Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical And Health Services - Rajasthan

33335880 supply and installation of various chemicals reagents consumables items for pathology lab 1 anti a ( sera ) 2 anti b ( sera ) 3 anti d ( sera ) 4 capillary tubes 5 sprit ( surgical ) 6 g6pd kit ( 12 test ) 7 ocult blood kit _ 8 anti sera _coombs 9 cover slip ( 18x18mm ) 10 disposable needles ( 24 guage ) 11* disposable needles ( 22 guage ) 12 disposable sterile urine container 13 esr disposable pipette 14 glass marker pencil 15 ketone strips 16 lancets 17 18 j micro glass slides microscope bulb 19 permanent marker thin ( black ) 20 rapid h & e 21 reticulocyte fluid 22 semen diluting fluid 23 sodiumcitrate 3.2% 24 thermal paper ( 110 mm ) 25 thermal paper ( 80 mm ) 26 thermal paper ( 57 mm ) 27_ small test tube plastic small test tube glass 28 29 tips ( 100 1000p i ) ( blue ) 30 tips ( 10 2001.11 ) ( yellow ) 31 tissue paper roll 32 tourniquate ( cloth ) 33 urine multi strips 34 urine strips for alb / sug, r 35 i vacutainer edta vial e 36 vacutainer sodium citrate 12% vial 37 new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area 38 cover slip ( 22x50 ) 39 diamond pencil 40 normal saline 41 papanicolou ready to use kit 42 myloproxidase 43 disposable syringes 2m1 44 disposable syringes 5m1 45 disposable syringes 10m1 46 disposable syringes 20m1 47 cotton roll 48 hand senitizer 49 dlc counter ( 8 diffrential min ) 50 alcian blue 51 benzidine powder 52 biebrich scarlet 53 celestine blue 54 chloral hydrate 55 malt diastase 56 microtome blade ( low profile ) 57 mercuric chloride 58 neutral red 59 nitric acid 60 nuclear fast red 61 numbering paper 62 peanut oil 63 plastic ring for block ( white ) 64 sodium metabisulfite 65 tetrazolium chloride 66 rapid pap stain kit 67 disposable gloves sterile / un steriliged 68 disposable gloves 69 non specihe esterase kit . 70 cryofix gel...

Rajasthan University Of Health Science - Rajasthan

33330379 lab regents and chemicals for pathology lab lab regents and chemicals for pathology lab , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , capillary tubes , sprit ( surgical ) , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , ketone strips , lancets , micro glass slides , microscope bulb , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , cover slip ( 22x50 ) , diamond pencil , normal saline , papanicolou ready to use kit , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , hand senitizer , dlc counter ( 8 diffrential min ) , alcian blue , benzidine powder , biebrich scarlet , celestine blue , chloral hydrate , malt diastase , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , peanut oil , plastic ring for block ( white ) , sodium metabisulfite , tetrazolium chlorlde , rapid pap stain kit , disposable gloves sterile / un steriliged , disposable gloves , non specihe esterase kit , cryofix gel...

Medical And Health Services - Rajasthan

32202322 regents for pathology lab 1 aceton 2 propanol 3 xylene 4 wa 5 microtome blade 6 plastic ring 7 eosin yellow 8 hemotoxiline crystal 9 sodium iodate 10 dpx ...

Rajasthan University Of Health Science - Rajasthan

31927326 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , sodium metabisulfite , capillary tubes , sprit , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n / 10 hcl , cedar wood oil , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50 ) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution ( liquid ammonia ) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate ( ammonium iron sulphate ) , ferric chloride , formalin ( formaldehyde 37 40 % ) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with ( ceresin 60 62 c ) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block ( white ) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye ( for shiff reagent ) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

31913247 supply of chemicals reagents consumable items for department of pathology anti b ( sera ) anti d ( sera ) sodium metabisulfite capillary tubes _ g6pd kit ( 12 tests ) ocutt blood kit coombs anti sera cover slip ( 18x18mm ) .__ dxposible nediles ( 24cuage ) disposible neoiues ( 22guage ) disposibue sterile urine comawer_ esr_oispoxable pipette glass marker pencil jsb stain i jsb stain ii ketone strips — — 1.ancets leishman’s stain micro glass slides microscope bulb cedar wood oil anti a ( sera ) ie thmnea? 26 ridh&e 27 reticulocyte stain semen diluting rluid 29 sodium citrate 3.2% 30 sodium citrate 3.8x 31 thermnlparllomm? 32 thermal paper 8o mm 33 thermalpaper57mm — 34 small test tube plastic small test tube glass 36. tips ( 1o04o0o11l ) 37 tips ( 10 2ooi.l ) 38 tissue paper roll — 39 torniguate ( cloth ) 4o urine multi sttips 41 urine strips for alt 42 vacutainer edta vial _ 43 vacutainer sodium citrate 3.2 % vial 44 wbc diluting fluid 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area giemsa stain liquid carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid !carbol fucihsin cover slip ( 22xso ) diamond pencil distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid _!carbol fucihsin _ cover slip ( 22xso ) diamond pencil . ? distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lo e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid hand sanitizer i ., 7o dic counter ( 8ditfrential miii ) fl acetk acid 72 acetone 73 acid fuschifl 74 acid periodic 75 activated charcoal 76 alicine blue 77 akjminftumchlo 78 mumoumhydx!h 7 ammoniun solution tliouid ammonlia 80 aniline blue 81 basic fuchsinl 82 benzidinle powder 83 biebrich scarlet — 84 brilliant cresyl blue 85 carmine power 86 celestine blue 87 chloral hvdrate 88 citric acid concentrated hcl 91 egg albumin flake 92 eosin yellow stain powder ferric ammonium sulphate ( ammonium 93 iron sulphate ) 94 ferric chloride gold chloride haematoxyline crystal hydrochloric acid ar hydrogen peroxide light green malt diastase mercuric oxide metanil yellow murcuri chloride 109 neutral red 110 nitric acid 111 nuclear fast red 112 numbering paper . 113 oxalic acid ______ _ 114 paraffin wax with ( ceresin 60 62 c ) ______ 115 peanut oil i 103 104 105 106 107 methylene blue _______ microtome blade ( low profile ) 108 9s rorman ( forrnaidehyde3 , _. _ congo red 89 90 fl6 e ? 117 phosphomolybuc acid 118 phosphotuflgstic acid .._________ i19. picric acid 120 plastic ring for block (white) 121 potassium oichromte 122 potassium hydroxi — 123 potassium metabisulphit 124 potassium permagnate 12s propaflolol — 126 readymade giemsanstanf 127 rosanilinle dye (for shiff reagent) 128 silver nitrate 135 tetrazollum chlorlde 136 toludine blue 137 xylene — 138 139 rapid pap stain kit disposable gloves sterile 140 disposable gloves unsteriliged 141 non speciheesterase kit 142 bovine albumin_22% 129 sodium nitropruside 13o sodium hydroxide 131 sodium sulphate — 132. sodium thiosuiphate 133 sudan black b 134 sulfurous acid_ ...

Medical College - Rajasthan

31635926 chemical reagents and glass items chemical reagents and glass items , rate contract of chemical and reagents items , picric acid purified , fuchsin acid (c.i. 42685) , acetic acid glacial 100% for analysis , charcoal activated , potassium permanganate for analysis , silver nitrate for analysis , ammonia solutionfor analysis , sulfuric acid about 98% for analysis , carbol fuchsin (ziehl & neelsen stain solution) dilute for microscopy , chloral hydrate, 99+%, extra pure, slr, meets the specification of bp and ph. eur. , cycloheximide 1pc x 1gm , micro tips material: pp autoclavable 10 to 200?l , micro tips material: pp autoclavable 200 1000?l , dpx new non aqueous mounting medium for microscopy , eosin yellowish (c.i.no. 45380, s.no. 881) indicator and for microscopy , aluminium ammonium sulfate , formaldehyde solution min. 37% (stabilized with about 10% methanol) , gold(iii) chloride =99.99% trace metals basis , hydrochloric acid comerical , hydrogen peroxide 30% for analysis , 2 propanol for analysis , metanil yellow reag. ph eur , methyl blue aqueous solution , paraffin wax 60 62°c , phenol , potassium dichromate for analysis , potassium hydroxide pellets for analysis , sodium hypochlorite solution approximately 4% w/v available chlorine , xylenesulfur free , brain heart infusion agar suitable for microbiology, nutriselect® plus , brain heart infusion broth suitable for microbiology, nutriselect® plus , deoxycholate citrate agar suitable for microbiology, nutriselect® plus , fluid thioglycollate medium , formaldehyde sconcentration 40% , mannitol salt agar , macconkey agar suitable for microbiology, nutriselect® basic , mueller hinton agar for testing the sens , nutrient agar , nuclear fast red (c.i. 60760) , sabouraud glucose agar with chloramphenicol suitable for microbiology, nutriselect® plus , triple sugar iron agar for microbiology , glucose broth , hematoxylin cryst. (c.i. 75290) for microscopy , light green (c.i. 42095) for microscopy , pus culture tube 15ml , tri sodium citrate dihydrate for analysis , urea agar (base) acc. to christensen for , dextrose anhydrous purified , arabinose disks suitable for microbiology , dulcitol disks suitable for microbiology , galactose disks suitable for microbiology , lactose disks suitable for microbiology , maltose disks suitable for microbiology , mannitol disks suitable for microbiology , mannose disks suitable for microbiology , sorbitol disks suitable for microbiology , sucrose disks suitable for microbiology , trehalose disks suitable for microbiology , xylose disks suitable for microbiology , aztreonam , bacitracin disks suitable for microbiology , carbenicillin (cb) , cefixime (cfx) , cefotaxime +clavulanic acid , cefoxitin (cn) , ceftazadime , ceftazidine +clav acid , amikacin , ampicillian , amoxycillin , amoxy clave , ceftriaxone+ clavulanic acid , ceftrixone , cephalexin , ciprofloxacin , cloxacillin , co trimoxozole , doxycline , erythoromycin , gentamicin , imepenem , nalidixic acid , nitrofurantoin , norifloxacin , onpg disks suitable for microbiology , optochin disks suitable for microbiology , pipercillin+tazobactum , tetracycline , vancomycin , colistin disc , polymixin b , azithromycin , cefotaxime , chloramphenicol , cefeperazone + sulbactum , clindamycin , ertapenam , gentamicin 120 mg. , netalmycin sulphate , ticoplanin , levofloxacin , linezolid , ofloxacin , novabiocin , tigicycline , fosfomycin , meropenam , raffinose , bile esculin disks suitable for microbiology , imepenem + edta , vancomycin e strip , polymixin b e strip , colistin e strip , netalmycin e strip , benzyl penicillin e strip , crystal violet , potassium tellurite , n,n,n,n tetramethyl p phenylenediamine dihydrochloride , giemsa stain, solution pbf , paraffin liquid , methanol , capillary tube (wide hole) (1 pkt. contained100 pcs.) , citric acid , hydrochloric acid , acetic acid glacial 100% , ammonium chloride for analysis , blood culture bottle pediatric (50x20) , blood culture bottleadult (50x20) , test tubes without rim 18 x 150 mm , test tubes without rim 12 x 100 mm , ammonium oxalate pc count solution , rapid rc stain kit (new methylene blue) , eosin y solution 0.5% alcoholic for microscopy , cover slipsize18x18mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x22mm english glass mo 1thik ness(0.13mmto0.16mm) , cover slipsize22x50mm english glass mo 1thik ness(0.13mmto0.16mm) , sodium meta bisulphati , methenamine borates tab. , ihc antibody er , pr , her 2 , microtome blade , myeloperoxidase mpo stain kit , pas staining kit for detection of aldehyde and mucosubstances , leishman’s stain a , leishman’s stain b , rbcdiluting fluid , w.b.c. diluting fluid , pearl stain kit , giemsa stain, modified solution (for the staining (of cellular blood components and blood parasites)) , fields stain a solution , fields stain b solution , hemoglobino meter , neubauer chamber , sprit lamp brass , ammonium sulfate , sodium chloride , potassium chloride , rapid pap kit , nitric acid , toludine blue , agar agar , alkaline peptone water , bile esculine agar base , mr vp (glucose phosphate broth) , peptone water , phenyl alanine agar , simmons citrate agar , xld agar , hichrome uti chromogenic agar , esculin , basic fuschin , bromocresol purple , cedarwood oil , calcium chloride , horse serum , iodine cyrstal , l lysine monohydrate , l araginine monohdyrate , l ornathine monohydrate , iso amyl alcohol , potassium iodide , p diamethyl amino benzeldehyde , ph indicater strip 0 to 7 , ph indicater strip 7 to 14 , sodiumpoly anthosulphonate , petridish glass size 4 inch borosilcate , petridish plastic size 4 inch autoclaveble , petridish plastic size 6 inch autoclaveble , petridish glass size 6 inch borosilcate , dorhums tubes , flask conical 500 ml , flask conical 1 ltr , flask conical 250 ml , measursing cylender glass 1000 ml , masuring cylenderglass 500 ml , measursing cylender plastic 1000 ml , masuring cylenderplastic 500 ml , masuring cylenderplastic 100 ml , glass funnel size 4 inch , glass funnel size 3 inch , plastic funnel size 4 inch , plastic funnel size 3 inch , disposable sterile swab , disposable sterile swab with tube , carbolic soap 80 grm , dimond marker/pencil...

Rajasthan University Of Health Science - Rajasthan

30320541 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a (sera) , anti b (sera) , anti d (sera) , sodium metabisulfite , capillary tubes , sprit , g6pd kit (12 test ) , ocult blood kit , coombs anti sera , cover slip (18x18mm) , disposable needles (24 guage) , disposable needles (22 guage) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n/10 hcl , cedar wood oil , permanent marker thin (black) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper (110 mm) , thermal paper (80 mm) , thermal paper (57 mm) , small test tube plastic , small test tube glass , tips (100 1000? l) ( blue ) , tips (10 200? l) ( yellow ) , tissue paper roll , tourniquate (cloth) , urine multi strips , urine strips for alb/sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution (liquid ammonia) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate (ammonium iron sulphate) , ferric chloride , formalin (formaldehyde 37 40 %) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade (low profile) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with (ceresin 60 62 c) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block (white) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye (for shiff reagent) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

30302809 supply and installation of various chemicals & reagents& consumable items for department of pathology 1 antia (sera) 1x10 ml 2 anti b (sera) 1x10 ml 3 ant| d (sera) 1x10 ml 4 sodium metabisulfite 1x50 gm 5 capillary tubes 1x100 ml 6 sprit 1x 5001 7 g6pd kit (12 tests ) lx],? 8 ocult blood kit 1x50ml 9 coombs antisera 1x10ml 10 cover slip (18x18mm) 20x10 11 disposible nediles (24guage) 1x100 t2 drsposrble nediles (22guage) 1x100 13 disposible sterile urine container 1x100 t4 esr disposable pipette 1x100 15 glass marker pencil 1x10 15 jsb stain i 1x500ml l7 jsb stain ii 1x500ml 18 ketone strips 1x50 19 lancets 1x200 20 leishman,s stain 2x500ml 2l micro glass slides 1x50 22 microscope bulb mono pack 23 n/1o hcl 1x500ml 24 cedar wood oil 1x1000m1 25 permanet marker pen thin (black) mono pack 26 lrapidh&e 2x500ml 27 i reticulocvte stain 1x25ml 28 semen dilutine fluid 1x125 ml 29 sodium citrate3.2% 1x500 ml 30 sodium citrate 3.8% 1x500 ml 31 thermal paper 1lomm monopack 32 thermal paper 80 mm monopack 33 thermal paper 57mm monopack 34 small test tube plastic 1x100 35 small test tube glass 1x100 36 tips (100 1000u1) 1xs00 37 tips (10 200u1) 1x1000 38 tissue paper roll monopack 39 torniquate (cloth) monopack 40 urine multistrips 1x100 47 urine strips for alb/sug 1x100 42 vacutainer edta vial 1x100 43 vacutainer sodium citrate 3.2 % vial 1x100 44 wbc dilutine fluid 1x500 ml h 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area monopack 46 giemsa stain liquid 1x125ml dj r 47 carbol fuchsin 1x100 ml 48 cover slip (22x50) 1x20 oackets 49 diamond pencil 1x10 50 distilled water 1x5lt 51 dpx mount 1x250 ml 52 ethanol 1x500 ml 53 filter oaoer 460x570 mm 1x100 54 methanol 1x2.5 lt 55 normalsaline 1x500 ml 56 papanicolou ready to use kit 1x1 kits 57 hematoxiline powder 5gm 58 glacial acetic acid 1x500 ml 59 aluminium potassium sulphate dodecehydrate 1x500 em 60 sodium lodate lx100 em 61 potassium ferrocvanide 1x500 ml 62 mveloperoxidase 1xl kit 63 disposable syringes 2ml 1x50 64 disposable svrinees 5ml 1x50 65 disposable svrinees 10ml 1x50 66 disposable svrinees 20ml 1x50 67 cotton roll 1x500gm 58 petridish disposable 1x1 69 hand senitiser 1x500 ml 70 dlc counter ( 8 diffrential min ) monopack 7t acetic acid 1x500 ml 72 acetone 1x2.5 lt 73 acid fuschin 1x25gm 74 acid periodic 1x100 em 75 activated charcoal 1x100 em 76 alicine blue 25 em 77 aluminium chloride 1x100 em 78 aluminium hydroxide 1x100 em 79 ammonium solution (liquio ammonia) 1x500 ml 80 aniline blue 1x259m 81 basic fuchsin 1x25 em 82 benzidine powder 25 em 83 biebrich scarlet 1x25 gm 84 brilliant cresyl blue 1x25 em 85 carmine power 1x5 sm 86 celestine blue 1x100 em 87 chloral hvdrate 1x500 gm 88 citric acid 1x500 ml 89 concentrated hcl 1x500 ml 90 congo red 1x100em 91 egg albumin flake 1x500 sm 92 eosin vellow stain oowder 1x25 em 93 ferric ammonium sulphate (ammonium iron sulphate) ,i 500gm dq ferric chloride 1x500 em 95 forma lin ( forma ldehv de 37 4o o/o 1x30lt 2tl{ / (rr * 95 1x2.5 lt 97 glycer:ol 1x2.5 lt 98 gold chloride 1x1 gm 99 haematoxvline crvstal 1x5 em 100 hvdrochloric acid ar 1x2.5 lt 101 hvdrosen peroxide 500 ml t02 light green 1x25 sm 103 malt diastase 1x5 gm to4 mercuric oxide 1x100 em 105 metanilyellow 25 em 106 methylene blue 1x25 gm lo7 microtome blade (low orofile) 1x50 108 murcurichloride 100 em 109 neutral red 1x25 gm 110 nitric acid 1x500 ml llt nuclear fast red 1x25 em lt2 numberine daoer 1x100 113 oxalic acid 1x500 em ll4 paraffin wax with (ceresin 60 62 c) 1x2 ke 115 peanut oil 1x100 rnl 116 phenol 1x500 ml tt7 phosohomolvbdic acid 1x100 em 118 phosphotunestic acid 1x100 gm 119 picric acid 1x500 ml l20 plastic ring for block (white) each lzl potassium dichromte 500 em l22 potassium hvdroxide 500 em 123 potassium metabisulphit 1x500 gm 724 potassium permaqnate 1x500 em l25 propanolol 1x2.5 lt 726 readymade giemsa stain 1x125 ml l27 rosaniline dye (for shiff reagent) 1x100 gnr l28 silver nitrate 1x25 em 129 sodium nitropruside 100 em 130 sodium hvdroxide 500em 131 sodium sulphate 500 em l32 sodium thiosulphate 1x500 em 133 sudan black b 1x25 gm 134 sulfurous acid 1x500 ml 13s tetrazollum chlorlde 1x25 em 135 toludine blue 1x25 gm t37 xylene 1x2.5 tt 138 rapid pap stain kit 139 disoosable gloves sterile 1x50 t40 disposable gloves unsteriliged 1x100 14l. non soecihe esterase kit monooack 142 bovine albumin22% ...

