dish diameter 90mm 452 petri dish diameter 75mm 453 conical flask 2000ml 454 conical flask 1000 ml 455 conical flask 500ml 456 conical flask 250ml 457 dark bottel 250ml 458 conical flask 100ml 459 test tube ( without rim ) 460 10 x 75 x 1.0mm 461 12 x 100 x1.2mm 462 15 x 75 x 1.2mm 463 8 x 100 x 1.0mm 464 mac – cartney bottle 30 ml with aluminum cap 465 mac – cartney bottle 30 ml with black plastic cap 466 glass funnel 4” 467 glass funnel 02’’ 468 glass beaker 500 ml 469 widal tube ( 75x4m ) 470 round bottom 471 conical bottom 472 measuring cylinder 500 ml 473 reagents bottles with dropper rubber teats 125 ml 474 reagents bottles with dropper rubber teats 250 ml 475 durham’s tube 476 micro glass slides ( dimension 75 x 25 mm 1.35 mm thick ) 477 micro cover slip ( small ) ( 22mm square 10 gram each ) 478 glass beaker 1000 ml 479 glass beaker 2000 ml 480 test tube ( with rim ) 18 x 150 x 1.2 mm 481 mac – cartney bottle 100 ml with aluminum cap 482 thermometer mercury 20o to 50o c 483 thermometer mercury 30o to 250o c 484 thermometer mercury 4 0o to 0o c 485 thermometer mercury 20o to 0o c 486 glass rods 10mm x 60cm length 487 glass rods ( for dropping oil on slides ) 488 glass peppette 2 ml 489 glass peppette 5 ml 490 glass peppett 10 ml 491 glass sprit lamp 492 staining jar ( coupling jar horizontal ) 493 oil bottle with glass rods ( canada blossom ) 494 candle jar ( bottle 60 ml 495 kits items 496 elisa kit scrub typhus lgm ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 497 elisa kit_ dengue lgm ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 498 elisa kit dengue ns 1 ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 499 hbsag elisa test kit ( compatible with fully automated transasia elan elisa machine & semi automated transasia elan machine ) 500 anti hcv rapid test ( ) 501 vdrl rapid test ( dip stick ) 502 hiv rapid card ( ) 503 hiv tri dot test ( ) 504 sterile swab stick with tube ( ) 505 sterile specimen container ( plastic transparent 50 ml capacity ) 506 vaccutainer vial plain ( 4 ml capacity ) 507 viral transport media ( ( i ) 1 3 of viral transport media in 8 10 ml tube containing protein stabilizer, antibiotic to discourage bacterial and fungal growth and buffer solution. ( ii ) single sterile sweb with synthetic tip such as polyste of decron and aluminium or plastic shaft with break point ) 508 viral transport media ( i ) 1 3 ml of viral transport media in 8 10 ml tube containing protein stabilizer, antibiotic to discourage bacterial and fungal growth and buffer solution. ( ii ) double sterile swab with synathetic tip such as polyster of dacron and aluminium or plastic shaft with break point. 509 elisa kits / ha test 510 elisa kit toxoplasme lgg 511 elisa kit tosoplasma igm 512 elisa kit rubella igg 513 elisa kit igm 514 elisa kit cytomegalovirus igm 515 elisa kit cytomegalovirus igg 516 elisa kit herpes simplex1 igg 517 elisa kit herpes simplex 1 igm 518 elisa kit herpes simplex2 igm 519 elisa kit herpes simplex2 igg 520 elisa kit brucella igg 521 elisa kit brucella igm 522 elisa kit ttg igm 523 elisa kit chilungunya igm 524 elisa kit hav igm 525 elisa kit hev igm 526 elisa kit japanese encephalitis igm 527 elisa kit rotaa virus antigen 528 tpha ( syphilis ) ...

