Govind Guru Tribal University - Rajasthan

33934146 supply of pharmacy lab equipments 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall, 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a ) stage micrometer b ) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a ) single channel b ) multi channel 53 uv cabinet 2 tube , 1 refractometer / abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double / triple necked a ) double neck b ) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath ( 12 holes ) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance ( 1mg sensitivity ) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc ( desirable ) , 36 atomic absorption and emission spectrophotometer ( desirable ) 37 biochemistry analyzer ( desirable ) 38 carbon, hydrogen, nitrogen analyzer 39 deep freezer ( desirable ) 40 ion exchanger 50 ltr. cap. 41 lyophilizer ( desirable ) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer ( trinocular microscope with camera attachment ) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly ( single unit ) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer ( activity cage ) 27 rotarod 2 compartment, 29 analgesiometer ( eddys hot plate and radiant heat methods ) a ) eddy hot plate digital b ) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a ) dissection tray 12x10 gi sheet b ) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a ) levers ( i ) simple lever with pointer ( ii ) starling heart lever with pointer ( iii ) frontal writing lever b ) cannula ( i ) symes cannula ( ii ) venous cannula ( iii ) arterial cannula 41 hypodermic syringes & needles size 15, 24, 26g pharmacognosy dept. 1 compound microscope ( student microscope ) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium, 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a ) single channel b ) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill ( bark and seed grinder ) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a ) autoclave 12x12 s.s. b ) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube, 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a ) blood pressure app. mercury b ) stethoscope 14 clinical thermometer mercury....

Dr. S.N.Medical College - Rajasthan

33900482 supply of rotatory mictotome rotatory mictotome , rotatory microtome(as per required technical specifications) , rate of c.m.c. for 1st year after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 2ndyear after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 3rdyear after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 4thyear after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 5thyear after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 6thyear after guarantee period of 3 years ( including all spere parts) , rate of c.m.c. for 7thyear after guarantee period of 3 years ( including all spere parts)...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Dr. S.N.Medical College - Rajasthan

33896694 supply of various laboratory items of m.m.n.n.j.y it paraffin wax 60 62% with ceresin absolute akohol ( ethanol 3 distilled water 4 xylene 5 sidit 6 cotton roll ( item related to schedule 1 as per rtpp rules 2013. priority will be given to msme sector hence enclose msme certificate i 7 micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass } b chloral hydrate 9 among solution 10 formaldehyde solution 40% 11 white adhesive tape u mfaotorne disposable blade high profile. 13 filter pape round 100x1 pkt 14 cassettes 3 crn.x1.5cm. ( plastic ) —yellow 15 cassettes 3 cm.3c2.5cnt. ( plastic ) —white 16 lain gloves sterilized 6.5p.0 / 75 no. 17 latex gloves unsterilized 6.5 / 7.0 / 7.5 no. i 18 dextrose 19 albumin powder 20 leishman stain 21 sulphur powder 22 sodium acetate 23 potassium ) acetate 24 potassium nitrate 25 benedlcts solution 26 acetone 27 dpx solution 28 cover slip libc18 0.1 man english glass 29 cover slip 22x22 0.1 mm english glass 30 cover slip 22360 0.1 mm english glass 31 glycerine 32 di— ionized water 33 schlffs reagent 34 bees wax 35 cea ( primary antibodies ) 36 gfap ( primary antibodies ) 37 hmb 4s ( primary antibodies ) 38 death ( primary antibodies ) 39 ema ( primary antibodies ) 40 bc12 temary setitakein4 41 hmwck ( primary antibodies ) 42 ck7 ( primary antibodies ) 43 er ( pnrnary antibodies ) 44 cd30 ( primary antibodies ) 45 cds ( primary antibodies ) 46 co23 ( primary antibodies ) 47 ck20 ( pdmary antibodies ) 48 1367 ( primary antibodies ) 49 cd10 ( primary antibodies ) 50 synaptoplvysin ( primary antibodies ) si pr ( primary antibodies ) 52 mpo ( primary antibodies ) 53 pax•5 ( primary antibodies ) 54 cd3 ( primary antibodies ) 55 vit1 ( primary antibodies ) 56 swo ( primary antibodies ) 57 aeuae3 ( muld ck ) ( primary antibodies ) 58 sma ( primary antibodies ) s9 inhibit ( primary antibodies ) 60 hpv ( primary antibodies ) 61 pi4 peran rams* 62 eber ( primary antbodes ) 63 oript avvin rebtedhes ) 64 cod ( primary antibodies ) 65 arnyioid ( primary antibodies ) 66 her 2— neu ( primary antibodies ) 67 vimentin ( primary antibodies ) 68 chromcieamin ( primary antibodies ) 60 antigens retrial buffer diva deciosket mr ( for manual ihc staining ) 70 background snapper ( for manual inc staining ) 71 wash buffer tbs autowash buffer 40x ( for manual ihc staining ) 72 imp polymer detection kit ( for manual ihc staining ) 73 pohtlysine coated slides ( for manual inc staining ) 74 peroxidaxed block 1 ( for manual ihc stain:mg ) 75 beuzold dab chtornogen ( for manual ihc staining ) 76 betazold dab substrate buffer ( for manual ihc staining ) 77 cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) sway! disinfectandfor cryostate ) i churls for cryostat microtome by thermofisher ( for cryostate ) microtorne blades ( high definition ) l cell pack dcl rd / sulfolyser 1....

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Govind Guru Tribal University - Rajasthan

33678311 supply of pharmacy lab equipments pharmaceutics dept. 1 ampoule filling & sealing machine hand operated model 2 magnetic stirrer 500ml & 1 ltr cap with taflon ball 3 aseptic cabinet medium size 4 tablet coating machine 12dia without polish pan lab model note. heavy duty coating pan rate on request 5 ball mill 1 kg cap. fixed seed note. with 1 rpm accuracy rate on request 6 double cone blender lab model fixed speed note. with 1 rpm accuracy rate on request 7 autoclave 12x12 all. 8 steam distillation still glass part complete with heating mantle 9 vacuum pump 15 ltr oil free 10 standard sieves no. 8, 10, 12, 22, 44, 66, 80 set of 7 11 tablet punching machine hand operated 12 capsule filling machine hand operated 13 ampoules washing machine demonstration model 14 tablet disintegration apparatus single basket with digital timer 15 hardness tester monsanto type 16 friability test apparatus single drum with digital timer 17 clarity test apparatus 18 bod incubator 4 cu.ft alluminium digital display 19 digital ph meter 20 bulk density digital model 21 hot plate 8 22 humidity chambers 18x18x18 digital superior quality 23 tray dryer 6 tray with digital temperature display 24 moisture balance 25 water bath 6 hole double wall 9 | p a g e ggtutender 26 ointment filling machine hand operated model 27 capsule counter 28 homoginizer variable speed controller 29 digital balance 10 mg acc. 30 microscope student note. medical microscope with 100x lens & mechanical stage rate on request 31 stage and eye piece micrometers a) stage micrometer b) micrometer eye piece 32 brookfileld viscometer model lv 201 note. original brookfield viscometer usa make rate on request. 33 sieve shaker machine hand operated model 34 extractive distillator complete assembly 35 mechanical stirrers with variable speed controller 36 suppository mould 4 mould 37 ultra sonicator 2 ltr cap. 38 sterility tester 3 stage with stand without vaccum pump 39 franz diffusion cell only glass part 40 hot air oven 14x14x14 all. 41 tablet dissolution test app. single stage microprocessor base 42 mortar and pestle porcelean 6 dia 43 milli pore filter 47 mm 44 vacuum distillator 45 desiccators soda glass 6 46 refrigerator pharmacy use 47 tincture press 48 centrifuge 4 tube 49 colony counter digital 50 antibiotic zone rader 51 laminar air flow 2ft x 2ft x 2ft 52 micropipette single & multi channel a) single channel b) multi channel 53 uv cabinet 2 tube pharmaceutical chemistry dept. 1 refractometer/abbe refractometer 2 polarimeter student model note. research polarimeter rate on request 3 photoelectric colorimeter 8 filter 4 atomic model set 120 balls 5 electronic balance 10 mg 6 periodic table chart 7 hot plates 8 dia 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 analytical balances with wt box 11 digital balance 10mg sensitivity 12 suction pumps glass 13 muffle furnace 9x4x4 digital temperature display 14 mechanical stirrers with variable speed controller 15 magnetic stirrers with thermostat with teflon ball 16 vacuum pump 15 ltr cap oil free 17 digital ph meter 18 microwave oven 19 distillation unit 4 ltr cap. 20 arsenic limit test apparatus 21 reflux flask and condenser double/ triple necked a) double neck b) triple neck 22 nesslers cylinders 23 reflux flask and condenser single necked 24 electronic water bath (12 holes) 25 copper water bath 6 dia 26 colorimeter 8 filter digital 27 uv visible spectrophotometer single beam with software 28 flourimeter digital 29 digital balance (1mg sensitivity) 30 nephelo turbidity meter digital 1000 ntu superior 31 flame photometer digital double display 32 potentiometer digital 33 conductivity meter digital sup. 34 hplc imported 35 hptlc (desirable) 11 | p a g e ggtutender 36 atomic absorption and emission spectrophotometer (desirable) 37 biochemistry analyzer (desirable) 38 carbon,hydrogen,nitrogen analyzer 39 deep freezer (desirable) 40 ion exchanger 50 ltr. cap. 41 lyophilizer (desirable) pharmacology dept. 1 microscopes student note. medical microscope with 100x lens & mechanical stage rate on request 2 haemocytometer indian 3 sahil haemoglobinometer 4 hutchinsons spirometer 6 ltr cap. 5 spygmomanometer digital 6 stethoscope 7 contraceptive devices pack in plastic box 8 pregnancy diagnosis kit 9 mercury thermometer 10 cell analyzer (trinocular microscope with camera attachment) 11 permanent slides for various tissues pack of 50 12 models for various organs large 13 specimen for various organs and systems small size 14 skeleton with bones 15 muscle electrodes 16 lucas moist chamber without stand 17 myographic lever with board but without stand 18 stimulator student model 19 centrifuge 4 tube 20 sherringtons kymograph machine e 8 model superior 21 sherrington drum spare drum for above 22 perspex bath assembly(single unit) 23 aerators 24 software packages for experiment validity for 1 year renew every year charges will be same. 25 standard graph of various drug 26 actophotometer(activity cage) 27 rotarod 2 compartment note. rotarod with 1 rpm accuracy rate on request 12 | p a g e ggtutender 28 pole climbing apparatus 29 analgesiometer (eddys hot plate and radiant heat methods) a) eddy hot plate digital b) radiant heat method analog 30 convulsiometer electro 31 plethysmograph without mercury with stand 32 digital ph meter 33 histamine chamber with glass neubilizer 34 metabolic cage s.s. 35 dissection tray & boards a) dissection tray 12x10 gi sheet b) dissection board 7x5 36 stereotaxic apparatus for rat & mice note. other required accessoreis rate on request 37 digital glucometer 38 folin wu tubes 39 hemostatic artery forceps 40 levers , cannula a) levers (i) simple lever with pointer (ii) starling heart lever with pointer (iii) frontal writing lever b) cannula (i) symes cannula (ii) venous cannula (iii) arterial cannula 41 hypodermic syringes & needles size 15,24,26g pharmacognosy dept. 1 compound microscope (student microscope) note. medical microscope with 100x lens & mechanical stage rate on request 2 dissecting microscope 3 projection microscope 6 dia 4 binocular microscope complete with optics 5 polarized microscope monocular 6 electronic digital balance cap. 600 gm acc. 10 mg 7 autoclave 12x12 alluminium 13 | p a g e ggtutender 8 hot air oven 14x14x14 all. 9 refrigerator pharmacy use 10 zone reader 11 digital ph meter 12 colorimeter 8 filter 13 sterility testing unit 3 stage with stand without vaccum pump note. available in single stage with flask rate on request 14 camera lucida mirror type 15 eye piece micrometer 10x 16 stage micrometer 17 muffle furnace 9x4x4 digital 18 moisture balance 19 heating mantles small 250 ml 20 vacuum pump 15 ltr cap. oil free 21 micropipette single & multi channel a) single channel b) multi channel 22 micro centrifuge digital model t 16 23 electric water bath 6 hole 24 hot plate 8 dia 25 microtome rotary with accessoires 26 mixer grinder 27 uv cabinet double tube 28 water distillation unit 4 ltr.cap. 29 cutter mill (bark and seed grinder) 30 medicinal plant chart raxine 31 models fibre glass big size 32 permanent slide pack of 50 33 sonicator 2 ltr cap. 34 electrophoresis with analog power supply 35 fermentor 1 ltr capacity without computer. required accessories for fermentor a) autoclave 12x12 s.s. b) chiller bath 36 rotary shaker / v.d.r.l shaker with timer note. rotary shaker with 1 rpm accuracy rate on request phramcy practice lab 1 autoclave sterilizer 12x12 all. 2 hot air oven 14x14x14 all. 3 membrane filter s.s. 4 centrifuge 4 tube 14 | p a g e ggtutender 5 filling machine / bottle filling machine electrical operated 6 sealing machine bottle sealing machine hand operated 7 glucometer with strips 8 sintered glass funnel with complete filtering assemble 9 small disposable membrane filter for iv admixture filtration 10 vacuum pump 15 ltr oil free 11 surgical dressing 12 ph meter digital 13 blood pressure apparatus and stethoscope a) blood pressure app. mercury b) stethoscope 14 clinical thermometer mercury ...