University Of Kota - Rajasthan

29729192 supply and installation of lab. items, instruments and equipments. 1 ice cube maker outer body with heavy duty angle iron frame and inner storage bin of steel, storage bin insulation with high density puf, cleaning provision after every cycle, with capacity of 25kg/hr. 2 2 analytical balance for demonstration case material: wooden and glass, capacity: 200gm approx., sensitivity: 1/5 mg, supply with weight box. 6 3 digital balance: 0.1 mg readability capacity: 220g or more, readability: 0.1 mg, repeatability (at nominal load): 0.1 mg, linearity deviation: ±0.2 mg, sensitivity temperature drift: 2 ppm/oc, setting time: 2s, adjustment: automated internal and external calibration, display: backlit lcd, power saving mode. 3 4 digital balance: 10 mg readability capacity: 220g or more, readability: 10 mg, repeatability (at nominal load): 0.1 mg, linearity deviation: ±0.2 mg, sensitivity temperature drift: 2 ppm/oc, setting time: 2s, adjustment: automated internal and external calibration, display: backlit lcd, power saving mode. 8 5 centrifuge machine brushless induction motor, microprocessor controlled led display, stainless steel centrifuge chamber, digital timer 0 59 min., frequency drive, dynamic brake with imbalance detector, speed ≥ 5000rpm, speed accuracy ±10 rpm, acceleration time to max. rpm : ≤15 s braking time to maximum rpm : ≤15s, safety lid with lock, adjusted swing/angle rotor with 15ml 8 tubes of polypropylene tubes, tube sealer to seal the tubes should be provided, noise level ≤ 65 db, compact design, voltage / frequency input according to indian options and good tolerance to the fluctuation 8 6 ultra centrifuge machine microprocessor based. square m s body duly powder coated. double walled light weight abs lid. speed not less than: 10000 26000 rpm, machine should have capacity 60 85ml in angle rotor. machine should have provision of mtp plate rotor. machine should have all rotors pre programmed. provision of speed increments 1 rpm. brushless drive, imbalance cut off & acceleration & deceleration curves led display for run. fitted with microprocessor based 2 lines 16 characters lcd panel for 0 59 minutes countdown timer, digital rpm meter and programmable speed controller. multiple rotor and carrier options, touch screen, easy to use controls, programmable acceleration/deceleration options make the portfolio highly 2 bidding document for e procurement university of kota, kota (rajasthan) page 10 of 39 d/nitesh/tender/chemistry adaptable for multiple applications. 7 double distillation assembly quartz double distillation unit. demountable boiler panel series. model – vertical. distilled water output capacity – 1 2.5 litres / hours. distillate water quality specification’s: ph: 6.9 to 7,free from pyrogen and organic matter, conductivity <1x10 6 s/cm, total organic carbon <500µg/l, total solids <0.1mg/lit. accessories for double distillation unit.• distillation apparatus power supply (daps) , low temperature circulating water bath (chiller),working temperature : 10°c to 100°c, temperature accuracy: ±01°c,insulated electrical connections with safety cutoff device. distillation stand should be of high quality rust free metal with embedded clamps for perfect holding and storage tank. threaded connectors are offered with all water connections., made of high quality heat resistant glass cylinders and tubes and also resistant to minor damages, boiler portion made of high purity and good quality borosilicate material along with water level indicator, borosilicate condenser, heater is of high purity electronic grade transparent quartz type. should avoid contact of embedded boiler with water electrical requirements 230 250 volts single phase 1.5x2 kw quartz heater, energy efficient. provided with safety cut off device. parts should be replaceable. iso accredited. audio alarm light indicator, electrical dual auto cut off system, mcb, optical beam sensor for the tracking of water level reduction, increase and also the increase of the boiler pressure. 4 8 single distillation assembly wall hanging type with bracket/clamps, electrically operated, single walled, capacity of production pyrogen free distilled water, made of heavy gauge stainless steel. distillation capacity: 2 10 litres/hr.isi immersion heating element. electric control panel: water level cut off device, rubber and sealing ring: between the boiler & lid, take control valve: for water inlet., return water pipe, acid resistant, alkali proof and corrosion proof. supplied with clamps, storage tank, 2 nos of replaceable immersion heating element and core power cord of minimum 2 meter length along with 3 pin industrial plug/top. single phase ac 230+ 10v & 50+ 1hz.loads:1.5kw 8kw. 1 9 uv cabinet uv viewing cabinet with uniform uv illumination, soft rubber view port, uv filters for eye protection, control switches, 3 uv sources (shortwave 254nm and longwave 366nm and visible), all the essential accessories required for inspecting paper & thin layer chromatograms and fluorescent materials. 6 10 hot air oven external/internal body and other parts like tray etc should be made of high quality material like ss316 or better. proper facility for ventilation and air circulation. temperature range: 50°c to 300°c or better. temp. set and display sensitivity: temp. variation: ± 1 ºc. material: stainless steel or better. no. of shelves: 3 or more, chamber size: 18x18x18 or better (should be fitted on 2.5 feet bench). accuracy: ±2°c or better. microprocessor control system and digital displays, digital 12 bidding document for e procurement university of kota, kota (rajasthan) page 11 of 39 d/nitesh/tender/chemistry sample temperature display; control panel option provision for door safety locking system. accessory: electric codes (1 pc), gloves (1 pair), and tong (2 pc), removable stainless steel racks (2 pc extra). power supply: 100 240v,50/60 hz. voltage (v) 220volt, frequency (hz) series 50 hz. 11 hot plate heating plate surface: the cast iron plate machined to a smooth & levelled surface is fitted on a robust mild steel double body painted with an attractive stoving enamel. top of rectangular cast iron plate has insulated beaded elements inside. heating range: up to 350 deg. c. continuous operation for long time. accuracy in temperature: +/ 2 deg. c. or better. uniformity: +/ 1 deg. c. or better. controller: provided with thermostat (up to 350°c) or energy regulator or digital controller cum indicator pid micro processor controller dual display with safety alarm. rating: 2kw. power indicator: on/off. power requirements:220v ac, 50hz cycle. dimensions :10 x 12 inches 19 12 water bath 6 holes 06 holes of 75mm dia, double walled inside stainless steel and outside mild steel sheet painted in epoxy powder coating (rust resistant material) with lid. bath should consist of two pilot lamp, temperature control knob and on/off switch to work on 220/230 volts ac supplied with or without stirring arrangement without racks and thermometer. instrument should have lift up bath cover; carrier racks should be given for flasks and test tubes racks. a cock should be provided to facilitate draining of bath contents. water bath protective media should be there to prevent contamination and formation of algae. temperature is generally electronic digital temperature controller, from ambient temperature +5 to 100oc with accuracy of ±10 c and ±0.10c. audible warning safety signals should be there for high/low temperature warnings, and dry running protection. all electrical peripherals required for smooth functioning e.g. voltage stabilizer should be provided with the equipment, water bath rectangular (single wall), auto cut heating elements are fitted 5 13 water bath 12 holes 12 holes of 75mm dia, double walled inside stainless steel and outside mild steel sheet painted in epoxy powder coating (rust resistant material) with lid. bath should consist of two pilot lamp, temperature control knob and on/off switch to work on 220/230 volts ac supplied with or without stirring arrangement without racks and thermometer. instrument should have lift up bath cover; carrier racks should be given for flasks and test tubes racks. a cock should be provided to facilitate draining of bath contents. water bath protective media should be there to prevent contamination and formation of algae. temperature is generally electronic digital temperature controller, from ambient temperature +5 to 100oc with accuracy of ±10 c and ±0.10c. audible warning safety signals should be there for high/low temperature warnings, and dry running protection. all electrical peripherals required for smooth functioning e.g. voltage stabilizer should be provided with the equipment, water bath rectangular (single wall), auto cut heating elements are fitted 5 14 melting point basic and digital melting point apparatus having measuring range 8 bidding document for e procurement university of kota, kota (rajasthan) page 12 of 39 d/nitesh/tender/chemistry apparatus of melting point: ambient to 300oc, resolution: 0.1oc, accuracy: better than 0.5oc, silicon oil bath, built in magnetic stirrer with electronic speed and heat rate controller, digital display of temperature with sensor, glare free background light with adjustable light intensity. 15 mechanical stirrer / agitators speed range 50 to ≥ 1500 rpm, capacity 500 ml 5 lit., high torque even at low speeds, led display, timer 0 99 minutes, monitoring of set & actual speed, advanced stirrers with microprocessor technology, maintenance free brushless dc motor ensures high torque, accurate stirring speed control, display of torque / speed, accepts shafts up to 13mm diameter with different types of agitators / impellers. 13 16 magnetic stirrer with hot plate 500 ml digital control, hot top warning indicator, microprocessor pid temperature control, three user selectable temperature control modes: optimal mode, fast mode and slow mode, two user selective timer, showing actual and set value simultaneously, temperature range: ambient to 450°c, heating control: feedback control with pid / scale, stirring range: 30 to ≥ 2000 rpm, speed resolution: 1 rpm, stirring capacity: max. 500 ml or more, timer: 0 60 minute, body material: ss, top plate material: ceramic coated, heating power: 600 watt, voltage / frequency input according to indian options and good tolerance to the fluctuation. 18 17 magnetic stirrer with hot plate 1000 ml digital control, hot top warning indicator, microprocessor pid temperature control, three user selectable temperature control modes: optimal mode, fast mode and slow mode, two user selective timer, showing actual and set value simultaneously, temperature range: ambient to 450°c, heating control: feedback control with pid / scale, stirring range: 30 to ≥ 2000 rpm, speed resolution: 1 rpm, stirring capacity: max. 1 l or more, timer: 0 60 minute, body material: ss, top plate material: ceramic coated, heating power: 600 watt, voltage / frequency input according to indian options and good tolerance to the fluctuation. 11 18 heating mantle simple made of yarn /spun aluminium providing uniform heating. the heating elements out of nichrome wire on helically wound coil form safety insulated fibre glass sleaving which in turn is attached to knitted glass fabric, to give flexible support to flask. surface temperature 450o c which is controlled by an energy regulator, suitable for operation on 230/240 v ac 50hz, size – 500ml capacity, temperature controlled, indicator light fitted in painted metallic box. 13 19 heating mantle with magnetic stirrer metallic heating mantle body, heating mantle material of glass fibre yarn for holding round bottom flask, inbuilt protection from liquid spill, knob for variable heat control with on/off, temperature range 4000c. 250 ml (5 nos) and 500 mal (5 nos) capacity. 10 20 digital nepheloturbidity meter source: led, detector: photodiode, display: 2 line 16 ch. lcd, ranges:0 1000ntu in 4 ranges (automatic), accuracy: ± 1.5% of fsd in 0 500ntu ± 2% of fsd in 500 1000ntu, repeatability: ±1 % of fs (std.), calibration: formazine 3 bidding document for e procurement university of kota, kota (rajasthan) page 13 of 39 d/nitesh/tender/chemistry standard solution, data stored in memory, with printer port, with four flat bottom test tubes (25mm ø) and light shield. 21 digital conductivity and tds meter source frequency:100hz or 1khz automatically selected, conductivity range: 0 μs to 20 μs with 0.1 cell constant and 0 μs to 200 ms with 1 cell constant in 5 decadic ranges, tds: 0 ppm to 20 ppt with 0.1 cell constant and 0 ppm to 200 ppt with 1 cell constant in 5 decadic ranges, temperature: 0 to 100oc (auto/manual), display:3 digits led, resolution: (i) conductivity: 0.01 μs is lowest range with cell constant of 0.1, (ii) tds: 0.01 ppm is lowest range with cell constant of 0.1, (iii) temperature:1oc; accuracy: (i) conductivity/tds: ±1% of fs ±1 digit, (ii) temperature: ± 1oc ±1 digit; conductivity cell composition: (i) 0.1 cell constant:0.09 to 0.11, (ii) 1 cell constant: 0.9 to 1.1; tds factor:0 to 1.00, cond. temp range: 0.0 to10% per oc, temperature range: 0 to 100oc, temperature sensor: pt 100, with 1 cell constant cell, ).1 cell constant cell, temperature probe (pt.100 sensor) and clamp & stand. 4 22 digital colorimeter type: manual, supplied in battery cum mains operation, measuring: % t and absorption & concentration (by factor) and k factor display: led 3 digit min., wavelength range:(400 700 nm) with 8 or more optical filter & auto zero, resolution: 0.1% t, abs. upto1.999 abs. (od) memory: 100 ≥ data must be stored in memory. print port: yes, accessories: 4 test tubes and 2 glass cuvettes, voltage / frequency input as per indian options and good tolerance to the fluctuation. 5 23 digital ph meter ph range: 0 to 14.00 ph, millivolt range: 0 to ± 1999 mv, slope correction: 85% to 115%, resolution: 0.01 ph, 1mv in mv mode, repeatability: ±0.01 ph ±1 digit for ph ±0.01 mv ± 1 digit for mv, standardization range: ±1 ph, temp. compensation: 0 to 100oc, display: 31/2 digital lcd seven segment with automatic polarity & decimal point, polarization current:10μa, record output: ±10 mv/ph in ph mode ±10 mv/100 mv in mv, with combined electrode, stand and clamp. 20 24 portable ph meter ph range: 0 to 14.00 ph, resolution: 0.01 ph, temp. accuracy ± 0.5oc, temp. range; 5 60oc, automatic shut off. 5 25 rotatory shaker variable speed from 20 rpm to 300 rpm with heating facility. digital display of speed with pre setting facility. shaking amplitude 40 mm. universal platform to accommodate interchangeable clamps of assorted sizes for different capacity of flasks. automatic restart at pre set speed in case of power failure. 2 26 colony counter 250 x 3100 x 130 hmm, 100 mm diameter magnifying lens, glare free illumination by fluorescent tube light, 4 digits resettable digital counter with audio beep at every count, wolf flue gel grid glass plate. 2 27 gel electrophoresisvertical dimension, 23cm(l)x18cm(b)x20cm(h) , number of samples : 13.buffer volume : 150 200ml ,gel size : 16x14 (1 gel) ,glass plate : 18x18cm notched and square plates (2 sets), number of combs : 13 wells 1mm thickness comb (well width6mm,interspace 4mm) (1 no., 13 wells 1.5mm thickness comb (well width 6mm,interspace 4mm) (1 no.) ,spacers : 1mm and 4 bidding document for e procurement university of kota, kota (rajasthan) page 14 of 39 d/nitesh/tender/chemistry 1.5mm spacers (3 nos. each) gasket: fixed, comb capacity: 30μ l,44μ l, clamp and screws: 1 set, connecting cord: red and black (each one) no. of platinum electrodes: positive and negative (each one), buffer chamber with safety lid: 1 no. gel casting system: 1 no. 28 gel electrophoresishorizontal cell size: 9 15 x 15 25 x4 6cm. sample. base buffer volume: 250 500 ml. gel tray size: 7 8 x 10 cm. supplied with two gel tray, gel caster, uv transparent plastic tray with compatible size, combs: at least with 4, 8 wells. multi channel suitability suitable for multi channel pipette. timing function 1min~999min or continue, with pause function. security settings the power is automatically paused when the cover is lifted. storage function automatically memorize the previous operating voltage and time. the electrophoresis tank and power supply can be separated. the cover with safety design, flip cover immediately turns the power off to ensure safety; transparent cover & open hole design for easy heat dissipation and observation; top handle design for easy to pick and place. one key select allows 135v, 100v, 70v, 50v, 35v, 25v, 18v desired output voltage for convenient and efficient saving on standby consumption. specially designed electrophoresis, reducing the temperature difference between the buffers due to improved heat uniformity. easy placement of gel into position without drift. pause function & timing function allows easy operations, with alarm function buzzer alert at the end. lcd displays the set parameters; default remember the output voltage and time. when the electrophoresis current exceeds the peak current, will automatically adjust the voltage to reduce the current value, improve the experimental reproducibility. 4 29 autoclave autoclave vertical, double walled made of thick high grade stainless steel sheet of ss 304 grade or better., capacity (litres): min. 50 ltr, operating range: temp.:100 1350c (sterilizing), 50 1000c (warming) & 50 100 0c (heating); pressure: up to 25 30psi with dial pressure gauge. working temperature: 121ºc at 15 to 20 psi pressure.inner & outer chamber, supply complete with stainless steel basket, chord and plug. the lid made of stainless steel sheet, unit fitted with double safety radial locking system with paddle lifting device, made of ms chrome plated and provided with pressure gauge (02.1kgf/cm2), safety device, safety valve, eject valve and neoprene/silicon gasket. steam, vacuum release and water draining by valve, led display for time and temperature. automatic pressure control switch to cut off the current from the heating elements, when the desired/ set pressure value level is attained inside the chamber and restarts the mechanism once the pressure inside the chamber falls from the desired level., automatic water cut off device – to protect the heaters from running dry and to ensure that the machine is automatically switched off in case the desired water level falls below the prescribed level (cut off with audible alarm),water inlet and outlet valves, water level indicator. timer with alarm system 4 bidding document for e procurement university of kota, kota (rajasthan) page 15 of 39 d/nitesh/tender/chemistry to regulate the sterilization time of the media to be sterilized with a buzzer. steel stand for keeping autoclave drum on it. electrically heated by immersion type heaters bearing isi mark. power supply: 220 230v, 50hz.onespare rubber gasket and electric element must be provided for autoclave. the apparatus should confirm to national or international standards with latest amendments covering markings, safety requirements with recommendations of safe operations from any reputed firm with iso 9001:2000 & ce certification. 30 laminar air flow vertical model. designed to meet the filtration, illumination, noise & vibration requirements, providing air to meet class 100 (class l) conditions, to the extent applicable, working area: 986x563x670 mm wx dxh, no. of hepa filters: 1 no. of pre filters:2, illumination: 1x40 w construction: modular, outer body of mild steel duly powder coated. the inner work table should be made of stainless steel. the side panels should have windows of uv absorbing toughened transparent glass, front of the cabinet should be provided with a transparent acrylic door mounted on hinges. air flow and filtration: hepa (high efficiency particulate air) filters having efficiency rating as high as 99.99% with cold dop and 99.97% with hot dop, thus retaining all airborne particles of size 0.3 micron and larger, double filtered air blows in laminar flow through the work table at designed velocity of 70 fpm 110 fpm (avg. air flow velocity 90 fpm), two gas corks are provided on one side panel, blower motor assembly: should be coupled to an inbuilt motor and operate with minimum noise level i.e. lower than 65 db on scale and vibration less than 2.5 um. illumination by diffused, glare free fluorescent light. inbuilt uv germicidal lamp, inbuilt pressure manometer. fitted with manometer for measurement of hepa filters choking system. fitted with cock for gas connection. 3 31 bod incubator features: providing fast and accurate results. cfc free refrigerant. temp. range: 5°c to 60°c. accuracy: ±0.5°c. temperature controller: digital pid. display: led display. door: double door, with silicon packing. inner door: tempered safety glass. safety device: over/under temperature protector. capacity: min. 300 litres. heaters tubular finned type heaters for dry and wet both. front panel: mains rocker switch, cooling/heating rocker switch, microcontroller, toggle switches for high and low position of heaters, fuses illumination: with the opening of the door. construction details: bod incubator should be double walled cooled unit. the gap between the outer and the inner wall should be filled with special grade glass wool to prevent thermal losses. air circulation: air circulation fans for maintaining temperature uniformly throughout the chamber. refrigeration unit: refrigeration unit is formed by isi marked compressor / cooling kit. 3 32 microtome rotatory ideally located coarse feed wheel for fatigue – free operation. 2 bidding document for e procurement university of kota, kota (rajasthan) page 16 of 39 d/nitesh/tender/chemistry advanced extremely smooth running hand wheel preferably with patented spring based forced balancing system. safety locking mechanism on the hand wheel. section thickness setting range 0.5 60µm approx. trimming thickness ranges – 10,50 µm approx. total horizontal specimen feed – 25mm approx. vertical stroke length – 59mm. approx. specimen retraction: on/off mechanism. specimen orientation – horizontal 80 & vertical 80. coarse feed wheel turn direction: user selectable. single – handed operation specimen clamps. facility to use cassette clamps should be available. precise knife holder lateral adjustments ensure that the entire width of the blade can be utilized. universal knife holder base for different knife holders (disposable, standard & heavy duty). disposable blade holder with integrated safety finger protection guard. accessories to be supplied along with the machine: cassette clamp 1 no. disposable microtome blades – 2 packets, c. dust cover, oil, manual. 33 microtome rotatorybasic steady built with a streamlined body, cut section from 1 to 40 micron in step 2 microns each, one razor of 120 mm, one sharpening hone, three block folders. 3 34 refrigerator ...