Government Medical College - Rajasthan

23054639 supply of chemical and reagents for microbiology lab : rate contract for 02 years 1 oxalic acid ( powder ) ( 500 gm ) 2 sodium hypochlorite ( liquid 10% ) solution ( 35 lt ) 3 acetone ( 500 ml ) 4 liquid ammonia ( 500 ml ) 5 absolute alcohol ( 500 ml ) 6 ammonium sulphate ( 500 gm ) 7 glacial acetic acid ( 500 ml ) 8 urea powder ( 500 gm ) 9 paradimethyl amino benzaldehyde ( 100 gm ) 10 ammonium oxalate crystals ( 500 gm ) 11 actidione ( 1 gm ) 12 phenyl crystal ( 500 gm ) 13 ferric ammonium sulphate ( 100 gm ) 14 di sodium hydrogen phosphate ( na2hpo4 ) ( 100 gm ) 15 sodium hydrogen phosphate ( nah2po4 ) ( 100 gm ) 16 sulphuric acid conc. ( 5 lt ) 17 nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) ( 5 gm ) 18 basic carbolfuschin powder ( practical grade ) ( 100 gm ) 19 barium chloride ( 100 gm ) 20 glycerol ( 500 ml ) 21 glucose anhydrous ( 500 gm ) 22 iso amyl alcohol ( 500 ml ) 23 malachite green ( practical grade ) ( 100 gm ) 24 sodium nitrite ( 100 gm ) 25 sulphanililc acid ( 100 gm ) 26 toluidine blue ( 100 gm ) 27 magnesium sulphate ( mgso4.7h2o ) ( 100 gm ) 28 n acetyl l cystine ( 25 gm ) 29 formaldehyde solution 40 % ( 5 lt ) 30 nigrocin ( himedia ) ( 100 gm ) 31 koh pallets ( 500 gm ) 32 naoh pallets ( 500 gm ) 33 concentrated hcl ( 500 ml ) 34 albert’s stain a and b for diphtheria ( staining solution ) ( 100 ml ) 35 brilliant cresyl blue ( 100 ml ) 36 liquid paraffin ( 500 ml ) 37 sodium acetate ( 500 gm ) 38 sodium sulphite ( 500 gm ) 39 sodium carbonate ( 500 gm ) 40 potassium bromide ( 500 gm ) 41 sodium thiosulphate ( 500 gm ) 42 spirit ( 500ml ) 43 poly vinyl alcohol ( 250ml ) 44 ammonium chloride ( 500 gm ) 45 sodium meta bisulphite ( 500 gm ) 46 sodium bicarbonate extra pure ( 500 gm ) 47 crystal violet ( practical grade ) ( 100 gm ) 48 bromothymol blue powder ( 25 gm ) 49 cetylpyridinium chloride ( 100 gm ) 50 alpha naphthylamine ( 100 gm ) 51 sodium deoxycholate ( 100 gm ) 52 magnesium citrate ( 500 gm ) 53 asparagine ( 5 gm ) 54 sodium citrate ( 500 gm ) 55 lactophenol ( cotton blue ) ( 100 ml ) 56 omera reagent / v p reagent ( 100 ml ) 57 potassium tellurite ( 25 gm ) 58 ferric chloride ( 500 gm ) 59 cyanogen bromide ( 100 gm ) 60 andrade’s indicator ( 125 ml ) 61 dimethyl sulphoxide ( dmso ) ( 500 ml ) 62 iodine crystal ( 500 gm ) 63 potassium idodide ( 250 gm ) 64 safarnine ( 100 gm ) 65 neutral red ( 100 gm ) 66 dpx mount ( 250 ml ) 67 paradimethylaminocinnamaldehyde ( 100 gm ) 68 hydrogen peroxide ( h2o2 ) ( 100 ml ) 69 alpha – naphthalamine ( 100 gm ) 70 sodium hippurate ( 100 gm ) 71 alpha – naphthol ( 100 gm ) 72 creatinine ( 100 gm ) 73 l – pyrolidonyl b – nephthalamide ( 50 gm ) 74 gelatin ( 500 gm ) 75 sodium borohydrate ( 100 gm ) 76 cobalt chloride ( 100 gm ) 77 agarrose with high eeo ( 100 gm ) 78 dextrose anhydrous ( 500 gm ) 79 lactose ( 500 gm ) 80 maltose ( 500 gm ) 81 mannitol ( 500 gm ) 82 dulcitol ( 500 gm ) 83 sucrose ( 500 gm ) 84 xylose ( 500 gm ) 85 arabinose ( 500 gm ) 86 sorbitol ( 500 gm ) 87 schaudinns solution ( 250 ml ) 88 microsporidiatrichome blue stain ( 250 ml ) 89 merthiolate iodine formalin ( 250 ml ) 90 chloroform ( 500 ml ) 91 formamide ( 500 ml ) 92 methylene blue ( 25 gm ) 93 nonidet p 40 ( 100 ml ) 94 phosphoric acid ( 500 ml ) 95 potassium di hydrogen phosphate ( 500 gm ) 96 potassium permanganate ( 500 gm ) 97 isopropanol ( 500 ml ) 98 sodium bicarbonate ( 500 gm ) 99 giemsa stain solutoin ( 1 kit ) 100 disposable syringe 5ml with needle 101 disposable syringe 10ml with needle 102 disposable syringe 20ml with needle 103 disposable syringe 50 ml with needle 104 measuring cylinder 50 ml plastic 105 measuring cylinder 100 ml plastic 106 measuring cylinder 500 ml plastic 107 measuring cylinder 1000 ml plastic 108 test tube racks 48 holes for 12 mm test tubes 109 test tube racks 48 holes for 15 mm test tubes 110 nitril gloves medium size 6.5 each 111 nitril gloves small size 6.5 each 112 latex gloves 6.5” unsterilized ( pack of 100 pc. ) 113 latex gloves 7.5” unsterilized ( pack of 100 pc. ) 114 disposable needle 18 gauge 115 staining jars 100 ml 116 plastic dropping bottle 125 ml 117 plastic dropping bottles 500 ml 118 sterile disposable petri dish 90mm 119 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 120 disposable plastic test tubes 75 x12 mm 121 beaker plastic various size 50 ml. 122 beaker plastic various size 100 ml. 123 beaker plastic various size 250 ml. 124 beaker plastic various size 500 ml . 125 beaker plastic various size 1000 ml. 126 thumb press disposable dropper 127 screw cap plastic vial 3 ml disposable with label self standing 128 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 129 vacutainer ( 5 ml without edta ) 130 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 131 . sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm, 150x12mm. ) 132 wash bottle ( 100 ml ) 133 microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 134 beaker 50 ml glass borosil ( cornig ) 135 beaker 100 ml glass borosil ( cornig ) 136 beaker 250 ml glass borosil ( cornig ) 137 beaker 500 ml glass borosil ( cornig ) 138 beaker 1000 ml glass borosil ( cornig ) 139 flat bottom conical flask 100 ml borosil ( cornig ) 140 flat bottom conical flask 200 ml borosil ( cornig ) 141 flat bottom conical flask 500 ml borosil ( cornig ) 142 flat bottom conical flask 1000ml borosil ( cornig ) 143 round flat bottom flask 100 ml borosil ( cornig ) 144 round flat bottom flask 250 borosil ( cornig ) 145 round flat bottom flask 500 ml borosil ( cornig ) 146 test tubes 12x100mm borosil 147 durham’s tube 25 mm x 6 to 7 mm dia. 148 bijou bottle with aluminium cap and silicon rubber washer 149 petri dish 110 mm borosil ( cornig ) 150 petri disc 90mm borosil ( cornig ) 151 glass cover slips 18 x 18mm, 8 x 0.1 mm english glass 152 glass funnel with 10 cm dia. ( small ) 153 glass funnel with 10 cm dia. ( medium ) 154 glass cover slip 22 x 22 mm x 0.1 mm, english glass 155 glass slide with concavities 156 test tube glass 12 x75 mm ( borosil ) 157 reagent bottle with cap ( borosil ) ( clear ) size 50 ml 158 reagent bottle with cap ( borosil ) ( clear ) size 100 ml 159 reagent bottle with cap ( borosil ) ( clear ) size 500 ml 160 reagent bottle with cap ( borosil ) ( clear ) size 1000 ml 161 reagent bottle with cap ( borosil ) ( brown ) size 50 ml 162 reagent bottle with cap ( borosil ) ( brown ) size 100 ml 163 reagent bottle with cap ( borosil ) ( brown ) size 500 ml, 164 reagent bottle with cap ( borosil ) ( brown ) size 1000 ml 165 150 x 15 mm dia., glass borosil 166 pasteur pipette with rubber bulbs capacity of 1 ml 167 pasteur pipette with rubber bulbs capacity of 2 ml 168 amphotericin b 169 micafungin 170 caspofungin 171 posaconazole 172 fluconazole 173 voriconazole 174 flucytosine 175 ketoconazole 176 itraconazole 177 adonitol 1 x25 178 arabinose 1 x25 179 cellobiose 1 x25 180 dextrose 1 x25 181 dulcitol 1 x25 182 galactose 1 x25 183 fructose 1 x25 184 inositol 1 x25 185 inulin 1 x25 186 lactose 1 x25 187 maltose 1 x25 188 mannitol 1 x25 189 mannose 1 x25 190 melibiose 1 x25 191 raffinose 1 x25 192 rhamnose 1 x25 193 salicin 1 x25 194 sorbitol 1 x25 195 sucrose 1 x25 196 trehalose 1 x25 197 xylose 1 x25 198 d arabitol 1 x25 199 colistin 25μg 100 x1 200 oxacillin 1 μg 100 x1 201 fusidic acid 30 μg 100 x1 202 pipracillin 100 μg 100 x1 203 polymyxin b 300 units 100 x1 204 tobramycin 10 μg 100 x1 205 nitrofurantoin 300 μg 100 x1 206 ticarcillin – 75 μg 100 x1 207 nalidixic acid 30 μg 100 x1 208 gatifloxacin 5 / 10 μg 100 x1 209 cefixime 10 μg 100 x1 210 levofloxacin 5 μg 100 x1 211 cefpodoxime 10 μg 100 x1 212 clindamycin 2 μg 100 x1 213 doxycycline 30 μg 100 x1 214 cloxacillin 10 μg 100 x1 215 co trimoxazole 30 μg 100 x1 216 aztreonan 30 μg 100 x1 217 erythromycin 15 μg 100 x1 218 netilmicin 30 μg 100 x1 219 sulphadiazine 100 μg 100 x1 220 clathromycin 15 μg 100 x1 221 griseofulvin 100 x1 222 neomycin 30 μg 100 x1 223 terbinafine 100 x1 224 norfloxacin 10 μg 100 x1 225 imipenem+ edta 10 / 750 100 x1 226 cefotaxime 30 μg 100 x1 227 novobiocin 5 μg 100 x1 228 amikacin 30 μg 100 x1 229 bacitracin 8 μg 100 x1 230 amoxyclave 10 μg 100 x1 231 ampicillin 10 μg 100 x1 232 cefazolin 30 μg 100 x1 233 cefaperazone 75 μg 100 x1 234 ceftizoxime 30 μg 100 x1 235 ceftazidime 30 μg 100 x1 236 ceftriaxone 30 μg 100 x1 237 amoxycilin 10 μg 100 x1 238 imipenum 10 μg 100 x1 239 cefapim 30 μg 100 x1 240 lomefloxacin 10 μg 100 x1 241 cephadroxil 30 μg 100 x1 242 ofloxacin 5 μg 100 x1 243 cefdinir 5 μg 100 x1 244 tetracycline 40 μg 100 x1 245 azithromycin 30 μg 100 x1 246 itraconazole 10& 30 μg 100 x1 247 vancomycin 10 μg 100 x1 248 ketoconazole 10 μg 100 x1 249 methicillin 5 μg 100 x1 250 amphotericin b 20, 50 &100 μg 100 x1 251 lincomycin 30 μg 100 x1 252 fluconazole 25 μg 100 x1 253 linezolid 30 μg 100 x1 254 clotrimmazole 10 μg 100 x1 255 doripenem 10μg 100 x1 256 mecillinam 10 μg 100 x 1 257 faropenem 5 μg 100 x1 258 mezocillin 75 μg 100 x 1 259 fosfomycin 200 100 x1 260 mupirocin 200 μg 100 x 1 261 piperacillin + tazobactam 100 / 10 μg 100 x1 262 ampicilline + clavulinic acid 10 / 10 μg x 10 263 cefoxitin 30 μg100 x1 264 mupirocin 5 μg 100 x1 265 meropenem 10 μg100 x1 266 ceftaroline 30 μg100 x1 267 nystatin100 units 268 miconazole 50 mcg 269 chloramphenicol 30 mcg 100x1 270 tigecycline 15 mcg 100 x1 271 penicillin 10 unit 272 voriconazole 1μg 273 gentamycin 120 μg 274 fluconazole 10 μg 275 polymyxin –b 50 units 276 rifampicin 30 μg 277 daptomycin 278 gentamycin 30 μg 279 amoxycilin&clavulanic acid 20 / 10 mcg 280 amoxycilin&sulbactum 10 / 10 mcg 281 ceftazidime&clavulanic acid 30 / 10 mcg 282 ticarcillin&clavulanic acid 75 / 10 mcg 283 cefaperazone&sulbactum 75 / 10 mcg 284 ceftazidime&tazobactam 30 / 10 mcg 285 parafloxin&mezulate 286 imipenam&cilastatin 10 / 10 mcg 287 piperacillin&tazobactam 30 / 6 mcg 288 clavulanic acid 10 mg &cefotaxime 30 mg 289 ampicillin &cloxacillin10 / 10 mcg 290 lysine hydrochloride 1 x25 ( amino acid disc ) 291 arginine hydrochloride 1 x25 ( amino acid disc ) 292 ornithine hydrochloride 1 x25 ( amino acid disc ) 293 onpg disc 294 oxidase disc 295 bacitracin disc 296 optochine disc 297 plain disc 298 nitrate reagent disc 299 x factor disc 300 v factor disc 301 x / v factor disc 302 vibrio 0129 differential disc 303 pyr disc 304 bile esculin disc 305 kovac’s reagent disc 306 lead acetate paper strip for h2s 307 spore strips 308 cefepime / cefepime+clavulanic acid ( cpm 0.25 16 : cpm+ca 0.064 4 ) 309 cefotaxime / cefotaxime+clavulanic acid ( ctx 0.25 16 : ctx+ca 0.016 1 ) 310 ceftazidime / ceftazidime+clavulanic acid ( caz 0.5 32 : caz+ca 0.064 4 ) 311 ceftriaxone / ceftriaxone+clavulanic acid ( ctr 0.025 16 : caz+ca 0.016 1 ) 312 esbl and ampc detection strip ( caz, ctx, cpm & clo with ca & taz 0.032 4 : caz, ctx, cpm & clo 0.125 16 ) 313 amikacin ( 256–0.15 ) 314 amoxycillin ( 256–0.015 ) 315 amoxycillin / clavulanic acid ( 256–0.015 ) 316 ampicillin ( 256–0.015 ) 317 cefotaxime ( 32–0.002 ) 318 cefotaxime ( 256–0.015 ) 319 ceftaroline ( 32–0.002 ) 320 ceftazidime† ( 256–0.015 ) 321 ceftriaxone ( 32–0.002 ) 322 ciprofloxacin ( 32–0.002 ) 323 clindamycin ( 256–0.015 ) 324 daptomycin ( 256–0.015 ) 325 erythromycin ( 256–0.015 ) 326 polymyxine ( 256 .016 ) 327 cefoxitin ( 256 .016 ) 328 levofloxacin ( 32–0.002 ) 329 linezolid ( 256–0.015 ) 330 meropenem ( 32–0.002 ) 331 metronidazole ( 256–0.015 ) 332 oxacillin ( 256–0.015 ) 333 penicillin g ( 32–0.002 ) 334 penicillin g ( 256–0.015 ) 335 teicoplanin ( 256–0.015 ) 336 tetracycline ( 256–0.015 ) 337 tigecycline ( 256–0.015 ) 338 vancomycin ( 256–0.015 ) 339 gentamicin ( 256–0.015 ) 340 imipenem ( 32–0.002 ) 341 colistin ( 256 .016 ) 342 fosfomycin ( 256 .016 ) 343 combi 94 for gram positive bacteria ( od 298 ) 344 combi 92 for gram negative bacteria ( od 293 ) 345 combi 512 for highly resistant pseudomonas ( od 88 ) 346 combi 677 for highly resistant staph aureus ( od 277 ) 347 meropenem with & without edta ( mpm+edta 1 64 mpm 4 256 ) 348 rapideccarba np 349 widal kit 4x5ml rapid slide test kit 350 mp card test ( for antigen pan, pf & pv detection ) 351 ra test kit 352 aso test kit 353 crp test kit 354 rpr 3rd generation / vdrl 355 hbs ag card test kit 356 hcv card test kit 357 rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) 358 rapid specific test for syphilis ( strip test ) kit 3rd generation 359 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 360 hepatitis a card test rapid card antibody test with control 361 rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) 362 h. pylori detection of all isotypes ( igg, igm, iga ) 363 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 364 rapid card test for troponin i for acute mi 365 rapid dengue card test for ns antigen igm and igg 366 latex agglutination for cryptococcalneoformans. 367 hiv rapid card test 4th generation ( nib / who / naco approved ) 368 rapid test kit device for toxoplasma infection with built in control test device 369 peptone water powder 370 macconkey agar 371 hichrome uti agar 372 nutrient agar 373 muller hinton agar 374 alkaline peptone water powder 375 hichrome candida differential agar 376 sda with cycloheximide 377 sda with chloramphenicol 378 potato dextrose agar base 379 rpmi 1640 380 glucose phosphate broth 381 simmons citrate agar 382 urease base agar ( christensen ) 383 c.zapekdox agar 384 triple sugar iron agar 385 phenyl pyruvic acid agar 386 bile esculin agar 387 hugh leifson oxidation fermentation media 388 stuart transport medium 389 dnaase agar media 390 l arginine dihydrolasehiveg medium 391 lysine decarboxylase hiveg broth 392 ornithine decarboxylase hiveg broth 393 cetrimide agar 394 anaerobic hiveg agar 395 thioglycolate agar 396 brain heart infusion broth 397 agar – agar powder 398 selenite f broth 399 tetra thionate broth 400 yeast extract “cr 027” 401 bacto peptone ( peptone ) “rm 015” 402 tryptose soya broth 403 carry blair w / o charcoal 404 tcbs agar 405 dca aagr 406 bile salt agar 407 coagulase manitol broth base 408 soyabincasin digest broth 409 l.j. medium base 410 miu medium 411 xylose lysine deoycholate agar 412 c.l.e.d. agar with andrde indicator 413 cooked meat medium broth 414 mannitol salt agar 415 phenol phthelinediphosphate agar 416 gelatin agar 417 sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) 418 cetrimide agar 419 hi combi dual performance media ( blood culture ) 420 bact alert blood culture bottle ( adult ) 421 bact alert blood culture bottle ( paediatric ) 422 yeast nitrogen base 423 muller decarboxylase 424 biomedical waste bags ( red, yellow, black, blue ) 25 lit. capacity 425 dustbin ( red yellow black blue ) 25 lt. 426 deionised triple distilled water reagent grade with conductivity <1.0 427 liquid soap dettol 428 teasing needle for fungus 429 markers blue red and black, finetip 430 nichrome wire 26g 431 adjustable loop holder 432 self adhesive autoclvable tape ( 18mmx50mt ) 433 self adhesive dry heat tape ( a8mmx50mt ) 434 hand guard disinfectant gel 435 hi spark alkaline clear solution biodegradable 436 filter paper full size 46x57 cm 437 spirit lamp glass with batti 438 slide boxes wooden / plastic 439 sterile polyester tipped swab 440 para film ( sealing film for glassware ) 2” 441 short range ph paper sticks ( 3 to 9 ) 442 ( grinded vessel ) 5, 10, 20ml 443 halogen bulb for microscope 6 v, 20w 444 stainless steel forceps blunt ( rust resistant ) 445 stainless steel forceps printed ( rust resistant ) 446 match box 447 disposable gloves 448 broom 449 disposable face masks 450 disposable apron 451 disposable shoe cover 452 disposable caps 453 aluminum tray for slide horizontal & vertical 454 phenyl solution 455 glass marking pencil white & red 456 test tube brush for cleaning tubes small / large 457 diamond pencil 458 rubber tourniquet 459 triple layer surgical mask with elastic earband 460 serology reporting register 461 koh reporting form 462 culture reporting form 463 serology reporting form 464 carbon brush ( for centrifuge machine ) 465 microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) 466 bamboo stick 467 cotton roll 468 ph indicator paper 469 slide tray plastic 470 cellophane tape 1’ 471 surgical blade 472 aluminium foil 473 match boxes 474 tissue paper roll 475 distilled water 476 disposable sterile container for urine sample / sputum for c / s 477 disposable plastic test tube 75x12mm 478 falcons tubes 50ml 479 falcons tubes 15ml 480 hav igm ( 96 well ( 1kit ) ) 481 hev igm ( 96 well ( 1kit ) ) 482 anti hbs ag ( 96 well ( 1kit ) ) 483 anti adenovirus iga ( 96 well ( 1kit ) ) 484 anti rotavirus antigen in stool elisa & serum ( 96 well ( 1kit ) ) 485 anti ebv igm ( 96 well ( 1kit ) ) 486 anti herpes simplex 2 igg ( 96 well ( 1kit ) ) 487 anti herpes simplex 2 igm ( 96 well ( 1kit ) ) 488 anti parainfluenzaigg ( 96 well ( 1kit ) ) 489 anti parainfluenza iga ( 96 well ( 1kit ) ) 490 measles igm ( 96 well ( 1kit ) ) 491 rubella igm ( 96 well ( 1kit ) ) 492 anti varicella zoster igg ( 96 well ( 1kit ) ) 493 anti varicella zoster igm ( 96 well ( 1kit ) ) 494 elisa ns1 antigen for dengue ( 96 well ( 1kit ) ) 495 anti respiratory syncitial virus igm ( 96 well ( 1kit ) ) 496 anti measles igg, igm ( 96 well ( 1kit ) ) 497 anti parainfluenzaigm ( 96 well ( 1kit ) ) 498 mumps igm ( 96 well ( 1kit ) ) 499 anti nmda receptor encephalitis ( 96 well ( 1kit ) ) 500 elisa for enterovirus ( 96 well ( 1kit ) ) 501 anti varicella zoster iga ( 96 well ( 1kit ) ) 502 hcvigm elisa ( 96 well ( 1kit ) ) 503 anti ds dna ( 96 well ( 1kit ) ) 504 ( apla ) anti phospholipid antibody igg, igm ( 96 well ( 1kit ) ) 505 ttg iga ( 96 well ( 1kit ) ) 506 dengue antigen elisa ( 96 well ( 1kit ) ) 507 chikunguniyaigm elisa ( 96 well ( 1kit ) ) 508 anti h. pylori iga ( 96 well ( 1kit ) ) 509 anti h. pylori igg elisa ( 96 well ( 1kit ) ) 510 anti rota virus ( antigen ) elisa ( 96 well ( 1kit ) ) 511 anti japanese b encephalitis igm ( 96 well ( 1kit ) ) 512 anti paravovirus 19 igg ( 96 well ( 1kit ) ) 513 anti paravovirus 19 igm ( 96 well ( 1kit ) ) 514 anti sm ( 96 well ( 1kit ) ) 515 anti rnp ( 96 well ( 1kit ) ) 516 anti panca, canca ( 96 well ( 1kit ) ) 517 scrub typhus ( 96 well ( 1kit ) ) 518 anti cardilopin igg ( 96 well ( 1kit ) ) 519 anti cardilopin igm ( 96 well ( 1kit ) ) 520 anti echinococcaligg ( 96 well ( 1kit ) ) 521 hbs antibodies ( 96 well ( 1kit ) ) 522 anti hsv 1 igm ( 96 well ( 1kit ) ) 523 anti hsv 1 igg ( 96 well ( 1kit ) ) 524 cmv igm ( 96 well ( 1kit ) ) 525 cmv –igg ( 96 well ( 1kit ) ) 526 anti parainfluenzaigg ( 96 well ( 1kit ) ) 527 anti parainfluenzaigm ( 96 well ( 1kit ) ) 528 anti brucellaigg ( 96 well ( 1kit ) ) 529 anti brucellaigm ( 96 well ( 1kit ) ) 530 anti thyroid peroxidase antibodies ( microsomall ) ( 96 well ( 1kit ) ) 531 west nile igm elisa ( 96 well ( 1kit ) ) 532 hbeag elisa ( 96 well ( 1kit ) ) 533 hbs ag elisa ( 96 well ( 1kit ) ) 534 anti neulear antibody ( elisa ) ( 96 well ( 1kit ) ) 535 nucleic acid isolation ( rna & dna both ) ( 250 rxn ) 536 nucleic acid isolation kits ( from blood & bacterial culture ) ( 250 rxn ) 537 viral rna isolation kit ( 250 rxn ) 538 viral dna isolation kit ( 250 rxn ) 539 gel extraction / purification kit ( 250 rxn ) 540 quantitative estimation pcr kits for hbv ( available pack size ) 541 quantitative estimation pcr kits for hcv ( 100 rxn ) 542 quantitative estimation pcr kits for hpv 16 ( 100 rxn ) 543 quantitative estimation pcr kits for hpv 18 ( 100 rxn ) 544 rt pcr kits for japanese enchephalitis ( 100 rxn ) 545 rt pcr kit for zika virus. ( 100 rxn ) 546 rt pcr multiplex kits for viral meningitis ( ( ftd neuro 9 ) ( 100 rxn ) 547 rt pcr multiplex kits for neonatal meningitis ( 100 rxn ) 548 rt pcr multiplex kits for respiratory tract virus ( 100 rxn ) 549 quantitative estimation pcr kits for viral encephalitis. ( 100 rxn ) 550 steel instrument tray medium size ( 1 pc. ) 551 lab trays ( 6 ) 450 x 350 x 75 ( 1 pc. ) 552 cryo box ( 100 places ) ( plastic ) ( 5 pc. / per box ) 553 falcons tubes50ml, ( 100 pc. / pkt. ) 554 falcons tubes 15 ml ( 100 pc. / pkt. ) 555 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) a )       2 ml ( 500 pc. / pkt. ) 556 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) b )       1.5 ml ( 500 pc. / pkt. ) 557 brush ( nylon bristles seated in galvanized wire with a wire handle ) ( 90 x 150 x 340 mm ) 558 volumetric flask brush ( 50 x 70 x 170 mm ) 559 beaker brush ( 30 x 110 x 260 mm ) 560 test tube brush 561 float rack ( 6 pc. / pkt. ) 562 pipette stands for every pipette set vertical revolving ( 1 pc. ) 563 multipurpose racks / stand ( 5 pc. / pkt. ) 564 laboratory spatula 565 micro spatula, set of 3 (  220 mm ) 566 spatula, spoon end ( ) 567 thermometer, mercury ( 0 150°c x 1°c ) 568 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 50 ml ) 569 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 100 ml ) 570 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 500 ml ) 571 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 1000 ml ) 572 flat bottom conical flask ( with screw cap, graduated, clear ) ( 100 ml ) 573 flat bottom conical flask ( with screw cap, graduated, clear ) ( 250 ml ) 574 flat bottom conical flask ( with screw cap, graduated, clear ) ( 1000 ml ) 575 glass funnel ( 5 cm dia. ) 576 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 577 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 578 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 579 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 580 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 581 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 582 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 583 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 584 measuring cylinder plastic ( 100 ml ) 585 measuring cylinder plastic ( 500 ml ) 586 measuring cylinder plastic ( 1000 ml ) 587 nitril gloves small ( 6.5 inch. ( 100 / pack ) 588 latex gloves ( 6.5 inch. ( 100 / pack ) 589 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 0.5 – 10 μl ) 590 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 10 – 100 μl ) 591 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 20 – 200 μl ) 592 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 100 – 1000 μl ) 593 beaker plastic ( with spout, graduated, autoclavable ) ( 50 ml ) 594 beaker plastic ( with spout, graduated, autoclavable ) ( 100 ml ) 595 beaker plastic ( with spout, graduated, autoclavable ) ( 500 ml ) 596 beaker plastic ( with spout, graduated, autoclavable ) ( 1000 ml. ) 597 screw cap plastic vial 2 ml disposable with label self standing, autoclavable ( 500 pc / pkt. ) 598 k3 edta blood collection vials vaccunized 599 pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat cap ( 500 pc / pkt. ) 600 pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml ( 500 pc / pkt. ) 601 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 602 micro amp fast reaction caps ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 603 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 604 micro amp fast reaction caps ( 8 tubes / strips ) 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 605 ptfe magnetic stir bar retrievers ( 18 24 inch ) 606 rapid test for detection of igm antibodies against salmonella infection ( lam test ) ( 96 test ) 607 rapid specific test for syphilih ( card test ) kit 3rd generation ( igg / igm / iga ) tpha ( 96 test ) 608 hepatitis a card test rapid card antibody test with control ( 96 test ) 609 rotavirus detetion of rota virus detecation ag of all serotypes ( 96 test ) 610 h. pylori detection of all isotypes ( igg, igm, iga ) ( 96 test ) 611 brucellaantibodyslide agglutination test b. abortus 5 mlb.mclitersis 5ml ( 96 test ) 612 rapid card test for troponin i foracute mi ( 96 test ) 613 rapid dengue card test for ns1 antigen igm and igg ( 96 test ) 614 hiv rapid card test4th generation ( nib / who / naco approved ) ( 96 test ) 615 acetone 4x2.5 ltr ( 4x2.5 ltr ) 616 agar agar powder 2x500 gm ( 2x500 gm ) 617 amikacin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 618 amoxycillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 619 amoxyclave 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 620 ampicillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 621 aslo 5 box = 500 ( 1 box = 500 ) 622 azithromycin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 623 bijou bottle with aluminium cap and silicon rubber washer ( each ) ( each ) 624 blue tips ( 5000 nos ) ( 5000 ) 625 cefaperazone 75μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 626 cefapim 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 627 cefdinir 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 628 cefixime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 629 cefotaxime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 630 cefoxitin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 631 cefpodoxime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 632 ceftazidime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 633 ceftriaxone 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 634 cephadroxil 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 635 chromogenic uti agar ( 5x500 gm ) ( 5x500 gm ) 636 clindamycin 2μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 637 colistin 25μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 638 disinfecctent soap ( 150 nos. ) ( 150 nos. ) 639 disinfectent solution for hand wash 500ml ( 20 nos ) ( 20 nos ) 640 disposable container for urine ( 40000 nos. ) ( 40000 nos. ) 641 disposable plastic test tube 75x12ml ( 10000 nos. ) ( 10000 nos. ) 642 distilled water ( 2000 nos. ) ( 5000 nos. ) 643 gulcose phosphate broth ( 2x500 gm ) ( 2x500 gm ) 644 hugh leifson oxidation fermentation ( 2x500 gm ) ( 2x500 gm ) 645 imipenum 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 646 itraconazole 10&30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 647 ketoconazole 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 648 levofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 649 linezolid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 650 lomefloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 651 mac conkey agar ( 6x500 gm ) ( 6x500 gm ) 652 methicillin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 653 mr. vp medium ( 2x500 gm ) ( 1x500 gm ) 654 muller hinton agar ( 10x500 gm ) ( 5x500 gm ) 655 nalidixic acid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 656 nitrofurantoin 300μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 657 normal saline solution ( 500mlx510 ) ( 500mlx510 ) 658 novobiocin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 659 nrfloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 660 nutrient agar ( 10x500 gm ) ( 10x500 gm ) 661 ofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 662 paraffin liquid ( 2x500 ml ) ( 2x500 ml ) 663 peptone water ( 2x500 gm ) ( 2x500 gm ) 664 pipracillin 100μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 665 procalcitonin ( 300 box = 3000 test ) ( 300 box = 3000 test ) 666 rpmi 1640 ( 6x500 ml ) ( 6x500 ml ) 667 simmons citrate agar ( 2x500 gm ) ( 2x500 gm ) 668 spirit lamp ( 2 nos ) ( 5 nos ) 669 sterile cotton swab in screw capped polypropylene tube ( 20x100 = 2000 nos ) ( 20x100 = 2000 nos ) 670 sterile disposable petri dises 99 mm ( 200x100=20, 000 nos ) ( 200x100=20, 000 nos ) 671 suborounds d extrose agar with cyclohexmide ( 2x500 gm ) ( 2x500 gm ) 672 teasing needle for fungus ( 10xeach ) ( 5xeach ) 673 test tube borosilicate with rim ( 12x100 ) ( 10000 ( piece ) tube nos ) ( 10000 ( piece ) tube nos ) 674 test tube borosilicatee with rim ( 18*150 ) ( 1000 nos ) ( 1000 nos ) 675 test tube brushes for cleaning tube small / large ( 50 nos ) ( 50 nos ) 676 tissue paper roll ( 4450 nos ) ( 4450 nos ) 677 tobramycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 678 triple blood bag with sagm 350ml ( 12000 nos ) ( 12000 nos ) 679 urease base agar ( 2x500 gm ) ( 2x500 gm ) 680 vancomycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 681 xyline ( 1x25 ltr ) ( 1 bottle ) 682 sterile cotton swab in screw capped polyprohylietube ( 10x100 box ) ( 10x100 box ) 683 hicrome rapid mrsa agar base ( 1x500gm ) ( 1x500gm ) 684 sabouraved agar+chlormphnicol+ gentamicin ( 1x500gm ) ( 1x500gm ) 685 loeffler serum slant ( 100 slants ) ( 50 slants ) 686 v.t.m. ( 500 nos ) ( 500 nos ) 687 ethanol ( 1 bottle ) 688 isoamylalcohal ( 1 bottle ) 689 paradimethyl diamobenjaldenyde ( 100 ml ) 690 hcl ( 1 ltr ) 691 h2o2 ( 1 ltr ) 692 gycerol ( 1 ltr ) 693 lpcb ( 1 ltr ) 694 grams staining ( 1 bottle ) 695 zn staining ( 1 bottle ) 696 albert staining a&b ( 1 bottle each for a&b ) 697 bhi ( brain heart infusion ) ( 1 bottle ) 698 foceps ( 12 pcs ) 699 methanol ( 5 ltr ) 700 bile exulin agar ( 1x500 ) 701 ppa ( phenyl pyrumi acid ) ( 1x500 ) 702 feu3 ( 100 ml ) 703 dtm ( dermatophyte testing media ) ( 1x500 ) 704 pda ( potato dextrose agar ) ( 2x500 ) 705 formaline ( 10 ltr ) 706 paraffin oil ( 1 ltr ) 707 petri dish ( 15000 ) 708 tecopanin anitibiotic ( 50vl=5000 disc ) 709 ciprofloxacin ( 50vl=5000 disc ) 710 cefuroxime ( 50vl=5000 disc ) 711 gentamycin ( 50vl=5000 disc ) 712 piperacillin & tazobactum ( 50vl=5000 disc ) 713 ampicillin and sulbactum ( 50vl=5000 disc ) 714 ticarcillin & clavulinic ( 50vl=5000 disc ) ...