Medical And Health Services - Rajasthan

33335880 supply and installation of various chemicals reagents consumables items for pathology lab 1 anti a ( sera ) 2 anti b ( sera ) 3 anti d ( sera ) 4 capillary tubes 5 sprit ( surgical ) 6 g6pd kit ( 12 test ) 7 ocult blood kit _ 8 anti sera _coombs 9 cover slip ( 18x18mm ) 10 disposable needles ( 24 guage ) 11* disposable needles ( 22 guage ) 12 disposable sterile urine container 13 esr disposable pipette 14 glass marker pencil 15 ketone strips 16 lancets 17 18 j micro glass slides microscope bulb 19 permanent marker thin ( black ) 20 rapid h & e 21 reticulocyte fluid 22 semen diluting fluid 23 sodiumcitrate 3.2% 24 thermal paper ( 110 mm ) 25 thermal paper ( 80 mm ) 26 thermal paper ( 57 mm ) 27_ small test tube plastic small test tube glass 28 29 tips ( 100 1000p i ) ( blue ) 30 tips ( 10 2001.11 ) ( yellow ) 31 tissue paper roll 32 tourniquate ( cloth ) 33 urine multi strips 34 urine strips for alb / sug, r 35 i vacutainer edta vial e 36 vacutainer sodium citrate 12% vial 37 new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area 38 cover slip ( 22x50 ) 39 diamond pencil 40 normal saline 41 papanicolou ready to use kit 42 myloproxidase 43 disposable syringes 2m1 44 disposable syringes 5m1 45 disposable syringes 10m1 46 disposable syringes 20m1 47 cotton roll 48 hand senitizer 49 dlc counter ( 8 diffrential min ) 50 alcian blue 51 benzidine powder 52 biebrich scarlet 53 celestine blue 54 chloral hydrate 55 malt diastase 56 microtome blade ( low profile ) 57 mercuric chloride 58 neutral red 59 nitric acid 60 nuclear fast red 61 numbering paper 62 peanut oil 63 plastic ring for block ( white ) 64 sodium metabisulfite 65 tetrazolium chloride 66 rapid pap stain kit 67 disposable gloves sterile / un steriliged 68 disposable gloves 69 non specihe esterase kit . 70 cryofix gel...

Rajasthan University Of Health Science - Rajasthan

33330379 lab regents and chemicals for pathology lab lab regents and chemicals for pathology lab , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , capillary tubes , sprit ( surgical ) , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , ketone strips , lancets , micro glass slides , microscope bulb , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , cover slip ( 22x50 ) , diamond pencil , normal saline , papanicolou ready to use kit , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , hand senitizer , dlc counter ( 8 diffrential min ) , alcian blue , benzidine powder , biebrich scarlet , celestine blue , chloral hydrate , malt diastase , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , peanut oil , plastic ring for block ( white ) , sodium metabisulfite , tetrazolium chlorlde , rapid pap stain kit , disposable gloves sterile / un steriliged , disposable gloves , non specihe esterase kit , cryofix gel...

Rajasthan University Of Health Science - Rajasthan

32582383 supply and installation of fully automatic rotary microtome at dept. of pathology, ruhs college of medical sciences, jaipur supply and installation of fully automatic rotary microtome at dept. of pathology, ruhs college of medical sciences, jaipur , supply and installation of fully automatic rotary microtome at dept. of pathology, ruhs college of medical sciences, jaipur...

Medical And Health Services - Rajasthan

32202322 regents for pathology lab 1 aceton 2 propanol 3 xylene 4 wa 5 microtome blade 6 plastic ring 7 eosin yellow 8 hemotoxiline crystal 9 sodium iodate 10 dpx ...