Medical College - Rajasthan

29518923 purchase of disposable and glassware purchase of disposable and glassware , electrical items : , disposable microtome blade ow profile, ce certified ivd approved suitable for leica mirotome, sample for approval is must low profile...

Sms Medical College - Rajasthan

29509255 purchase of disposable and glassware ( nit 120 ) disposable microtome blade low profile , ce certified ivd approved suitable for leica microtome sample for ...

Sardar Patel Medical College - Rajasthan

29157372 supply of patology lab items 01 micro slide ground edge & lint free 02 micro cover glasses from imported glass 03 filter papers sheets 04 disposable plastic apron 05 disposable tie on mask 06 disposable plastic gloves ( embossed ) size large 07 disposable plastic gloves ( embossed ) size medium 08 tissue paper roll 09 carbolic soap 1s0gm each 10 permanent marker pen ( bullettip ) black color 11 permanent marker pen ink black color 12 diamond point . pencil for marking on slides 13 o· 25 nos. disposable microtome blades 14 forceps sharp forceps blunt 18 scalpel blade handle stainless steel no 4 19 scalpel blade no 22 5 packet 2000 / ( 100 blades / pkt. ) 20 card board boxes with strips for block filling ( box of 25 strips ) 500 nos. 25000 / 21 tissuefloatation bath 01 nos. 20000 / microprocessor based / manual thermostatic elegantlydesigned & fabricated and tested for carrying out distortion lessand wrinkle free tissue specimens. in the field of diagnostic histo pathology and cyto pathology laboratories. outer wall: made of crcasheet duly powder coated after surface treatment inner chamber: it is rectangular in construcation & is made of seamless ( die pressed ) stainless steel sheet polished bright. insulation: high grade insulation, filled around power supply: 220volt, 50hz, singlephase, a.c. 15 _ heating element· emb dd temperature con~rollere. ~d heater element plate. temperature ra . . ~cro processor based digital chamber size ( nbej. . amb, ent to 70°c+_ 10c mm . 240 ( ljx1s0 ( w ) xso ( d ) 22 rectangular hot pi t ( for· a e s.s.top digitally controlled ) 01 nos. c~ntlouous heating up to 370* c 15000 / _ body ismade of specially desi d top made of stainless st i ( ! g~e cr~sheet duly powder coated uniformly ee or onger life and temperature insulated eleme t i f . . n are p aced underneath for uniform heatin c~:::~n7~~, ;, croprocessor based pid digita, temperature ind~ator 23 straight scissors with one blunted blade and one sharp blade straight scissors length 11.scm 10 nos 9000 / straight scissors length 14.scm 10 nos 24 slide warming table 9000 / 01 nos. 16000 / it is a rectangular flattening table with a jet black aluminumsurface ensuring very high thermal conductivity rates and exceptional resistance to mechanical expoitations temperature ranging from ambient to 70 *ccan be selected. the programmed as well as set temperature are displayed on the instruments and set values memorized by a built in battery backup system. top plate size: 300mm ( l ) x 200mm ( w ) 25 digitalanalytical balances 01 nos. multiple weighing units 25000 / standard bi directional rs 232interface. polyfunction backlitelcddisplay capacity: 230 gm readability :0.0001gm repeatability ( + / ) : 0.2mg linearity ( + / ) : 0.4 mg pan size: 80mm the balance issupplied with breeze shield. 01 nos. 65000 / 26 micro slide cabinet closed pack manner .. . for keeping 75 x 25 mm slidesin vertical position one after the 16 other made of oresteel with attractive powder coatedpaint finish. thecabinet has 480 x 75 rnrndrawers and takes slides in vertical position.eachdrawer moves in a slot and is completely removable for easy liftingof slides. the cabinet accommodates maximum number of slidesfor optimum space utilization. provided with lockable doors. 50000 slides / 160 drawers 27 water stili ( wall mounting ) 01 nos. the unit isrecommended for making pyrogen free distilled water of a very high degree of purity. made out of net stainless steel. the cock fitted to the unit is brass c.p. a wall mounting clamp is provided with the unit supplied with rubber tubing, cord and plug to work 220 / 230 volts 50 hz. ac, supply. capacity 4 itr. / hr. approx. 15000 / _ 10 nos. 10000 / 28 knife for brain ( non _ knife metal handle edge 20 em 30000 / 30 nos. 28 staining trough ( giass / s.s. ) 10 nos. 5000 / 29 slide carrier ( to hold 25 slid...

Medical College - Rajasthan

28962307 supply of consumables, reagent and controls for lab chemical and kits 1 sodirn hydroxide 2 copper acetate — 3 ammonium sulphate 4 sodium sulphate 5 6 sulphur powder sodim carbonate 7 silver nitrate 8 sodium hyrogen carbonate 9 calcium chloride 10 0 toluidine 11 1 naphthole 12 acetone 13 ninhydrine 14 bromine ampoules 15 ammonium solution ( liquid +na3 ) 16 hdrogen peroxide 17 phenolphthanlein t 18 lethanol 19 h2s04 20 hci 21 hno3 22 calcium carbonae 23 uthum carbonate 24 uric acid 25 potassium dichromate 26 ortho phosphoric acid pottasium dihydrogen orthophosphate i k2hpo2 28 potussiun hydrnxide 1 29 potassium oxalate l 30 ammonium molybdate 31 glass slides 32 cover slip 33 feci3 34 phenol — 3s ammonium oxalate 36 barium chloride sodium nitroprusside , acetic acid , phenol crystals , formalin , albumin flakes, bovine albumin , urea , creatinine micropipette , 46 micropipette 47 micropipette 48 micro tip 49 micro tip so micro tip 51 glucose 52 urea 53 creatinine 54 alkaline phosphatase 55 sgot 56 sgpt 57 cholesterol — s8 ihdl cholesterol 59 triglycerides 60 calcium 61 bilirubin 62 inorganic phosphorus 63 total protein 64 albumin flakes 65 uric acid 66 hydrogen peroxide 1 antiiotlc disc. 2 anikacin 30 mcg 3 ampicllin lomcg 4 amoxvcd1in. 10 mcg 5 amoxicillin / ciavulanic 2o / 10 6 ampicillne i sabactum 75 / 30 7 azithromycln 8 a.zreonam3omg 9 cefeperozone / salbactum 75 / 30 10 cefixime. smcg 11 cefatolne 30 mcg. 1 12 ceftazdime 30 mcg 13 ceftrixone 3o mcg. 14 15 cefipime3omcg cefoxitin 30 mcg 16 ciprofloxacin s mcg 17 chndamycin 2 mcg 18 colitstin ( methan sulphnate ) 19 erythromycin_50_mcg 20 gentamicin 10 mcg 21 imipenum1omcg 22 gentamicin 120 mcg 23 levofloxacine s mcg 24 linezolid 2s meropenum 10 mcg 26 norfloxacinl 10 mcg 27 nitrofuranltofli 300 mcg 28 oxidase disc. 29 otochin single 5 mcg 31 32 33 34 piperaclliin 100 mcg t — piperacillin / tazobactum 100 / 10 penicillin 10 unit tritmethoprim / sulphomethoxazole polymiwnn b 30o f 35 telcoplanin 3o mcg 36 tetracychne 3o mcg 37 vancomycin s.no. name of item other consumables 1 grams stain kit 2 biphasic blood culture meda for adults 3 biphasic blood culture media for pediatric 4 spirit lamp 5 straight wire with holder ( nichrome ) 6 wire uoop nichrom with holder 7 spirit for writ lamp 1oo ml 8 disposable petri dishes 1o0 mm 1 9 f sterilized sample collection swab 1o flask ( borosill sooml ) 11 test tube ( borosill 12x75mm ) 12 test tube ( borosiil l8xlsomm ) 1.3 test stand ( hole size 12 mm ) 14 test stand ( hole size 18 mm ) 15 slide box 16 cover slip box 17 acetone 500ml of an ato my 1 jformaidehye ( 1a0% strengah ) 2 glycerine 3 potassium hydroxide ikoh ) hydrogen peroxide department of physiology —.—s sno. name of item 1 neubauer counting chamber 2 rbc pipette 3 wbc ploette 4 sahlis haemoglobirnometer 5 esra pipette filler ( auto pipetee for westergren pipette ) 6 esra pasteur pipette with a long thin nozl fo wintrobes tube 7 methyl alcohol ( acetone free ) 8 cover glass square 22x22x0.13 9 antisera a, b&d 10 23 sterile needles 11 plaine vials for blood collection 12 test tube stand 13 acetone 1 harris haematoxylin cdh / oxfford 2 eosin v oxiford 3 microtome blade sndone high...

Indian Army - Rajasthan

27859741 proposal ( rfp ) in two bid system invitation of bid for supply of medical stores 1 prothrombin time kit 1*5 ml 2. pttk ( 10*2ml ) 3. glucose poweder 1 kg pkt 4. microtips 0 200 microlitre ( pkt of 1000 ) 5. microtips 50 1000 microlitre ( pkt of 500 ) 6. chloroform ( 2.5 ltr ) 7. cover slip glass ( 22*50mm ) 8. vacccutainer sodium citrate 3 ml with needle fda approved 9. gram, s stain ( 4 x 125 ml ) 10. petridish 480 plates 11. cytochrome li stain pack ( 500ml*500ml ) 12. zn stain kit 13. viral transport media with double swab 14. pcr plate white compatible with q tower 3 g touch analytik jena pcr machine ( pack of 50 plates ) 96 wells 15. pcr optical plate sealing foil compatible q tower 3 g touch analytik jena pcr machine ( pack of 100 ) 16. micropipette tips with aerosol barrier 0.5 10ul ( 10x96 ) ( rnaase free 17. micropipette tips with aerosol barrier 100 1000ul ( 6x96 ) ( rnaase free ) 18. tissue roll 19. printer roll for sysmex kx21 haematology analyser 20. macconkey agar 500 gm 0 21. hemostar cuvette stirer ( 1x100 ) 22. tissue tek processing cassettes ( 1x500 ) 23. tissue tek embedding cassette plastic ( 1x500 ) 24. crp rapid agglutination test 25. ra factor kit of 100 test 26. dengue test kit ns1 antigen, igg2 igm, pack of 10 27. glycerin ( 500 ml ) bott 28. aso kit of 25 test 29. widal test kit of 50 test 30. surgical blade sterile size 20 31. haematoxyllin ( harris ) stain ( 1x500 ml ) 32. anti ccp elisa kit 33. exp micro centrifuge tube stand / rack with holding capacity of 100 tubes 34. mpo stain 35. bio rad diabetic control 36. bio rad l1 37. bio rad l2 38. tmppd kit 39. molecular grade ethenol bott of 500 ml for rt pcr 40. micro centrifuge tube 2 ml with conical bottom ( rnase free ) 41. micro centrifuge tube 1.5 ml with conical bottom ( rnase free ) 42. micro centrifuge tube 2 ml with conical bottom 43. sterile swab sticks with tube ( 1x100 ) 44. bhi 50ml adult ( colour colt ) 45. bhi 50ml paediatric ( colour colt ) 46. stands for pipettes 47. sabouraud dextrose agar ( bott of 500 gms ) 48. rapid dengue ns1ag test kit ( 1x10 test kit ) 49. micro pro val id kit ( 25 test kit ) 50. high profile microtome blade 51. candida chromogenic media for candida identification ( chrom agar ) bottle of 500 gms 52. cartridge of laser toner printer lexmark ms312dn 53. cartridge of laser toner printer canon 925 ( f166400 ) 54. cartridge of laser toner printer kyocera ecosys fs 1040 55. cartridge of laser toner printer hp laserjet pro m202n 56. nicrome wire inoculating loop 5 mm diameter twisted inside 57. nicrome wire inoculating loop 2 3mm diameter inside 58. inaculating loop holder 59. g6pd test kit ( qualitative visual method ) 60. alcohol swab 61. round band aid plaster 62. e check ( sysmex control ) l 1, l 2, l 3 63. cell clean sysmex ( 50 mlx1 ) 64. cell pack symex ( 20 ltrx1 ) 65. stromatolyser ( 1x500 ml ) 66. viral rna extraction kit silica technology ( silica membrane column ) 67. methylene blue powder lab grade for microscopy ( bottle of 25 grams ) 68. real time pcr kit for noval coronavirus ( sars cov 2 / covid 19 ) for qualitative testita...

Department Of Medical Education - Rajasthan

27620749 supply of reagents . hametoxy line dtafield, eosin, formadehyde, cassette plastic, dpx mourt, microscopic slide, cover slip, diamond pencil , nictric acid, iso propyl alcohol, xylene, paraffin wax, egg album n, staining jar, distil water, pap stain kit, microtome blade , hematoxyl powder , potassium alum, sodium lodate, steel tissue mould , bouin s fixative, ...

Medical Education Department - Rajasthan

27553868 rate contract for lab kits chemical items pathology lab at srg hospital, jhlawar absolute alcolol 99.5% ( 2.5 ltr ) , acetone ar ( 2.5 ltr. ) , acid fuchsian 500 gm, activated charcoal 500gm, alcian blue 500 gm, ammonium chloride anhydrous ( 500gm ) , ammonium pattasium alum 500gm, ammonium solution ( 25% ) 500ml, ammonium sulphate 500 gm, b.t.c.t. cappillry tube 1 x100, barium chloride 500gm, basic fuchsin 500 gm, beaker glass 1 ltr., beaker glass 250ml, beaker glass 500ml, benedicts reagent 500ml, biebrich scarlet 500 gm, brilliant cresyl blue 520ml, buffer tablets, ph: 6.8 7.0, buffer tablets, ph: 4.0 8.0, carbol fuschsin ( strong ) , 500 ml, carmine stain, 25gm, cedarwood oil ( colour less ) , 125ml, conc. hcl, 2.5 liter, congo red, 100gm, conical flask glass, 2 ltr., conical flask glass, 100ml, conical flask glass , 250ml, coplin’s jars ( vertical ) plastic, each, crystal violet, 500 gm, coag control n+p, 12x2x1 ml, d.p.x. mountant, 250ml, dekaphane uristix, 100, dextrose anhydrous, 500 gm, dropper plastic, 1 ml, dropper plastic, 2 ml, dropper plastic, 3 ml, dropping bottle, 250ml, edta powder, 100gm, egg albumin flacks, 500gm, eosin 2%, 125 ml, eosinophil diluting fluid, 150 ml, esr tube ( westergreens ) , 2ml, ethanol absolute, 500ml, ferric ammonium sulphate, 500gm, field stain a, 500ml, field stain b, 500ml, filter paper ( watmans ) , each, formaldehyde ( 37 40% ) , 25 30 lit., formaline, 5 ltr., formic acid 90%, 2.5 liter, fouchets reagent, 125ml / 100ml, funnel, 6”, funnel 4”, giemsa’s powder 100gm, glacial acetic acid 2.5 liter, glass piptte with bulb 5ml, glass piptte with bulb 1ml, glass slide box size 75x25x1.35 1 x 50 nos, glycerin 2.5 lit., haem test for ocult blood in stool 200 test, hematoxylene 5 gm, iso propyl alcohol 2.5 ltr., jsb i stain 500ml, jsb ii stain 500ml, keto diastix 100, labolene 5ltr., leishaman’s stain kit / cytochrome 500ml, light magnesium carbonate 500 gm, lithium carbonate 500gm, lugol’s iodine 100ml, magnesium sulphate 500 gm, measuring cylinder glass 100ml, measuring cylinder glass 500ml, mercuric oxide red 500 gm., mercuric oxide yellow 500 gm., metanil yellow 500gm, methyene blue 125ml, micro albumin strips – 1x25, n / 10 hcl 500 ml, neoplastine ci plus – 2 6x2 ml, paraffin wax 1 k.g., phosphotungstic acid 100gm, platelet diluting fluid 500ml, polylysene 100ml, potasium metabisulphite 500 gm, potassium acetate 500 gm, potassium chloride 500 gm, potassium iodide 100gm, rbc diluting fluid 500ml, reagent bottle 125ml / 60ml / 250 ml / 500 ml, reagent dropping bottle 100ml, seman diluting fluid 520ml, silicon gun with silicon 1 gun & 2 tubes, silver nitrate 25gm, sod. hypochlorite 5ltr., sodium aceate trihydrate ar ( 500gm ) , sodium biacarbonate 500 gm, sodium metabisulphide ( 500gm ) , sodium thiosulphate 500 gm., sta cacl2 0.25 m 24x15 ml, sta cuvettes 150x4 cuv., sta steel balls 1850 balls, staining jar trough glass for 10 slides each, sulphuric acid 2.5 lit., test tube glass 12x75, test tube plastic 12x75, test tube glass 12 x 100, test tube plastic 12 x 100, thrombin time test kit 12x2 ml, thymol 500 gm, toludine blue 125ml, trisodium citrate 500 gm, trisodium citrate dehydrate purified 500gm, triss ( hydroxymethyl methylamine ) 500gm, tween 20 ( polyoxyethylene sorbitan monolaurate ) 500ml, wbc diluting fluid 500ml, xylene ( sulfur free ) ar 2.5 ltr., ready to use antibodies ( dilutional ) er1 kit each, ready to use antibodies ( dilutional ) pr1 kit each, ready to use antibodies ( dilutional ) her 2 neu 1 kit each, peroxidase staining test kit 1 kit each, ihc detection kit 1 kit each, absolute ethanol ( 99.9% ) 500ml, xylene lr ( sulphur free ) 2.5lt, acetone 2.5 lt, formaldehyde solution ( 37 40 % w / v ) 50 lt, lithium carbonate ( li2co3=73.89 ) 250 gm, d.p.x. mountant 250 ml, egg albumin flakes 500 gm, surgical blade 22 no. pro core 100, microtome blade hp 35 coated 34° / 75 mm 1x50, diamond pencil, watmans filter paper 125 mm, paraffin wax with ceresin 2 kg, glycerine 2.5 lt, methanol, lugols iodine, light green 25 gm, aluminium sulphate al2 ( so4 ) 3.16h2o 500 gm, periodic acid 25 grm, aluminium hydroxide 500 grm, aluminium chloride anhydrous 500 gm, potassium ferrocyanide 500 grm, nuclear fast red 1gm, koh ( potassium hydroxide ) 500 gm, oxalic acid 500 gm, bouins luid 1lt, saturated picric acid 100 ml, glacial acetic acid 500ml, methanamine 500gm, hydrogen peroxide 30% 500ml, hemotoxylin stain 25gm, eosin 2% w / v 125ml, potassium dihydrogen phosphate.2h20 500gm, naphthol as bs phosphate 500mg, fast blue bb salt 25gm, neutral red ( aqueous sol. ) 500ml, naphthol as&d chloroacetate 250ml, glycerol 2.5lt, nn dmethly formamide 500ml, phosphate buffer 500gm, toluidine 25gm, potassium permanganate powder 500gm, gold chloride 1gm, ferric chloride 500gm, sodium hydroxide 500gm, borax powder 500gm, ferric chloride 500gm, sodium dihydrogen phosphate 500gm, sodium chloride 500gm, hexamethelene tetramine 500ml, chromic acid 500gm, kh2po4 ( monobasic ) 500gm, alpha naphthyl acetate 10gm, fast garnet gbc salt 1gm, non specific esterase kit for leukemia pack size 1, myeloperoxidase stain kit for leukemia pack size 1, benzidine dihydrochloride 1gm, znso4.7h2o 500gm, sodium acetate trihydrate 500gm, pap stain kit 250 tests / kit, disposable microtome blade 80 mmx14 mmx0.35 mm pack of 50, ( a ) . gopd kit quantitative 12test, ( b ) . g6pd qualitative 12test, microscope bulb ( low voltage halogen lamp & led ) , drabkins solution 500ml, bone marrow needle ( jamshidi & sahlas ) , fructose test reagent ( for semen ) 100ml, new methylene blue ( for reticulocyte count ) 5gm, csf diluting fluid reagent 100ml, buffer tablet ( ph 4.0, 6.0 &7.5 ) , haem test for occult blood in stool 200 test, fdp 60 test, d dimer 60 test, bone marrow aspiration needle ( 16 g. & 50mm ) pack size 1, peanut oil 5lt, k2 edta vial duble cap non vacmmum, pt 3.2% vial duble cap non vacmmum, polyl lysine 100ml, ready to use antibodies ( dilutional ) er1 kit each 12ml, ready to use antibodies ( dilutional ) pr1 kit each 12ml, ready to use antibodies ( dilutional ) her2 neu 1 kit each 12ml, ihc detection kit 1 kit each 15 kit, trisodium citrate dehyrate purified ( 500 gm ) 500gm, tween 20 ) polyoxyethylene sorbitan monolaurate 500 gm, triss ( hydroxymethyl methylamine 500 gm ) , disodium hydrogen phosphate 500gm, sodium dihydrogen phosphate 500gm, edta powder 500gm, copper sulphate powder 1x10 ml, syringe 5 ml & 3 ml, cover slip 22x22 mm, 22x50 mm, dropper plastic 1x500, normal saline, sample edta vial duble cap non vacmmum ( k3, ) , sample plain vial duble cap non vacmmum ( red top ) , glass slide, conical flask ( 250 ml & 500 ml ) borosil, test tubes ( 7 inches & 10 inches ) borosil, electronic weighing machine, measuring glass cylinder 500 ml borosil, measuring glass beaker 50 ml, 100 ml & 500 ml borosil, glass stirring rod, test tube stand 48 hole plastic, test tube stand 96 hole plastic, periodic acid 100grm, basic fuschin, sodium metabisulphite, hcl, activated charcoal, martius yellow, phosphotungstic acid, brilliant crystral scarlet, glacial acetic acid 500gm, acetic acid 1%, 1% aquaeous potassium ferrocyanide 500gm, 2% hcl, 0.5% neutral red 500ml, silver nitrate 10%, conc. ammonia, 3% sodium hydroxide 500gm, 1% potassium permanganate 500gm, 1% oxalic acid 500gm, 2.5 % iron alum, 0.2% gold chloride 1 gm, 5% sod. thiosulphate, congo red, carbol fuschin, h2so4 5%, h2s04 20%, methylene blue ( aqueous ) 125ml, giemsa stain 10x500ml, leishman stain 500ml, leishman powder 50gm, retic stain 25ml, pas stain ( ready to use ) pa 25gm schiff reagent 125ml, sudan black kit, ph meter / litmus papers ( basic and acidic ) , cedar wood oil 100ml, semen diluting fluid 100ml, wbc diluting fluid 500ml, csf diluting fluid 100ml, microscope lens cleaner 100ml, thymol crystal 100gm, sodium citrate 500ml, filter paper ( watmanns ) packet, westergrens pippet tube, wintrobe tube tube, neubauer chamber, sahlis hemoglobinometer set 5, benedicts reagent 500ml, microalbumin strips ( urine ) 100 strips per box, esr card 10000 per card, sulphosalicylic acid 500ml, conc. acetic acid 500ml, liquid ammonia 500ml, potassium ferrocyanide 500gm, conc. hcl 500ml, heys sulphur sulphur sublimate powder 500gm, sodium nitroprusside powder, h202, fouchets reagent, benzidine solution, barium chloride, trichloroacetic acid, ehrlich reagent, chloroform, sodium acetate, butenol, ferric chloride, eosin niagresin, tourniquet, spinal needle, wooden & plastic slide storage box, puncture proof box, glass marking pencil, couplins jar, picric acid 500gm, citric acid 500gm, esbachs albuminometer, urine container 30ml, urinometer, pipettes 5 50ul tips – yellow 100 1000ul blue 20ul fix, dextrose 500gm, sodium nitrite 500gm, methylene blue chloride 50gm, anhydrous dipotassium hydrogen phosphate 500gm, anhydrous potassium dihydrogen phosphate 500gm, sodium dithionate 500gm, saponin 100gm, glass measuring beaker 50ml, glass measuring beaker 100ml, glass measuring beaker 500ml, measuring cylinder 200ml, glass stir rod, carmine 100gm, alcian blue 8gx, acetic acid 3% solution, aluminium sulphate al2 ( so4 ) 3.18h20 500gm, oil red o, p.t. vial 1x100, k2 edta vial 1x100, k3 edta vial 1x100, c.k. prest test kit, tissue paper roll, pregnancy test kit etc...