Shree Karan Narendra Agriculture University - Rajasthan

22975432 supply of chemicals and glasswares open tender for supply of chemicals & glasswares naphthol ar, tri phenyl tetrazolium chloride, dicholorophenol indophenol, suphosalicylic acid dihydrate ar, absolute alcohol, acetic acid, acetic acid glacial ar, acetocarmine solutions, acetone, acetone ar, acrylamide, agar agar (bacteriological grade), aluminium chloride hexahydrate extrapure, ammonia buffer solution, ammonia solution, ammonium acetate, ammonium chloride, ammonium dihydrogen ortho phosphate, ammonium molybdate, ammonium oxalate monohydrate, borex, buffer ampule set, cadmium chloride monohydrate, calcium nitrate tetrahydrate, calcium cabonate, calcium chloride dihydrate, carmine powder, catechol extrapure, cedar wood oil medium, chloroform, citric acid, cobaltus chloride, cobaltus nitrate hexahydrate, copper sulphate, corn meal media, crystal violet, czepek, diphenylamine, diphenylamine indicator, dmso, glycerene, glycerol, gum acacia, haxen, hydrochloric acid, hydrochloric acid, hydrogen peroxide, hydroxyl amines, iodine solution, iron sulphate, iron tartrate, lactic acid, labolene, magnesium chloride, magnesium sulphate heptahydrates, manganese sulphate, mannitol ar, martis media, mercuric chloride ar, metaphosphoric acid, methanol for hplc, methly methanesulfonate, methly red indicator, molyclean ma 03 phosphate free, molysol e ar, sodium hydroxide, nesseller reagent, n heaxane, ninhydrin ar, nitric acid, nutrient agar readymade, oat meal media, orcinol, ortho phospho0ric acid, oxalic acid, praffin wax, phenoiphthalin indicator, phenol disafonic acid, phenolphthalein indicator power, phosphoric acid, perchloric acid, petroleum ether, potasium meta bi sulphite, potassium dicromate, potassium hydroxide pelllets, potassium iodide, potassium acetate, potassium chloride, perchloric acid, petroleu ether, polyvinyl pyrrolodone, potassium meta bi sulphite, potassium dicromate, potassium hydroxide pellets, potassium iodide, potassium acetate, potassium chloride, potasium sulphate, potassium titrate, proceloin dish, protein ladder marker, silver nitrate, sodium azide, sodium benzoate, sodium bicarbonate, sodium carbonate anydrous, sodium carbonate, sodium cobalt nitrite, urea, glasswares beaker, bod bottle, bottle reagent, burettes, conical flas graduated, conical flask standard ground, cotton, cover slip, digestion flask ,dropping bottle, filter paper ordinary, conical flask, cotton, cover sliop, cover slips, digestion flask, dropping bottle, filter paper ordinary, filter paper, funner, measuring cylinder, permanent slide, pastle & mortal, petri culture, petri plates, petridish, pipette, plain slide, reagent bottle, reagent bottle, room thermometer, round bottom flask, slide storage box, speciment glass jars, stage micrometer, staining jar & rack, test tube, test tube stand, volumetric flask, wash bottle, watch glass, whatman filter paper. ...

Shree Karan Narendra Agriculture University - Rajasthan

22948600 open tender for supply of chemicals and glasswares 1 naphthol ar 2. 2 3 5 tri phenyl tetrazolium chloride ( ttc ) 3. 2, 4 d 4. 2, 6, dicholorophenol indophenol 5. 5 sulphosalicylic acid dihydrate ar 6. absolute alcohol 7. acetic acid 8. acetic acid glacial ar 9. acetocarmine solutions 10. acetone 11. acetone ar ( special grade ) 12. acrylamide 13. agar agar ( bacteriological grade ) 14. aluminium chloride hexahydrate extrapure ar, 99% 15. ammonia buffer solution 16. ammonia solution sp. gr 0.91 17. ammonium acetate 18. ammonium chloride 19. ammonium dihydrogen ortho phosphate 20. ammonium ferrous sulphate hexahydrates 21. ammonium molybdate 22. ammonium molybdate tetrahydrate extrapure 23. ammonium oxalate monohydrate 24. ammonium oxilate 25. ammonium purpurate 26. ammonium sulphate 27. anthorne reagent 28. anthrone ar 29. ascorbic acid 30. azomethine h 31. barium chloride dihydrate 32. barium chloride solution ( 10% ) 33. barium sulphate 34. barium chloride gelatin 35. borex 36. boric acid ( powder ) 37. bromocresol purple sodium salt 38. bromocresol green 39. bromothymol blue indicator powder 40. bsa ( bovine scrum ) 41. buffer ampule ( set of 6 ) 42. buffer ampule ( set of 6 ) 43. cadmium chloride monohydrate 44. calcium nitrate tetrahydrate 45. calcium carbonate 46. calcium chloride 99% extra pure 47. calcium chloride dihydrate 48. calcium sulphate anhydrous 49. calcium sulphate dihydrate 50. carmine powder 51. catechol extrapure 99% 52. cedar wood oil medium 53. chloroform ( ethanol stabilized ) 54. citric acid 55. cobaltus chloride 56. cobaltus nitrate hexahydrate 57. copper sulphate 58. corn meal media 59. crystal violet 60. czapeks dox agar 61. d ( + ) ribose 62. darco g 60 ( activated charcoal ) 63. detergent 64. dextrose 65. d fructose asr 66. di sodium hydrogen arsenate 67. diethyl ether ar ( stabilised ) 68. diethyline tri amine penta actic aci dtpa ) 69. diphenylamine 70. diphenylamine indicator 71. di sodium hydrogen arsenate disodium tetrachloropalladate ( na2pdc14 ) 72. 73. dmso 74. eric chrome black t 75. ethanol 76. ethyl methanesulfonate ( ems ) 77. ethylene alcohol 78. ethyline diamine tetra actic aci ( edta ) 79. ferrion indicator 80. ferrous sulphate ( feso4.7h20 ) ar 81. ferrous sulphate hypt 82. ferus sulphate ( fe so ) 83. folin & ciocalteus phenol ( fcp ) reagent ar 84. folins uric acid 85. gallic acid pure, 98% ( 3, 4, 5 trihydroxybenzoic acid ) glutamic acid 86. 87. glycerene 88. glycerol 89. glycerol ( glycerin ) anhydrous pi 99% 90. gum acacia 91. haxen 92. hoaglands no. 2 basal salt mixt 93. hydrochloric acid 94. hydrochloric acid 0.5n aq. solut 95. hydrochloric acid lr 96. hydrogen peroxide 30% 97. hydrogen peroxide 6% 98. hydroquinone 99. hydroxyl amines ( ha ) 100 hydroxylamme hydrochloride 101 iodine solution 1% w / v 102 iron sulphate 103 iron ( nh4 ) 2 fe ( so4 ) 26 h2o 104 iron tartrate 105 kh2po4 106 lactic acid ar 107 labolene 108 l ascorbic acid extrapure 109 l glycine ( triglycine ) extrapure, 99 110 l phenylalanine extrapure chr, 991 l tyrosine for biochemistry 111 112 magnesium chloride 113 magnesium sulphate heptahydrates 114 manganese sulphate 115 mannitol ar 116 martins media 117 mercuric chloride ar 118 metaphosphoric acid 119 methanol for hplc 120 methyl methanesulfonate ( mms ) 121 methyl red indicator 122 molyclean ma 03 phosphate free 123 molysol e ar 124 n / 10 sodium hydroxide 125 nesseller reagent 126 n hexane 99% ar 127 ninhydrin ar ( 99% assay ) 128 nitric acid 129 nitric acid ar 69 71% 130 nutrient agar readymade 131 oat meal media 132 orcinol 133 ortho phosphoric acid 134 oxalic acid 135 p nitrophenyl sulphate 136 paraffin wax 137 pda readymade 138 peg 6000 139 ph 4, ph 7, ph 9.2 standard solution 140 phenoiphthalin indicator 141 phenol crystalline extrapure ar, acs, exiplus®, 99.5% 142 phenol disalfonic acid 143 phenolphthalein indicator 144 phenolphthalein indicator power 145 phosphoric acid 146 perchloric acid 70% 147 petroleum ether 40 60 c 148 petroleum ether 60 80° c 149 polyvinyl pyrrolodone ( pvpk 30 ) 150 potasium meta bi sulphite 151 potassium dicromate 152 potassium hydroxide pellets 153 potassium iodide 154 potassium acetate 155 potassium chloride 156 potassium chromate ar 157 potassium dichromate ( k2cr2o7 ) 158 potassium dihydrogen phosphate 159 potassium hydrogen sulphate 160 potassium metabisulphite 161 potassium oxalate 162 potassium permanganate 163 potassium sulphate 164 potassium titrate 165. pottassium hydroxide 85% ar 166 pottassium nitrate 99% ar 167 proceloin dish 2 168 protein ladder marker ( mid range ) 169 pyrogallol extrapure 170 resorcinol ar 171 rutin trihydrate pure, 95% ( vitamin trihydrate, rutoside quercetin 3 rutinoside ) 172 saffranin 173 salicyclic acid 174 silver nitrate 175 sodium chloride 176 sodium acetate anhydrous 177 sodium acetate trihydrate 178 sodium arsanate 179 sodium azide 180 sodium benzoate 181 sodium bicarbonate 182 sodium carbonate anhydrous 183 sodium carbonate ar 184 sodium cobalt nitrite 185 sodium hydroxide ( naoh ) 186 sodium hydroxide extrapure ar, acs, exiplus®, 98% 187 sodium hydroxide flakes 188 sodium hydroxide pellets 189 sodium hypochlorite sodium nitrite 190 191 sodium cyanide 192 sodium potassium tartaratt tetrahydrate 193 sodium silicate 194 sodium thiosulphate sodium tungstate dihydrate extrapure ar, 99% 195 196 stannous chloride dihydrate 197 sucrose ar 198 sulphuric acid 199 sulphuric acid 98% ar 200 tolene 201 total hardness indicator tablets 202 trichloroacetic acid 10% 203 triethylamine ( tea ) 204 thioglycolic acid 205 tris 206 thiourea 207 triton x 100 208 universal indicator solution 209 urea 210 v8 agar medium ( vinegar ) 211 xylene 212 zinc chloride 213 zinc oxide 214 zinc sulphate heptahydrate 1. beaker ( graduated ) 25, 50, 10c 250, 500, 1000 ml capacity 2. bod bottle 125 ml, 300m1 3. bottle reagent 100, 125, 250 m. 4. burettes 50m1 5. conical flask graduated 50, 10c 150, 250, 500 ml 6. conical flask standard ground mouth250, 500 ml 7. cotton ( in gm. ) 8. cover slip ( square ) 22 mm 9. cover slips ( round ) 22 mm 10. digestion flask 100 ml 11. dropping bottle 50 ml 12. dropping bottle 500 ml 13. filter paper ordinary 12.5 cm ( 10 ( circle ) 14. filter paper sheet 15. filter paper whatman no. 4112.5 cm ( 100 circles ) 16. filter paper whatman no. 4212.5 cm ( 100 circles ) 17. funnel 18. glass road 19. glass tubes 20. kejldahl flask 100m1 round bottom long nack 21. kejldahl flask 500m1 round bottom long nack 22. laboratory tray plastic ordinary 23. measuring cylinder 50, 100, 250 ml capacity 24. measuring cylinder with pour ou hexagonal base 1000m1 graduate 25. measuring cylinder with pour ou hexagonal base 100m1 graduated 26. measuring cylinder with pour ou hexagonal base 10m1 graduated 27. measuring cylinder with pour ou hexagonal base 250m1 graduated 28. measuring cylinder with pour out hexagonal base 25m1 graduated 29. measuring cylinder with pour out hexagonal base 500m1 graduated 30. measuring cylinder with pour out hexagonal base 50m1 graduated 31. measuring cylinder with pour out hexagonal base 5m1 graduated 32. measuring mugs transparent 100 ml 33. measuring mugs transparent 500 ml 34. micro pipette adjustable automatic 35. ocular micrometer 10mm with 100 divisions 36. permanent glass slide set of meiosis in plants 37. permanent glass slide set of mitosis in plants 38. permanent slide of all parts of root, leaf and stem 39. permanent slide of anatomy of dicot root 40. permanent slide of anatomy of dicot stem �� 41. permanent slide of anatomy of leaf 42. permanent slide of anatomy of monocot root 43. permanent slide of anatomy of monocot stem 44. pestle & mortal 45. petri culture dish90 160mm cover diameter 46. petri plates 5cm cover diameter 47. petri plates 10 cm cover diameter 48. petridish 49. pipette 1 ml graduated 50. pipette 10 ml graduated 51. pipette 2 ml graduated 52. pipette 5 ml graduated 53. plain slide 76x26 mm pre cleaned ready for use 54. reagent bottle 250m1 amber colour 55. reagent bottle 500m1 56. reagent bottle 500m1 amber colour 57. reagent bottles 125 ml 58. reagent bottles 100 ml capacity 59. room thermometer in celsius 60. round bottom flask250 ml 61. slide storage box for 25 pieces of slide 62. specimen glass jars ( 1 & 2 ltr. ) 63. stage micrometer ( 1x 3 ) 1 mm, 100 divisions 64. staining jar and rack for 24 pieces of slide 65. test tube 12 x 75 mm 66. test tube 15 x 125 mm 67. test tube 16 x 16 x 16 mm 68. test tube 25 x 100 mm 69. test tube 25 x 200 mm 70. test tube stand 71. test tube stand 4x12 72. volumetric flask 1000m1 with stopper ( size 24 / 29 ) , flat bottom 73. volumetric flask 100m1 with stopper ( size 14 / 23 ) , flat bottom 74. volumetric flask 250m1 with stopper ( size 14 / 23 ) , flat bottom 75. volumetric flask 25ml with stopper ( size 10 / 19 ) , flat bottom . 76. volumetric flask 50m1 with stopper ( size 10 / 19 ) , flat bottom 77. wash bottle 500m1 78. watch glass 65 mm dia 79. watch glass 80mm 80. whatman no.40 filter paper ( in pics ) ...