Indian Army - Rajasthan

32105238 local purchase of medicine for mh jodhpur , medicines : , alkaline phosphatase ( 2x44 / 2x11 ml ) , lipase ( 1x44 / 1x11 ml ) , albumin ( 10x44 ml ) , amylase ( 5x22 ml ) , bilirubin direct ( 6x44 / 3x22 ml ) , total bilirubin ( 6x44 / 3x22 ml ) , calcium ( 10x12 ml ) , cholesterol ( 10x44 ml ) , creatinine ( 5x44 / 5x11 ml ) , glucose ( 10x44 ml ) , hdl cholesterol ( 4x30 / 4x10 ml ) , ldl cholesterol ( 2x30 / 2x10 ml ) , total protein ( 10x44 ml ) , triglycerides ( 5x44 / 5x11 ml ) , urea ( 5x44 / 5x11 ml ) , uric acid ( 5x44 / 5x11 ml ) , ggt ( 2x44 / 2x11 ml ) , erba norm ( 1x5 ml ) , erba path ( 1x5 ml ) , erba xl multical ( 4x3 ml ) , cuvette for em 360 , ck mb ( 2x44 / 2x11 ml ) , ck nac ( 2x44 / 2x11 ml ) , ldh ( 2x44 / 2x11 ml ) , phosphorous ( 10x12 ml ) , micro protein ( 10x12 ml ) , sgpt ( 6x44 / 3x22 ml ) , sgot ( 6x44 / 3x22 ml ) , crp quantitative test ( 2x22 / 1x11 ml ) , ra factor quantitative test ( 1x22 / 1x5.5 ml ) , sample cups , pm kit ( em 360 ) , completetubing set ( em 360 ) , erba auto wash ( 10x100 ml ) , appen droff tube , biored biochemistry control ( level 1 ) , biored biochemistry control ( level 2 ) , cell pack solution ( 20 ltr ) , cell cleaner solution ( 50 ml ) , wbc / hgblysed reagent ( sromatolyser ) 500 ml , control ( 1x3 ) for sysmax kx 21 , printing paper 110 mm , calibrator for sysmax kx 21 , bact / alert blood culture infants , bact / alert blood culture adults ( aerobic ) , bact / alert blood culture adults ( an aerobic ) , crp ( 100 test / kit ) , ra factor ( 100 test / kit ) , aso ( 100 test / kit ) , widal ( 4x5 ml ) , dengue ( ns1, igg / igm ) rapid test , malaria parachek card ( 50 test ) , occultblood ( 50 test ) kit , pregnancy test card , h1n1 rapid test kit , viral transport media ( 50 test ) , esr tube , typhi dot igm ( 50 test ) , ketosticks ( 100 strips ) , uristickes ( 100 stripes ) , urine container ( 50 ml ) , sterile urine container ( 50 ml ) single packed , chloroform , microscopic cover glass ( 22x50mm ) , auto pipette multi channel , auto pipette ( 5 50 ul ) , auto pipette ( 50 200 ul ) , tissue paper roll , whatman filter paper no 1 , whatman filter paper no 4 , harris haematoxylin ( readymade stain ) , parafin wax with ceresin , perl stain , grocott stain , pas stain , reticulin stain , casette for tissue hilding , l mould , liquor ammonia , rapid pap stain , disposable blade ( art no 2840700 ) for microtome ( compatable with slee ) , durham tube ( 50 test ) , petridishes , sugar set for microbiological test lactose , sugar set for microbiological test maltose , sugar set for microbiological test glucose , sugar set for microbiological test urease , sugar set for microbiological test citrate , gram stain kit , zn stain kit , kovac reagent strip ( 25 strip / vial ) , lead acetate strip ( 25 strip / vial ) , oxidase disc ( 50 disc / vail ) , l j media ( readymade ) , mpo stain , spirit , band aid , litmus paper , procalcitonin rapid , gloves ( ancelle ) non latex , surgical blade 20’ , rna extraction kit ( containing:5x50 spins, carrier rna 1550 ?g, avl buffer 155ml, aw1 wash buffer 98 ml, aw2 wash buffer 66ml ) ( 250 tests in each kit ) , covid 19 one step rt pcr kit ( for orf1ab & n gene ) ( 50 test in each kit ) , strip indicators for sterilisation control ( for testing sterility of drums ) , vacutainer: edta 3ml , vacutainer sodium fluoride / sodium fluoride+k3edta , vacutainer sterile tube with gel 5ml , vacutainer sterile tube with out gel – 5ml , vacutainer sodium citrate – 3ml , agglutination tube ( felix ) 50 mmx12 mm , elisa reader thermal paper 110mm , glass cover microscopic , 22 x 30mm , glass cover 22x50 mm , paper filter round pkt of 100 , paper filter square ( 51cm x 51cm ) pkt of 100 , printing paper roll 55 mm for semiautoanalyser , acetone commercial , glacial acetic acid , hydrochloric acid. , alcohol dehydrated , alcohol methyl , d p x mounting med , prothrombin time , pttk reagent , xylene ( xylol pure ) , rapid coliform kit / water culture kit , meropenem 10ug ( pack of five vial ) , oxacillin 1 ug ( pack of five vial ) , ampicillin10ug ( pack of five vial ) , amoxyclav ( pack of five vial ) , imipenem ( pack of five vial ) , penicillin 10ug ( pack of five vial ) , tetracyclin 30ug ( pack of five vial ) , clindamycin ( pack of five vial ) , bacitracin 0.04ug ( pack of five vial ) , cefotaxim ( pack of five vial ) , ceftriaxone ( pack of five vial ) , ceftazidim / clavulanic acid ( pack of five vial ) , optochin ( pack of five vial ) , novobicin ( pack of five vial ) , ampi sulbactum ( pack of five vial ) , cefoxitin30ug ( pack of five vial ) , ceftazidim ( pack of five vial ) , chloramphenicol ( pack of five vial ) , colistin ( pack of five vial ) , streptomycin 300ug hls ( pack of five vial ) , linezolide ( pack of five vial ) , ticoplanin30ug ( pack of five vial ) , netilmycin ( pack of five vial ) , norfloxacin ( pack of five vial ) , nitrofurantoin ( pack of five vial ) , cefepime ( pack of five vial ) , amikacin ( pack of five vial ) , azythromycin ( pack of five vial ) , co trimoxazole ( pack of five vial ) , cefoperazone ( pack of five vial ) , ciprofloxacin ( pack of five vial ) , erythromycin ( pack of five vial ) , gentamicin ( pack of five vial ) , gentamicin 120ug hsg ( pack of five vial ) , levofloxacin ( pack of five vial ) , nalidixic acid 30ug ( pack of five vial ) , piperacillin 100ug ( pack of five vial ) , vancomycin 30ug ( pack of five vial ) , polymixin b ( pack of five vial ) , piperacillin / tazobactam ( pack of five vial ) , ofloxacin 5ug ( pack of five vial ) , cifran ( pack of five vial ) , ceftriaxone / sulbacta ( pack of five vial ) , augmentin ( pack of five vial ) , cefoparazone / sulbactum ( pack of five vial ) , tigicyclin ( pack of five vial ) , fluconazole ( pack of five vial ) , minocycline 30ug ( pack of five vial ) , ceftazidime avibactam ( pack of five vial ) , aztreonam 30ug ( pack of five vial ) , ertapenem 10ug ( pack of five vial ) , rifampicin ( pack of five vial ) , doxycycline 30ug ( pack of five vial ) , fosfomycin 200ug ( pack of five vial ) , pefloxacin ( pack of five vial ) , quinapristin dalfopristin ( pack of five vial ) , gatiflox 5ug ( pack of five vial ) , peflox 5ug ( pack of five vial ) , fostomycin 200ug ( pack of five vial ) , doripenem 10ug ( pack of five vial ) , ritampin 5ug ( pack of five vial ) , oinupeistin dalopristin 15ug ( pack of five vial ) , filter barrier tips ( 10?l ) pack of 960 , filter barrier tips ( 20?l ) pack of 960 , filter barrier tips ( 50?l ) pack of 960 , filter barrier tips ( 100?l ) pack of 960 , filter barrier tips ( 200?l ) pack of 960 , filter barrier tips ( 1000?l ) pack of 960 , 8 strip 0.1 ml tubes and flat optical strip caps ( each pkt contain 125 strip tubes +caps ) , kimtec wipes , molecular grade ethanol / bott of 500ml , absolute alcohol , falcon tube ( 50ml ) , micro centrifuge tube ( 2.0 ml ) pkt of 500 tube , eppendorf tube ( 1.5 ml ) pkt of 500 tube , rnase kil , covid 19 rapid ag test ( kit of 25 test ) , vtm kit ( kit of 50 test ) , d dimer fia ( porteblein sd biosensopr ) , pct fia ( porteblein sd biosensopr ) , drabkins sol for hb estimation , kit dengue serology ( ns1, igm / igg ) rapid test ( 10 test / kit ) , kit glucose 10x50 ml for semi auto analyzer , kit hdl 2x50 ml for semi auto analyzer , kit sgot for semi auto analyzer , kit sgpt for semi auto analyzer , kit t3 elisa , kit triglyceride 10x50 ml for semi auto analyzer , kit tsh elisa , kit urea 10x50 ml for semi auto analyzer , kit uric acid 10x50 ml for semi auto analyzer , kit cholestrol 2x50 ml for semi auto analyzer , microscope slide 75mm x 25 mm ( pkt of 50 ) , kit t4 elisa , vaccum blood collection tubes with needles : edta 3ml , vaccum blood collection tubes with needles : heparin 3ml , vaccum blood collection tubes with needles : sterile tube with gel 5ml ( material plastic / glass ) , vaccum blood collection tubes with needles and additives sodium fluoride / sodium fluoride+k3edta in tubes of vol 02 ml , solution erba wash 50 ( ml ) , pregnancy stip , kit paracheck sd ( green colourlebel ) no of 100 strip , mico tips ( 5 200ul ) , mico trips ( 500 1000ul ) , spirit , urostix ( 100 test per kits ) , urine dipstick 10 parameter ( sp gravity urobilinogen, nitrates, protine / albumine, glucose, kitones, ph, bilirubin, heme / rbc , vaccutainer plain , microscope cover slip 22 x 70mm , urine container disposable , lancet disposable ( pack of 100 ) , urine analysis strips ( bott of 50 strips ) , kit malaria paracheck ( antigen ) pack of 40 test , kit creatinine 10x50 ml for semi auto analyzer...

Rajasthan University Of Health Science - Rajasthan

31927326 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , sodium metabisulfite , capillary tubes , sprit , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n / 10 hcl , cedar wood oil , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50 ) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution ( liquid ammonia ) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate ( ammonium iron sulphate ) , ferric chloride , formalin ( formaldehyde 37 40 % ) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with ( ceresin 60 62 c ) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block ( white ) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye ( for shiff reagent ) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

31913247 supply of chemicals reagents consumable items for department of pathology anti b ( sera ) anti d ( sera ) sodium metabisulfite capillary tubes _ g6pd kit ( 12 tests ) ocutt blood kit coombs anti sera cover slip ( 18x18mm ) .__ dxposible nediles ( 24cuage ) disposible neoiues ( 22guage ) disposibue sterile urine comawer_ esr_oispoxable pipette glass marker pencil jsb stain i jsb stain ii ketone strips — — 1.ancets leishman’s stain micro glass slides microscope bulb cedar wood oil anti a ( sera ) ie thmnea? 26 ridh&e 27 reticulocyte stain semen diluting rluid 29 sodium citrate 3.2% 30 sodium citrate 3.8x 31 thermnlparllomm? 32 thermal paper 8o mm 33 thermalpaper57mm — 34 small test tube plastic small test tube glass 36. tips ( 1o04o0o11l ) 37 tips ( 10 2ooi.l ) 38 tissue paper roll — 39 torniguate ( cloth ) 4o urine multi sttips 41 urine strips for alt 42 vacutainer edta vial _ 43 vacutainer sodium citrate 3.2 % vial 44 wbc diluting fluid 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area giemsa stain liquid carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid !carbol fucihsin cover slip ( 22xso ) diamond pencil distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid _!carbol fucihsin _ cover slip ( 22xso ) diamond pencil . ? distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lo e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid hand sanitizer i ., 7o dic counter ( 8ditfrential miii ) fl acetk acid 72 acetone 73 acid fuschifl 74 acid periodic 75 activated charcoal 76 alicine blue 77 akjminftumchlo 78 mumoumhydx!h 7 ammoniun solution tliouid ammonlia 80 aniline blue 81 basic fuchsinl 82 benzidinle powder 83 biebrich scarlet — 84 brilliant cresyl blue 85 carmine power 86 celestine blue 87 chloral hvdrate 88 citric acid concentrated hcl 91 egg albumin flake 92 eosin yellow stain powder ferric ammonium sulphate ( ammonium 93 iron sulphate ) 94 ferric chloride gold chloride haematoxyline crystal hydrochloric acid ar hydrogen peroxide light green malt diastase mercuric oxide metanil yellow murcuri chloride 109 neutral red 110 nitric acid 111 nuclear fast red 112 numbering paper . 113 oxalic acid ______ _ 114 paraffin wax with ( ceresin 60 62 c ) ______ 115 peanut oil i 103 104 105 106 107 methylene blue _______ microtome blade ( low profile ) 108 9s rorman ( forrnaidehyde3 , _. _ congo red 89 90 fl6 e ? 117 phosphomolybuc acid 118 phosphotuflgstic acid .._________ i19. picric acid 120 plastic ring for block (white) 121 potassium oichromte 122 potassium hydroxi — 123 potassium metabisulphit 124 potassium permagnate 12s propaflolol — 126 readymade giemsanstanf 127 rosanilinle dye (for shiff reagent) 128 silver nitrate 135 tetrazollum chlorlde 136 toludine blue 137 xylene — 138 139 rapid pap stain kit disposable gloves sterile 140 disposable gloves unsteriliged 141 non speciheesterase kit 142 bovine albumin_22% 129 sodium nitropruside 13o sodium hydroxide 131 sodium sulphate — 132. sodium thiosuiphate 133 sudan black b 134 sulfurous acid_ ...