Government Medical College Hospital - Rajasthan

27552531 rate contract for supply of laboratory kits chemical items , phathology at srg hospital jhalawar. 1 1 pathology 2 2 absolute alcolol 99.5% ( 2.5 ltr ) 1 nos 3 3 acetone ar ( 2.5 ltr. ) 1 nos 4 4 acid fuchsian 500 gm 1 nos 5 5 activated charcoal 500gm 1 nos 6 6 alcian blue 500 gm 1 nos 7 7 ammonium chloride anhydrous ( 500gm ) 1 nos 8 8 ammonium pattasium alum 500gm 1 nos 9 9 ammonium solution ( 25% ) 500ml 1 nos 10 10 ammonium sulphate 500 gm 1 nos 11 11 b.t.c.t. cappillry tube 1 x100 1 nos 12 12 barium chloride 500gm 1 nos 13 13 basic fuchsin 500 gm 1 nos 14 14 beaker glass 1 ltr. 1 nos 15 15 beaker glass 250ml 1 nos 16 16 beaker glass 500ml 1 nos 17 17 benedicts reagent 500ml 1 nos 18 18 biebrich scarlet 500 gm 1 nos 19 19 brilliant cresyl blue 520ml 1 nos 20 20 buffer tablets, ph: 6.8 7.0 1 nos 21 21 buffer tablets, ph: 4.0 8.0 1 nos 22 22 carbol fuschsin ( strong ) , 500 ml 1 nos 23 23 carmine stain, 25gm 1 nos 24 24 cedarwood oil ( colour less ) , 125ml 1 nos 25 25 conc. hcl, 2.5 liter 1 nos 26 26 congo red, 100gm 1 nos 27 27 conical flask glass, 2 ltr. 1 nos 28 28 conical flask glass, 100ml 1 nos 29 29 conical flask glass , 250ml 1 nos 30 30 coplin’s jars ( vertical ) plastic, each 1 nos 31 31 crystal violet, 500 gm 1 nos 32 32 coag control n+p, 12x2x1 ml 1 nos 33 33 d.p.x. mountant, 250ml 1 nos 34 34 dekaphane uristix, 100 1 nos 35 35 dextrose anhydrous, 500 gm 1 nos 36 36 dropper plastic, 1 ml 1 nos 37 37 dropper plastic, 2 ml 1 nos 38 38 dropper plastic, 3 ml 1 nos 39 39 dropping bottle, 250ml 1 nos 40 40 edta powder, 100gm 1 nos 41 41 egg albumin flacks, 500gm 1 nos 42 42 eosin 2%, 125 ml 1 nos 43 43 eosinophil diluting fluid, 150 ml 1 nos 44 44 esr tube ( westergreens ) , 2ml 1 nos 45 45 ethanol absolute, 500ml 1 nos 46 46 ferric ammonium sulphate, 500gm 1 nos 47 47 field stain a, 500ml 1 nos 48 48 field stain b, 500ml 1 nos 49 49 filter paper ( watmans ) , each 1 nos 50 50 formaldehyde ( 37 40% ) , 25 30 lit. 1 nos 51 51 formaline, 5 ltr. 1 nos 52 52 formic acid 90%, 2.5 liter 1 nos 53 53 fouchets reagent, 125ml / 100ml 1 nos 54 54 funnel, 6” 1 nos 55 55 funnel 4” 1 nos 56 56 giemsa’s powder 100gm 1 nos 57 57 glacial acetic acid 2.5 liter 1 nos 58 58 glass piptte with bulb 5ml 1 nos 59 59 glass piptte with bulb 1ml 1 nos 60 60 glass slide box size 75x25x1.35 1 x 50 nos 1 nos 61 61 glycerin 2.5 lit. 1 nos 62 62 haem test for ocult blood in stool 200 test 1 nos 63 63 hematoxylene 5 gm 1 nos 64 64 iso propyl alcohol 2.5 ltr. 1 nos 65 65 jsb i stain 500ml 1 nos 66 66 jsb ii stain 500ml 1 nos 67 67 keto diastix 100 1 nos 68 68 labolene 5ltr. 1 nos 69 69 leishaman’s stain kit / cytochrome 500ml 1 nos 70 70 light magnesium carbonate 500 gm 1 nos 71 71 lithium carbonate 500gm 1 nos 72 72 lugol’s iodine 100ml 1 nos 73 73 magnesium sulphate 500 gm 1 nos 74 74 measuring cylinder glass 100ml 1 nos 75 75 measuring cylinder glass 500ml 1 nos 76 76 mercuric oxide red 500 gm. 1 nos 77 77 mercuric oxide yellow 500 gm. 1 nos 78 78 metanil yellow 500gm 1 nos 79 79 methyene blue 125ml 1 nos 80 80 micro albumin strips – 1x25 1 nos 81 81 n / 10 hcl 500 ml 1 nos 82 82 neoplastine ci plus – 2 6x2 ml 1 nos 83 83 paraffin wax 1 k.g. 1 nos 84 84 phosphotungstic acid 100gm 1 nos 85 85 platelet diluting fluid 500ml 1 nos 86 86 polylysene 100ml 1 nos 87 87 potasium metabisulphite 500 gm 1 nos 88 88 potassium acetate 500 gm 1 nos 89 89 potassium chloride 500 gm 1 nos 90 90 potassium iodide 100gm 1 nos 91 91 rbc diluting fluid 500ml 1 nos 92 92 reagent bottle 125ml / 60ml / 250 ml / 500 ml 1 nos 93 93 reagent dropping bottle 100ml 1 nos 94 94 seman diluting fluid 520ml 1 nos 95 95 silicon gun with silicon 1 gun & 2 tubes 1 nos 96 96 silver nitrate 25gm 1 nos 97 97 sod. hypochlorite 5ltr. 1 nos 98 98 sodium aceate trihydrate ar ( 500gm ) 1 nos 99 99 sodium biacarbonate 500 gm 1 nos 100 100 sodium metabisulphide ( 500gm ) 1 nos 101 101 sodium thiosulphate 500 gm. 1 nos 102 102 sta cacl2 0.25 m 24x15 ml 1 nos 103 103 sta cuvettes 150x4 cuv. 1 nos 104 104 sta steel balls 1850 balls 1 nos 105 105 staining jar trough glass for 10 slides each 1 nos 106 106 sulphuric acid 2.5 lit. 1 nos 107 107 test tube glass 12x75 1 nos 108 108 test tube plastic 12x75 1 nos 109 109 test tube glass 12 x 100 1 nos 110 110 test tube plastic 12 x 100 1 nos 111 111 thrombin time test kit 12x2 ml 1 nos 112 112 thymol 500 gm 1 nos 113 113 toludine blue 125ml 1 nos 114 114 trisodium citrate 500 gm 1 nos 115 115 trisodium citrate dehydrate purified 500gm 1 nos 116 116 triss ( hydroxymethyl methylamine ) 500gm 1 nos 117 117 tween 20 ( polyoxyethylene sorbitan monolaurate ) 500ml 1 nos 118 118 wbc diluting fluid 500ml 1 nos 119 119 xylene ( sulfur free ) ar 2.5 ltr. 1 nos 120 120 ready to use antibodies ( dilutional ) er1 kit each 1 nos 121 121 ready to use antibodies ( dilutional ) pr1 kit each 1 nos 122 122 ready to use antibodies ( dilutional ) her 2 neu 1 kit each 1 nos 123 123 peroxidase staining test kit 1 kit each 1 nos 124 124 ihc detection kit 1 kit each 1 nos 125 125 absolute ethanol ( 99.9% ) 500ml 1 nos 126 126 xylene lr ( sulphur free ) 2.5lt 1 nos 127 127 acetone 2.5 lt 1 nos 128 128 formaldehyde solution ( 37 40 % w / v ) 50 lt 1 nos 129 129 lithium carbonate ( li2co3=73.89 ) 250 gm 1 nos 130 130 d.p.x. mountant 250 ml 1 nos 131 131 egg albumin flakes 500 gm 1 nos 132 132 surgical blade 22 no. pro core 100 1 nos 133 133 microtome blade hp 35 coated 34° / 75 mm 1x50 1 nos 134 134 diamond pencil 1 nos 135 135 watmans filter paper 125 mm 1 nos 136 136 paraffin wax with ceresin 2 kg 1 nos 137 137 glycerine 2.5 lt 1 nos 138 138 methanol 1 nos 139 139 lugols iodine 1 nos 140 140 light green 25 gm 1 nos 141 141 aluminium sulphate al2 ( so4 ) 3.16h2o 500 gm 1 nos 142 142 periodic acid 25 grm 1 nos 143 143 aluminium hydroxide 500 grm 1 nos 144 144 aluminium chloride anhydrous 500 gm 1 nos 145 145 potassium ferrocyanide 500 grm 1 nos 146 146 nuclear fast red 1gm 1 nos 147 147 koh ( potassium hydroxide ) 500 gm 1 nos 148 148 oxalic acid 500 gm 1 nos 149 149 bouins luid 1lt 1 nos 150 150 saturated picric acid 100 ml 1 nos 151 151 glacial acetic acid 500ml 1 nos 152 152 methanamine 500gm 1 nos 153 153 hydrogen peroxide 30% 500ml 1 nos 154 154 hemotoxylin stain 25gm 1 nos 155 155 eosin 2% w / v 125ml 1 nos 156 156 potassium dihydrogen phosphate.2h20 500gm 1 nos 157 157 naphthol as bs phosphate 500mg 1 nos 158 158 fast blue bb salt 25gm 1 nos 159 159 neutral red ( aqueous sol. ) 500ml 1 nos 160 160 naphthol as&d chloroacetate 250ml 1 nos 161 161 glycerol 2.5lt 1 nos 162 162 nn dmethly formamide 500ml 1 nos 163 163 phosphate buffer 500gm 1 nos 164 164 toluidine 25gm 1 nos 165 165 potassium permanganate powder 500gm 1 nos 166 166 gold chloride 1gm 1 nos 167 167 ferric chloride 500gm 1 nos 168 168 sodium hydroxide 500gm 1 nos 169 169 borax powder 500gm 1 nos 170 170 ferric chloride 500gm 1 nos 171 171 sodium dihydrogen phosphate 500gm 1 nos 172 172 sodium chloride 500gm 1 nos 173 173 hexamethelene tetramine 500ml 1 nos 174 174 chromic acid 500gm 1 nos 175 175 kh2po4 ( monobasic ) 500gm 1 nos 176 176 alpha naphthyl acetate 10gm 1 nos 177 177 fast garnet gbc salt 1gm 1 nos 178 178 non specific esterase kit for leukemia pack size 1 1 nos 179 179 myeloperoxidase stain kit for leukemia pack size 1 1 nos 180 180 benzidine dihydrochloride 1gm 1 nos 181 181 znso4.7h2o 500gm 1 nos 182 182 sodium acetate trihydrate 500gm 1 nos 183 183 pap stain kit 250 tests / kit 1 nos 184 184 disposable microtome blade 80 mmx14 mmx0.35 mm pack of 50 1 nos 185 185 ( a ) . gopd kit quantitative 12test 1 nos 186 186 ( b ) . g6pd qualitative 12test 1 nos 187 187 microscope bulb ( low voltage halogen lamp & led ) 1 nos 188 188 drabkins solution 500ml 1 nos 189 189 bone marrow needle ( jamshidi & sahlas ) 1 nos 190 190 fructose test reagent ( for semen ) 100ml 1 nos 191 191 new methylene blue ( for reticulocyte count ) 5gm 1 nos 192 192 csf diluting fluid reagent 100ml 1 nos 193 193 buffer tablet ( ph 4.0, 6.0 &7.5 ) 1 nos 194 194 haem test for occult blood in stool 200 test 1 nos 195 195 fdp 60 test 1 nos 196 196 d dimer 60 test 1 nos 197 197 bone marrow aspiration needle ( 16 g. & 50mm ) pack size 1 1 nos 198 198 peanut oil 5lt 1 nos 199 199 k2 edta vial duble cap non vacmmum 1 nos 200 200 pt 3.2% vial duble cap non vacmmum 1 nos 201 201 polyl lysine 100ml 1 nos 202 202 ready to use antibodies ( dilutional ) er1 kit each 12ml 1 nos 203 203 ready to use antibodies ( dilutional ) pr1 kit each 12ml 1 nos 204 204 ready to use antibodies ( dilutional ) her2 neu 1 kit each 12ml 1 nos 205 205 ihc detection kit 1 kit each 15 kit 1 nos 206 206 trisodium citrate dehyrate purified ( 500 gm ) 500gm 1 nos 207 207 tween 20 ) polyoxyethylene sorbitan monolaurate 500 gm 1 nos 208 208 triss ( hydroxymethyl methylamine 500 gm ) 1 nos 209 209 disodium hydrogen phosphate 500gm 1 nos 210 210 sodium dihydrogen phosphate 500gm 1 nos 211 211 edta powder 500gm 1 nos 212 212 copper sulphate powder 1x10 ml 1 nos 213 213 syringe 5 ml & 3 ml 1 nos 214 214 cover slip 22x22 mm, 22x50 mm 1 nos 215 215 dropper plastic 1x500 1 nos 216 216 normal saline 1 nos 217 217 sample edta vial duble cap non vacmmum ( k3, ) 1 nos 218 218 sample plain vial duble cap non vacmmum ( red top ) 1 nos 219 219 glass slide 1 nos 220 220 conical flask ( 250 ml & 500 ml ) borosil 1 nos 221 221 test tubes ( 7 inches & 10 inches ) borosil 1 nos 222 222 electronic weighing machine 1 nos 223 223 measuring glass cylinder 500 ml borosil 1 nos 224 224 measuring glass beaker 50 ml, 100 ml & 500 ml borosil 1 nos 225 225 glass stirring rod 1 nos 226 226 test tube stand 48 hole plastic 1 nos 227 227 test tube stand 96 hole plastic 1 nos 228 228 periodic acid 100grm 1 nos 229 229 basic fuschin 1 nos 230 230 sodium metabisulphite 1 nos 231 231 hcl 1 nos 232 232 activated charcoal 1 nos 233 233 martius yellow 1 nos 234 234 phosphotungstic acid 1 nos 235 235 brilliant crystral scarlet 1 nos 236 236 glacial acetic acid 500gm 1 nos 237 237 acetic acid 1% 1 nos 238 238 1% aquaeous potassium ferrocyanide 500gm 1 nos 239 239 2% hcl 1 nos 240 240 0.5% neutral red 500ml 1 nos 241 241 silver nitrate 10% 1 nos 242 242 conc. ammonia 1 nos 243 243 3% sodium hydroxide 500gm 1 nos 244 244 1% potassium permanganate 500gm 1 nos 245 245 1% oxalic acid 500gm 1 nos 246 246 2.5 % iron alum 1 nos 247 247 0.2% gold chloride 1 gm 1 nos 248 248 5% sod. thiosulphate 1 nos 249 249 congo red 1 nos 250 250 carbol fuschin 1 nos 251 251 h2so4 5% 1 nos 252 252 h2s04 20% 1 nos 253 253 methylene blue ( aqueous ) 125ml 1 nos 254 254 giemsa stain 10x500ml 1 nos 255 255 leishman stain 500ml 1 nos 256 256 leishman powder 50gm 1 nos 257 257 retic stain 25ml 1 nos 258 258 pas stain ( ready to use ) pa 25gm schiff reagent 125ml 1 nos 259 259 sudan black kit 1 nos 260 260 ph meter / litmus papers ( basic and acidic ) 1 nos 261 261 cedar wood oil 100ml 1 nos 262 262 semen diluting fluid 100ml 1 nos 263 263 wbc diluting fluid 500ml 1 nos 264 264 csf diluting fluid 100ml 1 nos 265 265 microscope lens cleaner 100ml 1 nos 266 266 thymol crystal 100gm 1 nos 267 267 sodium citrate 500ml 1 nos 268 268 filter paper ( watmanns ) packet 1 nos 269 269 westergrens pippet tube 1 nos 270 270 wintrobe tube tube 1 nos 271 271 neubauer chamber 1 nos 272 272 sahlis hemoglobinometer set 5 1 nos 273 273 benedicts reagent 500ml 1 nos 274 274 microalbumin strips ( urine ) 100 strips per box 1 nos 275 275 esr card 10000 per card 1 nos 276 276 sulphosalicylic acid 500ml 1 nos 277 277 conc. acetic acid 500ml 1 nos 278 278 liquid ammonia 500ml 1 nos 279 279 potassium ferrocyanide 500gm 1 nos 280 280 conc. hcl 500ml 1 nos 281 281 heys sulphur sulphur sublimate powder 500gm 1 nos 282 282 sodium nitroprusside powder 1 nos 283 283 h202 1 nos 284 284 fouchets reagent 1 nos 285 285 benzidine solution 1 nos 286 286 barium chloride 1 nos 287 287 trichloroacetic acid 1 nos 288 288 ehrlich reagent 1 nos 289 289 chloroform 1 nos 290 290 sodium acetate 1 nos 291 291 butenol 1 nos 292 292 ferric chloride 1 nos 293 293 eosin niagresin 1 nos 294 294 tourniquet 1 nos 295 295 spinal needle 1 nos 296 296 wooden & plastic slide storage box 1 nos 297 297 puncture proof box 1 nos 298 298 glass marking pencil 1 nos 299 299 couplins jar 1 nos 300 300 picric acid 500gm 1 nos 301 301 citric acid 500gm 1 nos 302 302 esbachs albuminometer 1 nos 303 303 urine container 30ml 1 nos 304 304 urinometer 1 nos 305 305 pipettes 5 50ul tips – yellow 100 1000ul blue 20ul fix 1 nos 306 306 dextrose 500gm 1 nos 307 307 sodium nitrite 500gm 1 nos 308 308 methylene blue chloride 50gm 1 nos 309 309 anhydrous dipotassium hydrogen phosphate 500gm 1 nos 310 310 anhydrous potassium dihydrogen phosphate 500gm 1 nos 311 311 sodium dithionate 500gm 1 nos 312 312 saponin 100gm 1 nos 313 313 glass measuring beaker 50ml 1 nos 314 314 glass measuring beaker 100ml 1 nos 315 315 glass measuring beaker 500ml 1 nos 316 316 measuring cylinder 200ml 1 nos 317 317 glass stir rod 1 nos 318 318 carmine 100gm 1 nos 319 319 alcian blue 8gx 1 nos 320 320 acetic acid 3% solution 1 nos 321 321 aluminium sulphate al2 ( so4 ) 3.18h20 500gm 1 nos 322 322 oil red o 1 nos 323 323 p.t. vial 1x100 1 nos 324 324 k2 edta vial 1x100 1 nos 325 325 k3 edta vial 1x100 1 nos 326 326 c.k. prest test kit 1 nos 327 327 tissue paper roll 1 nos 328 328 pregnancy test kit 1 nos...