Medical And Health Services - Rajasthan

22709733 supply of laboratory reagent kits and other items b.sugar god/pod mack erba, b.urea (berthelot) mack erba, s. cretinine (kinetic) mack erba, s.bilirubin t&d mack erba, sgot (kinetic) mack erba, sgpt (kinetic) mack erba, colestrol mack erba, widal, ra, aslo, crp, vdrl (rp strip), hb sag card, hcv, hiv rapid, hiv tri dot, anti a, anti b, anti d igg+igm monocolan, anti ab, anti xh, ahg, anti a1, seurm bovine albumin, uristi x s parameter, multisti x, coomb sera vail, n/10 hcl, 2, sodium citrate 3.8%, lesmen stain, lesmen powder, tlc flude, ceder wood oil, pregnancy test rapid kit, jsb stain a, jsb stain b, sodium hypocloride, xylene, semen diluting fluid, cpd beg, cpd beg, distil water, micro tips 2 200 ul, micro tips 5 1000 ul, cover slip, glass slide, edta vail with screw cap (k2), sodium cicrate tube for blood collection edta k3, plane vail with screw cap, urine collection container, urine centrifugal vail, esr tube glass, state fax tube glass, glass tube 10 ml, tissue paper, ph paper, blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes, abx minoclear, abx minidil lmg, abx lyse bio, abx cleaner, minocal calibrator, minotrol 16 twin pak (02l), minoclair, paper roll for abx micro es 60, reagents for elisa reader, hiv elisa, hbs ag elisa, hcv alisa, vtm kit, anti d igg + igm, tournicate, rubber ball for blood donner, tharmograph paper for, papper roll for sami auto analizer transasia, papper roll sami auto analizer gyro, papper roll automatic fully esr analizer transasia, projection lamp 6v20w for microscope, fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables, albumin mack erba, amylase mack erba, bilirubin t&d mack erba, urea mack erba, cholestrol mack erba, alkaline phosphate mack erba, glucose mack erba, s. creatinine mack erba, calcium mack erba, total protein mack erba, triglyceride mack erba, hdl cholestrol direct mack erba, sgot mack erba, sgpt mack erba, chloride mack erba, uric acid mack erba, ck mack erba, ckmb mack erba, sample cup mack erba, ggt mack erba, ldl cholestrol with calibrator mack erba, ldhp mack erba, microprotein mack erba, 2, phosporus mack erba, x l multical mack erba, x l wash mack erba, blood gas analizer regants mack phox plus l nova biomedical, calibration solution c 1, calibration solution c 2, fluid pack c 3, fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal, amylase direct mack biosystem, amylase pancreatin mack biosystem, adenosine deaminase (ada) mack biosystem, alanine aminotransferase (alt/gpt) mack biosystem, albumin mack biosystem, alkaline phosphatase(alp) amp mack biosystem, alkaline phosphatase (alp) dea mack biosystem, aspantate aminotransferase (ast/got) mack biosystem, bilrubin (direct) mack biosystem, bilrubin (total) mack biosystem, calcum arsenazo mack biosystem, cabon diooxide mack biosystem, cholesterol mack biosystem, cholesterol hdl direct mack biosystem, cholesterol ldl direct mack biosystem, crecatinine kinase ck mack biosystem, creatinine kinase mb(ck ,mb) mack biosystem, creatinine mack biosystem, glutamyl transferase (y gt) mack biosystem, glucose mack biosystem, iron ferrozine mack biosystem, lactate dehydrogenase ldh mack biosystem, lipase mack biosystem, magnesium mack biosystem, phosphorus mack biosystem, protein total mack biosystem, protein (urine/csf) mack biosystem, total bile acid mack biosystem, triglycerides mack biosystem, urea/bun vv mack biosystem, uric acid mack biosystem, sample cup mack biosystem, washing solution mack biosystem, washing solution mack biosystem, rotor mack biosystem, conc. system liquid mack biosystem, halogen uv p lamp mack biosystem, control level 1 mack biosystem, control level ii mack biosystem, calibrator mack biosystem, urine analyzer strip, gluco strip sd cheek code 21, gluco strip accuchek, gluco strip dr. marpirn, semi auto analizer regents, hemoglobino meter micro cuvette, edta vial k 3 double cap, fully auto analyser sample cube, micropipettes 1 10 microliter, micropipettes fix 500 microliter, westergreen stand, westergreen esr tube, dengue test kit rapid igm/ns1, chikungunia test card, scrub typhus ab. card, ns1 elisa for dengue, igm elisa for chikungunia, igm elisa for hepatitis a, igm elisa for hepatitis e, igm elisa for scrub typhus, igm elisa for japanese enaphalitis, typhl dot for typhoid, igm elisa for leptospirosis, t pal salution 5 ltr, trop – t test, printed paper for cbc 5 part, printed paper for cbc 3 part, seman diluent fluid 100 ml, fruity 200ml, idsp lab reagents, test tubes without rim borosilicate, 25 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 15 x 150 mm, autoclavable caps for above test tubes 15 ml, test tubes without rim borosilicate, 12 x 150 mm, autoclavable caps for above test tubes, burette borosilicate 50 ml, burette stands, measuring cylinders graduated, 10 ml, petridishes, 15 x 90 mm borosilicate, universal bottles, 28 ml, mccartney bottles, 28 ml, funnels glass, diameter 100 mm, stem 50 mm, buchner flasks, 1 liter, beakers, borosilicate / pyrex, 1000 ml, conical flasks (erlenmeyer), pyrex 100 ml, volumetric flasks, grade a, 500 ml, pipettes, 1ml with 0.1 ml graduations grade a, glass bottles with polypropylene (autoclavable) screw caps, 500 ml, durham tubes 50 x 7.5 mm, cotton wool non absorbent, weighing boats, plastic 1 ¾ 5 boxes, weighing boats, plastic 3 5/16 5 boxes, brushes for bottle washing 40 cm, h2s water testing bottle, brilliant green broth, macconkey broth, eosin methylene blue, lactose broth, durham tubes 20x 7.5 mm, cotton wool non absorbent, measuring cylinders graduated, 10 ml, test tubes without rim borosilicate, 15 x 150 mm, pipettes, 1ml with 0.1 ml graduations grade a, test tubes without rim borosilicate, 25 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 15 x 150 mm, autoclavable caps for above test tubes, test tubes without rim borosilicate, 12 x 150 mm, autoclavable caps for above test tubes, test tubes stand aluminium 9 x 3 holes triple rack, meat extract b, powder, brilliant green stain powder, bromo cresol green indicator powder, carbol fuchsin, practical grade, carmine staining powder, sq’ chloroform, cresol red indicator powder, sq’ m cresol, sq’ diethyl ether, eosin yellow staining powder (water soluble), eosin stain solution (2% w/v), fuchsin acid staining powder (acid fuchsin), gentian violet powder, giemsa’s staining powder, gram’s iodine stain solution, sq’ iodine resublimed, litmus blue indicator papers, litmus red indicator papers, malachite green staining powder, sq’ mannitol, nessler’s reagent (for ammonia), leishman’s stain powder, phenol red indicator powder (water soluble), phenolphthalein indicator powder, phosphotungstic acid ‘excelar’, sq’ potassium iodide, sq’ potassium oxalate monohydrate, sq’ iso propyl alcohol (propan 2 ol), safranine staining powder, sq’ sodium chloride, sq’ sodium hydroxide flakes, thymol blue indicator powder, tryptone (bacteriological) mediaid, wright’s stain, hi cert, sq’ xylene sulphur free, sq’ zinc sulphate heptahydrate, methylene blue staining powder, sq’ hydrochloric acid, sq’ amyl alcohol (iso amyl alcohol), n,n,n’,n’ tetramethyl p phenylenediamine dihydrochloride, sq’ p dimethyl amino benzaldehyde (ehrlich’s reagent), kovacs’ indole reagent, hidispotm bag 10*, gordon mcleod reagent (oxidase reagent), gram stains kit, albert`s metachromatic stains kit, crystal violet staining powder, carbol fuchsin conc. (ziehl neelsen) stain solution, carbol fuchsin dilute (ziehl neelsen) stain solution, gram’s iodine stain solution, neutral red indicator powder, safranine staining powder, methylene blue staining powder, sq’ iodine resublimed, sq’ potassium iodide, sq’ ammonium oxalate monohydrate, thymol blue indicator powder, phenol red indicator powder (water soluble), neutral red indicator powder, bromo cresol green indicator powder, bromo cresol green indicator powder, chlorophenol red, hi cert, congo red indicator powder, horse serum, antibiotics, ampicillin 10 mcg (50 disc), chloramphenicol 30 mcg, co trimoxazole 25 mcg (sulpha/trimethoprim) (23.75/1.25mcg), erythromycin 15 mcg, gentamicin 10 mcg, nitrofurantoin 300 mcg, oxacillin 1 mcg, piperacillin 100 mcg, tetracycline 30 mcg, trimethoprim 5 mcg, amikacin 30 mcg, ceftriaxone 30 mcg, cefuroxime 30 mcg, ciprofloxacin 30 mcg, clindamycin 10 mcg, nalidixic acid 30 mcg (50 disc), tobramycin 10 mcg, bacitracin 10 units, potassium tellurite 3.5% (1 ml per vial), vancomycin, colistin (methane sulphonate), nystatin 50 mcg, urea broth base, xylose lysine deoxycholate agar (xld agar), potassium cyanide broth base w/o kcn, dulcitol selenite broth, glucose broth, lactose monohydrate, bacteriological grade, lactose broth, brilliant green bile broth, macconkey broth w/ neutral red, ethyl alcohol, malachite green staining powder, ‘sq’ sodium chloride, ‘sq’ phenol (carbolic acid), toluidine blue o, practical grade, fuchsin basic staining powder (basic fuchsin), ‘sq’ potassium hydroxide pellets, ‘sq’ sodium carbonate anhydrous, azure a, hi cert, azure b, hi cert, ‘sq’ sodium dihydrogen orthophosphate dihydrate (sodium acid phosphate), ‘sq’ potassium dihydrogen orthophosphate, ‘sq’ methanol, ‘sq’ acetic acid glacial, ‘sq’ maltose monohydrate, ‘sq’ sodium thiosulphate pentahydrate (hypo), ‘sq’ calcium carbonate, n 95 particulate respirator with exhalation, size regular,, ‘sq’ hydrochloric acid, whatman filter paper no. 1, size 12.5cm, 100/pk, triclogel dispenser bottle* w/ pump in 500 ml bottle (hand sanitizer), spatula 8, ‘sq’ hydrogen peroxide solution 30% w/v (100 volumes), glucose phosphate broth, granulated (buffered glucose broth, granulated) (mr vp medium, granulated), micropipette 100* capacity : 10 to 100 μl, micropipette 1000* capacity : 100 to 1000 μl, micropipette 10 capacity : 0.5 to 10 μl, μpet autoclavable micropipette 8 channel (20 200 μl), antibiotics disk positive hexa g, antibiotics disk negative hexa g, maleriya card antigen, maleriya card antibody, hiculture™ transport swabs w/amies medium (b), hiculture™ transport swabs w/ dey engley neutralizing broth, alkaline saline peptone water (aspw), alternative thioglycollate medium (nih thioglycollate broth) (thioglycollate broth, alternative), amies transport medium w/ charcoal, agar medium m (triple sugar, iron agar), columbia blood agar base, cooked meat medium (revised as cooked m medium) (r.c.medium), reagan lwe medium, hoyle medium base, potassium tellurite 3.5% (1 ml per vial), loeffler medium base, horse serum donor herd gamma irradiated sterile filtered, macconkey hiveg™ agar w/ cv, nacl, 0.003% nr and 1.5% agar, mycoplasma agar base (pplo agar base), mycoplasma enrichment supplement, nutrient broth w/ 1% peptone, nutrient agar w/ 1% peptone, nutrient agar, 1.5%, peptone water, pyrazinamidase agar, selenite f broth (twin pack) medium 11 (in accordance with ip 2007), stuart transport medium w/o methylene blue with charcoal, tellurite blood agar base, haemoglobin powder, vitamino growth supplement (twin pack), potassium tellurite 1% (1 ml per vial), transport charcoal medium, transport liquid medium, stuart transport medium (transport medium, stuart), tryptic soya agar, field’s tryptic digest broth (tryptic digest broth), tryptone tellurite agar base, potassium tellurite 1% (1 ml per vial), autoclavable petri plates polycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm., makarthy tube, aluminium cap with silicon rubber gasket, flat bottom vol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall, wash bottle; capacity 500ml, metaloop sl, sterile cotton swab, triclogel in 100 ml bottle, steriswift™ disinfectant wipes size: 7” x 7”, bactrex™ plus, bottles, reagent, graduated with screw cap and pouring ring, 100ml, sterile pure viscose swab, mbl esbl, esbl multi, steam indicator tape, hivibrio™ identification kit, hisalmonella™ identification kit, himotility™ biochemical kit for salmonella, geobacillus stearothermophilus, anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre (le002f) 1 no & anaero indicator tablet (le065)., anaerobic system mark v, hisalmonella™ latex test kit, mccartney bottle w/ aluminium cap neutral glass, autoclavable., sterile pure viscose swab, nasco sampling bag, thumb press dispensing dropper/ pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack., test tube without rim, glass cap. 38x200mm, 50/pk, labolene neutral ph, plasticine, dpx mountant (for microscopy), sq’ potassium hydroxide pellets, sq’ hydrogen peroxide solution 30% w/v (100 volumes), sq’ charcoal powder activated 250 mb, spore strips (25 strips/pack), sterile membrane syringe filters all size, lugol’s iodine, grams iodine, stabilized, methylene blue (aqueous), safranin, 0.5% w/v, gram’s crystal violet, albert’s stain a, albert’s stain b, grams decolourizer, conical flask erlenmeyer cap. 250ml, 120 ml capacity glass bottle with alluminium cap, felix tube, dreyers tube, pointed foceps 6/4, kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm, alluminium racks 4*12 all size tubes, magnifying glass/hand lens dia 3, metal loops holder, test tube without rim, glass cap.12x75mm, 100/pk, 2, test tube without rim, glass cap. 15x125mm, 100/pk, test tube without rim, glass cap. 18x150mm, 100/pk, hiassorted™ biochemical test kit, blotting papers sheet 46x57cm, antibiotics, bacitracin disc 10 mcg, 5 x 100 disc, bile esculin disc, (50 discs / vl), novobiocin disc, 5 x 100 disc, optochin disc, (50 discs / vl), ampicillin disc 10 mcg , 5 x 100 disc, ampicillin/sulbactam (10/10 mcg), 5 x 100 disc, amikacin disc 30 mcg , 5 x 100 disc, amoxycillin + clavulanic acid (20/10 mcg) (amoxyclav 30mcg), 5 x 100 disc, aztreonam disc 30 mcg , 5 x 100 disc, azithromycin disc 15 mcg , 5 x 100 disc, cefixime disc 5 mcg , 5 x 100 disc, ceftazidime disc 30 mcg , 5 x 100 disc, ceftazidime + clavulanic acid disc, 5 x 100 disc, cetriaxone disc 30 mcg , 5 x 100 disc, cephalexin disc, 5 x 100 disc, cefachlor disc 30 mcg , 5 x 100 disc, cefamadmandole disc 30 mcg , 5 x 100 disc, cefazoline disc 30 mcg , 5 x 100 disc, cefdinir disc 5 mcg , 5 x 100 disc, cefmetazole disc 30 mcg , 5 x 100 disc, cefonicid disc 30 mcg , 5 x 100 disc, cefoparazone disc 75 mcg , 5 x 100 disc, cefotetan disc 30 mcg , 5 x 100 disc, cefpodoxime disc 10 mcg , 5 x 100 disc, cefprozil disc 30 mcg , 5 x 100 disc, ceftizoxime disc 30 mcg , 5 x 100 disc, cefuroxime disc 30 mcg , 5 x 100 disc, cephalothine disc 30 mcg , 5 x 100 disc, cephotaxime (cefotaxime) disc 30 mcg, 5x100 disc, cefoxitime disc 30 mcg , 5 x 100 disc, clarithromicine disc 15 mcg , 5 x 100 disc, clindamycin disc 2 mcg , 5 x 100 disc, colistin disc 10 mcg , 5 x 100 disc, co trimoxazole disc 25 mcg , 5 x 100 disc, furazolidone disc 50 mcg , 5 x 100 disc, kannamimycine disc 30 mcg, 5 x 100 disc, cefepime disc 30 mcg , 5 x 100 disc, chloramphenicol disc 30 mcg , 5 x 100 disc, ciprofloxacin disc 5 mcg , 5 x 100 disc, cefoxitin disc , 5 x 100 disc, cotrimoxazole disc, 5 x 100 disc, doxycyline disc 30 mcg , 5 x 100 disc, erythromycin disc 15 mcg, 5 x 100 disc, gentamycin disc 10 mcg , 5 x 100 disc, imipenam disc 10 mcg , 5 x 100 disc, linezolid disc 30 mcg , 5 x 100 disc, levofloxacine disc 5 mcg , 5 x 100 disc, lomefloxacine disc 10 mcg , 5 x 100 disc, methicilline disc 5 mcg , 5 x 100 disc, mezlocilline disc 5 mcg, 5 x 100 disc, mecillinam disc 10 mcg , 5 x 100 disc, meropenem disc 10 mcg , 5 x 100 disc, nitrofurantoin disc , 5 x 100 disc, nafcilin disc 1 mcg , 5 x 100 disc, netilmicin disc, 5 x 100 disc, norfloxacin disc, 5 x 100 disc, oxacilline disc , 5 x 100 disc, ofloxacin disc , 5 x 100 disc, penicilline g disc 10 mcg , 5 x 100 disc, piperacillin disc 100 mcg, 5 x 100 disc, piperacillin tazobactum disc, 5 x 100 disc, quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc, sulfisoxazole disc 300 mcg , 5 x 100 disc, ticarcilline disc 75 mcg , 5 x 100 disc, ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc, teicoplanin disc, 5 x 100 disc, tetracycline disc 30 mcg , 5 x 100 disc, tobramycin disc, 5 x 100 disc, vancomycin disc, 5 x 100 disc, meropenam disc, 5 x 100 disc, cefpodoxime, 5 x 100 disc, clarithromycin disc, 5 x 100 disc, clindamycin disc, 5 x 100 disc, polymyxin b 300 units disc, 5 x 100 disc, nalidixic acid disc, 5 x 100 disc, swabs cat. ref. case qty material sterility, wooden applicator sticks, plain swab, wooden shaft, cotton tip, plain swab, wooden shaft, cotton tip individually, plain swab, polystyrene shaft, cotton tip individually, plain swab, wooden shaft, cotton tip, plain swab in round tube, wooden shaft, cotton tip, plain swab in round tube, polystyrene shaft, cotton tip, amies transport swab, plain media, polystyrene shaft,, viscose tip, amies transport swab, charcoal media, polystyrene, shaft, viscose tip, environmental swabs, enviromax foam tip sampling swab, enviromax foam tip sampling swab sterile, enviromax pre moistened samplig swab sterile, esk 4ml neutralising buffer swab, esk 10ml neutralising buffer swab, petri dishes loops and spreaders, 90mm triple vent, 55mm triple vent, contact plate 65 x 16mm, 120mm x 120mm square, vented, 140mm triple vent, 1ul shortie loop, 10ul shortie loop, 5ul shortie loop, 1ul loop packs, 10ul loop packs, l shaped spreaders in packs, blue spreaders in packs, ‘u’ well microtitration plate, ‘f’ well microtitration plate, ‘v’ well microtitration plate, lid for microtitre plates, large containers ( 24 hour urine ) and sweetie jars, 2 litre graduated pe container, 2.5 litre 24 hour urine collection, labelled, 2.7 litre graduated pe container, 5 litre 24 hour urine container, sweet jar with cap, small, sweet jar with cap & label, small pet, sweet jar with cap, large pet, sweet jar with cap & label, large, 250ml snap top bucket, 250ml snap top bucket and lid, 500ml snap top bucket, containers, 7ml bijou container, no label, 7ml bijou container, with plain label, 7ml bijou container, with boric acid, 7ml bijou container, no label, 30ml universal, with label flow seal, 30ml universal, plain label, 30ml universal with spoon, printed label, 30ml universal, no label, 30ml universal, printed label, 30ml universal, with boric acid, no label, 60ml clear plastic cap, no label, 60ml clear plastic cap, with printed label, 60ml container blue p/p screw cap plain label, 60ml container dark blue p/p screw cap plain label, 60ml plastic cap container, no label, 60ml plastic cap container, no label, 60ml plastic cap container, plain label, 60ml metal cap container, printed label, tray wrapped, 60ml metal cap container, no label, tray wrapped, 100ml metal cap container, printed label, tray wrapped, 100ml metal cap container, no label, tray wrapped, 125ml container dark blue, screw cap, plain label, 125ml container blue, screw cap, plain label, 125ml container natural, screw cap, plain label, 125ml container screw cap with spoon, plain label, 150ml metal cap container, no label, tray wrapped, 150ml metal cap container, printed label, tray wrapped, 160ml container with spoon, 200ml container blue p/p screw cap, no label, 200ml container blue p/p screw cap, plain label, 200ml container natural p/p screw cap, no label, 250ml metal cap container, printed label, tray wrapped, 250ml metal cap container, no label, tray wrapped, 250ml metal cap container, plain label, tray wrapped, 200ml container, no label, 30ml dippa sampler with handle, 250ml dippa sampler with handle ps/pp blue, 500ml sodium thiosulphate bottle, 1000ml sodium, thiosulphate bottle, 500ml sample bottle plain label, 1000ml sample bottle plain label, 500ml wide mouth container with thiosulphate, 1000ml wide mouth container with thiosulphate, 1000ml wide mouth container, test tubes polystyrene and polypropylene, 55 x 11mm, round bottom, cap to fit 11mm diameter tube, cap to fit 12mm diameter tube, plug tight cap to fit 13mm diameter tube, re caps to fit 13mm tube, 13mm hanging vacutainer insert flat bottom., 12ml conical base, 16 x 100 conical tube, centrifuge tubes, 15ml graduated with screw cap, 15ml conical with screw cap, 50ml graduated with screw cap (self standing), 4.5ml pasteur pipette, 1ml pasteur, plastic graduated, 1ml pasteur pipette, ind. wrapped, 3ml pasteur, plastic graduated, 3ml pasteur pipette, ind. wrapped, 1ml pasteur, plastic graduated sterile pack, 1ml pasteur, plastic graduated sterile ind. wrap., 3ml pasteur, plastic graduated sterile ind. wrap, 5ml pasteur pipette, graduated, 7ml pasteur pipette, jumbo, 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s, 3ml fine tip, pasteur pipette 210002 500 pe ns, 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns, 3.0ml micro tip, pasteur pipette 210004 250 pe ns, 2.5ml pasteur pipette 210006 400 pe ns, 3ml fine tip, pasteur pipette, ind. wrapped, 1ml micro tip pasteur pipette, 3ml pasteur pipette, peel pack, serological pipettes, 1ml. taper jet, bulk wrap, pipette tips, yellow pipette tip 5 200ul eppendorf, yellow pipette tip 5 200ul eppendorf (racked), blue pipette tip 100 1000ul eppendorf, blue pipette tip 100 1000ul eppendorf (racked), yellow pipette tip 5 200ul, yellow pipette tip 5 200ul (racked) 199620 10 x 96 pp ns, blue pipette tip 100 1000ul, blue pipette tip 100 1000ul (racked) 10 x 96 pp ns, white slim pipette tip 5 200ul, blue slim line tip 200 1000ul, white macro pipette tip 5000ul, natural pipette tip 1000 5000ml, natural pipette tip 1000 5000ml universal, essential microbiology consumables gloves cat. ref. case qty material sterility, powder free / small (6 7) latex ns, powder free, easy stretch, white, small (6 7) nitrile ns, plastic bags / zip lock bags, microcentrifuge tubes, microtube 0.5ml, microtube 2.0ml flat cap, screw cap microtubes and cryovials, 2ml skirted microtube without cap, screw cap with o ring, natural, screw cap with o ring, white, screw cap with o ring, orange, screw cap with o ring, red, screw cap with o ring, blue, screw cap with o ring, green, screw cap with o ring, yellow, screw cap with o ring, black, 1.2ml cryovial storage to 190 c, 2.0ml cryovial storage to 190 c, 5.0ml cryovial storage to 190 c, essential microbiology consumables, scoops and weigh boats cat. ref. case qty material sterility, 5ml white diamond, 41 x 41 x 8mm, 30ml white diamond, 89 x 89 x 25mm, 100ml white diamond, 140 x 140 x 22mm, 10ml measuring scoop, microscope slides and cover slips, white superfrost slides blue superfrost slides, plain slide cut edge, plain slide ground edge, twin frosted slide ground edge twin frosted slide ground edge, twin frosted slide cetiglass pure glass 76x26x1mm, cover slip 18x18, slide mailer, slide box 100, autoclave bags and paper products, autoclave bags 310 x 660mm, high temp., yellow clinical waste bags 30 x 39, ethylene oxide gas tape 19mm x 50m, dry heat (pou pinel) tape 19mm x 50m, autoclave tape 19mm x 50m, specimen bag, 5½˝ x 6˝ x 8½˝, specimen bag, printed biohazard, absorbent benchcoat 50cm x 50 meters, 10 inch hygiene rolls 2 ply, white, c fold 1 ply, green, medical wipes 2 ply, white, post lip paper / slide blotting paper, absorbent bench paper sheets, filter paper 50x50cm, microtips racks box of all size, macconkey agar w/o cv w/0.15% bile salt, nutrient agar, ss agar (salmonella shigella agar), mueller hinton agar, cary blair medium base (transport medium w/o charcoal), triple sugar iron agar, mannitol salt agar, urea agar base (christensen) (autoclavable), simmons citrate agar, bile salt agar, xylose lysine deoxycholate agar (xld agar), tcbs agar, deoxycholate citrate agar (agar medium j), brain heart infusion broth, peptone, bacteriological, sorbitol agar (macconkey sorbitol agar), sabouraud dextrose agar, glucose broth, tryptic soya agar, bordet gengou agar base with supllements, gordon mcleod reagent (oxidase reagent), kovacs’ indole reagent, ‘sq’ acetone, ‘sq’ iodine resublimed, gram stains kit, albert`s metachromatic stains kit, ‘sq’ phenol (carbolic acid), spirit, ethanol, absolute, antibiotics disc positive, antibiotics disc negative, metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml., nicrome wire(resistance wire) 100gm, spirit lamp, cotton roll 500gm, aluminium foil, plain slides, cover slip size 18mm round, grooves glass slides, bhi supplemented w/ 0.05% spsä, conical flask erlenmeyer cap.500ml, petri dish culture, s line size, 80x15, glass measuring cylinder, cap. 250ml, glass measuring cylinder, cap. 500ml, test tube with rim size 12x75mm, 100/pk, test tube with rim size 15x125mm, 100/pk, test tube with rim size 18x150mm, 100/pk, surgical gloves, 100/pk, micro tips 10 100μl, 1000/pk, yellow, micro tips 100 1000μl, 500/pk, blue, plastic beaker 500 ml, pvc, glass beaker, cap. 500ml, sterile disposable petri plates* polystyrene, optically clear, size : 100 mm diameter x 15 mm, individually packed., labolene neutral ph (soap solution), for glassware washing, ph indicator papers full range (ph 1.0 to 14.0), distill water, micropipette 100* capacity : 10 to 100 μl, micropipette 1000* capacity : 100 to 1000 μl, micropipette 10 capacity : 0.5 to 10 μl, μpet autoclavable micropipette 8 channel (20 200 μl), disposable masks, bloting paper, filter paper size 12.5cm circule, serological test for typhoid, zn acid fast stains, ‘sq’ sulphuric acid, giemsa’s stain, ‘sq’ formaldehyde solution 37 41% w/v, ‘sq’ potassium oxalate monohydrate, ‘sq’ sodium hypochlorite solution (available chlorine 4% w/v approx.), funnels, plain , size 50mm, funnels, plain , size 75mm, pestle & mortar, ‘sq’ acetic acid glacial, methylene blue aqueous stain solution, staining rods/ staining tray/ slide tray, salmonella polyvalent somatic (o) antigen, salmonella polyvalent somatic (h) antigen, test tubes stand, pvc, glassware for measuring, forceps 5, tranport container etc ...