Medical College - Rajasthan

31635926 chemical reagents and glass items chemical reagents and glass items , rate contract of chemical and reagents items , picric acid purified , fuchsin acid (c.i. 42685) , acetic acid glacial 100% for analysis , charcoal activated , potassium permanganate for analysis , silver nitrate for analysis , ammonia solutionfor analysis , sulfuric acid about 98% for analysis , carbol fuchsin (ziehl & neelsen stain solution) dilute for microscopy , chloral hydrate, 99+%, extra pure, slr, meets the specification of bp and ph. eur. , cycloheximide 1pc x 1gm , micro tips material: pp autoclavable 10 to 200?l , micro tips material: pp autoclavable 200 1000?l , dpx new non aqueous mounting medium for microscopy , eosin yellowish (c.i.no. 45380, s.no. 881) indicator and for microscopy , aluminium ammonium sulfate , formaldehyde solution min. 37% (stabilized with about 10% methanol) , gold(iii) chloride =99.99% trace metals basis , hydrochloric acid comerical , hydrogen peroxide 30% for analysis , 2 propanol for analysis , metanil yellow reag. ph eur , methyl blue aqueous solution , paraffin wax 60 62°c , phenol , potassium dichromate for analysis , potassium hydroxide pellets for analysis , sodium hypochlorite solution approximately 4% w/v available chlorine , xylenesulfur free , brain heart infusion agar suitable for microbiology, nutriselect® plus , brain heart infusion broth suitable for microbiology, nutriselect® plus , deoxycholate citrate agar suitable for microbiology, nutriselect® plus , fluid thioglycollate medium , formaldehyde sconcentration 40% , mannitol salt agar , macconkey agar suitable for microbiology, nutriselect® basic , mueller hinton agar for testing the sens , nutrient agar , nuclear fast red (c.i. 60760) , sabouraud glucose agar with chloramphenicol suitable for microbiology, nutriselect® plus , triple sugar iron agar for microbiology , glucose broth , hematoxylin cryst. (c.i. 75290) for microscopy , light green (c.i. 42095) for microscopy , pus culture tube 15ml , tri sodium citrate dihydrate for analysis , urea agar (base) acc. to christensen for , dextrose anhydrous purified , arabinose disks suitable for microbiology , dulcitol disks suitable for microbiology , galactose disks suitable for microbiology , lactose disks suitable for microbiology , maltose disks suitable for microbiology , mannitol disks suitable for microbiology , mannose disks suitable for microbiology , sorbitol disks suitable for microbiology , sucrose disks suitable for microbiology , trehalose disks suitable for microbiology , xylose disks suitable for microbiology , aztreonam , bacitracin disks suitable for microbiology , carbenicillin (cb) , cefixime (cfx) , cefotaxime +clavulanic acid , cefoxitin (cn) , ceftazadime , ceftazidine +clav acid , amikacin , ampicillian , amoxycillin , amoxy clave , ceftriaxone+ clavulanic acid , ceftrixone , cephalexin , ciprofloxacin , cloxacillin , co trimoxozole , doxycline , erythoromycin , gentamicin , imepenem , nalidixic acid , nitrofurantoin , norifloxacin , onpg disks suitable for microbiology , optochin disks suitable for microbiology , pipercillin+tazobactum , tetracycline , vancomycin , colistin disc , polymixin b , azithromycin , cefotaxime , chloramphenicol , cefeperazone + sulbactum , clindamycin , ertapenam , gentamicin 120 mg. , netalmycin sulphate , ticoplanin , levofloxacin , linezolid , ofloxacin , novabiocin , tigicycline , fosfomycin , meropenam , raffinose , bile esculin disks suitable for microbiology , imepenem + edta , vancomycin e strip , polymixin b e strip , colistin e strip , netalmycin e strip , benzyl penicillin e strip , crystal violet , potassium tellurite , n,n,n,n tetramethyl p phenylenediamine dihydrochloride , giemsa stain, solution pbf , paraffin liquid , methanol , capillary tube (wide hole) (1 pkt. contained100 pcs.) , citric acid , hydrochloric acid , acetic acid glacial 100% , ammonium chloride for analysis , blood culture bottle pediatric (50x20) , blood culture bottleadult (50x20) , test tubes without rim 18 x 150 mm , test tubes without rim 12 x 100 mm , ammonium oxalate pc count solution , rapid rc stain kit (new methylene blue) , eosin y solution 0.5% alcoholic for microscopy , cover slipsize18x18mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x22mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x50mm english glass mo 1thik ness(0.13mmto0.16mm) , sodium meta bisulphati , methenamine borates tab. , ihc antibody er , pr , her 2 , microtome blade , myeloperoxidase mpo stain kit , pas staining kit for detection of aldehyde and mucosubstances , leishman’s stain a , leishman’s stain b , rbcdiluting fluid , w.b.c. diluting fluid , pearl stain kit , giemsa stain, modified solution (for the staining (of cellular blood components and blood parasites)) , fields stain a solution , fields stain b solution , hemoglobino meter , neubauer chamber , sprit lamp brass , ammonium sulfate , sodium chloride , potassium chloride , rapid pap kit , nitric acid , toludine blue , agar agar , alkaline peptone water , bile esculine agar base , mr vp (glucose phosphate broth) , peptone water , phenyl alanine agar , simmons citrate agar , xld agar , hichrome uti chromogenic agar , esculin , basic fuschin , bromocresol purple , cedarwood oil , calcium chloride , horse serum , iodine cyrstal , l lysine monohydrate , l araginine monohdyrate , l ornathine monohydrate , iso amyl alcohol , potassium iodide , p diamethyl amino benzeldehyde , ph indicater strip 0 to 7 , ph indicater strip 7 to 14 , sodiumpoly anthosulphonate , petridish glass size 4 inch borosilcate , petridish plastic size 4 inch autoclaveble , petridish plastic size 6 inch autoclaveble , petridish glass size 6 inch borosilcate , dorhums tubes , flask conical 500 ml , flask conical 1 ltr , flask conical 250 ml , measursing cylender glass 1000 ml , masuring cylenderglass 500 ml , measursing cylender plastic 1000 ml , masuring cylenderplastic 500 ml , masuring cylenderplastic 100 ml , glass funnel size 4 inch , glass funnel size 3 inch , plastic funnel size 4 inch , plastic funnel size 3 inch , disposable sterile swab , disposable sterile swab with tube , carbolic soap 80 grm , dimond marker/pencil...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

31523086 miscellaneous items for anatomy miscellaneous items for anatomy , dissection table with stainless steel top , dissection table half standard size , embalming table , hand saw(stainless steel) , bone & meat cutting machine for thin body sections. , brain knife ( handles and blades ) , simple s.s. stretcher trolley for cadever transport , embalming machine , dissecting instruments. , electrically operated hand drill. , x – ray viewing lobby (4 film view) view boxes. , microtome manual , slide cabinets ( horizontal manner ) , skeletons articulated with box , slide rack. , slide carrying tray. , paraffin embedding system. , plastic tanks for storing soft and dissected parts , rectangular hot plate , dissection microscope , skeleton disarticulated. , band saw , microtome sledge large cutting , chiesel and hammer (i each) made of steel , note: 1. this bid should be summited online only. 2. the financial bid should compulsorily be in this sheet only. any financial information mentioned elsewhere or in different form shall be liable not to be considered. 3. all rates quoted must be for destination. 4. rates quoted should include all expenditure upto destination point including freight, insurance, etc. except taxes should be shown separately. 5. rates should be quoted itemized. 6. the financial bid shall be considered only technically qualified bidders....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

31483564 miscellaneous items for anatomy table with stainless steel tops with a minimum size of 6 x 2 x3 dieection table) 10 40 tables with stainless steel tops half standard size (disscetion table) 2 8 drill machine 2 8 handsaw, preferably metal 3 12 band saw for sectioning body and limbs , 1 4 brain knife 2 8 plastic tanks for storing soft and dissected parts 8 32 stretcher trolley 2 8 x ray viewing lobby 2 8 dissecting instruments for cadaveric dissection 10 40 meat cuffing machine for thin body sections (trans and vertical) for gross anatomy sectional study i 4 embalming machine 1 4 embalming table 1 4 dissection micmscope 3 12 microtomes rotary . 1 4 miocrotome sledge large cuttin.g 1 4. cabinet f* slides (1000) . 4 16 paraffin embedding system i. 4 rectangular hot plate . 1 4 sliderack i 4 slide carrying tray . . . 5 2o articulated skeleton set. 5 20 bones (dis articulated) sets . 15 60 chiesel and hammer (1 each) ...

Medical And Health Services - Rajasthan

30685026 supply of medicine ecg roll, glass slide, wax, ethanol, xylene, hemetoxyline, eosin, cassete, microtome knife, fanc gun, tube seelar, bd vacutainer, centrifuge machine, tissu paper roll, examination gloves, micropipate, para film, plain tube with cap for plasma separation, lopinavir / ritonvir, tips stend, ria vail, tips, dropers, b p instruments mercury, pipette stand, timer machine digital, mephentin vail, phonytoin, propofol, pricking needle, ranitidine, adrenaline, spinal needle, lox heavy, cord clamp, plastic apron, eye drape, black goggles, cresant blade, keratone, t.m. plus eye drope, pilocarpine eye drope, homide eye drop, eye iol lence, lance tip blade, tropicamide + phenylephine eye drop, dopamine inj, meg. sulphate, plaster of paris, r l glass bottle, tab efavirinz, pts. trolley, examination table with mattress powder, nabuliser machine, suction machine electric, needle syringe destroyer, laryngoscope + four blade, bain circuit, bed side screen with curtain, oxygen regulator with glass humidifier bottle, inst. troley ss, ambu bag....

Government College of Education - Rajasthan

30369012 supply of equipment in prani vigyan section govt girls college chittorgarh 1 student compound microscope | 2 laboratory incubator l hot plate 4 4 laboratory balance 5 rotatory microtome 6 haemometer 7 digital analyical electronic balance 8 haemocytome ter o mercurial bp apparatus ( regular ) 0 double door refrigerator, 11 digital binocular research microscope and usb digital camera : 2 digital ph meter l3 sacchi disk binocular research mlcroscope 2 laminar air flow bench 3 revolutionary micro centrifuge 4 student compound microscope 5 double door refrigerator, etc...

Government College of Education - Rajasthan

30368477 supply of equipment in vanaspati vigyan section govt girls college chittorgarh 1 student compound microscope | 2 laboratory incubator l hot plate 4 4 laboratory balance 5 rotatory microtome 6 haemometer 7 digital analyical electronic balance 8 haemocytome ter o mercurial bp apparatus ( regular ) 0 double door refrigerator, 11 digital binocular research microscope and usb digital camera : 2 digital ph meter l3 sacchi disk binocular research mlcroscope 2 laminar air flow bench 3 revolutionary micro centrifuge 4 student compound microscope 5 double door refrigerator, etc ...

Rajasthan University Of Health Science - Rajasthan

30320541 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a (sera) , anti b (sera) , anti d (sera) , sodium metabisulfite , capillary tubes , sprit , g6pd kit (12 test ) , ocult blood kit , coombs anti sera , cover slip (18x18mm) , disposable needles (24 guage) , disposable needles (22 guage) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n/10 hcl , cedar wood oil , permanent marker thin (black) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper (110 mm) , thermal paper (80 mm) , thermal paper (57 mm) , small test tube plastic , small test tube glass , tips (100 1000? l) ( blue ) , tips (10 200? l) ( yellow ) , tissue paper roll , tourniquate (cloth) , urine multi strips , urine strips for alb/sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution (liquid ammonia) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate (ammonium iron sulphate) , ferric chloride , formalin (formaldehyde 37 40 %) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade (low profile) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with (ceresin 60 62 c) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block (white) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye (for shiff reagent) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