Dr. S.N.Medical College - Rajasthan

26660207 supply of reagent and chemicals for pathology. micropipette variable 50 micro ltr to 200, tincture iodine, vacutte holder with vacutte needles size / g4920, pas staining kit, muci carmine staining kit, msn staining kit, perls staining kit, mts staining kits, three one oil, boxes for block 16 ½ x 10 ½ x 2 ½, white cloth, antiseptic solution, ammonia solution, wbc diluting fluid for tlc, trbc fluid, test tube holder, test tube 10ml, match box, adhesive tape, spirit rectified, peroxide acid, cea, gfap, betazoid dab substrate buffer for cytocentrifuge, filter card for cytology ( funnel reusable ) , cell slides single circle coated, cell slides single circle uncoated, double cytology funnel ( reusable ) , ck 20, ttf 1, pax 8, cd 31, cd 34, cd 99, cd 57, fli 1, oxalic acid, aquous phenol, toluedene blue, silver nitrate, safferenine o, potassium alum, cryomatrix gel, tissue freezing chacks, mix preniere microtome blades, letheium corborate, sodium acetate....

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Dr. S.N.Medical College - Rajasthan

26654824 supply of reagents and chemicals for pathology 1 disposable syringes 5 ml x 2 disposable syringes 10 ml x 3 disposable syringes 20 ml x 4 disposable syringes 2 ml x 5 disposable vacutainer needles 24 gauge 6 disposable needles 22 gauge 7 urine container plastic with lid 30 ml 8 rubber tourniquate 9 urine strip 10 urine strip 4 parameter 11 multi parameter urine strips 12 stool occult blood kit 13 giemsa stain powder 14 methanol ch3 oh = 32.04 purity 15 distilled water 16 micro capillary tube (90mm length) 17 cover slip 1. 22 mm 18 cover slip 2. 22 x50 mm 19 cover slip 3. 22 x 22 mm 20 glass test tube 12 x 100 mm 21 pregnancy card 22 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 23 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 24 reticulocite fluid – brilliant cresyle blue 25 diamond pencill 26 micropipettes (50 mm) 27 micropipettes (100mm) 28 sodium hypochlorite 29 esr pipette disposable 30 dpx meuntant 31 spirit 32 rapid pap kit 33 iron stand for staining 34 slide tray (horizontal) 35 slide tray (vertical) 36 coplin jars 37 graduated cylinder small 200 ml 38 graduated cylinder large 500 ml 39 sample transport racks ( big plastic ) 40 sterile lancets for blood grouping 41 sharps containers with lid and lock 42 plastic funnel 10 cm diameter 43 hematoxylin stain powder 44 eosin powder 45 modified neubaur’s chamber 46 zn stain kit 47 bulbs halogen for microscope 6v 20 watts 48 filter paper full size nohi 49 formalin tablets 50 disposable bone marrow aspiration needle 18 gauge 51 disposable bone marrow aspiration needle 20 gauge 52 disposable spinal needle 22 gauge 53 betadin 54 eye towel 55 xylene 56 slide box plastic 57 slide box wooden 58 absolute alcohol 59 methyl alcohol 60 dustbin 61 coplin jar (glass) 62 3 amino propyl triethoxysilane 63 acetone 64 albumin egg flaskes 65 alcian blue 66 ammonium sulphate 67 bees wax 68 benedict solution ( reagent ) 69 brilliant cresyl blue stain powder 70 cassettes s.s.3cmx2.5cm 71 cd 45 kit (6ml) 72 chloroform 73 ck cocktail kit (6ml) 74 combistix 75 copper sulphate powder 76 dextrose anhydrous 77 diamino benzidine (dab) 78 disodium hydrogen phosphate (na2hpo4) 79 disposable plastic test tube 75x12 ml 80 disposable vial – 5ml 81 drabkin solution with hemoglobin standard 82 dropper plastic – 3ml 83 eosinophil diluting fluid 84 er diagnostic kit (6ml) 85 ferric ammonium sulphate 86 field stain a & b 87 fluoride vial for blood sugar 88 formaldehyde 37 40% 89 formic acid 90 french chalk powder 91 giemsa stain solution 92 glacial acetic acid 93 glass cover slip 18x18mm 94 glass pipette 20cm long 95 halogen bulb for mp qbc machine 96 hb a/c kit 97 glycerin a.r. 98 hemocytometer 99 her 2/niu kit (6ml) ( 6 ml x 4) 100 hydrochloric acid hct n/10 101 hydrogen peroxide (liquid 30%) 102 ketostix 103 knife sharpner powder 2000 micro abrasive powder 104 knife sharpner powder 3000 micro abrasive powder 105 lead oxide powder 106 leishmain stain powder 107 leishmain stain (liquid) solution 108 liquid ammonia 109 liquid paraffin 110 mal mal cloth 111 measuring cylinder 100 ml glass 112 measuring cylinder 250 ml 113 mercuric oxide 114 methyline blue solution 115 micropipette, auto pipette (a) 10 fix volume 116 micropipette, auto pipette (a) 100 fireed 10% 117 micropipette, auto pipette (a) 1000 fireed 10% 118 micropipette, auto pipette (a) 50 fireed volume 119 micropipette, auto pipette (multichannel) variable 50 300 micro ltr channel 8 or 12 120 micro slides 75x25x1.25 to 1.5 mm (glass) 121 microtome knife 120 mm 122 microtome knife 150 mm 123 micro ambrary 3000 micro gm 124 mp qbc oil 125 multistix 126 museum specimen glass jar with glass lid (7x3.5x5) 127 museum specimen glass jar with glass lid (6x3x10”) 128 museum specimen glass jar with glass lid (4x2x8”) 129 museum specimen glass jar with glass lid (6x4x10.5”) 130 museum specimen glass jar with glass lid (7.5x3.5x12”) 131 oil 3 : 1 132 paraffin wax 60 62’ with ceresin 133 pasteur pipette 134 picric acid 135 phenyl solution 136 pipettes for hemoglobin 20 micro ltr. 137 plain vial 5ml 138 plain vial screw cap 3 ml with sticker 139 plastic beaker 100 ml 140 plastic casettes 141 plastic beaker 200 ml 142 plastic cuvettes with stirrer for coagulation analyzer model coastat 1 fibran 20 143 plastic cuvettes with stirrer for coagulation analyzer model fibran 20 144 plastic test tube screw cap with sticker 145 platelet diluting fluid 146 poly – l – lysine 147 polymer hrp kit 148 potassium alum 149 potassium ferrocyanide 150 pr diagnostic kit (6ml) 151 prussian blue stain 152 rbc diluting fluid 153 rbc pipettes 154 schiff’s reagent 155 semen diluting fluid 156 silver nitrate 157 sodium nitrate 158 sodium chloride 159 sodium citrate powder 160 sodium citrate 3.8% 161 blood collection vacutech with 1.8 ml marking for coagulation analyser 162 sodium nitroprusside 163 sodium thiosulphate 164 spirit lamp aluminium 165 staining jar (glass) 13x11x7 cm 166 staining jars 100ml & 500 ml 167 sulphur powder / sulphur precipitate 168 sulphuric acid 169 test tube brushes for cleaning tubes small 170 test tube brushes for cleaning tubes large 171 test tube graduated conical 15 ml 172 thermal printer paper 173 thermometer 174 thymol 175 tips blue (1000) for micropipette 176 urea 177 wbc diluting fluid 178 wbc pipette 179 cell clean/ equivalent 50 ml for sysmex xs 800i 180 antiseptic solution 181 coated slides 182 filter paper round 183 formaline 184 glass test tubes 4” 185 hematoxylene powder 186 metallic slide holders 187 micropipette 10 200ml 188 micropipette 100 1000ml 189 micropipette variable 50 micro ltr to 200 190 tincture iodine 191 vacutte holder with vacutte needles size/ g4920 192 pas staining kit 193 muci carmine staining kit 194 msn staining kit 195 perls staining kit 196 mts staining kits 197 three one oil 198 boxes for block 16 ½ x 10 ½ x 2 ½ 199 white cloth 200 antiseptic solution 201 ammonia solution 202 wbc diluting fluid for tlc 203 trbc fluid 204 test tube holder 205 test tube 10ml 206 match box 207 adhesive tape 208 spirit rectified 209 peroxide acid 210 cea 211 gfap 212 hmb45 213 desmin 214 ema 215 bcl2 216 hmwck 217 ck7 218 er 219 cd 13 220 cd 5 221 cd 23 222 ck 20 223 ki 67 224 cd 10 225 synaptophysin 226 pr 227 mpo 228 pax 5 229 cd 3 230 wt 1 231 s 100 232 ae 1/ae3 233 sma 234 inhibin 235 hpv 236 p16 237 eber 238 lmp 1 239 c4d 240 amyloid 241 her2 neu 242 vimentin 243 chromogranin for manual ihc staining 244 antigen retrieval buffer diva decloaker 20x 245 background snipper 246 wash buffer tbs autowash buffer 40x 247 mach2 hrp polymer detection kit 248 polylysine coated slides 249 peroxidated block 1 250 betazoid dab chromogen 251 betazoid dab substrate buffer for cytocentrifuge 252 filter card for cytology (funnel reusable) 253 cell slides single circle coated 254 cell slides single circle uncoated 255 double cytology funnel (reusable) 256 ck 20 257 ttf 1 258 pax 8 259 cd 31 260 cd 34 261 cd 99 262 cd 57 263 fli 1 264 cd 15 265 cd 22 266 cd 30 267 cd 57 268 cd 5 269 cd 7 270 cd 79 a 271 cd 163 272 cd 68 273 cd 56 274 nsf 275 ca 125 276 ck 7 277 cdx 2 278 kappa 279 lambda 280 cell clip for cell clipotor 281 single cytology funnel (for cryostat) 282 cryomatrix (optimal cooling tool gel coolant) 283 sarasil disinfectant 284 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 285 lyser cell(wnr) 286 fluorocell (ret) 287 fluorcell plt (plt) 288 basic fucshin 289 sodium metabisulfite 290 acetic acid solution 3 % 291 nuclear fast red 292 carmine 293 ferric chloride 294 metanil yellow 295 acid fucshine 296 phospho molybdic acid 297 methyl blue 298 iodine 299 potassium permanganate 300 potassium metabisulfite 301 iron alum 302 gold chloride 303 oxalic acid 304 aquous phenol 305 toluedene blue 306 silver nitrate 307 safferenine o 308 potassium alum 309 cryomatrix gel 310 tissue freezing chacks 311 mix preniere microtome blades 312 letheium corborate 313 sodium acetate ...

Medical College - Rajasthan

24948880 supply of consumable reagents and chemical for pathology item no 03 1. disposable syringes 5 ml x 2. disposable syringes 10 ml x 3. disposable syringes 20 ml x 4. disposable syringes 2 ml x 5. disposable vacutainer needles 24 gauge 6. disposable needles 22 gauge 7. urine container plastic with lid 30 ml 8. rubber tourniquate 9. urine strip 10.. urine strip 4 parameter 11. multi parameter urine strips 12. stool occult blood kit 13. giemsa stain powder 14. methanol ch3 oh = 32.04 purity 15. distilled water 16. micro capillary tube (90mm length 17. cover slip 1. 22 mm 18. cover slip 2. 22 x50 mm 19. cover slip 3. 22 x 22 mm 20. glass test tube 12 x 100 mm 21. pregnancy card 22. paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 23. paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 24. reticulocite fluid brilliant cresyle blue 25. diamond pencill 26. micropipettes (50 mm) 27. micropipettes (100mm) 28. sodium hypochlorite 29. esr pipette disposable 30. dpx meuntant 31. spirit 32. rapid pap kit 33. iron stand for staining 34. slide tray (horizontal) 35. slide tray (vertical) 36. coplin jars 37. graduated cylinder small 200 ml 38. graduated cylinder large 500 ml 39. sample transport racks ( big plastic ) 40. sterile lancets for blood grouping 41. sharps containers with lid and lock 42. plastic funnel 10 cm diameter 43. hematoxylin stain powder 44. eosin powder 45. modified neubaurs chamber 46. zn stain kit 47. bulbs halogen for microscope 6v 20 watts 48. filter paper full size nohl 49. formalin tablets 50. disposable bone marrow aspiration needle 18 gauge 51. disposable bone marrow aspiration needle 20 gauge 52. disposable spinal needle 22 gauge 53. betadin 54. eye towel 55. xylene 56. slide box plastic 57. slide box wooden 58. absolute alcohol 59. methyl alcohol 60. dustbin 61. coplin jar (glass) 62. 3 amino propyl triethoxysilane 63. acetone 64. albumin egg flaskes 65. alcian blue 66. ammonium sulphate 67. bees wax 68. benedict solution ( reagent ) 69. brilliant cresyl blue stain powder 70. cassettes s.s.3cmx2.scm 71. cd 45 kit (6ml) 72. chloroform 73. ck cocktail kit (6m1) 74. combistix 75. copper sulphate powder 76. dextrose anhydrous 77. diamino benzidine (dab) 78. disodium hydrogen phosphate (na2hpo4) 79. disposable plastic test tube 75x12 ml 80. disposable vial 5m1 81. drabkin solution with hemoglobin standard 82. dropper plastic 3m1 83. eosinophil diluting fluid 84. er diagnostic kit (6m1) 85. ferric ammonium sulphate 86. field stain a & b 87. fluoride vial for blood sugar 88. formaldehyde 37 40% 89. formic acid 90. french chalk powder 91. giemsa stain solution 92. glacial acetic acid 93. glass cover slip 18x18mm 94. glass pipette 20cm long 95. halogen bulb for mp qbc machine 96. hb a/c kit 97. glycerin a.r. 98. hemocytometer 99. her 2/niu kit (6m1) ( 6 ml x 4) 100. hydrochloric acid hct n/10 101. hydrogen peroxide (liquid 30%) 102. ketostix 103. knife sharpner powder 2000 micro abrasive powder 104. knife sharpner powder 3000 micro abrasive powder 105. lead oxide powder 106. leishmain stain powder 107. leishmain stain (liquid) solution 108. liquid ammonia 109. liquid paraffin 110. mal mal cloth 111. measuring cylinder 100 ml glass 112. measuring cylinder 250 ml 113. mercuric oxide 114. methyline blue solution 115. micropipette, auto pipette (a) 10 fix volume 116. micropipette, auto pipette (a) 100 fireed 10% 117. micropipette, auto pipette (a) 1000 fireed 10% 118. micropipette, auto pipette (a) 50 fireed volume 119. micropipette, auto pipette (multichannel) variable 50 300 micro ltr channel 8 or 12 120. micro slides 75x25x1.25 to 1.5 mm (glass) 121. microtome knife 120 mm 122. microtome knife 150 mm 123. micro ambrary 3000 micro gm 124. mp qbc oil 125. multistix 126. museum specimen glass jar with glass lid (7x3.5x5) 127. museum specimen glass jar with glass lid (6x3x10) 128. museum specimen glass jar with glass lid (4x2x8) 129. museum specimen glass jar with glass lid (6x4x10.5) 130. museum specimen glass jar with glass lid (7.5x3.5x12) 131. oil 3 : 1 132. paraffin wax 60 62 with ceresin 133. pasteur pipette 134. picric acid 135. phenyl solution 136. pipettes for hemoglobin 20 micro ltr. 137. plain vial 5m1 138. plain vial screw cap 3 ml with sticker 139. plastic beaker 100 ml 140. plastic casettes 141. plastic beaker 200 ml 142. plastic cuvettes with stirrer for coagu!ation analyzer model coastat 1 fibran 20 143. plastic cuvettes with stirrer for coagulation analyzer model fibran 20 144. plastic test tube screw cap with sticker 145. platelet diluting fluid 146. poly l lysine 147. polymer hrp kit 148. potassium alum 149. potassium ferrocyanide 150. pr diagnostic kit (6m1) 151. prussian blue stain 152. rbc diluting fluid 153. rbc pipettes 154. schiffs reagent 155. semen diluting fluid 156. silver nitrate 157. sodium nitrate 158. sodium chloride 159. sodium citrate powder 160. sodium citrate 3.8% 161. blood collection vacutech with 1.8 ml marking for coagulation analyser 162. sodium nitroprusside 163. sodium thiosulphate 164. spirit lamp aluminium 165. staining jar (glass) 13x11x7 cm 166. staining jars 100m1 & 500 ml 167. sulphur powder / sulphur precipitate 168. sulphuric acid 169. test tube brushes for cleaning tubes small 170. test tube brushes for cleaning tubes large 171. test tube graduated conical 15 ml 172. thermal printer paper 173. thermometer 174. thymol 175. tips blue (1000) for micropipette 176. urea 177. wbc diluting fluid 178. wbc pipette blood cell counter reagents suit 179. cell clean/ equivalent 50 ml for sysmex xs 800i 180. antiseptic solution 181. coated slides 182. filter paper round 183. formaline 184. glass test tubes 4 185. hematoxylene powder 186. metallic slide holders 187. micropipette 10 200m1 188. micropipette 100 1000m1 189. micropipette variable 50 micro kr to 200 190. tincture iodine 191. vacutte holder with vacutte needles size/ g4920 192. pas staining kit 193. muci carmine staining kit 194. msn staining kit 195. perls staining kit 196. mts staining kits 197. three one oil 198. boxes for block 161/2x 10y2 x 2 1/2 199. white cloth 200. antiseptic solution 201. ammonia solution 202. wbc diluting fluid for tlc 203. trbc fluid 204. test tube holder 205. test tube 10m1 206. match box 207. adhesive tape 208. spirit rectified 209. peroxide acid 210. bond tm wash solution 10x 211. bond tm epitope retrival 2 212. bond tm epitope retrival 1 213. bond dewax solution 214. bond aspirating probe cleaning kit 215. bond polymer refine detection 216. bond open container 7m1 217. leica universal label 3000/pk 218. bond mixing stations 219. bond universal cover tiles 220. microsystem plus slide for inc 1.0mm) ( 25.5 x 75.5 x 221. slide label & printer ribbon 222. cea 223. gfap 224. hmb45 225. desmin 226. ema 227. bcl2 228. hmwck 229. ck7 230. er 231. cd 13 232. cd 5 233. cd 23 234. ck 20 235. ki 67 236. cd 10 237. synaptophysin 238. pr 239. mpo 240. pax 5 241. cd 3 242. wt 1 243. s 100 244. ae 1/ae3 245. sma 246. inhibin 247. hpv 248. p16 249. eber 250. lmp 1 251. c4d 252. amyloid 253. her2 neu 254. vimentin 255. chromogranin for manual ihc staining 256. antigen retrieval buffer diva decloaker 20x 257. background snipper 258. wash buffer tbs autowash buffer 40x 259. mach2 hrp polymer detection kit 260. polylysine coated slides 261. peroxidated block 1 262. betazoid dab chromogen 263. betazoid dab substrate buffer for cytocentrifuge 264. filter card for cytology (funnel reusable) 265. cell slides single circle coated 266. cell slides single circle uncoated 267. double cytology funnel (reusable) 268. cell clip for cell clipotor 269. single cytology funnel (for cryostat) 270. cryomatrix (optimal cooling tool gel coolant) 271. sarasil disinfectant 272. microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 273. lyser cell(wnr) 274. fluorocell (ret) 275. fluorcell plt (plt) 276. basic fucshin 277. sodium metabisulfite 278. acetic acid solution 3 % 279. nuclear fast red 280. carmine 281. ferric chloride 282. metanil yellow 283. acid fucshine 284. phospho molybdic acid 285. methyl blue 286. iodine 287. potassium permanganate 288. potassium metabisulfite 289. iron alum 290. gold chloride 291. oxalic acid 292. aquous phenol 293. toluedene blue 294. silver nitrate 295. safferenine 0 ...