Medical Health And Family Welfare - Rajasthan

22708176 supply of laboratory reagents kits and other material 1 1 b.sugar god / pod nmack erba 1 10 x 500 ml 2 2 b.urea ( berthelot ) nmack erba 1 2 x 50 ml 3 3 s. cretinine ( kinetic ) nmack erba 1 2 x 50 ml 4 4 s.bilirubin t&d nmack erba 1 2 x 100 ml 5 5 sgot ( kinetic ) nmack erba 1 20 x 50 ml 6 6 sgpt ( kinetic ) nmack erba 1 20 x 50 ml 7 7 colestrol nmack erba 1 2 x 50 ml 8 8 widal 1 4 x 5 ml ( per pkt ) 9 9 ra 1 typhe dot each 10 10 aslo 1 50 t ( per vial ) 11 11 crp 1 50 t ( per vial ) 12 12 vdrl ( rp strip ) 1 1 x 100 stp ( each packet ) 13 13 hb sag card 1 1 x 50 card ( each packet ) 14 14 hcv 1 1 x 40 card ( each packet ) 15 15 hiv rapid 1 1 x 40 card ( each packet ) 16 16 hiv tri dot 1 1 x 100 t ( each packet ) 17 17 anti a 1 1 x 10 ml ( per vial ) 18 18 anti b 1 1 x 10 ml ( per vial ) 19 19 anti d igg+igm monocolan 1 1 x 10 ml ( per vial ) 20 20 anti ab 1 1 x 10 ml ( per vial ) 21 21 anti xh 1 1 x 10 ml ( per vial ) 22 22 ahg 1 1 x 10 ml ( per vial ) 23 23 anti a1 1 1 x 10 ml ( per vial ) 24 24 seurm bovine albumin 1 1 x 10 ml ( per vial ) 25 25 uristi x s parameter 1 1 x 100 stp ( each packet ) 26 26 multisti x 1 1 x 100 stp ( each packet ) 27 27 coomb sera vail 1 1x10 ml ( per boil ) 28 28 n / 10 hcl 1 1 x 500 mm ( per bottle ) 29 29 sodium citrate 3.8% 1 1 x 500 ml ( per bottle ) 30 30 lesmen stain 1 1 x 250 ml ( per bottle ) 31 31 lesmen powder 1 1 x 25 gm ( per pkt ) 32 32 tlc flude 1 1 x 500 ml ( per bottle ) 33 33 ceder wood oil 1 1 x 50 ml ( per bottle ) 34 34 pregnancy test rapid kit 1 1 x 100 stp ( per pkt ) 35 35 jsb stain a 1 1x500ml ( per bottle ) 36 36 jsb stain b 1 1 x 500 ml ( per bottle ) 37 37 sodium hypocloride 1 5 ltr can 38 38 xylene 1 1 x 500 ml per bottle 39 39 semen diluting fluid 1 100 ml per bottle 40 40 cpd beg 1 350 ml ( 10 pkt ) 41 41 cpd beg 1 100 ml ( 10 pkt ) 42 42 distil water 1 1 x 5 ltr ( per can ) 43 43 micro tips 2 200 ul 1 1 x 1000 ( per pkt ) 44 44 micro tips 5 1000 ul 1 1 x 1000 ( per pkt ) 45 45 cover slip 1 1 x 20 ( per pkt. ) 46 46 glass slide 1 1 x 50 ( per pkt ) 47 47 edta vail with screw cap ( k2 ) 1 1 x 100 ( per pkt ) 48 48 sodium cicrate tube for blood collection edta k3 1 1 x 100 ( per pkt ) 49 49 plane vail with screw cap 1 1 x 100 ( per pkt ) 50 50 urine collection container 1 1 x 100 ( per pkt ) 51 51 urine centrifugal vail 1 1 x 100 ( per pkt ) 52 52 esr tube glass 1 1x10 ( per pkt ) 53 53 state fax tube glass 1 each 54 54 glass tube 10 ml 1 per pkt 55 55 tissue paper 1 per pkt 56 56 ph paper 1 per pkt 57 57 blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes 1 each 58 58 abx minoclear 1 100 ml per pack 59 59 abx minidil lmg 1 20 l per pack 60 60 abx lyse bio 1 1 l per pack 61 61 abx cleaner 1 1 l per pack 62 62 minocal calibrator 1 2.0 ml per vail 63 63 minotrol 16 twin pak ( 02l ) 1 2.5 ml per vail 64 64 minotrol 16 twin pack ( 2n ) 1 2.5 ml per vail 65 65 minotrol 16 twin pack ( 2h ) 1 2.5 ml per vail 66 66 minoclair 1 0.5 ml per vail 67 67 paper roll for abx micro es 60 1 per pkt 68 68 reagents for elisa reader 69 69 hiv elisa 1 1 x 96 t per pkt 70 70 hbs ag elisa 1 1 x 96 t per pkt 71 71 hcv alisa 1 1 x 96 t per pkt 72 72 vtm kit 1 1 x 50 tube per pkt 73 73 anti d igg + igm 1 per vail 74 74 tournicate 1 per piece 75 75 rubber ball for blood donner 1 per piece 76 76 tharmograph paper for 1 per pkt 77 77 papper roll for sami auto analizer transasia 1 per pkt 78 78 papper roll sami auto analizer gyro 1 per pkt 79 79 papper roll automatic fully esr analizer transasia 1 per pkt 80 80 projection lamp 6v20w for microscope 1 each 81 81 fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables 1 system pack 82 82 albumin nmack erba 1 system pack per pkt 83 83 amylase nmack erba 1 system pack per pkt 84 84 bilirubin t&d nmack erba 1 system pack per pkt 85 85 urea nmack erba 1 system pack per pkt 86 86 cholestrol nmack erba 1 system pack per pkt 87 87 alkaline phosphate nmack erba 1 system pack per pkt 88 88 glucose nmack erba 1 system pack per pkt 89 89 s. creatinine nmack erba 1 system pack per pkt 90 90 calcium nmack erba 1 system pack per pkt 91 91 total protein nmack erba 1 system pack per pkt 92 92 triglyceride nmack erba 1 system pack per pkt 93 93 hdl cholestrol direct nmack erba 1 system pack per pkt 94 94 sgot nmack erba 1 system pack per pkt 95 95 sgpt nmack erba 1 system pack per pkt 96 96 chloride nmack erba 1 system pack per pkt 97 97 uric acid nmack erba 1 system pack per pkt 98 98 ck nmack erba 1 system pack per pkt 99 99 ckmb nmack erba 1 system pack per pkt 100 100 sample cup nmack erba 1 system pack per pkt 101 101 ggt nmack erba 1 system pack per pkt 102 102 ldl cholestrol with calibrator nmack erba 1 system pack per pkt 103 103 ldhp nmack erba 1 system pack per pkt 104 104 microprotein nmack erba 1 system pack per pkt 105 105 phosporus nmack erba 1 system pack per pkt 106 106 x l multical nmack erba 1 system pack per pkt 107 107 x l wash nmack erba 1 system pack per pkt 108 108 blood gas analizer regants nmack phox plus l nova biomedical 1 per pkt 109 109 calibration solution c 1 1 per pkt 110 110 calibration solution c 2 1 per pkt 111 111 fluid pack c 3 1 per pkt 112 112 fully automated biochemisty analayzer n model biosystem a25 reagent chemical & disposal 113 113 amylase direct nmack biosystem 1 system pack per pkt 114 114 amylase pancreatin nmack biosystem 1 system pack per pkt 115 115 adenosine deaminase ( ada ) nmack biosystem 1 system pack per pkt 116 116 alanine aminotransferase ( alt / gpt ) nmack biosystem 1 system pack per pkt 117 117 albumin nmack biosystem 1 system pack per pkt 118 118 alkaline phosphatase ( alp ) amp nmack biosystem 1 system pack per pkt 119 119 alkaline phosphatase ( alp ) dea nmack biosystem 1 system pack per pkt 120 120 aspantate aminotransferase ( ast / got ) nmack biosystem 1 system pack per pkt 121 121 bilrubin ( direct ) nmack biosystem 1 system pack per pkt 122 122 bilrubin ( total ) nmack biosystem 1 system pack per pkt 123 123 calcum arsenazo nmack biosystem 1 system pack per pkt 124 124 cabon diooxide nmack biosystem 1 system pack per pkt 125 125 cholesterol nmack biosystem 1 system pack per pkt 126 126 cholesterol hdl direct nmack biosystem 1 system pack per pkt 127 127 cholesterol ldl direct nmack biosystem 1 system pack per pkt 128 128 crecatinine kinase ck nmack biosystem 1 system pack per pkt 129 129 creatinine kinase mb ( ck , mb ) nmack biosystem 1 system pack per pkt 130 130 creatinine nmack biosystem 1 system pack per pkt 131 131 glutamyl transferase ( y gt ) nmack biosystem 1 system pack per pkt 132 132 glucose nmack biosystem 1 system pack per pkt 133 133 iron ferrozine nmack biosystem 1 system pack per pkt 134 134 lactate dehydrogenase ldh nmack biosystem 1 system pack per pkt 135 135 lipase nmack biosystem 1 system pack per pkt 136 136 magnesium nmack biosystem 1 system pack per pkt 137 137 phosphorus nmack biosystem 1 system pack per pkt 138 138 protein total nmack biosystem 1 system pack per pkt 139 139 protein ( urine / csf ) nmack biosystem 1 system pack per pkt 140 140 total bile acid nmack biosystem 1 system pack per pkt 141 141 triglycerides nmack biosystem 1 system pack per pkt 142 142 urea / bun vv nmack biosystem 1 system pack per pkt 143 143 uric acid nmack biosystem 1 system pack per pkt 144 144 sample cup nmack biosystem 1 1x1000 per pkt 145 145 washing solution nmack biosystem 1 500 ml per pkt 146 146 r washing solution nmack biosystem 1 500 ml per pkt 147 147 rotor nmack biosystem 1 10x120 per pkt 148 148 conc. system liquid nmack biosystem 1 1000 ml per pkt 149 149 halogen uv p lamp nmack biosystem 1 1 unit per pkt 150 150 control level 1 nmack biosystem 1 5x5 ml per pkt 151 151 control level ii nmack biosystem 1 5x5 ml per pkt 152 152 calibrator nmack biosystem 1 5x5 ml per pkt 153 153 urine analyzer strip 1 per pkt 154 154 gluco strip sd cheek code 21 1 per bottle 155 155 gluco strip accuchek 1 per bottle 156 156 gluco strip dr. marpirn 1 per bottle 157 157 semi auto analizer regents 1 per bottle 158 158 hemoglobino meter micro cuvette 1 per bottle 159 159 edta vial k 3 double cap 1 per pkt 160 160 fully auto analyser sample cube 1 per pkt 161 161 micropipettes 1 10 microliter 1 each 162 162 micropipettes 2 20 microliter 1 each 163 163 micropipettes 10 100 microliter 1 each 164 164 micropipettes 20 200 microliter 1 each 165 165 micropipettes 100 1000 microliter 1 each 166 166 micropipettes fix 10 microliter 1 each 167 167 micropipettes fix 50 microliter 1 each 168 168 micropipettes fix 100 microliter 1 each 169 169 micropipettes fix 200 microliter 1 each 170 170 micropipettes fix 500 microliter 1 each 171 171 westergreen stand 1 per piece 172 172 westergreen esr tube 1 each 173 173 dengue test kit rapid igm / ns1 1 each 174 174 chikungunia test card 1 each 175 175 scrub typhus ab. card 1 each 176 176 ns1 elisa for dengue 1 1 x 96 test 177 177 igm elisa for chikungunia 1 1 x 96 test 178 178 igm elisa for hepatitis a 1 each 179 179 igm elisa for hepatitis e 1 each 180 180 igm elisa for scrub typhus 1 1 x 96 test per pkt 181 181 igm elisa for japanese enaphalitis 1 per pkt 182 182 typhl dot for typhoid 1 each test per pkt 183 183 igm elisa for leptospirosis 1 each test 184 184 t pal salution 5 ltr 1 per can 185 185 trop – t test 1 each test 186 186 printed paper for cbc 5 part 1 per pkt 187 187 printed paper for cbc 3 part 1 per pkt 188 188 seman diluent fluid 100 ml 1 per bottle 189 189 fruity 200ml 1 per pkt 190 190 idsp lab reagents 191 191 test tubes without rim borosilicate, 25 x 150 mm 1 per pkt 192 192 autoclavable caps for above test tubes 1 per pkt 193 193 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 194 194 autoclavable caps for above test tubes 15 ml 1 per pkt 195 195 test tubes without rim borosilicate, 12 x 150 mm 1 per pkt 196 196 autoclavable caps for above test tubes 1 per pkt 197 197 burette borosilicate 50 ml 1 each 198 198 burette stands 1 each 199 199 measuring cylinders graduated, 10 ml 1 each 200 200 measuring cylinders graduated, 100ml 1 each 201 201 measuring cylinders graduated, 500 ml 1 each 202 202 measuring cylinders graduated, 1000 ml 1 each 203 203 petridishes, 15 x 90 mm borosilicate 1 each 204 204 universal bottles, 28 ml 1 per pkt 205 205 mccartney bottles, 28 ml 1 per pkt 206 206 funnels glass, diameter 100 mm, stem 50 mm 1 each 207 207 buchner flasks, 1 liter 1 each 208 208 beakers, borosilicate / pyrex, 1000 ml 1 each 209 209 beakers, borosilicate / pyrex, 500 ml 1 each 210 210 beakers, borosilicate / pyrex, 250 ml 1 each 211 211 beakers, borosilicate / pyrex, 2000 ml 1 each 212 212 conical flasks ( erlenmeyer ) , pyrex 100 ml 1 each 213 213 conical flasks ( erlenmeyer ) , pyrex 500 ml 1 each 214 214 conical flasks ( erlenmeyer ) , pyrex 1000 ml 1 each 215 215 conical flasks ( erlenmeyer ) , pyrex 2000 ml 1 each 216 216 volumetric flasks, grade a, 500 ml 1 each 217 217 volumetric flasks, grade a, 250 ml 1 each 218 218 volumetric flasks, grade a, 10 ml 1 each 219 219 pipettes, 1ml with 0.1 ml graduations grade a 1 each 220 220 pipettes, 2 ml with 0.1 ml graduations grade a 1 each 221 221 pipettes, 5 ml with 0.5 graduations grade a 1 each 222 222 pipettes, 10 ml with 1 ml graduations grade a 1 each 223 223 glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml 1 each 224 224 glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml 1 each 225 225 glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml 1 each 226 226 durham tubes 50 x 7.5 mm 1 per pkt 227 227 cotton wool non absorbent 1 per pkt 228 228 weighing boats, plastic 1 ¾ 5 boxes 1 each 229 229 weighing boats, plastic 3 5 / 16 5 boxes 1 each 230 230 brushes for bottle washing 40 cm 1 each 231 231 h2s water testing bottle 1 per pkt 232 232 brilliant green broth 1 500 gm 233 233 macconkey broth 1 500 gm 234 234 eosin methylene blue 1 500 gm 235 235 lactose broth 1 500 gm 236 236 durham tubes 20x 7.5 mm 1 per pkt 237 237 cotton wool non absorbent 1 per pkt 238 238 measuring cylinders graduated, 10 ml 1 each 239 239 measuring cylinders graduated, 100ml 1 each 240 240 measuring cylinders graduated, 500 ml 1 each 241 241 measuring cylinders graduated, 1000 ml 1 each 242 242 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 243 243 pipettes, 1ml with 0.1 ml graduations grade a 1 each 244 244 pipettes, 2 ml with 0.1 ml graduations grade a 1 each 245 245 pipettes, 5 ml with 0.5 graduations grade a 1 each 246 246 pipettes, 10 ml with 1 ml graduations grade a 1 each 247 247 test tubes without rim borosilicate, 25 x 150 mm 1 per pkt 248 248 autoclavable caps for above test tubes 1 per pkt 249 249 test tubes without rim borosilicate, 15 x 150 mm 1 per pkt 250 250 autoclavable caps for above test tubes 1 per pkt 251 251 test tubes without rim borosilicate, 12 x 150 mm 1 per pkt 252 252 autoclavable caps for above test tubes 1 per pkt 253 253 test tubes stand aluminium 9 x 3 holes triple rack 1 each 254 254 meat extract b, powder 1 500 gm 255 255 brilliant green stain powder 1 per pkt 256 256 bromo cresol green indicator powder 1 per pkt 257 257 bromo cresol purple indicator powder 1 per pkt 258 258 bromo phenol blue indicator powder 1 per pkt 259 259 bromo thymol blue indicator powder 1 per pkt 260 260 carbol fuchsin, practical grade 1 per pkt 261 261 carmine staining powder 1 per pkt 262 262 ‘sq’ chloroform 1 per pkt 263 263 cresol red indicator powder 1 per pkt 264 264 ‘sq’ m cresol 1 per pkt 265 265 ‘sq’ diethyl ether 1 per pkt 266 266 eosin yellow staining powder ( water soluble ) 1 per pkt 267 267 eosin stain solution ( 2% w / v ) 1 per pkt 268 268 fuchsin acid staining powder ( acid fuchsin ) 1 per pkt 269 269 fuchsin basic staining powder ( basic fuchsin ) 1 per pkt 270 270 gentian violet powder 1 per pkt 271 271 giemsa’s staining powder 1 per pkt 272 272 gram’s iodine stain solution 1 per pkt 273 273 ‘sq’ iodine resublimed 1 per pkt 274 274 litmus blue indicator papers 1 per pkt 275 275 litmus red indicator papers 1 per pkt 276 276 malachite green staining powder 1 per pkt 277 277 ‘sq’ mannitol 1 per pkt 278 278 nessler’s reagent ( for ammonia ) 1 per pkt 279 279 leishman’s stain powder 1 per pkt 280 280 phenol red indicator powder ( water soluble ) 1 per pkt 281 281 phenolphthalein indicator powder 1 per pkt 282 282 phenolphthalein indicator solution 1 per pkt 283 283 phosphotungstic acid ‘excelar’ 1 per pkt 284 284 ‘sq’ potassium iodide 1 per pkt 285 285 ‘sq’ potassium oxalate monohydrate 1 per pkt 286 286 ‘sq’ iso propyl alcohol ( propan 2 ol ) 1 per pkt 287 287 safranine staining powder 1 per pkt 288 288 ‘sq’ sodium chloride 1 per pkt 289 289 ‘sq’ sodium hydroxide flakes 1 per pkt 290 290 thymol blue indicator powder 1 per pkt 291 291 thymol blue indicator solution 1 per pkt 292 292 thymolphthalein indicator solution 1 per pkt 293 293 tryptone ( bacteriological ) mediaid 1 per pkt 294 294 wright’s stain, hi cert 1 per pkt 295 295 ‘sq’ xylene sulphur free 1 per pkt 296 296 ‘sq’ zinc sulphate heptahydrate 1 per pkt 297 297 methylene blue staining powder 1 per pkt 298 