30302809 supply and installation of various chemicals & reagents& consumable items for department of pathology 1 antia (sera) 1x10 ml 2 anti b (sera) 1x10 ml 3 ant| d (sera) 1x10 ml 4 sodium metabisulfite 1x50 gm 5 capillary tubes 1x100 ml 6 sprit 1x 5001 7 g6pd kit (12 tests ) lx],? 8 ocult blood kit 1x50ml 9 coombs antisera 1x10ml 10 cover slip (18x18mm) 20x10 11 disposible nediles (24guage) 1x100 t2 drsposrble nediles (22guage) 1x100 13 disposible sterile urine container 1x100 t4 esr disposable pipette 1x100 15 glass marker pencil 1x10 15 jsb stain i 1x500ml l7 jsb stain ii 1x500ml 18 ketone strips 1x50 19 lancets 1x200 20 leishman,s stain 2x500ml 2l micro glass slides 1x50 22 microscope bulb mono pack 23 n/1o hcl 1x500ml 24 cedar wood oil 1x1000m1 25 permanet marker pen thin (black) mono pack 26 lrapidh&e 2x500ml 27 i reticulocvte stain 1x25ml 28 semen dilutine fluid 1x125 ml 29 sodium citrate3.2% 1x500 ml 30 sodium citrate 3.8% 1x500 ml 31 thermal paper 1lomm monopack 32 thermal paper 80 mm monopack 33 thermal paper 57mm monopack 34 small test tube plastic 1x100 35 small test tube glass 1x100 36 tips (100 1000u1) 1xs00 37 tips (10 200u1) 1x1000 38 tissue paper roll monopack 39 torniquate (cloth) monopack 40 urine multistrips 1x100 47 urine strips for alb/sug 1x100 42 vacutainer edta vial 1x100 43 vacutainer sodium citrate 3.2 % vial 1x100 44 wbc dilutine fluid 1x500 ml h 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area monopack 46 giemsa stain liquid 1x125ml dj r 47 carbol fuchsin 1x100 ml 48 cover slip (22x50) 1x20 oackets 49 diamond pencil 1x10 50 distilled water 1x5lt 51 dpx mount 1x250 ml 52 ethanol 1x500 ml 53 filter oaoer 460x570 mm 1x100 54 methanol 1x2.5 lt 55 normalsaline 1x500 ml 56 papanicolou ready to use kit 1x1 kits 57 hematoxiline powder 5gm 58 glacial acetic acid 1x500 ml 59 aluminium potassium sulphate dodecehydrate 1x500 em 60 sodium lodate lx100 em 61 potassium ferrocvanide 1x500 ml 62 mveloperoxidase 1xl kit 63 disposable syringes 2ml 1x50 64 disposable svrinees 5ml 1x50 65 disposable svrinees 10ml 1x50 66 disposable svrinees 20ml 1x50 67 cotton roll 1x500gm 58 petridish disposable 1x1 69 hand senitiser 1x500 ml 70 dlc counter ( 8 diffrential min ) monopack 7t acetic acid 1x500 ml 72 acetone 1x2.5 lt 73 acid fuschin 1x25gm 74 acid periodic 1x100 em 75 activated charcoal 1x100 em 76 alicine blue 25 em 77 aluminium chloride 1x100 em 78 aluminium hydroxide 1x100 em 79 ammonium solution (liquio ammonia) 1x500 ml 80 aniline blue 1x259m 81 basic fuchsin 1x25 em 82 benzidine powder 25 em 83 biebrich scarlet 1x25 gm 84 brilliant cresyl blue 1x25 em 85 carmine power 1x5 sm 86 celestine blue 1x100 em 87 chloral hvdrate 1x500 gm 88 citric acid 1x500 ml 89 concentrated hcl 1x500 ml 90 congo red 1x100em 91 egg albumin flake 1x500 sm 92 eosin vellow stain oowder 1x25 em 93 ferric ammonium sulphate (ammonium iron sulphate) ,i 500gm dq ferric chloride 1x500 em 95 forma lin ( forma ldehv de 37 4o o/o 1x30lt 2tl{ / (rr * 95 1x2.5 lt 97 glycer:ol 1x2.5 lt 98 gold chloride 1x1 gm 99 haematoxvline crvstal 1x5 em 100 hvdrochloric acid ar 1x2.5 lt 101 hvdrosen peroxide 500 ml t02 light green 1x25 sm 103 malt diastase 1x5 gm to4 mercuric oxide 1x100 em 105 metanilyellow 25 em 106 methylene blue 1x25 gm lo7 microtome blade (low orofile) 1x50 108 murcurichloride 100 em 109 neutral red 1x25 gm 110 nitric acid 1x500 ml llt nuclear fast red 1x25 em lt2 numberine daoer 1x100 113 oxalic acid 1x500 em ll4 paraffin wax with (ceresin 60 62 c) 1x2 ke 115 peanut oil 1x100 rnl 116 phenol 1x500 ml tt7 phosohomolvbdic acid 1x100 em 118 phosphotunestic acid 1x100 gm 119 picric acid 1x500 ml l20 plastic ring for block (white) each lzl potassium dichromte 500 em l22 potassium hvdroxide 500 em 123 potassium metabisulphit 1x500 gm 724 potassium permaqnate 1x500 em l25 propanolol 1x2.5 lt 726 readymade giemsa stain 1x125 ml l27 rosaniline dye (for shiff reagent) 1x100 gnr l28 silver nitrate 1x25 em 129 sodium nitropruside 100 em 130 sodium hvdroxide 500em 131 sodium sulphate 500 em l32 sodium thiosulphate 1x500 em 133 sudan black b 1x25 gm 134 sulfurous acid 1x500 ml 13s tetrazollum chlorlde 1x25 em 135 toludine blue 1x25 gm t37 xylene 1x2.5 tt 138 rapid pap stain kit 139 disoosable gloves sterile 1x50 t40 disposable gloves unsteriliged 1x100 14l. non soecihe esterase kit monooack 142 bovine albumin22% ...

Indian Army - Rajasthan

29803476 local purchase of laboratory reagents local purchase of laboratory reagents for mh jodhpur , medicines : , alkaline phosphatase ( 2x44 / 2x11 ml ) , lipase ( 1x44 / 1x11 ml ) , albumin ( 10x44 ml ) , amylase ( 5x22 ml ) , bilirubin direct ( 6x44 / 3x22 ml ) , total bilirubin ( 6x44 / 3x22 ml ) , calcium ( 10x12 ml ) , cholesterol ( 10x44 ml ) , creatinine ( 5x44 / 5x11 ml ) , glucose ( 10x44 ml ) , hdl cholesterol ( 4x30 / 4x10 ml ) , ldl cholesterol ( 2x30 / 2x10 ml ) , total protein ( 10x44 ml ) , triglycerides ( 5x44 / 5x11 ml ) , urea ( 5x44 / 5x11 ml ) , uric acid ( 5x44 / 5x11 ml ) , ggt ( 2x44 / 2x11 ml ) , erba norm ( 1x5 ml ) , erba path ( 1x5 ml ) , erba xl multical ( 4x3 ml ) , ck mb ( 2x44 / 2x11 ml ) , ck nac ( 2x44 / 2x11 ml ) , ldh ( 2x44 / 2x11 ml ) , phosphorous ( 10x12 ml ) , micro protein ( 10x12 ml ) , sgpt ( 6x44 / 3x22 ml ) , sgot ( 6x44 / 3x22 ml ) , crp quantitative test ( 2x22 / 1x11 ml ) , ra factor quantitative test ( 1x22 / 1x5.5 ml ) , sample cups , pm kit ( em 360 ) , erba auto wash ( 10x100 ml ) , cuvette for em 360 , biored biochemistry control ( level 1 ) , biored biochemistry control ( level 2 ) , appen droff tube , cell pack solution ( 20 ltr ) , cell cleaner solution ( 50 ml ) , wbc / hgblysed reagent ( sromatolyser ) 500 ml , control ( 1x3 ) for sysmax kx 21 , printing paper 55 mm , calibrator for sysmax kx 21 , bact / alert blood culture infants , bact / alert blood culture adults ( aerobic ) , bact / alert blood culture adults ( an aerobic ) , crp ( 100 test / kit ) , ra factor ( 100 test / kit ) , aso ( 100 test / kit ) , widal ( 4x5 ml ) , dengue ( ns1, igg / igm ) rapid test , malaria parachek card ( 50 test ) , ana qualitative test kit , doublechannel coagulometer tube ( pkt of 1000 ) , occultblood ( 50 test ) kit , g6pd kit ( 12 test ) , pregnancy test card , chikengunya rapid test ( 1x10 test kit ) , esr tube , typhi dot igm ( 50 test ) , ketosticks ( 100 strips ) , uristickes ( 100 stripes ) , urine container ( 50 ml ) , sterile urine container ( 50 ml ) single packed , chloroform , auto pipette multi channel , auto pipette ( 5 50 ul ) , auto pipette ( 50 200 ul ) , tissue paper roll , glucose pulv ( 1 kg ) , whatman filter paper no 1 , whatman filter paper no 4 , perl stain , grocott stain , pas stain , reticulin stain , casette for tissue hilding , l mould , diamond glass marker , disposable blade ( art no 2840700 ) for microtome ( compatable with slee ) , petridishes , mpo stain , spirit , swab sticks ( pkt of 100 ) , nylon thread , litmus paper , procalcitonin test kit , gloves ( ancelle ) non latex , eosin powder , coplin jar , vacutainer: edta 3ml , vacutainer sterile tube with gel 5ml , vacutainer sterile tube with out gel – 5ml , vacutainer sodium citrate – 3ml , microscope bulbs , agglutination tube ( felix ) 50 mmx12 mm , elisa reader thermal paper 110mm , microscopic cover glass ( 22x50mm ) , glass cover microscopic ( 28 x 50mm ) , glass cover ( 32x50 mm ) , paper filter square ( 51cm x 51cm ) pkt of 100 , printing paper roll 55 mm for semiautoanalyser , test tube ( 12 mm x 75 mm ) , assorted pkt of various size of nichrome loops , glacial acetic acid , nitricacid , alcohol dehydrated , alcohol methyl , d p x mounting med , sugar set for microbiological test urease , sugar set for microbiological test citrate , albert metachromatic stain , neissers metachromatic stain , strip indicators for sterilisation control ( for testing sterility of drums ) , alkaline peptone water , mc farland standard set , gram stain kit , zn stain kit , kovac reagent strip ( 25 strip / vial ) , lead acetate strip ( 25 strip / vial ) , oxidase disc ( 50 disc / vail ) , ceftazidime avibactam 30 / 20 ug ( pack of five vial ) , aztreonam 30ug ( pack of five vial ) , ertapenem 10ug ( pack of five vial ) , doxycline 30 ug ( pack of five vial ) , fosfomycin 200 ug ( pack of five vial ) , minocycline30 ug ( pack of five vial ) , oxacillin1 ug ( pack of five vial ) , bacitracin 0.04 ug ( pack of five vial ) , meropenem vaborbactam ( pack of five vial ) , optochin ( pack of five vial ) , cefoxitin ( pack of five vial ) , gentamicin 120 ughlg ( pack of five vial ) , ampicillin 10 ug , piperacillin 100 ug , tetracylin 30 ug , gatiflox5 ug , naladixic acid 30 ug , oflox 5 ug , peflox 5 ug , co trimaxazole ( trimethoprim +sulphanethoxozole ) , fostomycin200ug , aztreonam 30 ug , imipenem 10 ug , meropenem10 ug , doripenem 10 ug , cefoxitin 30 ug , penicillin 10 ug , ritampin 5 ug , qinupeistin dal opristin 15 ug , vancomycin 30 ug , teicoplanin 30 ug , iodine solution , mac conkey agar , mueller hinton agar , cled agar , prothrombin time , pttk reagent , hcvrapid test card , hbsagrapid test card , vdrl test , blood donor batch figer 1 , blood donor batch figer 2 , blood donor batch figer 3 , blood donor batch figer 4 , abo / rho ( d ) forward & reverse grouping card with auto control pack of 24 cards , abo / rho ( d ) forward conformation card pack of 24 cards , abo / rho ( d ) ahg neonate 209group card pack of 24 car21ds , ahg ( coombs ) test card pack of ( 6x24ahg card ) , forward groupingand cross matching cardpack of 24 cards , abo sub grouping card a1pack of 24 cards , abo sub grouping cardhpack of 24 cards , matrix diluents 2 pack of 500 mlpack ( liss ) , hepatitis arapid test , hepatitis erapid test , rpr test , hiv i & ii rapid test kit ( 50 cards pack ) , hepatitis b surface antigen ( hbsag ) detection elisa kit of 96 tests , hiv antibody 1 & 2 detection elisa kit for 96 tests. , hcv elisa kit ( advanced 3rd generation ) , double blood bag of 350ml with 49ml cpd a anticoagulant made up of non toxic plastic , transfer blood bag 100ml capacity ( paediatric ) , serum anti d igg + igm ( for saline tube test ) , serum anti human globulin , serum haemaglutinatinggp. a ( anti b ) ( monoclonal ) , serum haemaglutinatinggp. b ( anti a ) ( monoclonal ) , serum haemaglutinatinggp. ( anti ab ) ( monoclonal ) , serum anti a 1 , serum anti h , serum anti d 1gg , rna extraction kit ( containing:5x50 spins, carrier rna 1550 μg, avl buffer 155ml, aw1 wash buffer 98 ml, aw2 wash buffer 66ml ) , covid 19 one step rt pcr kit ( for orf1ab & n gene ) , filter barrier tips ( 10μl ) , filter barrier tips ( 20μl ) , filter barrier tips ( 50μl ) , filter barrier tips ( 100μl ) , filter barrier tips ( 200μl ) , filter barrier tips ( 1000μl ) , 8 strip 0.1 ml tubes and flat optical strip caps ( each pkt contain 125 strip tubes +caps ) , kimtec wipes , molecular grade ethanol , absolute alcohol , falcon tube ( 50ml ) , falcon tube stand , micro centrifuge tube ( 2.0 ml ) , eppendorf tube ( 1.5 ml ) , rnase kil , drabkins sol for hb estimation , kit cholestrol 2x50 ml for semi auto analyzer , kit creatinine 10x50 ml for semi auto analyzer , kit glucose 10x50 ml for semi auto analyzer , kit hdl 2x50 ml for semi auto analyzer , kit malaria paracheck ( antigen ) pack of 40 test , kit sgot for semi auto analyzer , kit sgpt for semi auto analyzer , kit t3 elisa , kit t4 elisa , kit triglyceride 10x50 ml for semi auto analyzer , kit tsh elisa , kit urea 10x50 ml for semi auto analyzer , kit uric acid 10x50 ml for semi auto analyzer , kit wbc / hgb lysed reagent ( 500ml ) ( stromatoliser ) , lancet disposable ( pack of 100 ) , microscope cover slip 22 x 70mm , microscope slide 75mm x 25 mm ( pkt of 50 ) , urine analysis strips ( bott of 50 strips ) , vaccum blood collection tubes with needles : heparin 3ml , vaccum blood collection tubes with needles and additives sodium fluoride / sodium fluoride+k3edta in tubes of vol 02 ml , covid 19 rapid ag test ( kit of 25 test ) , xylose lysine deoxycholate agar , lacto phenol cotton blue , l j media readymade ( pack of 6 bottle ) , streptomycin 300ug hls ( pack of five vial ) , rapid coliform test kit ( water culture ) , 5% ship blood agar on mha ( pack of 20 plates ) , nichrome wirre loop for urine culture , hiv antibody 1 & 2 detection rapid test kit ( kit of 50 test ) => limited...