Rajasthan University Of Health Science - Rajasthan

24680655 supply of reagent & consumable for pathology laboratory in govt. r.d.b.p. jaipuria hospital ruhs medical college jaipur 2 anti a ( sera ) 3 anti b ( sera ) 4 anti d ( sera ) 5 sodium metabisulfite 6 capillary tubes 7 sprit ( surgical ) 8 g6pd kit ( 12 test ) 9 ocult blood kit 10 coombs anti sera 11 cover slip ( 18x18mm ) 12 disposable needles ( 24 guage ) 13 disposable needles ( 22 guage ) 14 disposable sterile urine container 15 esr disposable pipette 16 glass marker pencil 17 jsb stain i 18 jsb stain ii 19 ketone strips 20 lancets 21 leishmans stain 22 micro glass slides 23 microscope bulb 24 n / 10 hcl 25 cedar wood oil 26 permanent marker thin ( black ) 27 rapid h & e 28 reticulocyte fluid 29 semen diluting fluid 30 sodium citrate 3.2% 31 sodium citrate 3.8% 32 thermal paper ( 110 mm ) 33 thermal paper ( 80 mm ) 34 thermal paper ( 57 mm ) 35 small test tube plastic 36 small test tube glass 37 tips ( 100 1000μ l ) ( blue ) 38 tips ( 10 200μ l ) ( yellow ) 39 tissue paper roll 40 tourniquate ( cloth ) 41 urine multi strips 42 urine strips for alb / sug 43 vacutainer edta vial 44 vacutainer sodium citrate 3.2 % vial 45 wbc diluting fluid 46 new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area 47 giemsa stain liquid 48 carbol fuchsin 49 cover slip ( 22x50 ) 50 diamond pencil 51 distilled water 52 dpx mount 53 ethanol 54 filter paper 460x570 mm 55 methanol 56 normal saline 57 papanicolou ready to use kit 58 hematoxiline powder 59 glacial acetic acid 60 aluminium potassium sulphate dodecahydrate 61 sodium lodate 62 potassium ferrocyanide 63 myloproxidase 64 disposable syringes 2ml 65 disposable syringes 5ml 66 disposable syringes 10ml 67 disposable syringes 20ml 68 cotton roll 69 petridish disposable 70 hand senitizer 71 dlc counter ( 8 diffrential min ) 72 acetic acid 73 acetone 74 acid fuchsin 75 acid periodic 76 activated charcoal 77 alcian blue 78 aluminium chloride 79 aluminium hydroxide 80 ammonium solution ( liquid ammonia ) 81 aniline blue 82 basic fuchsin 83 benzidine powder 84 biebrich scarlet 85 brilliant cresyl blue 86 carmine powder 87 celestine blue 88 chloral hydrate 89 citric acid 90 concentrated hcl 91 congo red 92 egg albumin flake 93 eosin yellow stain powder 94 ferric ammonium sulphate ( ammonium iron sulphate ) 95 ferric chloride 96 formalin ( formaldehyde 37 40 % ) 97 glycerin 98 glycerol 99 gold chloride 100 haematoxyline crystal 101 hydrochloric acid ar 102 hydrogen peroxide 103 light green 104 malt diastase 105 mercuric oxide 106 metanil yellow 107 methylene blue 108 microtome blade ( low profile ) 109 mercuric chloride 110 neutral red 111 nitric acid 112 nuclear fast red 113 numbering paper 114 oxalic acid 115 paraffin wax with ( ceresin 60 62 c ) 116 peanut oil 117 phenol 118 phosphomolybdic acid 119 phosphotungstic acid 120 picric acid 121 plastic ring for block ( white ) 122 potassium dichromte 123 potassium hydroxide 124 potassium metabisulphite 125 potassium permagnate 126 propanolol 127 readymade giemsa stain 128 rosaniline dye ( for shiff reagent ) 129 silver nitrate 130 sodium nitropruside 131 sodium hydroxide 132 sodium sulphate 133 sodium thiosulphate 134 sudan black b 135 sulfurous acid 136 tetrazolium chlorlde 137 toludine blue 138 xylene 139 rapid pap stain kit 140 disposable gloves sterile 141 disposable gloves un sterile 142 non specihe esterase kit 143 bovine albumin 22%...

Indian Army - Rajasthan

24291663 9024/ms/dglp/re/br 04/2020 21 ( lab ) procurement of drugs and consumables , wbc diluting fluid ( 500ml ) , gram stain ( 4x125ml ) , rapid pap stain/ ( ultra pap ) , haematoxyllin ( harris ) stain ( 1x500ml ) , michrom mueller hinton agar ( 500gm ) , michrom cled agar with bromothymol blue ( 500gm ) , michrom urea agar base 500 gm , michrom blood agar base ( 500gm ) , michrom macconkey broth ( 500gm ) , straight wire ( nicrome ) la 022 ( 5x5 ) , acetone ( 2 . 5 ltr ) , whatsman filter paper ( 1001 090 ) qualitative ( 9cm diameter ) , absolute alcohol ( 500ml ) , chloroform ( 2 . 5 ltr ) , xylene ( 2 . 5 ltr ) , wax ( for tissue embedding ) , formaldehyde ( 5ltr ) , rapid malaria test kit ( pan/pf antigen ) 50 test , g6pd ( 12 test ) , auto zero disposable esr pipette ( 1x100 ) , haemtest ( occult blood ) , ketodio stix ( 1x100 strips ) , uristic with specefic gravity ( 1x100 strips ) , dpx ( 500ml ) , glycerin ( 500ml ) , tisse tek embedding rings plastic ( 1x500 ) , uniplastin ( 1x5ml ) , tisse tek processing cassette plastic cat no . ( 1x500 ) , vaccutainer sterile gel 3 ml with needle ( fda approved ) , vaccutainer edta 3 ml with needle ( fda approved ) , vaccutainer sodium citrate 3 ml with needle ( fda approved ) , vaccutainer sodium fluoride 3 ml with needle ( fda approved ) , sterile urine container ( 1x100 ) , e check ( sysmex control ) l 1 , l 2 , l 3 , colourcult tm aerobic culture vail 30ml , colourcult tm pediatric culture vail 30ml , cell pack ( pack of 20 ltr ) , stromatolyser ( 1x500ml ) , ada , 1x18ml/1x10ml system pack , hi profile microtome blade , hemostar cuvette stirer ( 1x100 ) , blue star cover slip glass ( 22x50mm ) , lypocheck assaed chemistry control l1 ( 12 . 5 ) biorad , lypocheck assaed chemistry control l2 ( 12 . 5 ) biorad , lypocheck dibetic control assay , biorad immunoassay plus control l , l2 , l3 , cell clean , hiv rapid tridot , hbsag rapid hepacard , anti hcv rapid tridot , vdrl rpr , blood bag double , crp kit ( 25test ) , ra kit ( 100test ) , aso , hiv elisa 96 tests 4th gen , hbsag elisa 96 tests , anti hcv elisa kit 96 test , lancet packet of 100 pcs , trop t kit ( pkt of 5 ) , anti human globulin 10 ml , lishman stain with buffer 500 ml , petridish 480 plates , pm kit 9180 electrolyte analyser , snap pack for 9180 electrolyte analyser , de protineser 9180 electrolyte analyser , roch clener , pas stain , prega news hcg test ( 1x50 ) , dengu igm elisa kit , micro pipette fixed volium 1000ul expendable , micro pipette fixed volium 500ul expendable , dengu ns1 antigen , ph indicator ( 50 strips ) , microscopic slide bluestar ( pkt of 50 ) , litmus papper ( 25x1 ) , filter papper 100 peces , anti ccp elisa , syphecktpha rapid card 25 test , mpo stain ...

Sms Medical College - Rajasthan

22903376 disposable and glassware items micro cover slip smooth edges made of transparent glass, glass slides with ground edges one end frosted glass slide, surgical blade should have sharp cutting eduge, disposable gloves rubber, haematocytometer cover slip, lens cleaning paper, filter paper sheets, disposable microtome blade low profile ce certified ivd approved suitable for leica microtome sample, beaker borosil glass, wash bottle made of ldpe plastic with delivery tube, coupling jar 10 slides plastic with cap, borosciicate test tubes glass, test tube plastic, staining glass rod, wbc pipette, rbc pipette, hb pipette, flasks graduated borosil, flat bottom capacity engraved on the flasks, spirit lamp glass, albunometer complete set, urinometer complete set, glass marking pencil, hb pencil, disposable gown, neubaur couting chamber, disposable plastic cassette with lids, yellow colour for tissue processing, sample required for approval, aluminium tray for slides, disposable face mask, index card, measuring cylinder, slide staining hangers, edta evacuated blood collection tube with spray dried k2 edta with lavender hemogard, test tube plastic with cap, glass putty, silicon jelly gun, test tube holder, disposable plastic dropper, plastic test tube stand, dropping bottle plastic cap, wintrobes tube, dustbin plasstic yellow cap with wheels, reagent bottles borosil, rectangular museum jar with cover made of borosiicate, filter paper disposable for cytotek, brain knife ss, scissor ss, forceps artery ss, forceps for cutting, scalpesh blade holder, micropipettes, moisture chamber, water bath for pathology (nit 111) ...

Medical College - Rajasthan

22883315 rate contract for disposable and glassware items for pathology 1 micro cover slip 22x50 mm no. 0 smooth edges made of transparent glass 2 glass slides; size 76x26x1.35 mm with ground edges one end frosted glass slide isi marked , sample required for approval. 3 surgical blade no. 22, 23, 24 should have sharp cutting edge 4 disposable gloves – rubble size 6 sterile surgical gloves, latex sterile surgical gloves made of latex gloves should be according to the specifications of bis ( bureau of indian standards ) . n it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue.   roughened surface on grip area.  size embossed for easy identification.  thinner wall at finger tips for better sensitivity. 5 disposable gloves – rubble size 6.5 nsterile surgical gloves, latex nsterile surgical gloves made of latex ngloves should be according to the specifications of bis ( bureau of indian standards ) . n it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. ncurved finger. sample required for approval. n 6 disposable gloves – rubber size 7 nsterile surgical gloves, latex nsterile surgical gloves made of latex n gloves should be according to the specifications of bis ( bureau of indian standards ) . nit should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger, sample required for approval. n 7 disposable gloves – rubber size 7.5 nsterile surgical gloves, latex nsterile surgical gloves made of latex n gloves should be according to the specifications of bis ( bureau of indian standards ) . n it should fit in anatomic shape of hand for relaxed fit and prevention of fatigue. roughened surface on grip area. size embossed for easy identification. thinner wall at finger tips for better sensitivity. curved finger, sample required for approval. n 8 haematocytometer cover slip 9 lens cleaning paper 10 filter paper no. ‘0’ 17”x27” sheets 11 disposable microtome blade low profile, ce certified ivd approved suitable for leica microtome, sample for approval is must. 12 beaker borosil glass 500 ml 13 beaker borosil glass 250 ml 14 beaker borosil glass 100 ml 15 wash bottle made of ldpe plastic with delivery tube. it should be made of chemically resistant low density polyethylene, flexible with screw cap ( 500 ml ) 16 coupling jar 10 slides plastic with cap 17 borosilicate test tubes glass 10 ml n ( 1x100 ) 18 test tube plastic 5 ml 19 staining glass rod ( 2.5 feet in length, 0.5 to 1 cm in circumference ) 20 wbc pipette 21 rbc pipette 22 hb pipette 23 hb tubes 24 flasks graduated 1ltr ( 1000 ml ) borosil, flat bottom. capacity engraved on the flasks 25 flasks graduated 500 ml borosil, flat bottom. capacity engraved on the flasks 26 spirit lamp glass 27 albunometer complete set ( esbach’s albumino’s ) 28 urinometer complete set 29 glass marking pencil ( red ) 30 hb pencil 31 disposable gown for autopsy and histopathology ( 1x100 ) 32 neubaur counting chamber ( bright ) 33 disposable plastic cassette with lids, yellow colour for tissue processing, sample required for approval. ( small biopsy ) 34 disposable plastic cassette with lids, white / off white colour for tissue processing, sample required for approval. ( surgical and autopsy ) 35 disposable plastic cassette with lids, blue colour for tissue processing, sample required for approval. ( gynae biopsies ) 36 aluminum tray for slides 37 index card 38 disposable face mask isi mark 39 measuring cylinder 25 ml 40 measuring cylinder 100 ml 41 measuring cylinder 500 ml 42 measuring cylinder 1000 ml 43 slide staining hangers for 25 30 slides 44 edta evacuated blood collection ( plastic ) tube with spray dried k2 edta with lavender hemogard. it should be made for clear latex free polyethylene terephthalate. 13mm x 75mm with 4.0 ml volume. nbatch wise sterility / pyrrogenicity / toxicity certificate should be given. nadequate combustion data to prove that it is safe for the environment upon incineration. it should be us fda certified. firm should provide training to the technicians / nurses regularly. clinical services should be documented by the company. ( 1x100 ) 45 test tube plastic with cap 10.5 cm x 1.1 cm 46 test tube plastic with cap 7 cm x 1 cm 47 glass putty 48 silicon jelly gun 49 test tube holder 50 funnel plastic 2” 51 disposable plastic dropper 2 ml 52 disposable plastic dropper 5 ml 53 plastic test tube stand of 12 holes big 54 dropping bottle plastic cap 125 ml 55 wintrobe’s tube 56 funnel plastic 4” 57 dustbin plastic yellow cap 100 kg with wheels for bmw 58 dustbin plastic red cap 100 kg with wheels for bmw 59 dustbin plastic yellow cap 50 kg with wheels for bmw 60 dustbin plastic blue cap 50 kg with wheels for bmw 61 dustbin plastic red cap 50 kg with wheels for bmw 62 dustbin plastic black cap 50 kg with wheels for bmw 63 reagent bottles borosil cap 250 ml 64 rectangular museum jar with cover made of borosilicate glass with coverslip n ( 200x125x125 mm ) 65 rectangular museum jar with cover made of borosilicate glass with coverslip n ( 360x150x100 mm ) 66 rectangular museum jar with cover made of borosilicate glass with coverslip n ( 220x195x80 mm ) 67 filter paper disposable for cytotek 68 brain knife s.s. 69 brain knife s.s. 70 scissor ss 71 scissor ss 72 forceps artery ss 73 forceps artery ss 74 forceps for cutting 75 forceps ordinary 76 scalpel blade holder 77 scalpel blade holder 78 micropipettes 79 micropipettes 80 moisture chamber for 25 30 slides 81 water bath...

Indian Army - Rajasthan

22584260 procurement of drugs and consumables for hospital lab: 1 wbc diluting fluid ( 500ml ) 2 gram stain ( 4x125ml ) 3 rapid pap stain / ( ultra pap ) 4 haematoxyllin ( harris ) stain ( 1x500ml ) 5 mueller hinton agar ( 500gm ) 6 cled agar with bromothymol blue ( 500gm ) 7 urea agar base 500 gm 8 blood agar base ( 500gm ) 9 macconkey broth ( 500gm ) 10 straight wire ( nicrome ) la 022 ( 5x5 ) 11 acetone ( 2.5 ltr ) 12 whatsman filter paper ( 1001 090 ) qualitative ( 9cm diameter ) 13 absolute alcohol ( 500ml ) 14 chloroform ( 2.5 ltr ) 15 xylene ( 2.5 ltr ) 16 wax ( for tissue embedding ) 17 formaldehyde ( 5ltr ) 18 rapid malaria test kit ( pan / pf antigen ) 50 test 19 g6pd ( 12 test ) 20 citratr agar 500 gm 21 auto zero disposable esr pipette ( 1x100 ) 22 haemtest ( occult blood ) 23 ketodio stix ( 1x100 strips ) 24 uristic ( 1x100 strips ) 25 dpx ( 500ml ) 26 glycerin ( 500ml ) 27 tisse tek embedding rings plastic ( 1x500 ) 28 prothrombin time reagents ( 1x5ml ) 29 tisse tek processing cassette plastic cat no. ( 1x500 ) 30 vaccutainer sterile gel 3 ml with needle ( fda approved ) 31 vaccutainer edta 3 ml with needle ( fda approved ) 32 vaccutainer sodium citrate 3 ml with needle ( fda approved ) 33 vaccutainer sodium fluoride 3 ml with needle ( fda approved ) 34 sterile urine container ( 1x100 ) 35 micropro ast susceptibility test panel kit –gn 1 ( 20 test ) 36 micropro ast susceptibility test panel kit –gn ( 20 test ) 37 5% hypochlorite 38 e check ( sysmex control ) l 1, l 2, l 3 39 bhi ( adult ) colorcult 50 ml 40 bhi ( paed ) colorcult 20ml 41 cell pack ( pack of 20 ltr ) 42 stromatolyser ( 1x500ml ) 43 cholesterol ( 10x44ml ) system pack 44 uric acid ( r1 5x44ml / r2 5x11ml ) system pack 45 triglyceride ( r1 5x44ml / r2 5x11ml ) system pack 46 sgot hl ( 4x34ml / 4x17ml ) system pack 47 ada, 1x18ml / 1x10ml 48 hi profile microtome blade 49 hemostar cuvette stirer ( 1x100 ) 50 cover slip glass ( 22x50mm ) 51 lypocheck assaed chemistry control l1 ( 12.5 ) biorad 52 lypocheck assaed chemistry control l2 ( 12.5 ) biorad 53 lypocheck dibetic control assay 54 biorad immunoassay plus control l, l2, l3 55 cell clean 56 hiv rapid tridot 57 hbsag rapid hepacard 58 anti hcv rapid tridot 59 vdrl rpr 60 blood bag double 61 crp kit ( 25test ) 62 ra kit ( 100test ) 63 aso 64 anti sera anti a, 10 ml vial 65 anti sera anti b, 10 ml vial 66 anti sera anti ab, 10 ml vial 67 anti sera anti d ( igm+igg ) 10 ml vial 68 anti sera weak anti d ( igg ) monoclonal, 10 ml 69 anti h lactin, 05 ml vial 70 hiv elisa 96 tests 4th gen 71 hbsag elisa 96 tests 72 anti hcv elisa kit 96 test 73 lancet packet of 100 pcs 74 trop t kit ( pkt of 5 ) 75 anti human globulin 10 ml 76 anti a1 anti sera 77 sterile gloves size 6.5 ( powder free ) , 0.24 mm thick with isi mark 78 sterile gloves sizes 7 ( powder free ) , 0.24mm thick with isi mark 79 sterile gloves size 7.5 ( powder free ) , 0.24mm thick with isi mark 80 sterile gloves size 8, powder free, 0.24mm thick with isi mark 81 sterile gloves size 6.5, 0.24 mm thick with isi mark 82 sterile gloves sizes 7 , 0.24 mm thick with isi mark 83 sterile gloves size 7.5 , 0.24 mm thick with isi mark 84 sterile gloves size 8, 0.24mm thick with isi mark...