298 ‘sq’ hydrochloric acid 1 500 ml 299 299 ‘sq’ amyl alcohol ( iso amyl alcohol ) 1 500 ml 300 300 n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride 1 500 ml 301 301 ‘sq’ p dimethyl amino benzaldehyde ( ehrlich’s reagent ) 1 500 ml 302 302 kovacs’ indole reagent 1 500 ml 303 303 hidispotm bag 10* 1 500 ml 304 304 gordon mcleod reagent ( oxidase reagent ) 1 500 ml 305 305 gram stains kit 306 306 albert`s metachromatic stains kit 1 1 kit 307 307 crystal violet staining powder 1 per pkt 308 308 carbol fuchsin conc. ( ziehl neelsen ) stain solution 1 per pkt 309 309 carbol fuchsin dilute ( ziehl neelsen ) stain solution 1 per pkt 310 310 gram’s iodine stain solution 1 per pkt 311 311 neutral red indicator powder 1 per pkt 312 312 safranine staining powder 1 per pkt 313 313 methylene blue staining powder 1 per pkt 314 314 ‘sq’ iodine resublimed 1 per pkt 315 315 ‘sq’ potassium iodide 1 per pkt 316 316 ‘sq’ ammonium oxalate monohydrate 1 per pkt 317 317 thymol blue indicator powder 1 per pkt 318 318 phenol red indicator powder ( water soluble ) 1 per pkt 319 319 neutral red indicator powder 1 per pkt 320 320 methyl red indicator powder 1 per pkt 321 321 bromo cresol green indicator powder 1 per pkt 322 322 bromo cresol green indicator powder 1 per pkt 323 323 chlorophenol red, hi cert 1 per pkt 324 324 congo red indicator powder 1 per pkt 325 325 horse serum 1 per vial 326 326 antibiotics 327 327 ampicillin 10 mcg ( 50 disc ) 1 per vial 328 328 chloramphenicol 30 mcg 1 per vial 329 329 co trimoxazole 25 mcg ( sulpha / trimethoprim ) ( 23.75 / 1.25mcg ) 1 per vial 330 330 erythromycin 15 mcg 1 per vial 331 331 gentamicin 10 mcg 1 per vial 332 332 nitrofurantoin 300 mcg 1 per vial 333 333 oxacillin 1 mcg 1 per vial 334 334 piperacillin 100 mcg 1 per vial 335 335 tetracycline 30 mcg 1 per vial 336 336 trimethoprim 5 mcg 1 per vial 337 337 amikacin 30 mcg 1 per vial 338 338 ceftriaxone 30 mcg 1 per vial 339 339 cefuroxime 30 mcg 1 per vial 340 340 ciprofloxacin 30 mcg 1 per vial 341 341 clindamycin 10 mcg 1 per vial 342 342 nalidixic acid 30 mcg ( 50 disc ) 1 per vial 343 343 tobramycin 10 mcg 1 per vial 344 344 bacitracin 10 units 1 per vial 345 345 potassium tellurite 3.5% ( 1 ml per vial ) 1 per vial 346 346 vancomycin 1 per vial 347 347 colistin ( methane sulphonate ) 1 per vial 348 348 nystatin 50 mcg 1 per vial 349 349 urea broth base 1 per vial 350 350 xylose lysine deoxycholate agar ( xld agar ) 1 500 gm 351 351 potassium cyanide broth base w / o kcn 1 500 gm 352 352 dulcitol selenite broth 1 500 gm 353 353 glucose broth 1 500 gm 354 354 lactose monohydrate, bacteriological grade 1 500 gm 355 355 lactose broth 1 500 gm 356 356 brilliant green bile broth 1 500 gm 357 357 macconkey broth w / neutral red 1 500 gm 358 358 ethyl alcohol 1 500 gm 359 359 malachite green staining powder 1 500 gm 360 360 ‘sq’ sodium chloride 1 500 gm 361 361 ‘sq’ phenol ( carbolic acid ) 1 500 gm 362 362 toluidine blue o, practical grade 1 500 gm 363 363 fuchsin basic staining powder ( basic fuchsin ) 1 500 gm 364 364 ‘sq’ potassium hydroxide pellets 1 500 gm 365 365 ‘sq’ sodium carbonate anhydrous 1 500 gm 366 366 azure a, hi cert 1 500 gm 367 367 azure b, hi cert 1 500 gm 368 368 ‘sq’ sodium dihydrogen orthophosphate dihydrate ( sodium acid phosphate ) 1 500 gm 369 369 ‘sq’ potassium dihydrogen orthophosphate 1 500 gm 370 370 ‘sq’ methanol 1 500 ml 371 371 ‘sq’ acetic acid glacial 1 500 ml 372 372 ‘sq’ maltose monohydrate 1 500 ml 373 373 ‘sq’ sodium thiosulphate pentahydrate ( hypo ) 1 500 ml 374 374 ‘sq’ calcium carbonate 375 375 n 95 particulate respirator with exhalation, size regular, 1 per pkt 376 376 ‘sq’ hydrochloric acid 1 500 ml 377 377 whatman filter paper no. 1, size 12.5cm, 100 / pk 1 per pkt 378 378 triclogel dispenser bottle* w / pump in 500 ml bottle ( hand sanitizer ) 1 per bottle 379 379 spatula 8 1 each 380 380 ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) 1 500 ml 381 381 glucose phosphate broth, granulated ( buffered glucose broth, granulated ) ( mr vp medium, granulated ) 1 500 gm 382 382 micropipette 100* capacity : 10 to 100 μl 1 each 383 383 micropipette 1000* capacity : 100 to 1000 μl 1 each 384 384 micropipette 10 capacity : 0.5 to 10 μl 1 each 385 385 μpet autoclavable micropipette 8 channel ( 20 200 μl ) 1 each 386 386 antibiotics disk positive hexa g 1 50 disc vial 387 387 antibiotics disk negative hexa g 1 50 disc vial 388 388 maleriya card antigen 1 1 pkt 389 389 maleriya card antibody 1 1 pkt 390 390 hiculture™ transport swabs w / amies medium ( b ) 1 1 pkt 391 391 hiculture™ transport swabs w / dey engley neutralizing broth 1 1 pkt 392 392 alkaline saline peptone water ( aspw ) 1 500 gm 393 393 alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) 1 500 gm 394 394 amies transport medium w / charcoal 1 500 gm 395 395 agar medium m ( triple sugar, iron agar ) 1 500 gm 396 396 columbia blood agar base 1 500 gm 397 397 cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) 1 500 gm 398 398 reagan lwe medium 1 500 gm 399 399 hoyle medium base 1 500 gm 400 400 potassium tellurite 3.5% ( 1 ml per vial ) 1 each vial 401 401 loeffler medium base 1 500 gm 402 402 horse serum donor herd gamma irradiated sterile filtered 1 500 ml 403 403 macconkey hiveg™ agar w / cv, ?nacl, 0.003% nr and 1.5% agar 1 500 gm 404 404 mycoplasma agar base ( pplo agar base ) 1 500 gm 405 405 mycoplasma enrichment supplement 1 1 pkt 406 406 nutrient broth w / 1% peptone 1 500 gm 407 407 nutrient agar w / 1% peptone 1 500 gm 408 408 nutrient agar, 1.5% 1 500 gm 409 409 peptone water 1 500 gm 410 410 pyrazinamidase agar 1 500 gm 411 411 selenite f broth ( twin pack ) medium 11? ( in accordance with ip 2007 ) 1 500 gm 412 412 stuart transport medium w / o methylene blue with charcoal 1 500 gm 413 413 tellurite blood agar base 1 500 gm 414 414 haemoglobin powder 1 1 pkt 415 415 vitamino growth supplement ( twin pack ) 1 1 pkt 416 416 potassium tellurite 1% ( 1 ml per vial ) 1 1 vial 417 417 transport charcoal medium 1 500 gm 418 418 transport liquid medium 1 500 gm 419 419 stuart transport medium ( transport medium, stuart ) 1 500 gm 420 420 tryptic soya agar 1 500 gm 421 421 field’s tryptic digest broth ( tryptic digest broth ) 1 500 gm 422 422 tryptone tellurite agar base 1 500 gm 423 423 potassium tellurite 1% ( 1 ml per vial ) 1 500 gm 424 424 autoclavable petri plates polycarbonate, clear, transparent and unbreakable, ?size : 90 mm, diameter x 15 mm. 1 per pkt 425 425 makarthy tube, aluminium cap with silicon rubber gasket, flat bottom vol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall 1 per pkt 426 426 wash bottle; capacity 500ml 1 each 427 427 metaloop sl 1 each 428 428 sterile cotton swab 1 per pkt 429 429 triclogel in 100 ml bottle 1 each bottle 430 430 steriswift™ disinfectant wipes size: 7” x 7” 1 per pkt 431 431 bactrex™ plus 432 432 bottles, reagent, graduated with screw cap and pouring ring, 100ml 1 each 433 433 sterile pure viscose swab 1 pkt 434 434 mbl esbl 1 pkt 435 435 esbl multi 1 pkt 436 436 steam indicator tape 1 pkt 437 437 hivibrio™ identification kit 1 pkt 438 438 hisalmonella™ identification kit 1 pkt 439 439 himotility™ biochemical kit for salmonella 1 kit 440 440 geobacillus stearothermophilus 1 pkt 441 441 anaero box – s transparent unbreakable polycarbonate box, ?size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, ?accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . 1 each 442 442 anaerobic system mark v 1 each 443 443 hisalmonella™ latex test kit 1 each 444 444 mccartney bottle ?w / aluminium cap neutral glass, autoclavable. 1 pkt 445 445 sterile pure viscose swab 1 pkt 446 446 nasco sampling bag 1 pkt 447 447 thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, ?available in individual sterile pack. 1 pkt 448 448 test tube without rim, glass cap. 38x200mm, 50 / pk 1 per pkt 449 449 labolene neutral ph 1 per pkt 450 450 plasticine 1 per pkt 451 451 dpx mountant ( for microscopy ) 1 per pkt 452 452 ‘sq’ potassium hydroxide pellets 1 per pkt 453 453 ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) 1 1 vial 500 ml 454 454 ‘sq’ charcoal powder activated 250 mb 1 pkt 455 455 spore strips ( 25 strips / pack ) 1 per pkt 456 456 sterile membrane syringe filters all size 1 per pkt 457 457 lugol’s iodine 1 500 ml 458 458 grams iodine, stabilized 1 500 ml 459 459 methylene blue ( aqueous ) 1 500 ml 460 460 safranin, 0.5% w / v 1 500 ml 461 461 gram’s crystal violet 1 500 ml 462 462 albert’s stain a 1 500 ml 463 463 albert’s stain b 1 500 ml 464 464 grams decolourizer 1 500 ml 465 465 conical flask erlenmeyer cap. 250ml 1 each 466 466 120 ml capacity glass bottle with alluminium cap 1 each 467 467 felix tube 1 each 468 468 dreyers tube 1 each 469 469 pointed foceps 6 / 4 1 each 470 470 kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm 1 each 471 471 alluminium racks 4*12 all size tubes 1 each 472 472 magnifying glass / hand lens dia 3 1 each 473 473 metal loops holder 1 each 474 474 test tube without rim, glass cap.12x75mm, 100 / pk 1 per pkt 475 475 test tube without rim, glass cap. 15x125mm, 100 / pk 1 per pkt 476 476 test tube without rim, glass cap. 18x150mm, 100 / pk 1 per pkt 477 477 hiassorted™ biochemical test kit 1 each kit 478 478 blotting papers sheet 46x57cm 1 pkt 479 479 antibiotics 480 480 bacitracin disc 10 mcg, 5 x 100 disc 1 1 vial 100 disc 481 481 bile esculin disc, ( 50 discs / vl ) 1 1 vial 50 disc 482 482 novobiocin disc, 5 x 100 disc 1 1 vial 483 483 optochin disc, ( 50 discs / vl ) 1 1 vial 484 484 ampicillin disc 10 mcg , 5 x 100 disc 1 1 vial 485 485 ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc 1 1 vial 486 486 amikacin disc 30 mcg , 5 x 100 disc 1 1 vial 487 487 amoxycillin + clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc 1 1 vial 488 488 aztreonam disc 30 mcg , 5 x 100 disc 1 1 vial 489 489 azithromycin disc 15 mcg , 5 x 100 disc 1 1 vial 490 490 cefixime disc 5 mcg , 5 x 100 disc 1 1 vial 491 491 ceftazidime disc 30 mcg , 5 x 100 disc 1 1 vial 492 492 ceftazidime + clavulanic acid disc, 5 x 100 disc 1 1 vial 493 493 cetriaxone disc 30 mcg , 5 x 100 disc 1 1 vial 494 494 cephalexin disc, 5 x 100 disc 1 1 vial 495 495 cefachlor disc 30 mcg , 5 x 100 disc 1 1 vial 496 496 cefamadmandole disc 30 mcg , 5 x 100 disc 1 1 vial 497 497 cefazoline disc 30 mcg , 5 x 100 disc 1 1 vial 498 498 cefdinir disc 5 mcg , 5 x 100 disc 1 1 vial 499 499 cefmetazole disc 30 mcg , 5 x 100 disc 1 1 vial 500 500 cefonicid disc 30 mcg , 5 x 100 disc 1 1 vial 501 501 cefoparazone disc 75 mcg , 5 x 100 disc 1 1 vial 502 502 cefotetan disc 30 mcg , 5 x 100 disc 1 1 vial 503 503 cefpodoxime disc 10 mcg , 5 x 100 disc 1 1 vial 504 504 cefprozil disc 30 mcg , 5 x 100 disc 1 1 vial 505 505 ceftizoxime disc 30 mcg , 5 x 100 disc 1 1 vial 506 506 cefuroxime disc 30 mcg , 5 x 100 disc 1 1 vial 507 507 cephalothine disc 30 mcg , 5 x 100 disc 1 1 vial 508 508 cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc 1 1 vial 509 509 cefoxitime disc 30 mcg , 5 x 100 disc 1 1 vial 510 510 clarithromicine disc 15 mcg , 5 x 100 disc 1 1 vial 511 511 clindamycin disc 2 mcg , 5 x 100 disc 1 1 vial 512 512 colistin disc 10 mcg , 5 x 100 disc 1 1 vial 513 513 co trimoxazole disc 25 mcg , 5 x 100 disc 1 1 vial 514 514 furazolidone disc 50 mcg , 5 x 100 disc 1 1 vial 515 515 kannamimycine disc 30 mcg, 5 x 100 disc 1 1 vial 516 516 cefepime disc 30 mcg , 5 x 100 disc 1 1 vial 517 517 chloramphenicol disc 30 mcg , 5 x 100 disc 1 1 vial 518 518 ciprofloxacin disc 5 mcg , 5 x 100 disc 1 1 vial 519 519 cefoxitin disc , 5 x 100 disc 1 1 vial 520 520 cotrimoxazole disc, 5 x 100 disc 1 1 vial 521 521 doxycyline disc 30 mcg , 5 x 100 disc 1 1 vial 522 522 erythromycin disc 15 mcg, 5 x 100 disc 1 1 vial 523 523 gentamycin disc 10 mcg , 5 x 100 disc 1 1 vial 524 524 imipenam disc 10 mcg , 5 x 100 disc 1 1 vial 525 525 linezolid disc 30 mcg , 5 x 100 disc 1 1 vial 526 526 levofloxacine disc 5 mcg , 5 x 100 disc 1 1 vial 527 527 lomefloxacine disc 10 mcg , 5 x 100 disc 1 1 vial 528 528 methicilline disc 5 mcg , 5 x 100 disc 1 1 vial 529 529 mezlocilline disc 5 mcg, 5 x 100 disc 1 1 vial 530 530 mecillinam disc 10 mcg , 5 x 100 disc 1 1 vial 531 531 meropenem disc 10 mcg , 5 x 100 disc 1 1 vial 532 532 nitrofurantoin disc , 5 x 100 disc 1 1 vial 533 533 nafcilin disc 1 mcg , 5 x 100 disc 1 1 vial 534 534 netilmicin disc, 5 x 100 disc 1 1 vial 535 535 norfloxacin disc, 5 x 100 disc 1 1 vial 536 536 oxacilline disc , 5 x 100 disc 1 1 vial 537 537 ofloxacin disc , 5 x 100 disc 1 1 vial 538 538 penicilline g disc 10 mcg , 5 x 100 disc 1 1 vial 539 539 piperacillin disc 100 mcg, 5 x 100 disc 1 1 vial 540 540 piperacillin tazobactum disc, 5 x 100 disc 1 1 vial 541 541 quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc 1 1 vial 542 542 sulfisoxazole disc 300 mcg , 5 x 100 disc 1 1 vial 543 543 ticarcilline disc 75 mcg , 5 x 100 disc 1 1 vial 544 544 ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc 1 1 vial 545 545 teicoplanin disc, 5 x 100 disc 1 1 vial 546 546 tetracycline disc 30 mcg , 5 x 100 disc 1 1 vial 547 547 tobramycin disc, 5 x 100 disc 1 1 vial 548 548 vancomycin disc, 5 x 100 disc 1 1 vial 549 549 meropenam disc, 5 x 100 disc 1 1 vial 550 550 cefpodoxime, 5 x 100 disc 1 1 vial 551 551 clarithromycin disc, 5 x 100 disc 1 1 vial 552 552 clindamycin disc, 5 x 100 disc 1 1 vial 553 553 polymyxin b 300 units disc, 5 x 100 disc 1 1 vial 554 554 nalidixic acid disc, 5 x 100 disc 1 1 vial 555 555 swabs cat. ref. case qty material sterility 1 pkt 556 556 wooden applicator sticks 1 pkt 557 557 plain swab, wooden shaft, cotton tip 1 pkt 558 558 plain swab, wooden shaft, cotton tip individually 1 pkt 559 559 plain swab, polystyrene shaft, cotton tip individually 1 pkt 560 560 plain swab, wooden shaft, cotton tip 1 pkt 561 561 plain swab in round tube, wooden shaft, cotton tip 1 pkt 562 562 plain swab in round tube, polystyrene shaft, cotton tip 1 pkt 563 563 amies transport swab, plain media, polystyrene shaft, 1 pkt 564 564 viscose tip 1 pkt 565 565 amies transport swab, charcoal media, polystyrene 1 pkt 566 566 shaft, viscose tip 1 pkt 567 567 environmental swabs 1 pkt 568 568 enviromax foam tip sampling swab 1 pkt 569 569 enviromax foam tip sampling swab sterile 1 pkt 570 570 enviromax pre moistened samplig swab sterile 1 pkt 571 571 esk 4ml neutralising buffer swab 1 pkt 572 572 esk 10ml neutralising buffer swab 1 pkt 573 573 petri dishes loops and spreaders 1 pkt 574 574 90mm triple vent 1 each 575 575 55mm triple vent 1 each 576 576 contact plate 65 x 16mm 1 each 577 577 120mm x 120mm square, vented 1 each 578 578 140mm triple vent 1 each 579 579 1ul shortie loop 1 each 580 580 10ul shortie loop 1 each 581 581 5ul shortie loop 1 each 582 582 1ul loop packs 1 pkt 583 583 10ul loop packs 1 pkt 584 584 l shaped spreaders in packs 1 pkt 585 585 blue spreaders in packs 1 pkt 586 586 ‘u’ well microtitration plate 1 each 587 587 ‘f’ well microtitration plate 1 each 588 588 ‘v’ well microtitration plate 1 each 589 589 lid for microtitre