University Of Kota - Rajasthan

29729192 supply and installation of lab. items, instruments and equipments. 1 ice cube maker outer body with heavy duty angle iron frame and inner storage bin of steel, storage bin insulation with high density puf, cleaning provision after every cycle, with capacity of 25kg/hr. 2 2 analytical balance for demonstration case material: wooden and glass, capacity: 200gm approx., sensitivity: 1/5 mg, supply with weight box. 6 3 digital balance: 0.1 mg readability capacity: 220g or more, readability: 0.1 mg, repeatability (at nominal load): 0.1 mg, linearity deviation: ±0.2 mg, sensitivity temperature drift: 2 ppm/oc, setting time: 2s, adjustment: automated internal and external calibration, display: backlit lcd, power saving mode. 3 4 digital balance: 10 mg readability capacity: 220g or more, readability: 10 mg, repeatability (at nominal load): 0.1 mg, linearity deviation: ±0.2 mg, sensitivity temperature drift: 2 ppm/oc, setting time: 2s, adjustment: automated internal and external calibration, display: backlit lcd, power saving mode. 8 5 centrifuge machine brushless induction motor, microprocessor controlled led display, stainless steel centrifuge chamber, digital timer 0 59 min., frequency drive, dynamic brake with imbalance detector, speed ≥ 5000rpm, speed accuracy ±10 rpm, acceleration time to max. rpm : ≤15 s braking time to maximum rpm : ≤15s, safety lid with lock, adjusted swing/angle rotor with 15ml 8 tubes of polypropylene tubes, tube sealer to seal the tubes should be provided, noise level ≤ 65 db, compact design, voltage / frequency input according to indian options and good tolerance to the fluctuation 8 6 ultra centrifuge machine microprocessor based. square m s body duly powder coated. double walled light weight abs lid. speed not less than: 10000 26000 rpm, machine should have capacity 60 85ml in angle rotor. machine should have provision of mtp plate rotor. machine should have all rotors pre programmed. provision of speed increments 1 rpm. brushless drive, imbalance cut off & acceleration & deceleration curves led display for run. fitted with microprocessor based 2 lines 16 characters lcd panel for 0 59 minutes countdown timer, digital rpm meter and programmable speed controller. multiple rotor and carrier options, touch screen, easy to use controls, programmable acceleration/deceleration options make the portfolio highly 2 bidding document for e procurement university of kota, kota (rajasthan) page 10 of 39 d/nitesh/tender/chemistry adaptable for multiple applications. 7 double distillation assembly quartz double distillation unit. demountable boiler panel series. model – vertical. distilled water output capacity – 1 2.5 litres / hours. distillate water quality specification’s: ph: 6.9 to 7,free from pyrogen and organic matter, conductivity <1x10 6 s/cm, total organic carbon <500µg/l, total solids <0.1mg/lit. accessories for double distillation unit.• distillation apparatus power supply (daps) , low temperature circulating water bath (chiller),working temperature : 10°c to 100°c, temperature accuracy: ±01°c,insulated electrical connections with safety cutoff device. distillation stand should be of high quality rust free metal with embedded clamps for perfect holding and storage tank. threaded connectors are offered with all water connections., made of high quality heat resistant glass cylinders and tubes and also resistant to minor damages, boiler portion made of high purity and good quality borosilicate material along with water level indicator, borosilicate condenser, heater is of high purity electronic grade transparent quartz type. should avoid contact of embedded boiler with water electrical requirements 230 250 volts single phase 1.5x2 kw quartz heater, energy efficient. provided with safety cut off device. parts should be replaceable. iso accredited. audio alarm light indicator, electrical dual auto cut off system, mcb, optical beam sensor for the tracking of water level reduction, increase and also the increase of the boiler pressure. 4 8 single distillation assembly wall hanging type with bracket/clamps, electrically operated, single walled, capacity of production pyrogen free distilled water, made of heavy gauge stainless steel. distillation capacity: 2 10 litres/hr.isi immersion heating element. electric control panel: water level cut off device, rubber and sealing ring: between the boiler & lid, take control valve: for water inlet., return water pipe, acid resistant, alkali proof and corrosion proof. supplied with clamps, storage tank, 2 nos of replaceable immersion heating element and core power cord of minimum 2 meter length along with 3 pin industrial plug/top. single phase ac 230+ 10v & 50+ 1hz.loads:1.5kw 8kw. 1 9 uv cabinet uv viewing cabinet with uniform uv illumination, soft rubber view port, uv filters for eye protection, control switches, 3 uv sources (shortwave 254nm and longwave 366nm and visible), all the essential accessories required for inspecting paper & thin layer chromatograms and fluorescent materials. 6 10 hot air oven external/internal body and other parts like tray etc should be made of high quality material like ss316 or better. proper facility for ventilation and air circulation. temperature range: 50°c to 300°c or better. temp. set and display sensitivity: temp. variation: ± 1 ºc. material: stainless steel or better. no. of shelves: 3 or more, chamber size: 18x18x18 or better (should be fitted on 2.5 feet bench). accuracy: ±2°c or better. microprocessor control system and digital displays, digital 12 bidding document for e procurement university of kota, kota (rajasthan) page 11 of 39 d/nitesh/tender/chemistry sample temperature display; control panel option provision for door safety locking system. accessory: electric codes (1 pc), gloves (1 pair), and tong (2 pc), removable stainless steel racks (2 pc extra). power supply: 100 240v,50/60 hz. voltage (v) 220volt, frequency (hz) series 50 hz. 11 hot plate heating plate surface: the cast iron plate machined to a smooth & levelled surface is fitted on a robust mild steel double body painted with an attractive stoving enamel. top of rectangular cast iron plate has insulated beaded elements inside. heating range: up to 350 deg. c. continuous operation for long time. accuracy in temperature: +/ 2 deg. c. or better. uniformity: +/ 1 deg. c. or better. controller: provided with thermostat (up to 350°c) or energy regulator or digital controller cum indicator pid micro processor controller dual display with safety alarm. rating: 2kw. power indicator: on/off. power requirements:220v ac, 50hz cycle. dimensions :10 x 12 inches 19 12 water bath 6 holes 06 holes of 75mm dia, double walled inside stainless steel and outside mild steel sheet painted in epoxy powder coating (rust resistant material) with lid. bath should consist of two pilot lamp, temperature control knob and on/off switch to work on 220/230 volts ac supplied with or without stirring arrangement without racks and thermometer. instrument should have lift up bath cover; carrier racks should be given for flasks and test tubes racks. a cock should be provided to facilitate draining of bath contents. water bath protective media should be there to prevent contamination and formation of algae. temperature is generally electronic digital temperature controller, from ambient temperature +5 to 100oc with accuracy of ±10 c and ±0.10c. audible warning safety signals should be there for high/low temperature warnings, and dry running protection. all electrical peripherals required for smooth functioning e.g. voltage stabilizer should be provided with the equipment, water bath rectangular (single wall), auto cut heating elements are fitted 5 13 water bath 12 holes 12 holes of 75mm dia, double walled inside stainless steel and outside mild steel sheet painted in epoxy powder coating (rust resistant material) with lid. bath should consist of two pilot lamp, temperature control knob and on/off switch to work on 220/230 volts ac supplied with or without stirring arrangement without racks and thermometer. instrument should have lift up bath cover; carrier racks should be given for flasks and test tubes racks. a cock should be provided to facilitate draining of bath contents. water bath protective media should be there to prevent contamination and formation of algae. temperature is generally electronic digital temperature controller, from ambient temperature +5 to 100oc with accuracy of ±10 c and ±0.10c. audible warning safety signals should be there for high/low temperature warnings, and dry running protection. all electrical peripherals required for smooth functioning e.g. voltage stabilizer should be provided with the equipment, water bath rectangular (single wall), auto cut heating elements are fitted 5 14 melting point basic and digital melting point apparatus having measuring range 8 bidding document for e procurement university of kota, kota (rajasthan) page 12 of 39 d/nitesh/tender/chemistry apparatus of melting point: ambient to 300oc, resolution: 0.1oc, accuracy: better than 0.5oc, silicon oil bath, built in magnetic stirrer with electronic speed and heat rate controller, digital display of temperature with sensor, glare free background light with adjustable light intensity. 15 mechanical stirrer / agitators speed range 50 to ≥ 1500 rpm, capacity 500 ml 5 lit., high torque even at low speeds, led display, timer 0 99 minutes, monitoring of set & actual speed, advanced stirrers with microprocessor technology, maintenance free brushless dc motor ensures high torque, accurate stirring speed control, display of torque / speed, accepts shafts up to 13mm diameter with different types of agitators / impellers. 13 16 magnetic stirrer with hot plate 500 ml digital control, hot top warning indicator, microprocessor pid temperature control, three user selectable temperature control modes: optimal mode, fast mode and slow mode, two user selective timer, showing actual and set value simultaneously, temperature range: ambient to 450°c, heating control: feedback control with pid / scale, stirring range: 30 to ≥ 2000 rpm, speed resolution: 1 rpm, stirring capacity: max. 500 ml or more, timer: 0 60 minute, body material: ss, top plate material: ceramic coated, heating power: 600 watt, voltage / frequency input according to indian options and good tolerance to the fluctuation. 18 17 magnetic stirrer with hot plate 1000 ml digital control, hot top warning indicator, microprocessor pid temperature control, three user selectable temperature control modes: optimal mode, fast mode and slow mode, two user selective timer, showing actual and set value simultaneously, temperature range: ambient to 450°c, heating control: feedback control with pid / scale, stirring range: 30 to ≥ 2000 rpm, speed resolution: 1 rpm, stirring capacity: max. 1 l or more, timer: 0 60 minute, body material: ss, top plate material: ceramic coated, heating power: 600 watt, voltage / frequency input according to indian options and good tolerance to the fluctuation. 