Indian Army - Rajasthan

21969905 supply of lab consumables and reagents: 1 alkaline phosphate ( 2x44 / 2x11ml ) 2 lipase ( 1x44 / 1x11 ml ) 3 albumin ( 10x44 ml ) 4 amylase ( 5x22 ml ) 5 bilirubin direct ( 6x 44 / 3x22 ml ) 6 total bilirubin ( 6x44 / 3x22 ml ) 7 calcium ( 10x12 ml ) 8 cholestrol ( 10x44 ml ) 9 creatinine ( 5x44 / 5x11ml ) 10 glucose ( 10x44 ml ) 11 hdl cholestrol ( 4x30 / 4x10 ml ) 12 ldl cholestrol; ( 2x30 / 2x10 ml ) 13 total protein ( 10x44 ml ) 14 triglycerides ( 5x44 / 5x11 ml ) 15 urea ( 5x44 / 5x11 ml ) 16 uric acid ( 5x44 / 5x11 ml ) 17 ggt ( 2x44 / 2x11 ml ) 18 erba norm ( 1x5 ml ) 19 erba path ( 1x5 ml ) 20 erba xl multical ( 4x3 ml ) 21 cuvette for em 360 22 ckmb ( 2x44 / 2x11 ml ) 23 cknac ( 2x44 / 2x11 ml ) 24 ldh ( 2x44 / 2x11 ml ) 25 phosphorous ( 10x12 ml ) 26 micro protein ( 10x12 ml ) 27 sgpt ( 6x44 / 3x22 ml ) 28 sgot ( 6x44 / 3x22 ml ) 29 crp quantitative test ( 2x22 / 1x11 ml ) 30 ra factor quantitative test ( 1x11 / 1x5.5 ml ) 31 cell pack solution ( 20 liter ) 32 cell cleaner solution ( 50 ml ) 33 wbc / hgb lysed reagent ( stromatolyser ) 500 ml compatible with sysmax 34 control ( 1x3 ) for compatible with sysmax kx 21 35 snap pack 36 vaccum blood collection tubes edta 3 ml 37 vaccum blood collection tubes sterile tube with gel 5 ml 38 vacutainer buffred sodium citrate ( 1:9 ) 39 vaccum blood collection tubes flouride / sodium flourideflouride + k3 edta in tubes of vol 2 ml 40 vaccum blood collection tube with needle heparin 3 ml 41 whatman filter paper no 1 ( pkts ) 42 whatman filter paper no 4 ( pkts ) 43 absolute alcohol bott of 1 ltr 44 parafin wax with ceresin 45 xylene pure 46 glycerine bott of 500 ml 47 reticulin stain ( 100 test ) 48 schiffs fuchin sulphate reagent 500 ml 49 periodic acid solution ( pas ) 500 ml 50 phenols red indicator ( 125 ml ) 51 plastic container for routine urine sample 52 sterile urine container ( single pack ) 53 afb stain kit ( 3x125 ml ) 54 gram stain kit ( 4x 100 ml ) 55 hydrogen peroxide 500 ml 56 sulphuric acid 500 ml 57 printer paper 110 mm 58 leishaman powder 25 mg 59 micro tips ( 5 200ul ) 60 tissue paper roll 61 glucose pluv ( 1kg ) 62 disposable microtome blade ( art no 2840700 pkt of 50 blade 63 diamond glass marker 64 malaria antigen paracheck card 65 sterile swab sticks 66 disposable lancet pkt of 200 67 hiv rapid test 68 hbsag rapid test 69 hcv rapid test 70 anti a bott of 5 ml 71 anti b bott of 10 ml 72 anti ab bott of 10 ml 73 anti d ( igm+lgg ) monoconal 10 ml 74 ahg 5 ml 75 hcv elisa 96 test 76 hbsag elisa 96 test / kit 77 hiv elisa 96 test kit 78 vdrl 79 double blood bag 80 micro pipette ( 200 1000ul ) 81 micro pipette ( 50 200ul ) 82 micro pipette ( 5 50ul ) 83 tmppd 84 spirit 85 liquid paraffin 86 bact / alert blood culture infants compatible with bact system 87 bact / alert 3d blood culture adults ( aerobic ) compatible with bact system 88 bact / alert 3d blood culture adults ( anaerobic ) compatible with bact system 89 sodium conditioner ( 125 ml ) 90 deproteinizer ( 125 ml ) 91 petridishes disposable pack of 500 92 prothrombin time kit ( 12x5ml ) 93 pttk reagent with cal chloride ( 6x2ml ) 94 uristick ( bott of 100 strip ) 95 crp ( 100 test ) 96 widal ( 4x5 ml ) 97 aso titrate ( 100 test ) 98 ra factor ( 100 test ) 99 typhi dot kit ( igm ) 50 test 100 dengue ns1 ag+ab combo rapid test ( 10 test ) 101 pregnancy test card 102 t3 elisa kit 96 test 103 t4 elisa kti 96 test 104 tsh elisa kit 96 test 105 occult blood ( 50 test ) 106 g6pd kit ( 12 test ) 107 glass test tube ( 110x12 mm ) 108 harris haematoxyline readymade stain 500 ml 109 isetrol ( level 1, 2, 3 3x10x1.0 ml ) 110 printer paper 50 mm 111 bromothymol blue indicator ( 125ml ) 112 sodium hypochloride solution 10% 113 l j media ( readymade ) 114 urea slant ( readymade ) 115 kovac strip 116 citrate slant ( readyamde ) 117 hepatitis a rapid test 118 oxidase 50 disc 119 disposable esr tube ( pack of 100 tubes ) 120 viral transport media ( vtm ) bott of 12 121 nylon thread 122 complete tubing set compatible with roche electrolyte analyzer 123 rendox control 124 bio rad diabetic control 125 bio rad bio chemistry control level 1& level 2 ) 126 bio rad ucfp control ( level 1& level 2 ) 127 gloves ( ancelle ) non latex 128 mpo stain 129 abo / rho ( d ) forward & reverse grouping card with auto control pack of 24 cards 130 abo / rho ( d ) forward & conformation card pack of 24 cards 131 abo / rho ( d ) ahg neonate 209 group card pack of 24 cards 132 ahg ( coombs ) test card pack of ( 6x24 ahg card ) 133 octoplus complete grouping card pack of 24 cards 134 octoplus forward & reverse grouping card with sub groups pack of 24 cards 135 forward grouping and cross matching card pack of 24 cards 136 forward grouping dat card pack of 24 cards 137 abo sub grouping card a1 pack of 24 cards 138 abo sub grouping card h pack of 24 cards 139 matrix diluents 2 pack of 500 ml pack ( liss ) 140 needle no 09 pack of 10 141 mac elisa lgm+lgg for dengue 142 procalcitonin rapid kit 143 microscopic cover slip ( 22x50 mm ) 144 rapid pap stain ( 250 smear ) 145 anti h sera 5 ml 146 anti a 1 sera 5 ml 147 kit hdl 2x50 ml for semi auto analyzer 148 kit glucose 10x50 ml for semi auto analyzer 149 kit triglyceride 10x50 ml for semi auto analyzer 150 kit urea 10x50 ml for semi auto analyzer 151 kit creatinine 10x50 ml for semi auto analyzer 152 kit uric acid 2x50 ml for semi auto analyzer 153 kit cholestrol 2x50 ml for semi auto analyzer 154 microscope cover slip 155 test tube medium pkt 100 156 kit serum bilirubin 2x50 ml for semi auto analyzer 157 kit uric acid 2x50 ml for semi auto analyzer 158 filter paper large 159 methyl alcohol 160 kit of estimation of sgot ( ast ) 100 ml for semi auto analyzer 161 kit of estimation of sgpt ( ast ) 100 ml for semi auto analyzer 162 stain gimsa 500 ml 163 kit of estimation of widal test for semi aut anlayzer 164 kit total proetin 2x50 ml for semi auto analyzer 165 wash solution for semi auto analyzer 166 micro tips pipett ( 5 100ul ) pkt 167 micro tips pipett ( 100 1000ul ) pkt 168 deionized water 169 test tube plastic 3 170 methanol 171 semi auto cleaner 172 blood collection needle 22g...

Indian Army - Rajasthan

21351536 procurement of drugs and consumables for hospital lab: 1 wbc diluting fluid ( 500ml ) 2 gram stain ( 4x125ml ) 3 rapid pap stain / ( ultra pap ) 4 haematoxyllin ( harris ) stain ( 1x500ml ) 5 mueller hinton agar ( 500gm ) 6 cled agar with bromothymol blue ( 500gm ) 7 uti chrome agar ( 500gm ) 8 blood agar base ( 500gm ) 9 macconkey broth ( 500gm ) 10 straight wire ( nicrome ) la 022 ( 5x5 ) 11 acetone ( 2.5 ltr ) 12 india ink ( grm5259 23 ml ) 13 whatsman filter paper ( 1001 090 ) qualitative ( 9cm diameter ) 14 absolute alcohol ( 500ml ) 15 chloroform ( 2.5 ltr ) 16 xylene ( 2.5 ltr ) 17 wax ( for tissue embedding ) 18 formaldehyde ( 5ltr ) 19 h2s test kit ( 1x4 test ) 20 bile esculin 50 disc / vial 21 kovac’s indole reagent ( 1x100 ml ) 22 mr / vp medium ( 1x100gm ) 23 ttc media ( motility test ) 500gram 24 rapid malaria test kit ( pan / pf antigen ) 50 test 25 g6pd ( 12 test ) 26 semen diluting fluid ( 500ml ) 27 auto zero disposable esr pipette ( 1x100 ) 28 haemtest ( occult blood ) 29 ketodio stix ( 1x50 strips ) 30 uristic ( 1x50 strips ) 31 dpx ( 500ml ) 32 glycerin ( 500ml ) 33 tisse tek embedding rings plastic ( 1x500 ) 34 prothrombin time reagents ( 1x5ml ) 35 tisse tek processing cassette plastic cat no. ( 1x500 ) 36 vaccutainer sterile gel 3 ml with needle ( fda approved ) 37 vaccutainer edta 3 ml with needle ( fda approved ) 38 vaccutainer sodium citrate 3 ml with needle ( fda approved ) 39 vaccutainer sodium fluoride 3 ml with needle ( fda approved ) 40 micro pipettes 50 100 ul ( expendable ) 41 micro pipettes 100 200 ul ( expendable ) 42 lacto phenol cotton blue ( 100ml ) 43 sterile urine container ( 1x100 ) 44 micropro ast susceptibility test panel kit –gn 1 ( 20 test ) 45 5% hypochlorite 46 e check ( sysmex control ) l 1, l 2, l 3 47 bhi ( adult ) 50 ml 48 bhi ( paed ) 20ml 49 cell pack ( pack of 20 ltr ) 50 stromatolyser ( 1x500ml ) 51 cholesterol ( 10x44ml ) system pack 52 uric acid ( r1 5x44ml / r2 5x11ml ) system pack 53 triglyceride ( r1 5x44ml / r2 5x11ml ) system pack 54 sgot hl ( 4x34ml / 4x17ml ) system pack 55 ada, 1x18ml / 1x10ml 56 hi profile microtome blade 57 hemostar cuvette stirer ( 1x100 ) 58 cover slip glass ( 22x50mm ) 59 lypocheck assaed chemistry control l1 ( 12.5 ) biorad 60 lypocheck assaed chemistry control l2 ( 12.5 ) biorad 61 lypocheck dibetic control assay 62 biorad immunoassay plus control l, l2, l3 63 anti ccp elisa ( 1x96 ) 64 hiv rapid 65 hbsag rapid 66 anti hcv rapid 67 vdrl rpr 68 blood bag 69 crp kit ( 25test ) 70 ra kit ( 100test ) 71 aso 72 anti sera anti a, 10 ml vial 73 anti sera anti b, 10 ml vial 74 anti sera anti ab, 10 ml vial 75 anti sera anti d ( igm+igg ) 10 ml vial 76 anti sera weak anti d ( igg ) monoclonal, 10 ml 77 anti h lactin, 05 ml vial 78 hiv elisa 96 tests 79 hbsag elisa 96 tests 80 anti hcv elisa kit 81 lancet packet of 100 pcs 82 trop t kit ( pkt of 5 ) ...

Indian Army - Rajasthan

21256861 procurement of drugs and consumables for hospital lab: 1 wbc diluting fluid ( 500ml ) 2 gram stain ( 4x125ml ) 3 rapid pap stain / ( ultra pap ) 4 haematoxyllin ( harris ) stain ( 1x500ml ) 5 mueller hinton agar ( 500gm ) 6 cled agar with bromothymol blue ( 500gm ) 7 uti chrome agar ( 500gm ) 8 blood agar base ( 500gm ) 9 macconkey broth ( 500gm ) 10 straight wire ( nicrome ) la 022 ( 5x5 ) 11 acetone ( 2.5 ltr ) 12 india ink ( grm5259 23 ml ) 13 whatsman filter paper ( 1001 090 ) qualitative ( 9cm diameter ) 14 absolute alcohol ( 500ml ) 15 chloroform ( 2.5 ltr ) 16 xylene ( 2.5 ltr ) 17 wax ( for tissue embedding ) 18 formaldehyde ( 5ltr ) 19 h2s test kit ( 1x4 test ) 20 bile esculin 50 disc / vial 21 kovac’s indole reagent ( 1x100 ml ) 22 mr / vp medium ( 1x100gm ) 23 ttc media ( motility test ) 500gram 24 rapid malaria test kit ( pan / pf antigen ) 50 test 25 g6pd ( 12 test ) 26 semen diluting fluid ( 500ml ) 27 auto zero disposable esr pipette ( 1x100 ) 28 haemtest ( occult blood ) 29 ketodio stix ( 1x50 strips ) 30 uristic ( 1x50 strips ) 31 dpx ( 500ml ) 32 glycerin ( 500ml ) 33 tisse tek embedding rings plastic ( 1x500 ) 34 prothrombin time reagents ( 1x5ml ) 35 tisse tek processing cassette plastic cat no. ( 1x500 ) 36 vaccutainer sterile gel 3 ml with needle ( fda approved ) 37 vaccutainer edta 3 ml with needle ( fda approved ) 38 vaccutainer sodium citrate 3 ml with needle ( fda approved ) 39 vaccutainer sodium fluoride 3 ml with needle ( fda approved ) 40 micro pipettes 50 100 ul ( expendable ) 41 micro pipettes 100 200 ul ( expendable ) 42 lacto phenol cotton blue ( 100ml ) 43 sterile urine container ( 1x100 ) 44 micropro ast susceptibility test panel kit –gn 1 ( 20 test ) 45 5% hypochlorite 46 e check ( sysmex control ) l 1, l 2, l 3 47 bhi ( adult ) 50 ml 48 bhi ( paed ) 20ml 49 cell pack ( pack of 20 ltr ) 50 stromatolyser ( 1x500ml ) 51 cholesterol ( 10x44ml ) system pack 52 uric acid ( r1 5x44ml / r2 5x11ml ) system pack 53 triglyceride ( r1 5x44ml / r2 5x11ml ) system pack 54 sgot hl ( 4x34ml / 4x17ml ) system pack 55 ada, 1x18ml / 1x10ml 56 hi profile microtome blade 57 hemostar cuvette stirer ( 1x100 ) 58 cover slip glass ( 22x50mm ) 59 lypocheck assaed chemistry control l1 ( 12.5 ) biorad 60 lypocheck assaed chemistry control l2 ( 12.5 ) biorad 61 lypocheck dibetic control assay 62 biorad immunoassay plus control l, l2, l3 63 anti ccp elisa ( 1x96 ) 64 hiv rapid 65 hbsag rapid 66 anti hcv rapid 67 vdrl rpr 68 blood bag 69 crp kit ( 25test ) 70 ra kit ( 100test ) 71 aso 72 anti sera anti a, 10 ml vial 73 anti sera anti b, 10 ml vial 74 anti sera anti ab, 10 ml vial 75 anti sera anti d ( igm+igg ) 10 ml vial 76 anti sera weak anti d ( igg ) monoclonal, 10 ml 77 anti h lactin, 05 ml vial 78 hiv elisa 96 tests 79 hbsag elisa 96 tests 80 anti hcv elisa kit 81 lancet packet of 100 pcs 82 trop t kit ( pkt of 5 ) ...

Indian Army - Rajasthan

20892873 procurement of drugs and consumable for hospital lab => limited: 54 sgot hl ( 4x34ml / 4x17ml ) system pack 55 ada, 1x18ml / 1x10ml 56 hi profile microtome blade 57 hemostar cuvette stirer ( 1x100 ) 58 cover slip glass ( 22x50mm ) 59 lypocheck assaed chemistry control l1 ( 12.5 ) biorad 60 lypocheck assaed chemistry control l2 ( 12.5 ) biorad 61 lypocheck dibetic control assay 62 biorad immunoassay plus control l, l2, l3 63 anti ccp elisa ( 1x96 ) 64 hiv rapid 65 hbsag rapid 66 anti hcv rapid 67 vdrl rpr 68 blood bag 69 crp kit ( 25test ) 70 ra kit ( 100test ) 71 aso 72 anti sera anti a, 10 ml vial 73 anti sera anti b, 10 ml vial 74 anti sera anti ab, 10 ml vial 75 anti sera anti d ( igm+igg ) 10 ml vial 76 anti sera weak anti d ( igg ) monoclonal, 10 ml 77 anti h lactin, 05 ml vial 78 hiv elisa 96 tests 79 hbsag elisa 96 tests 80 anti hcv elisa kit 81 lancet packet of 100 pcs 82 trop t kit ( pkt of 5 ) ...

Indian Army - Rajasthan

20328642 procurement of drugs, consumable and allied for hospital lab, procurement of medical stores 1:01 lyphochek assayed chemistry control l1 ( 125 ) biorad 1 02 lyphochek assayed chemistry control l2 ( 1 25 ) biorad 1 03 lyphochek diasbetes control assay 1 04 microtome blade ( high profile ) => limited...

Indian Army - Rajasthan

20160350 procurement of consumable for hospital lab: 1.01 lyphochek assayed chemistry control l1 ( 12.5 ) biorad 1.02 lyphochek assayed chemistry control l2 ( 12.5 ) biorad 1.03 lyphochek diasbetes control assay 1.04 microtome blade ( high profile ) => limited...