plates 1 each 590 590 large containers ( 24 hour urine ) and sweetie jars 1 each 591 591 2 litre graduated pe container 1 each 592 592 2.5 litre 24 hour urine collection, labelled 1 each 593 593 2.7 litre graduated pe container 1 each 594 594 5 litre 24 hour urine container 1 each 595 595 sweet jar with cap, small 1 each 596 596 sweet jar with cap & label, small pet 1 each 597 597 sweet jar with cap, large pet 1 each 598 598 sweet jar with cap & label, large 1 each 599 599 250ml snap top bucket 1 each 600 600 250ml snap top bucket and lid 1 each 601 601 500ml snap top bucket 1 each 602 602 1000ml snap top bucket 1 each 603 603 2500ml snap top bucket 1 each 604 604 5000ml snap top bucket 1 each 605 605 10000ml snap top bucket 1 each 606 606 20000ml snap top bucket 1 each 607 607 containers 1 each 608 608 7ml bijou container, no label 1 each 609 609 7ml bijou container, with plain label 1 each 610 610 7ml bijou container, with boric acid 1 each 611 611 7ml bijou container, no label 1 each 612 612 30ml universal, with label flow seal 1 each 613 613 30ml universal, plain label 1 each 614 614 30ml universal with spoon, printed label 1 each 615 615 30ml universal, no label 1 each 616 616 30ml universal, printed label 1 each 617 617 30ml universal, with boric acid, no label 1 each 618 618 60ml clear plastic cap, no label 1 each 619 619 60ml clear plastic cap, with printed label 1 each 620 620 60ml container blue p / p screw cap plain label 1 each 621 621 60ml container dark blue p / p screw cap plain label 1 each 622 622 60ml plastic cap container, no label 1 each 623 623 60ml plastic cap container, no label 1 each 624 624 60ml plastic cap container, plain label 1 each 625 625 60ml metal cap container, printed label, tray wrapped 1 each 626 626 60ml metal cap container, no label, tray wrapped 1 each 627 627 100ml metal cap container, printed label, tray wrapped 1 each 628 628 100ml metal cap container, no label, tray wrapped 1 each 629 629 125ml container dark blue, screw cap, plain label 1 each 630 630 125ml container blue, screw cap, plain label 1 each 631 631 125ml container natural, screw cap, plain label 1 each 632 632 125ml container screw cap with spoon, plain label 1 each 633 633 150ml metal cap container, no label, tray wrapped 1 each 634 634 150ml metal cap container, printed label, tray wrapped 1 each 635 635 160ml container with spoon 1 each 636 636 200ml container blue p / p screw cap, no label 1 each 637 637 200ml container blue p / p screw cap, plain label 1 each 638 638 200ml container natural p / p screw cap, no label 1 each 639 639 250ml metal cap container, printed label, tray wrapped 1 each 640 640 250ml metal cap container, no label, tray wrapped 1 each 641 641 250ml metal cap container, plain label, tray wrapped 1 each 642 642 200ml container, no label 1 each 643 643 30ml dippa sampler with handle 1 each 644 644 30ml dippa sampler with handle ps / pp blue 1 each 645 645 30ml dippa sampler with handle pp / pp 1 each 646 646 30ml dippa sampler with handle pp / pp blue 1 each 647 647 100ml dippa sampler with handle ps / pp 1 each 648 648 100ml dippa sampler with handle ps / pp blue 1 each 649 649 250ml dippa sampler with handle ps / pp 1 each 650 650 250ml dippa sampler with handle ps / pp blue 1 each 651 651 500ml sodium thiosulphate bottle 1 each 652 652 1000ml sodium, thiosulphate bottle 1 each 653 653 500ml sample bottle plain label 1 each 654 654 1000ml sample bottle plain label 1 each 655 655 500ml wide mouth container with thiosulphate 1 each 656 656 1000ml wide mouth container with thiosulphate 1 each 657 657 500ml wide mouth container 1 each 658 658 1000ml wide mouth container 1 each 659 659 test tubes polystyrene and polypropylene 1 pkt 660 660 55 x 11mm, round bottom 1 pkt 661 661 70 x 11mm, round bottom 1 pkt 662 662 75 x 12mm, round bottom 1 pkt 663 663 75 x 13mm, round bottom 1 pkt 664 664 100 x 16mm, round bottom 1 pkt 665 665 150 x 16mm, round bottom 1 pkt 666 666 55 x 11mm, round bottom 1 pkt 667 667 75 x 12mm, round bottom 1 pkt 668 668 75 x 13mm, round bottom 1 pkt 669 669 100 x 13mm, round bottom 1 pkt 670 670 100 x 16mm, round bottom 1 pkt 671 671 cap to fit 11mm diameter tube 1 pkt 672 672 cap to fit 12mm diameter tube 1 pkt 673 673 plug tight cap to fit 13mm diameter tube 1 pkt 674 674 re caps to fit 13mm tube 1 pkt 675 675 13mm hanging vacutainer insert flat bottom. 1 pkt 676 676 12ml conical base 1 pkt 677 677 16 x 100 conical tube 1 pkt 678 678 centrifuge tubes 1 pkt 679 679 15ml graduated with screw cap 1 pkt 680 680 15ml graduated with screw cap ( racked ) 1 pkt 681 681 15ml graduated with screw cap 1 pkt 682 682 15ml conical with screw cap 1 pkt 683 683 50ml graduated with screw cap 1 pkt 684 684 50ml graduated with screw cap 1 pkt 685 685 50ml graduated with screw cap ( self standing ) 1 pkt 686 686 4.5ml pasteur pipette 1 each 687 687 1ml pasteur, plastic graduated 1 each 688 688 1ml pasteur pipette, ind. wrapped 1 each 689 689 3ml pasteur, plastic graduated 1 each 690 690 3ml pasteur pipette, ind. wrapped 1 each 691 691 1ml pasteur, plastic graduated sterile pack 1 each 692 692 1ml pasteur, plastic graduated sterile ind. wrap. 1 each 693 693 3ml pasteur, plastic graduated sterile ind. wrap 1 each 694 694 5ml pasteur pipette, graduated 1 each pkt 695 695 7ml pasteur pipette, jumbo 1 each pkt 696 696 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s 1 pkt 697 697 3ml fine tip, pasteur pipette 210002 500 pe ns 1 pkt 698 698 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns 1 pkt 699 699 3.0ml micro tip, pasteur pipette 210004 250 pe ns 1 pkt 700 700 2.5ml pasteur pipette 210006 400 pe ns 1 pkt 701 701 3ml fine tip, pasteur pipette, ind. wrapped 1 pkt 702 702 1ml micro tip pasteur pipette 1 pkt 703 703 3ml pasteur pipette, peel pack 1 pkt 704 704 serological pipettes 1 pkt 705 705 1ml. taper jet, bulk wrap 1 pkt 706 706 1ml. taper jet, single wrap 1 pkt 707 707 1ml. open end, bulk wrap 1 pkt 708 708 2ml. taper jet, bulk wrap 1 pkt 709 709 2ml. taper jet, single wrap 1 pkt 710 710 5ml. taper jet, bulk wrap 1 pkt 711 711 5ml. taper jet, single wrap 1 pkt 712 712 10ml. taper jet, bulk wrap 1 pkt 713 713 10ml. taper jet, single wrap 1 pkt 714 714 10ml. open end, bulk wrap 1 pkt 715 715 25ml. taper jet, single wrap 1 pkt 716 716 pipette tips 1 pkt 717 717 yellow pipette tip 5 200ul eppendorf 1 pkt 718 718 yellow pipette tip 5 200ul eppendorf ( racked ) 1 pkt 719 719 blue pipette tip 100 1000ul eppendorf 1 pkt 720 720 blue pipette tip 100 1000ul eppendorf ( racked ) 1 pkt 721 721 yellow pipette tip 5 200ul 1 pkt 722 722 yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns 1 pkt 723 723 blue pipette tip 100 1000ul 1 pkt 724 724 blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns 1 pkt 725 725 white slim pipette tip 5 200ul 1 pkt 726 726 blue slim line tip 200 1000ul 1 pkt 727 727 white macro pipette tip 5000ul 1 pkt 728 728 white micro crystal tip 0.5 10ul 1 pkt 729 729 white micro crystal tip 0.5 10ul 1 pkt 730 730 natural pipette tip 1000 5000ml 1 pkt 731 731 natural pipette tip 1000 5000ml universal 1 pkt 732 732 essential microbiology consumables gloves cat. ref. case qty material sterility 1 pkt 733 733 powder free / small ( 6 7 ) latex ns 1 pkt 734 734 powder free / medium ( 7 8 ) latex ns 1 pkt 735 735 powder free / large ( 8 9 ) latex ns 1 pkt 736 736 powder free, small ( 6 7 ) nitrile ns 1 pkt 737 737 powder free, medium ( 7 8 ) nitrile ns 1 pkt 738 738 powder free, large ( 8 9 ) nitrile ns 1 pkt 739 739 powder free, easy stretch, white, small ( 6 7 ) nitrile ns 1 pkt 740 740 powder free, easy stretch, white, medium ( 7 8 ) nitrile ns 1 pkt 741 741 powder free, easy stretch, white, large ( 8 9 ) nitrile ns 1 pkt 742 742 plastic bags / zip lock bags 1 pkt 743 743 55 x 55 x 0.05mm 1 pkt 744 744 60 x 80 x 0.05mm 1 pkt 745 745 70 x 100 x 0.05mm 1 pkt 746 746 80 x 120 x 0.05mm 1 pkt 747 747 100 x 150 x 0.05mm 1 pkt 748 748 110 x 110 x 0.05mm 1 pkt 749 749 120 x 180 x 0.05mm 1 pkt 750 750 150 x 220 x 0.05mm 1 pkt 751 751 200 x 300 x 0.05mm 1 pkt 752 752 250 x 330 x 0.05mm 1 pkt 753 753 300 x 400 x 0.05mm 1 pkt 754 754 microcentrifuge tubes 1 each 755 755 microtube 0.5ml 1 each 756 756 microtube 0.5ml 1 each 757 757 microtube 1.2ml ( strips of 8 ) 1 each 758 758 microtube 1.5ml clear 1 each 759 759 microtube 1.5ml flat top 1 each 760 760 microtube 1.5ml twist lock 1 each 761 761 microtube 1.5ml yellow 1 each 762 762 microtube 1.5ml green 1 each 763 763 microtube 2.0ml 1 each 764 764 microtube 2.0ml flat cap 1 each 765 765 screw cap microtubes and cryovials 1 each 766 766 2ml skirted microtube without cap 1 each 767 767 screw cap with o ring, natural 1 each 768 768 screw cap with o ring, white 1 each 769 769 screw cap with o ring, orange 1 each 770 770 screw cap with o ring, red 1 each 771 771 screw cap with o ring, blue 1 each 772 772 screw cap with o ring, green 1 each 773 773 screw cap with o ring, yellow 1 each 774 774 screw cap with o ring, black 1 each 775 775 1.2ml cryovial storage to 190 c 1 each 776 776 2.0ml cryovial storage to 190 c 1 each 777 777 5.0ml cryovial storage to 190 c 1 each 778 778 essential microbiology consumables 1 each 779 779 scoops and weigh boats cat. ref. case qty material sterility 1 each 780 780 5ml white diamond, 41 x 41 x 8mm 1 each 781 781 30ml white diamond, 89 x 89 x 25mm 1 each 782 782 100ml white diamond, 140 x 140 x 22mm 1 each 783 783 10ml measuring scoop 1 each 784 784 25ml measuring scoop 1 each 785 785 100ml measuring scoop 1 each 786 786 microscope slides and cover slips 1 pkt 787 787 white superfrost slides blue superfrost slides 1 pkt 788 788 plain slide cut edge 1 pkt 789 789 plain slide ground edge 1 pkt 790 790 twin frosted slide ground edge twin frosted slide ground edge 1 pkt 791 791 twin frosted slide cetiglass pure glass 76x26x1mm 1 pkt 792 792 cover slip 18x18 1 pkt 793 793 cover slip 20x20 1 pkt 794 794 cover slip 22x22 1 pkt 795 795 cover slip 22x32 1 pkt 796 796 cover slip 22x40 1 pkt 797 797 cover slip 24x24 1 pkt 798 798 cover slip 24x50 1 pkt 799 799 cover slip 24x32 1 pkt 800 800 cover slip 24x36 1 pkt 801 801 cover slip 24x40 1 pkt 802 802 cover slip 24x60 1 pkt 803 803 slide mailer 1 pkt 804 804 slide box 25 1 pkt 805 805 slide box 50 1 pkt 806 806 slide box 100 1 pkt 807 807 autoclave bags and paper products 1 each 808 808 autoclave bags 310 x 660mm, high temp. 1 each 809 809 autoclave bags 400 x 700mm, high temp. 1 each 810 810 autoclave bags 600 x 780mm, high temp. 1 each 811 811 yellow clinical waste bags 30 x 39 1 each 812 812 ethylene oxide gas tape 19mm x 50m 1 each 813 813 dry heat ( pou pinel ) tape 19mm x 50m 1 each 814 814 autoclave tape 19mm x 50m 1 each 815 815 specimen bag, 5½? x 6? x 8½? 1 each 816 816 specimen bag, printed biohazard 1 each 817 817 absorbent benchcoat 50cm x 50 meters 1 each 818 818 10 inch hygiene rolls 2 ply, white 1 each 819 819 c fold 1 ply, green 1 each 820 820 medical wipes 2 ply, white 1 each 821 821 post lip paper / slide blotting paper 1 each 822 822 absorbent bench paper sheets 1 each 823 823 filter paper 50x50cm 1 pkt 824 824 microtips racks box of all size 1 each 825 825 macconkey agar w / o cv w / 0.15% bile salt 1 500 gm 826 826 nutrient agar 1 500 gm 827 827 ss agar ( salmonella shigella agar ) 1 500 gm 828 828 mueller hinton agar 1 500 gm 829 829 cary blair medium base ( transport medium w / o charcoal ) 1 500 gm 830 830 triple sugar iron agar 1 500 gm 831 831 mannitol salt agar 1 500 gm 832 832 urea agar base ( christensen ) ( autoclavable ) 1 500 gm 833 833 simmons citrate agar 1 500 gm 834 834 bile salt agar 1 500 gm 835 835 xylose lysine deoxycholate agar ( xld agar ) 1 500 gm 836 836 tcbs agar 1 500 gm 837 837 deoxycholate citrate agar ( agar medium j ) 1 500 gm 838 838 brain heart infusion broth 1 500 gm 839 839 peptone, bacteriological 1 500 gm 840 840 sorbitol agar ( macconkey sorbitol agar ) 1 500 gm 841 841 sabouraud dextrose agar 1 500 gm 842 842 glucose broth 1 500 gm 843 843 tryptic soya agar 1 500 gm 844 844 bordet gengou agar base with supllements 1 500 gm 845 845 gordon mcleod reagent ( oxidase reagent ) 1 500 gm 846 846 kovacs’ indole reagent 1 1 bottle 847 847 ‘sq’ acetone 1 1 bottle 848 848 ‘sq’ iodine resublimed 1 1 bottle 849 849 gram stains kit 1 1 kit 850 850 albert`s metachromatic stains kit 1 1 kit 851 851 ‘sq’ phenol ( carbolic acid ) 1 1 bottle 852 852 spirit 1 1 bottle 853 853 ethanol, absolute 1 1 bottle 854 854 antibiotics disc positive 1 1 vial 855 855 antibiotics disc negative 1 1 vial 856 856 metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. 1 each 857 857 nicrome wire ( resistance wire ) 100gm 1 each 858 858 spirit lamp 1 each 859 859 cotton roll 500gm 1 each 860 860 aluminium foil 1 each 861 861 plain slides 1 1 pkt 862 862 cover slip size 18mm round 1 1 pkt 863 863 grooves glass slides 1 1 pkt 864 864 bhi supplemented w / 0.05% spsä 1 500 gm 865 865 conical flask erlenmeyer cap.500ml 1 each 866 866 petri dish culture, s line size, 80x15 1 each 867 867 glass measuring cylinder, cap. 250ml 1 each 868 868 glass measuring cylinder, cap. 500ml 1 each 869 869 test tube with rim size 12x75mm, 100 / pk 1 1 pkt 870 870 test tube with rim size 15x125mm, 100 / pk 1 1 pkt 871 871 test tube with rim size 18x150mm, 100 / pk 1 1 pkt 872 872 surgical gloves, 100 / pk 1 1 pkt 873 873 micro tips 10 100μl, 1000 / pk, yellow 1 1 pkt 874 874 micro tips 100 1000μl, 500 / pk, blue 1 1 pkt 875 875 plastic beaker 500 ml, pvc 1 each 876 876 glass beaker, cap. 500ml 1 each 877 877 sterile disposable petri plates* polystyrene, optically clear 1 1 pkt 878 878 size : 100 mm diameter x 15 mm, individually packed. 1 1 pkt 879 879 labolene neutral ph ( soap solution ) , for glassware washing 1 1 bottle 880 880 ph indicator papers full range ( ph 1.0 to 14.0 ) 1 1 pkt 881 881 distill water 1 1 can 882 882 micropipette 100* capacity : 10 to 100 μl 1 each 883 883 micropipette 1000* capacity : 100 to 1000 μl 1 each 884 884 micropipette 10 capacity : 0.5 to 10 μl 1 each 885 885 μpet autoclavable micropipette 8 channel ( 20 200 μl ) 1 each 886 886 disposable masks 1 1 pkt 887 887 bloting paper 1 1 pkt 888 888 filter paper size 12.5cm circule 1 1 pkt 889 889 serological test for typhoid 1 1 pkt 890 890 zn acid fast stains 1 1 kit 891 891 ‘sq’ sulphuric acid 1 1 bottle 892 892 giemsa’s stain 1 1 bottle 893 893 ‘sq’ formaldehyde solution 37 41% w / v 1 1 bottle 894 894 ‘sq’ potassium oxalate monohydrate 1 1 bottle 895 895 ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) 1 1 bottle 896 896 funnels, plain , size 50mm 1 each 897 897 funnels, plain , size 75mm 1 each 898 898 pestle & mortar 1 each 899 899 ‘sq’ acetic acid glacial 1 500 ml 900 900 methylene blue aqueous stain solution 1 500 ml 901 901 staining rods / staining tray / slide tray 1 each 902 902 salmonella polyvalent somatic ( o ) antigen 1 1 kit 903 903 salmonella polyvalent somatic ( h ) antigen 1 1 kit 904 904 test tubes stand, pvc 1 each 905 905 glassware for measuring 1 each 906 906 forceps 5 1 each 907 907 tranport container 1 each...