11 18 heating mantle simple made of yarn /spun aluminium providing uniform heating. the heating elements out of nichrome wire on helically wound coil form safety insulated fibre glass sleaving which in turn is attached to knitted glass fabric, to give flexible support to flask. surface temperature 450o c which is controlled by an energy regulator, suitable for operation on 230/240 v ac 50hz, size – 500ml capacity, temperature controlled, indicator light fitted in painted metallic box. 13 19 heating mantle with magnetic stirrer metallic heating mantle body, heating mantle material of glass fibre yarn for holding round bottom flask, inbuilt protection from liquid spill, knob for variable heat control with on/off, temperature range 4000c. 250 ml (5 nos) and 500 mal (5 nos) capacity. 10 20 digital nepheloturbidity meter source: led, detector: photodiode, display: 2 line 16 ch. lcd, ranges:0 1000ntu in 4 ranges (automatic), accuracy: ± 1.5% of fsd in 0 500ntu ± 2% of fsd in 500 1000ntu, repeatability: ±1 % of fs (std.), calibration: formazine 3 bidding document for e procurement university of kota, kota (rajasthan) page 13 of 39 d/nitesh/tender/chemistry standard solution, data stored in memory, with printer port, with four flat bottom test tubes (25mm ø) and light shield. 21 digital conductivity and tds meter source frequency:100hz or 1khz automatically selected, conductivity range: 0 μs to 20 μs with 0.1 cell constant and 0 μs to 200 ms with 1 cell constant in 5 decadic ranges, tds: 0 ppm to 20 ppt with 0.1 cell constant and 0 ppm to 200 ppt with 1 cell constant in 5 decadic ranges, temperature: 0 to 100oc (auto/manual), display:3 digits led, resolution: (i) conductivity: 0.01 μs is lowest range with cell constant of 0.1, (ii) tds: 0.01 ppm is lowest range with cell constant of 0.1, (iii) temperature:1oc; accuracy: (i) conductivity/tds: ±1% of fs ±1 digit, (ii) temperature: ± 1oc ±1 digit; conductivity cell composition: (i) 0.1 cell constant:0.09 to 0.11, (ii) 1 cell constant: 0.9 to 1.1; tds factor:0 to 1.00, cond. temp range: 0.0 to10% per oc, temperature range: 0 to 100oc, temperature sensor: pt 100, with 1 cell constant cell, ).1 cell constant cell, temperature probe (pt.100 sensor) and clamp & stand. 4 22 digital colorimeter type: manual, supplied in battery cum mains operation, measuring: % t and absorption & concentration (by factor) and k factor display: led 3 digit min., wavelength range:(400 700 nm) with 8 or more optical filter & auto zero, resolution: 0.1% t, abs. upto1.999 abs. (od) memory: 100 ≥ data must be stored in memory. print port: yes, accessories: 4 test tubes and 2 glass cuvettes, voltage / frequency input as per indian options and good tolerance to the fluctuation. 5 23 digital ph meter ph range: 0 to 14.00 ph, millivolt range: 0 to ± 1999 mv, slope correction: 85% to 115%, resolution: 0.01 ph, 1mv in mv mode, repeatability: ±0.01 ph ±1 digit for ph ±0.01 mv ± 1 digit for mv, standardization range: ±1 ph, temp. compensation: 0 to 100oc, display: 31/2 digital lcd seven segment with automatic polarity & decimal point, polarization current:10μa, record output: ±10 mv/ph in ph mode ±10 mv/100 mv in mv, with combined electrode, stand and clamp. 20 24 portable ph meter ph range: 0 to 14.00 ph, resolution: 0.01 ph, temp. accuracy ± 0.5oc, temp. range; 5 60oc, automatic shut off. 5 25 rotatory shaker variable speed from 20 rpm to 300 rpm with heating facility. digital display of speed with pre setting facility. shaking amplitude 40 mm. universal platform to accommodate interchangeable clamps of assorted sizes for different capacity of flasks. automatic restart at pre set speed in case of power failure. 2 26 colony counter 250 x 3100 x 130 hmm, 100 mm diameter magnifying lens, glare free illumination by fluorescent tube light, 4 digits resettable digital counter with audio beep at every count, wolf flue gel grid glass plate. 2 27 gel electrophoresisvertical dimension, 23cm(l)x18cm(b)x20cm(h) , number of samples : 13.buffer volume : 150 200ml ,gel size : 16x14 (1 gel) ,glass plate : 18x18cm notched and square plates (2 sets), number of combs : 13 wells 1mm thickness comb (well width6mm,interspace 4mm) (1 no., 13 wells 1.5mm thickness comb (well width 6mm,interspace 4mm) (1 no.) ,spacers : 1mm and 4 bidding document for e procurement university of kota, kota (rajasthan) page 14 of 39 d/nitesh/tender/chemistry 1.5mm spacers (3 nos. each) gasket: fixed, comb capacity: 30μ l,44μ l, clamp and screws: 1 set, connecting cord: red and black (each one) no. of platinum electrodes: positive and negative (each one), buffer chamber with safety lid: 1 no. gel casting system: 1 no. 28 gel electrophoresishorizontal cell size: 9 15 x 15 25 x4 6cm. sample. base buffer volume: 250 500 ml. gel tray size: 7 8 x 10 cm. supplied with two gel tray, gel caster, uv transparent plastic tray with compatible size, combs: at least with 4, 8 wells. multi channel suitability suitable for multi channel pipette. timing function 1min~999min or continue, with pause function. security settings the power is automatically paused when the cover is lifted. storage function automatically memorize the previous operating voltage and time. the electrophoresis tank and power supply can be separated. the cover with safety design, flip cover immediately turns the power off to ensure safety; transparent cover & open hole design for easy heat dissipation and observation; top handle design for easy to pick and place. one key select allows 135v, 100v, 70v, 50v, 35v, 25v, 18v desired output voltage for convenient and efficient saving on standby consumption. specially designed electrophoresis, reducing the temperature difference between the buffers due to improved heat uniformity. easy placement of gel into position without drift. pause function & timing function allows easy operations, with alarm function buzzer alert at the end. lcd displays the set parameters; default remember the output voltage and time. when the electrophoresis current exceeds the peak current, will automatically adjust the voltage to reduce the current value, improve the experimental reproducibility. 4 29 autoclave autoclave vertical, double walled made of thick high grade stainless steel sheet of ss 304 grade or better., capacity (litres): min. 50 ltr, operating range: temp.:100 1350c (sterilizing), 50 1000c (warming) & 50 100 0c (heating); pressure: up to 25 30psi with dial pressure gauge. working temperature: 121ºc at 15 to 20 psi pressure.inner & outer chamber, supply complete with stainless steel basket, chord and plug. the lid made of stainless steel sheet, unit fitted with double safety radial locking system with paddle lifting device, made of ms chrome plated and provided with pressure gauge (02.1kgf/cm2), safety device, safety valve, eject valve and neoprene/silicon gasket. steam, vacuum release and water draining by valve, led display for time and temperature. automatic pressure control switch to cut off the current from the heating elements, when the desired/ set pressure value level is attained inside the chamber and restarts the mechanism once the pressure inside the chamber falls from the desired level., automatic water cut off device – to protect the heaters from running dry and to ensure that the machine is automatically switched off in case the desired water level falls below the prescribed level (cut off with audible alarm),water inlet and outlet valves, water level indicator. timer with alarm system 4 bidding document for e procurement university of kota, kota (rajasthan) page 15 of 39 d/nitesh/tender/chemistry to regulate the sterilization time of the media to be sterilized with a buzzer. steel stand for keeping autoclave drum on it. electrically heated by immersion type heaters bearing isi mark. power supply: 220 230v, 50hz.onespare rubber gasket and electric element must be provided for autoclave. the apparatus should confirm to national or international standards with latest amendments covering markings, safety requirements with recommendations of safe operations from any reputed firm with iso 9001:2000 & ce certification. 30 laminar air flow vertical model. designed to meet the filtration, illumination, noise & vibration requirements, providing air to meet class 100 (class l) conditions, to the extent applicable, working area: 986x563x670 mm wx dxh, no. of hepa filters: 1 no. of pre filters:2, illumination: 1x40 w construction: modular, outer body of mild steel duly powder coated. the inner work table should be made of stainless steel. the side panels should have windows of uv absorbing toughened transparent glass, front of the cabinet should be provided with a transparent acrylic door mounted on hinges. air flow and filtration: hepa (high efficiency particulate air) filters having efficiency rating as high as 99.99% with cold dop and 99.97% with hot dop, thus retaining all airborne particles of size 0.3 micron and larger, double filtered air blows in laminar flow through the work table at designed velocity of 70 fpm 110 fpm (avg. air flow velocity 90 fpm), two gas corks are provided on one side panel, blower motor assembly: should be coupled to an inbuilt motor and operate with minimum noise level i.e. lower than 65 db on scale and vibration less than 2.5 um. illumination by diffused, glare free fluorescent light. inbuilt uv germicidal lamp, inbuilt pressure manometer. fitted with manometer for measurement of hepa filters choking system. fitted with cock for gas connection. 3 31 bod incubator features: providing fast and accurate results. cfc free refrigerant. temp. range: 5°c to 60°c. accuracy: ±0.5°c. temperature controller: digital pid. display: led display. door: double door, with silicon packing. inner door: tempered safety glass. safety device: over/under temperature protector. capacity: min. 300 litres. heaters tubular finned type heaters for dry and wet both. front panel: mains rocker switch, cooling/heating rocker switch, microcontroller, toggle switches for high and low position of heaters, fuses illumination: with the opening of the door. construction details: bod incubator should be double walled cooled unit. the gap between the outer and the inner wall should be filled with special grade glass wool to prevent thermal losses. air circulation: air circulation fans for maintaining temperature uniformly throughout the chamber. refrigeration unit: refrigeration unit is formed by isi marked compressor / cooling kit. 3 32 microtome rotatory ideally located coarse feed wheel for fatigue – free operation. 2 bidding document for e procurement university of kota, kota (rajasthan) page 16 of 39 d/nitesh/tender/chemistry advanced extremely smooth running hand wheel preferably with patented spring based forced balancing system. safety locking mechanism on the hand wheel. section thickness setting range 0.5 60µm approx. trimming thickness ranges – 10,50 µm approx. total horizontal specimen feed – 25mm approx. vertical stroke length – 59mm. approx. specimen retraction: on/off mechanism. specimen orientation – horizontal 80 & vertical 80. coarse feed wheel turn direction: user selectable. single – handed operation specimen clamps. facility to use cassette clamps should be available. precise knife holder lateral adjustments ensure that the entire width of the blade can be utilized. universal knife holder base for different knife holders (disposable, standard & heavy duty). disposable blade holder with integrated safety finger protection guard. accessories to be supplied along with the machine: cassette clamp 1 no. disposable microtome blades – 2 packets, c. dust cover, oil, manual. 33 microtome rotatorybasic steady built with a streamlined body, cut section from 1 to 40 micron in step 2 microns each, one razor of 120 mm, one sharpening hone, three block folders. 3 34 refrigerator ...

University Of Kota - Rajasthan

29715618 supply of lab. items, instruments and equipments lab. items, instruments and equipment for various department of the university under rusa 2.0 scheme. 1 lce cube maker 2 analytical balance for demonstration 3 digital balance: 01 mg readability 4 digital balance: 10 mg readability 5 centrifuge machine 6 ultra centrifuge machine 7 double distillation assembly 8 single distillation assembly 9 uv cabinet 10 hot air oven 11 hot plate 12 water bath 6 holes 13 water bath 12 holes 14 melting point apparatus 15 mechanical stirrer i agitators 16 magnetic stirrer with hot plate 500 ml 17 magnetic stirrer with hot plate 1000 ml 18 heating mantle simple 19 heating mantle with magnetic stirrer 20 digital nepheloturbidity meter 21 digital conductivity and tds meter 22 digital colorimeter 23 digital ph meter 24 portable ph meter 25 rotatory shaker 26 colony counter 27 gel electrophoresis vertical 28 gel electrophoresis honzontal 29 autoclave 30 laminar air flow 31 bod incubator 32 microtome rotatory advanced 33 microtome rotatory basic 34 refrigerator ...

Medical College - Rajasthan

29518923 purchase of disposable and glassware purchase of disposable and glassware , electrical items : , disposable microtome blade ow profile, ce certified ivd approved suitable for leica mirotome, sample for approval is must low profile...

Sms Medical College - Rajasthan

29509255 purchase of disposable and glassware ( nit 120 ) disposable microtome blade low profile , ce certified ivd approved suitable for leica microtome sample for ...

Sardar Patel Medical College - Rajasthan

29157372 supply of patology lab items 01 micro slide ground edge & lint free 02 micro cover glasses from imported glass 03 filter papers sheets 04 disposable plastic apron 05 disposable tie on mask 06 disposable plastic gloves ( embossed ) size large 07 disposable plastic gloves ( embossed ) size medium 08 tissue paper roll 09 carbolic soap 1s0gm each 10 permanent marker pen ( bullettip ) black color 11 permanent marker pen ink black color 12 diamond point . pencil for marking on slides 13 o· 25 nos. disposable microtome blades 14 forceps sharp forceps blunt 18 scalpel blade handle stainless steel no 4 19 scalpel blade no 22 5 packet 2000 / ( 100 blades / pkt. ) 20 card board boxes with strips for block filling ( box of 25 strips ) 500 nos. 25000 / 21 tissuefloatation bath 01 nos. 20000 / microprocessor based / manual thermostatic elegantlydesigned & fabricated and tested for carrying out distortion lessand wrinkle free tissue specimens. in the field of diagnostic histo pathology and cyto pathology laboratories. outer wall: made of crcasheet duly powder coated after surface treatment inner chamber: it is rectangular in construcation & is made of seamless ( die pressed ) stainless steel sheet polished bright. insulation: high grade insulation, filled around power supply: 220volt, 50hz, singlephase, a.c. 15 _ heating element· emb dd temperature con~rollere. ~d heater element plate. temperature ra . . ~cro processor based digital chamber size ( nbej. . amb, ent to 70°c+_ 10c mm . 240 ( ljx1s0 ( w ) xso ( d ) 22 rectangular hot pi t ( for· a e s.s.top digitally controlled ) 01 nos. c~ntlouous heating up to 370* c 15000 / _ body ismade of specially desi d top made of stainless st i ( ! g~e cr~sheet duly powder coated uniformly ee or onger life and temperature insulated eleme t i f . . n are p aced underneath for uniform heatin c~:::~n7~~, ;, croprocessor based pid digita, temperature ind~ator 23 straight scissors with one blunted blade and one sharp blade straight scissors length 11.scm 10 nos 9000 / straight scissors length 14.scm 10 nos 24 slide warming table 9000 / 01 nos. 16000 / it is a rectangular flattening table with a jet black aluminumsurface ensuring very high thermal conductivity rates and exceptional resistance to mechanical expoitations temperature ranging from ambient to 70 *ccan be selected. the programmed as well as set temperature are displayed on the instruments and set values memorized by a built in battery backup system. top plate size: 300mm ( l ) x 200mm ( w ) 25 digitalanalytical balances 01 nos. multiple weighing units 25000 / standard bi directional rs 232interface. polyfunction backlitelcddisplay capacity: 230 gm readability :0.0001gm repeatability ( + / ) : 0.2mg linearity ( + / ) : 0.4 mg pan size: 80mm the balance issupplied with breeze shield. 01 nos. 65000 / 26 micro slide cabinet closed pack manner .. . for keeping 75 x 25 mm slidesin vertical position one after the 16 other made of oresteel with attractive powder coatedpaint finish. thecabinet has 480 x 75 rnrndrawers and takes slides in vertical position.eachdrawer moves in a slot and is completely removable for easy liftingof slides. the cabinet accommodates maximum number of slidesfor optimum space utilization. provided with lockable doors. 50000 slides / 160 drawers 27 water stili ( wall mounting ) 01 nos. the unit isrecommended for making pyrogen free distilled water of a very high degree of purity. made out of net stainless steel. the cock fitted to the unit is brass c.p. a wall mounting clamp is provided with the unit supplied with rubber tubing, cord and plug to work 220 / 230 volts 50 hz. ac, supply. capacity 4 itr. / hr. approx. 15000 / _ 10 nos. 10000 / 28 knife for brain ( non _ knife metal handle edge 20 em 30000 / 30 nos. 28 staining trough ( giass / s.s. ) 10 nos. 5000 / 29 slide carrier ( to hold 25 slid...

Medical College - Rajasthan

28962307 supply of consumables, reagent and controls for lab chemical and kits 1 sodirn hydroxide 2 copper acetate — 3 ammonium sulphate 4 sodium sulphate 5 6 sulphur powder sodim carbonate 7 silver nitrate 8 sodium hyrogen carbonate 9 calcium chloride 10 0 toluidine 11 1 naphthole 12 acetone 13 ninhydrine 14 bromine ampoules 15 ammonium solution ( liquid +na3 ) 16 hdrogen peroxide 17 phenolphthanlein t 18 lethanol 19 h2s04 20 hci 21 hno3 22 calcium carbonae 23 uthum carbonate 24 uric acid 25 potassium dichromate 26 ortho phosphoric acid pottasium dihydrogen orthophosphate i k2hpo2 28 potussiun hydrnxide 1 29 potassium oxalate l 30 ammonium molybdate 31 glass slides 32 cover slip 33 feci3 34 phenol — 3s ammonium oxalate 36 barium chloride sodium nitroprusside , acetic acid , phenol crystals , formalin , albumin flakes, bovine albumin , urea , creatinine micropipette , 46 micropipette 47 micropipette 48 micro tip 49 micro tip so micro tip 51 glucose 52 urea 53 creatinine 54 alkaline phosphatase 55 sgot 56 sgpt 57 cholesterol — s8 ihdl cholesterol 59 triglycerides 60 calcium 61 bilirubin 62 inorganic phosphorus 63 total protein 64 albumin flakes 65 uric acid 66 hydrogen peroxide 1 antiiotlc disc. 2 anikacin 30 mcg 3 ampicllin lomcg 4 amoxvcd1in. 10 mcg 5 amoxicillin / ciavulanic 2o / 10 6 ampicillne i sabactum 75 / 30 7 azithromycln 8 a.zreonam3omg 9 cefeperozone / salbactum 75 / 30 10 cefixime. smcg 11 cefatolne 30 mcg. 1 12 ceftazdime 30 mcg 13 ceftrixone 3o mcg. 14 15 cefipime3omcg cefoxitin 30 mcg 16 ciprofloxacin s mcg 17 chndamycin 2 mcg 18 colitstin ( methan sulphnate ) 19 erythromycin_50_mcg 20 gentamicin 10 mcg 21 imipenum1omcg 22 gentamicin 120 mcg 23 levofloxacine s mcg 24 linezolid 2s meropenum 10 mcg 26 norfloxacinl 10 mcg 27 nitrofuranltofli 300 mcg 28 oxidase disc. 29 otochin single 5 mcg 31 32 33 34 piperaclliin 100 mcg t — piperacillin / tazobactum 100 / 10 penicillin 10 unit tritmethoprim / sulphomethoxazole polymiwnn b 30o f 35 telcoplanin 3o mcg 36 tetracychne 3o mcg 37 vancomycin s.no. name of item other consumables 1 grams stain kit 2 biphasic blood culture meda for adults 3 biphasic blood culture media for pediatric 4 spirit lamp 5 straight wire with holder ( nichrome ) 6 wire uoop nichrom with holder 7 spirit for writ lamp 1oo ml 8 disposable petri dishes 1o0 mm 1 9 f sterilized sample collection swab 1o flask ( borosill sooml ) 11 test tube ( borosill 12x75mm ) 12 test tube ( borosiil l8xlsomm ) 1.3 test stand ( hole size 12 mm ) 14 test stand ( hole size 18 mm ) 15 slide box 16 cover slip box 17 acetone 500ml of an ato my 1 jformaidehye ( 1a0% strengah ) 2 glycerine 3 potassium hydroxide ikoh ) hydrogen peroxide department of physiology —.—s sno. name of item 1 neubauer counting chamber 2 rbc pipette 3 wbc ploette 4 sahlis haemoglobirnometer 5 esra pipette filler ( auto pipetee for westergren pipette ) 6 esra pasteur pipette with a long thin nozl fo wintrobes tube 7 methyl alcohol ( acetone free ) 8 cover glass square 22x22x0.13 9 antisera a, b&d 10 23 sterile needles 11 plaine vials for blood collection 12 test tube stand 13 acetone 1 harris haematoxylin cdh / oxfford 2 eosin v oxiford 3 microtome blade sndone high...