Medical And Health Services - Rajasthan

22699277 rate contact for chemical and glass were volumetric flask with stoper, measuring cylinder, conicla flask, pipette, butyrometer tube, tilth with 250 ml bottle, butyrometer tube stand aluminium, mojnnier fat extration tube, measuring cylends plastic, breaker, glass bottle stopps, bytyrometer grash, rm set with joint condensor, flat bottom round flak and steel over head with lamp and aluminium stand, flat bottom roud, brush for bottle and test tube, brush for flask, reasent bottle brown colour & stopper, containing boss heads retst ring report base rod for retost base, cotton reagent bottle, filter paper whatman, chromatography paper whatman no 1 sheet, crucible, tlc plate aluminium, separating funnel and teflon stop cock, rubber cock, ccondenser for rm set, pipette bulb big/small, seprating tunnel, chemical mask, gloves, spactula, plastic funnel,. funnel glass, diesctor with cap, termometer, wash bottle, glass beads, tissue paper roll, wire gauge, blue litmus, petri plates, tripode stand, dropping bottle glass, pipette stand verticle, sample bottle, morter plastel porcelin, tunnel glass, dropper, glass rods, soxhlet clamp, test tube holder, bunsen burner, toung, universal clamp, funnel stand, volumetric pipette, rubber pipe, capillary tube, volumetric with stoper, hydrocloric acid, b dimethyl amvo bondaldehyde, ethyl alcohol, copper acetate, acetic acid, ammonia solution, ammonia molybdate, phosphoric acid, silver nitrate, potassium chromate, sulphuric acid, isoamyl alcohol, rosalic acid, ferric chloride, diethyl ether, potassium iodide, iodine crystal, phosphomolybdic acid, starch powder, sodium chloride, sodium hydroxide pellets, phenolphthalein, pure sucrose, fehling solution, lacticc acid, nitric acid, glycerol, furfuraldehyde, potassium hyproxide, trissodium citrate, anhydrous potassium sulphate, copper sulphate pentanydrate, methyl red indicator, bromocresol green, boric acid powder, ammonium sulphate, amp n/10 hydrochloric acid, trichlord acetic acid, poceu 4r, carmosine, erthosine, sunset yellow, tatrazine, indigo carmine, brillant blue, fast green, sudan, metanil yellow, mask n, mask tripple layer, ppe kit, vtm cmho bharatpur ...

Medical And Health Services - Rajasthan

22180850 tender for idsp lab items purchase 1 bio clean solution for glassware ( per bottle ) disposable sterilized petri plate ( per plate ) n77;„ typhi dot card test ( igm ) 3 or terri 4 hav elisa kit per kit 5 hev elisa per kit 6 test tube stand 12.5*15cm per stand 7 sterile disposable swab with tube piece ) ( per 8 distilled water per litter 9 spirit per litter 10 dettol per litter 11 typhi dot elisa igm kit 12 mc kartney bottle for blood culture 13 zn stain 14 sps ( sodium poly antithio sulfonate ) anti coagulent 15 hypochloride solution 16 glass tube size 12.5 x 15 cm 17 scrub typhi igm kit 18 dangue typhins 1 ag elisa test 19 dengue igm elisa kit 20 glass conical flask 250, 500, 1000 ml 21 measuring cylinder 100 ml 22 tussue paper 23 aluminium foil 24 spatulla 25 alpha nepthol 26 koh pallets 27 antisera salmonella 0 antigen 28 antisera salmonella h antigen 29 antisera e coli 0137 30 chemical indicator for autoclave 31 h202 ( hydrogen peroxide ) 32 hav card test ( igm ) 418 hev card test ( igm ) / kw screw cap glass tube ( autoclavable ) 35 autoclave indicator ( chemical ) autoclave biological indicator ( bacillus stereo thermophillus ) ampules 37 plain vial with cap 38 chikungunya card test 39 srub typhus card test ao hand wash ( dettol ) 41 h2s test medium kit ( code no. k20 ) 42 scrub typhus elisa igm kit 43 ns 1 antigen dengue elisa kit 44 5 percent alpha naphthol 45 antisera vibriocholerae 01 and 0139 46 normal saline 47 gram stain 48 albert stain 49 iodine ( lugols ) solution 50 india ink 51 macconkey agar ( m082 ) 52 nutrient agar 53 sorbitol macconkey agar 54 cled 55 xld 56 tcbs 57 mha 58 cary blair medium 59 alkaline peptone water ( dry powdered ) so selenit f 61 bhi broth ( dry powdered media ) 62 thioglycolate broth ( dry powdered media ) 63 oxidase discs 64 optochin discs 5 bacitracin discs titsinntlovobiocin discs erekovacs reagent 68 methyl red reagent 69 glucose phosphate broth ( dried powdered media ) 70 simmons cirtrate agar 71 phenylalanine agar 72 urease agar 73 tsi agar 74 sodium deoxycholate 75 potassium tellurite 76 sodium thiosulphate 77 ferric chloride ( salt ) 78 ph paper 2 to 10.5 79 double strength macconkey broth ( dried ) 80 bile esculin agar 81 mannitol salt agar 82 mannitol motility agar 83 typtocase soy broth ( dried powder ) 84 glycerol 85 formaldihyde 86 sodium hippurate 87 ninhydrin reagent 88 amikacin ( 30 microgram ) disk 89 augmentin ( 20 / 10 microgram ) disk 90 ampicillin ( 10 microgram ) disk 91 cefipime ( 30 microgram ) disk 92 cefoxitin ( 30 microgram ) disk 93 ceftazidime ( 30 microgram ) disk 94 ceftriaxone ( 10 microgram ) disk 95 cefuroxime ( 30 microgram ) disk 96 chloramphenicol ( 30 microgram ) disk 97 ciprofloxacin ( 10 microgram ) disk m, clindamicin ( 30 microgram ) disk 993, cotrimoxazole ( 25 microgram ) disk 100 doxycycline ( 10 microgram ) disk 101 erythromicin ( 10 microgram ) disk 102 gentamicin ( 10 microgram ) disk 103 imipenem ( 10 microgram ) disk 104 levofloxacin ( 5 microgram ) disk 105 linezolid ( 30 microgram ) disk 106 meropenem ( 30 microgram ) disk 107 nalidixic acid ( 30 microgram ) disk 108 netilmicin ( 10 microgram ) disk 109 nitrofurantoin ( 300 microgram ) disk 110 ofloxacin ( 5 microgram ) disk 111 oxacilllin ( 1 microgram ) disk 112 penicillin ( 10 microgram ) disk 113 piperacillin / tazobactam ( 100 / 10 microgram ) disk 114 teicoplanin ( 30 microgram ) disk 115 tetracycline ( 30 microgram ) disk 116 vancomycin ( 30 microgram ) disk 117 ertapenum disk 118 aztreonum disk 119 tobramycin disk 120 gentamycin high level disk 121 micocycline disk 122 cefotaxime disk 123 azithromycin disk 124 amoxycillin disk 125 cefixime disk 126 cephalexin disk 127 norfloxacin disk 128 ofloxacin disk 129 cephopodoxime disk 130 viral transport medium 131 n 95 mask 132 tripple layer mask 133 personal protective equipment ( ppe ) ...

Medical College - Rajasthan

18846699 supply of reagents and chemicals for microbiology 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 , el, p 40 _ale 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate plastic ware 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm 82 test tube racks 48 holes for 15 mm test tubes 83 latex gloves 6.5 unsterilized ( pack of 100 pc. ) small size 6.5 each 84 latex gloves 7.5 unsterilized ( pack of 100 pc. ) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 94 vacutainer ( 5 ml without edta ) e. toclavable petri plates, polycarbonate, clear transparent akable, 90 mm x 15 mm. tivash bottle ( 100 ml ) glass ware microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) isi mark 97 test tubes 12x100mm borosil 98 durhams tube 25 mm x 6 to 7 mm dia. 99 bijou bottle with aluminium cap and silicon rubber washer 100 petri dish 110 mm borosil ( cornig ) 101 petri disc 90mm borosil ( cornig ) 102 103 glass funnel with 10 cm dia. ( small & medium ) 104 150 x 15 mm dia. glass borosil 105 pasteur pipette with rubber bulbs capacity of 1 ml 106 pasteur pipette with rubber bulbs capacity of 2 ml antifungal enzyme strips ( e strip ) 107 amphotericin b 0.002 32 mcg / ml caspofungin 108 0.002 32 mcg / ml 109 fluconazole 0.016 256 mcg / ml 110 flucytosine 0.002 32 mcg / ml 111 itraconazole 0.002 32 mcg / ml icafungin 0.002 32 mcg / ml113 posaconazole 0.002 32 mcg / mi 114 voriconazole 0.002 32 mcg / mi 1...

Dr. S.N.Medical College - Rajasthan

18833899 supply of reagents and chemicals for microbiology 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate plastic ware 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm 82 test tube racks 48 holes for 15 mm test tubes 83 latex gloves 6.5 unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5 unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile(individually packed) 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) toclavable petri plates, polycarbonate, clear transparent akable, 90 mm x 15 mm. ittn/ash bottle (100 ml) glass ware 97 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 98 test tubes 12x100mm borosil 99 durhams tube 25 mm x 6 to 7 mm dia. 100 bijou bottle with aluminium cap and silicon rubber washer 101 petri dish 110 mm borosil (cornig) 102 petri disc 90mm borosil (cornig) 103 glass funnel with 10 lill dia. (small & medium) 104 150 x 15 mm dia. glass borosil 105 pasteur pipette with rubber bulbs capacity of 1 ml 106 pasteur pipette with rubber bulbs capacity of 2 ml antifungal enzyme strips (e strip) 107 amphotericin b 0.002 32 mcg/ml 108 caspofungin 0.002 32 mcg/ml 109 fluconazole 0.016 256 mcg/ml 110 flucytosine 0.002 32 mcg/ml 111 itraconazole 0.002 32 mcg/ml .. icafungin a 0.002 32 mcg/ml 113 posaconazole 0.002 32 mcg/ml 114 voriconazole 0.002 32 mcg/m1 115 ketoconazole 0.002 32 mcg/m1 disc for carbohydrate fermentation test d 116 adonitol 1 x25 117 arabinose 1 x25 118 cellobiose 1 x25 119 dextrose 1 x25 120 dulcitol 1 x25 121 galactose 1 x25 122 fructose 1 x25 123 inositol 1 x25 124 inulin 1 x25 ...

Medical College - Rajasthan

16446177 supply of microbiology 80 disposable syringe 5m1, with needle 81 disposable syringe 82 disposable syringe 20m1 with needle 83 disposable syringe 50 ml with needle 84 test tube racks 48 holes for 12 mm 85 test tube racks 48 holes for 15 mm test tubes 86 nitril gloves medium size 6.5 each 87 nitril gloves small size 6.5 each 88 small size 6.5 each 89 small size 6.5 each 90 disposable needle 18 gauge 91 staining jars 100 ml 92 plastic dropping bottle 125 ml 93 plastic dropping bottles 500 ml 94 sterile disposable petri dish 90mm 95 sterile ( individually packed ) 96 disposable plastic test tubes 75 x12 mm 97 thumb press disposable dropper 98 99 vacutainer ( 5 ml without edta ) 100 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 101 wash bottle ( 100 ml ) glass ware 102 microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 103 test tubes 12x100mm borosil 104 durhams tube 25 mm x 6 to 7 mm dia. 105 bijou bottle with aluminium cap and silicon rubber washer 106 petri dish 110 mm borosil ( cornig ) 107 petri disc 90mm borosil ( cornig ) 108 glass funnel with 10 cm dia. ( small & medium ) 109 150 x 15 mm dia. glass borosil 110 pasteur pipette with rubber bulbs capacity of 1 ml 111 pasteur pipette with rubber bulbs capacity of 2m1 antifungal enzyme strips ( e strip ) 112 amphotericin b 0.002 32 mcg / ml 113 caspofungin 0.002 32 mcg / ml 114 fluconazole 0.016 256 mcg / ml 115 flucytosine 0.002 32 mcg / ml 116 itraconazole 0.002 32 mcg / ml 117 micaftmgin 4t0 it. 0 4r, v 0.002 32 mcg / ml 118 posaconazole 0.002 32 mcg / ml 119 voriconazole 0.002 32 mcg / ml 120 ketoconazole 0.002 32 mcg / ml disc for carbohydrate fermentation test discs 121 adonitol 1 x25 122 arabinose 1 x25 123 cellobiose 1 x25 124 dextrose 1 x25 125 dulcitol 1 x25 126 galactose 1 x25 127 fructose 1 x25 128 inositol 1 x25...