Rajasthan University Of Health Science - Rajasthan

19311315 supply of chemicals and reagents for pathology malt diastase, mercuric oxide, metanil yellow, methanol, methylene blue, micro glass slides, microtome blade ( low profile ) , mercuric chloride, myloproxidase, neutral red, nitric acid, normal saline, nuclear fast red, numbering paper, oxalic acid, papanicolou ready to use kit, paraffin wax with ( ceresin 60 62 c ) , peanut oil, permanent marker thin ( black ) , phenol, phosphomolybdic acid, phosphotungstic acid, picric acid, plastic ring for block ( white ) , potassium dichromte, potassium ferrocyanide, potassium hydroxide, potassium metabisulphite, potassium permagnate, propanolol, readymade giemsa stain, rosaniline dye ( for shiff reagent ) , silver nitrate, sodium nitropruside, sodium hydroxide, sodium lodate, sodium metabisulfite, sodium sulphate, sodium thiosulphate, sudan black b, sulfurous acid, tetrazolium chlorlde, toludine blue, xylene...

Medical College - Rajasthan

18847031 supply of reagents and chemicals for microbiology 437 bond aspirating probe cleaning kit 438 bond polymer refine detection 439 bond open container 7m1 440 leica universal label 3000 / pk 441 bond mixing stations 442 bond universal cover tiles 443 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm ) it a 444 slide label 445 printer ribbon 446 eber 447 antigen retrieval buffer diva decloaker 20x 448 background snipper 449 polylysine coated slides 450 peroxidated block 1 451 betazoid dab chromogen 452 betazoid dab substrate buffer for cytocentrifuge 453 filter card for cytology ( funnel reusable ) 454 cell slides single circle coated 455 cell slides single circle uncoated 456 double cytology funnel ( reusable ) 457 cell clip for cell clipotor 458 single cytology funnel ( for cryostat ) 459 cryomatrix ( optimal cooling tool gel coolant ) 460 sarasil disinfectant 461 microtome blades ( high definition ) ( for 6 part hematology analyser sysmex xn1000 ) s 462 lyser cell ( wnr ) 463 fluorocell ( ret ) 464 fluorcell plt ( plt ) 465 e.c.g jelly...

Dr. S.N.Medical College - Rajasthan

18834080 supply of reagents and chemicals for microbiology 437 bond aspirating probe cleaning kit 438 bond polymer refine detection 439 bond open container 7m1 440 leica universal label 3000 / pk 441 bond mixing stations 442 bond universal cover tiles 443 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm ) it a 444 slide label 445 printer ribbon 446 eber 447 antigen retrieval buffer diva decloaker 20x 448 background snipper 449 polylysine coated slides 450 peroxidated block 1 451 betazoid dab chromogen 452 betazoid dab substrate buffer for cytocentrifuge 453 filter card for cytology ( funnel reusable ) 454 cell slides single circle coated 455 cell slides single circle uncoated 456 double cytology funnel ( reusable ) 457 cell clip for cell clipotor 458 single cytology funnel ( for cryostat ) 459 cryomatrix ( optimal cooling tool gel coolant ) 460 sarasil disinfectant 461 microtome blades ( high definition ) ( for 6 part hematology analyser sysmex xn1000 ) s 462 lyser cell ( wnr ) 463 fluorocell ( ret ) 464 fluorcell plt ( plt ) 465 e.c.g jelly...

Indian Army - Rajasthan

18641482 supply of medicine: 1 ecg electrodes ( packet of 100 ) 2 microtome blade ( high profile ) => short tender notice...

Medical College - Rajasthan

18516133 rate contract for glassware and disposable for pathology department7 i micro cober slip, glass slides, surgical blad, disposable gloveshaematoeytometer cover saip 8 faiter paper no. ‘0’ 17”x27” sheets iens cleaning paper io. staining tiough capaciiy — 25 30 slides, dimension 13x10x7 cm wiih __________ lid made of glass 11 wash iottie made of idpe plaiiic waih delivery tube. it shculd be made of chemically resistant low density polyethylene, flexible with screw cap _________ ( 500 ml ) 12.? tissue paper roll 13. urinometer for specific graviiw ________e_ 14. disposabie microtome blade low piofile, ce ceiiiiied li i approved suitable for leica microtome sample for approval is must. ____._____ 15. disposabie piasiic casseiie wiih lids, yailow ralour for iissu processing, sample required for approval.nit 133 ) 16. disposabie piaitic casieiie wiih lids, white? off white colour for tissue — processing, sample required for approval. 17. disposabie plastic cassette with lids, bium colour for tiisui processing, _......___ sample required for approval. ______ 18. diamond pencil for marking glass slides 19. disposabie gowm for autopsy and histopathology, sample approval. o. reetangnlar museum jar with rover made of borosilicate gla s _.____ ( 2oox125x 12s mm ) ______ _______________ 21. rectangnlar museum iar with cover made of borosiiicate gin’.s _..__.._ ( 36oxl5oxloomn ) 22. rectangular museum jar with cover made of borosilicate gla s _.....__.__ ( 220x195x8o mm ) ____ 23. index card 24. fiiier paper disposable for cytotek 2s. measuring cyliider 25 ml, . 26. measuring cylinder 500 ml 27. measuring cylinder 1000 ml ) click lock microtube stand27. measuring cylinder 1o0o ml ) 28. click iock microtube stand? — 29. cryomatrix embedding resin 30. micro tips 0.5 10 ul 31. micro tips 10 l0oul 32. micro tips 10oo ul 33 click lock microcentifuge tube ( ipendoff ) 34 brush for cryostat...

Medical College - Rajasthan

18502541 rate contract of glassware and disposable for pathology department : 11 wash bottle made of ldpe plastic with delivery tube . it should be made of chemically resistant low density polyethylene, flexible with screw cap ( 500 ml ) 12 tissue paper roll 13 urinometer for specific gravity 14 disposable microtome blade low profile, ce certified ivd approved suitable for leica microtome, sample for approval is must. 15 disposable plastic cassette with lids, yellow colour for tissue processing, sample required for approval. 16 disposable plastic cassette with lids, white / off white colour for tissue processing, sample required for approval. 17 disposable plastic cassette with lids, blue colour for tissue processing, sample required for approval. 18 diamond pencil for marking glass slides 19 disposable gown for autopsy and histopathology , sample approval. 20 rectangular museum jar with cover made of borosilicate glass ( 200x125x125 mm ) 21 rectangular museum jar with cover made of borosilicate glass ( 360x150x100 mm ) 22 rectangular museum jar with cover made of borosilicate glass ( 220x195x80 mm ) 23 index card 24 filter paper disposable for cytotek 25 measuring cylinder 25 ml, 26 measuring cylinder 500 ml 27 measuring cylinder 1000 ml ) 28 click lock microtube stand 29 cryomatrix embedding resin 30 micro tips 0.5 10 ul 31 micro tips 10 100ul 32 micro tips 1000 ul 33 click lock microcentifuge tube ( ipendoff ) 34 brush for cryostat...

Indian Army - Rajasthan

18089166 supply of medicine, echs / lp / 724 / 2018 19 : 1 3 part control kit ( sysmes ) 2 glass cover slip ( blue star ) 3 microtome blade high profile 4 gm stain 5 disposable esr tube ( pkt of 100 tube ) 6 cuvette with stirrers ( haemostar ) pkt of 100...

Indian Army - Rajasthan

18040607 supply of medicine 1 ecg electrodes(packet of 100) 2 microtome blade (high profile) => short tender notice...

Indian Army - Rajasthan

17869489 supply of consumables and expendable medical stores : 33 hdl cholestrol kit ( 4x50 ml ) ( erba ) 34 highprofile microtome blades silver ( pkt of 50 ) 35 hiv antibody 1 & 2 detection elisa kit for 96 tests 36 hiv rapid test kit of 30test 37 kit for estimation of creatinine ( 4x50 ml ) ( erba ) 38 kit for estimation of sgot ( 10 x 10ml ) 39 kit for estimation of urea ( 5x20 ml ) ( bertholet reaction method ) ( erba ) 40 ldh test estimation kit ( kit of 5 x 10ml ) 41 leishman stain bott of 500 ml 42 mac conkey agar bott of 500gm 43 methylene blue ( must mention size of bott ) 44 micro abst disc amikacin 45 micro abst disc cefepime 46 micro abst disc cefotoxime 47 micro abst disc ceftazidime 48 micro abst disc ciprofloxacin 49 micro abst disc clindamycin 50 micro abst disc gentamycin 51 micro abst disc nalidixic acid 52 micro abst disc netilmycin 53 micro abst disc nitrofurantoin 54 micro abst disc norfloxacin 55 micro abst disc ofloxacin 56 micro abst disc oxacillin 57 micro tips 1000 μl pack of 1000 58 micro tips 200 μl pack of 1000 59 microscopic cover slips sunbeam 18 mm ( 14gm ) 60 microscopic slides 75 x 25 x 1.35 mm 61 multi strip for urine estimation for urine auto analyser 62 occult blood kit ( kit of 50 tests ) 63 pap stain kit 64 parafin wax 60 degree 2kg pkt 65 pediatric blood culture bottle 66 pregnancy test kit ( one step kit of 100 tests ) 67 printer roll ( sysmex ) 57mm x 20mtr 68 prothrombin test kit ( isi value less than 1.1 ) 1 x 5ml 69 pttk test kit 70 ra factor test ( 50 test kit ) 71 rapid test for malaria pan / p.f antigen ( 40 test kit ) ( erba ) 72 raticulin stain 73 serum anti a1 lactin ( bott of 5 ml ) 74 serum anti d for saline tube test 75 serum haemagglutnating gp a ( anti b monoclonal ) 76 serum haemagglutnating gp b ( anti a ) monoclonal 77 sgpt test kit ( erba ) ...

Indian Army - Rajasthan

17603512 tender for local purchase of laboratory reagents for serving personnel and their dependents, 70 novobicin 71 ampi sulbactum 72 cefoxitin 73 chlorophenicol 74 colistin 75 linezoide 76 teicoplanin 77 norfloxacin 78 nitrofurantion 79 cefepime 80 amikacin 81 azythromycin 82 cefoperazone 83 ciprofloxacin 84 erythromycin 85 gentamycin 86 levofloxacin 87 nalidixic acid 88 piperacillin 89 vancomycin 90 polymixin b 91 piperacillin tazobactam 92 ceftraxone+sulbactam 93 augmentin 94 potassium acetate 95 potassium nitrate 96 sodium acetate 97 disposable microtome blade 98 l mould brass ( pair ) 99 sterile petri dish 100 gram stain 101 z n stain 102 cover slip 22mm 103 oxidase reagent strip 104 sulfer power 105 sodium nitropruside 106 ammonium sulphate 107 benzidine power 108 sulphosalicylic acid 109 barium chloride 110 benedict”s solution 111 sodium deoxycholate 112 typhist ict kit 113 pt control ( plasmatrol h i / ii ) 114 ( bio rad ) lyphochek diabetes control level 1 115 ( bio rad ) lyphochek diabetes control level 2 116 ( bio rad ) lyphochek bio chemistry control level 1 117 ( bio rad ) lyphochek bio chemistry control level 2 118 lugol iodine 119 potassium electrode 120 sodium electrode 121 potassium di hydrogen phosphate 122 disodium hydrogen phophate 123 deproteiniser 125 ml 124 sodium conditioner 125 ml 125 aluminium slide processing trey 126 fnac gun 127 coplin glass jar 128 coplin plastic jar 129 liquicheck urine chemistry control l1 ( bio rad ) ( 12 x 10 ) 130 liquicheck urine chemistry control l2 ( 12 x 10 ) ...

Medical College - Rajasthan

17591557 misc. item for lab 1. micro slide ground edge & ilni free size — 75 mm longx25 mm wide thickness 1.25mm non foggy non corrosive processed from bcst imported micro glass. dimension variation of micro slide in size ± 1 mm and thickness ___ ±0.1mm 2. micro cover glasses from imported glass ( english glass ) thickness no. 0 ( i.e.0.08mmn to 1 .13mm ihick ) size a 3. filter papers sheets analytical qualitative filter speed medium fast sheets diameter 58cmx58cm i_ ( 58ornmx58ornm ) surgical gloves surgical gloves _______ surgical gloves ___e______e___e_._ 7. j surgical gloves disposable size 6 no. ___ disposabk microtomne blade iligh profile disposable microtome blade low profile 4. latex 5. 6.? latex latex disposable size 7.5 no. latex disposable size 7 no. 8. disposable size 6.5 no....

Indian Army - Rajasthan

13818058 supply of consumables and expendable medical stores : 44 dengue rapid test to detect ns1 ag and igg and igm ( kit of 10 test ) 45 disposable blade for advanced rotary microtome s 35 ( pack of 1x50 ) high profile ( heavy duty disposable microtome blade ) ( 1x50 blade ) 46 disposable petri disc ( 50x12mm ) 47 ehrlichs hematoxylin bott of 500ml 48 ertapenem susceptibility test discs 10 mcg / disc 49 ethyl alcohol bott of 500 ml ( merck ) 50 fecal occult blood detection rapid test ( kit of 25 tests ) 51 filter paper large ( pkt of 100 ) 52 filter paper no 1 125mm 53 formaldehyde solution bott of 500ml 54 g6pd qualitative test kit ( pack of 10 test ) 55 gentamycin susceptibility test discs 10 mcg / disc 56 glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g 57 glass, cover, microscope, 18 mm square 0.10 mm ( 1 / 250 ) thick for dark ground work pkt of 14 g 58 glass, coverslip microscope, rectangular ( 22 mm x 50 mm ) , 0.127 mm thick, pkt of 14 g=> limited tender...

Indian Army - Rajasthan

13233458 supply of consumables and expendable medical stores 51 dinoprostone gel 0.5mg ( in 3gm / 2.5ml gel ) / syringe 52 dispo surgeon cap 53 disposable bains circuit adult 54 disposable endo tracheal tube ( cuffed ) size 7, 7.5, 8, 8.5 55 disposable gown 56 disposable humidifier bottle for oxygen delivery 57 disposable loop pkt of 10 58 disposable mask n 95 59 disposable microtome blade low profile ( pkt of 50 blade ) 60 disposable needle 22 x 1, 24 x 1 61 disposable shoe cover 62 disposable surgical blade size 11 pkt of 100 blade 63 doxylamine succinate 10 mg usp+pyridoxine hydrochloride10 mg ip tab 64 dressing medicated adhesive 25 cm x 6 cm in single strip pack 65 duvadilan tab 66 ear buds disposable ( pkt of 100 ) 67 ear drop tobramycin 0.3% bott of 5 ml 68 ecg electrodes 69 ecg gel bott of 250gm 70 ecg paper 50 mm x 20 mtr 71 elastic shoulder immobiliser 72 elbow crutch 73 elemental iron with folic acid 74 endoloop pkt of 6 75 endotracheal tube various size from 3.5 5.0...

Indian Army - Rajasthan

12578609 supply of expendable drugs and consumables : 1 a1 lectin bott of 10 ml 2 acetone commercial bott of 500 ml 3 alkaline phosphate test kit ( 5x20ml ) 4 aluminium tray for slides for ( 20 slides in one tray ) 5 amylase test kit ( 2x50 ml ) 6 anti h serum bott of 5ml 7 anti human globulin ( ahg ) bott of 10 ml 8 antibiotic disc for amikacin 9 antibiotic disc for augmentine 10 aso titre estimation kit ( kit of 50 tests ) 11 auto dispenser ( 0.5 5.0 ml ) 12 auto dispenser ( 1 10 ml ) 13 autopippette ( 01 100ml ) 14 autopippette ( 01 50ml ) 15 autopippette 1000ml fixed 16 autopippette 100ml fixed 17 autopippette 10ml fixed 18 autopippette 200ml fixed 19 autopippette 20ml fixed 20 autopippette 500ml fixed 21 azetronam 500mg susceptibility test discs 22 azithromycin susceptibility test discs 10 mcg / disc 23 bacitracin 1 microgram susceptibility test discs 24 bilirubin direct estimation test kit ( 4 x 50 ml ) 25 bilirubin total and direct estimation test kit ( 6x30 ml ) 26 blood agar base 500 gm media bottle 27 blood glucose test kit 30x 20 ml 28 bovine albumin 20 % 29 brain heart infusion broth with paba & agar bott of 500 gm 30 broth maconkey ( ds ) 500 gm bottle with neutral red ( water culture media ) 31 buffer for use in haematology ph 6.8 32 calcium estimation test kit ( 4x50ml ) 33 cefepime susceptibility test discs 30 mcg / disc 34 cefotaxime susceptibility test discs 30 mcg / disc 35 ceftriaxone susceptibility test discs 36 chloroform ar ( analytical grade ) 37 cholesterol test kit ( 10x50 ml ) 38 ciprofloxacin 5 microgram susceptibility test discs 39 ck mb estimation test kit ( 4x 20ml ) 40 cled agar ( with bromo thymol blue ) bott of 500 gm 41 colistin susceptibility test discs 42 cpk ( ck nac ) ( uv kinetic method ) estimation kit ( kit of 30 test ) . 43 creatinine test kit ( 4x50 ml ) 44 creatnine kinase test kit ( 2x10ml ) 45 creatninie kinase estimation test kit ( 4 x 20ml ) 46 cryptococcus latex antigen detection kit, 70 tests 47 deionized water jar of 05 ltr 48 dengue rapid test to detect ns1 ag and igg and igm ( kit of 10 test ) 49 disposable blade for advanced rotary microtome s 35 ( pack of 1x50 ) high profile ( heavy duty disposable microtome blade ) ( 1x50 blade ) 50 disposable petri disc ( 50x12mm ) 51 ertapenem susceptibility test discs 10 mcg / disc 52 ethyl alcohal bott of 500 ml ( merck ) 53 fecal occult blood detection rapid test ( kit of 25 tests ) 54 filter paper large ( pkt of 100 ) 55 filter paper no 1 125mm 56 formaldehyde solution bott of 500ml 57 g6pd qualitative test kit ( pack of 10 test ) 58 gentamycin susceptibility test discs 10 mcg / disc 59 glass, cover, microscopic, square shape, 0.127 mm thick, side 22 mm, pkt of 14 g 60 glass, cover, microscope, 18 mm square 0.10 mm ( 1 / 250 ) thick for dark ground work pkt of 14 g ( coverslip ) 61 glass, coverslip microscope, rectangular ( 22 mm x 50 mm ) , 0.127 mm thick, pkt of 14 g 62 glycerine ar ( glycerol ) bott of 500ml 63 hbsag elisa test ( kit of 96 tests ) 64 hbsag rapid test ( kit of 30 tests ) 65 hcv elisa test kit ( kit of 96 tests ) 66 hcv rapid test kit ( kit of 30 tests ) 67 hiv ag / ab combo rapid test ( kit of 30test ) 68 hiv antibody 1 & 2 detection elisa kit for 96 tests. 69 imipenem susceptibility test discs 10 mcg / disc 70 keto diastix bottle of 50 strips 71 ldh test estimation kit ( kit of 6 x6 ml ) 72 litmus paper blue ( pkt of 10 pkt ) 73 litmus paper red ( pkt of 10 pkt ) 74 marking pen ( glass marker ) 75 methyl alcohal bott of 500 ml 76 microtips 1000 ul ( pkt of 500 ) 77 microtips 200 ul ( pkt of 1000 ) 78 mueller hinton agar 500 gm bottle 79 nalidixic acid susceptibility test discs 30 mcg / disc 80 netilmycin susceptibility test discs 10 mcg / disc 81 norfloxacin susceptibility test discs 50 mcg / disc 82 oflaxacin susceptibility test discs 05 mcg / disc 83 ph strips ( 0.5 10 ) 84 phenol bott 500gm 85 pipette 1 20 micro ltr 86 plastic embedding ring for histopathology ( pkt of 100 ) 87 plastic tissue processing cassettes ( all size ) ( pkt of 100 ) 88 potassium hydroxide bott of 500 gm ( koh ) 89 pregnancy test kit ( one step kit of 100 tests ) 90 printer roll ( roche ) ( pack of 5 roll ) 91 prothrombin test kit ( isi value less than 1.1 ) 10x10 ml 92 pttk test kit 93 r f test kit ( 20 test ) 94 rapid pap kit ( 250 smear kit ) 95 rapid test for malaria pan / p.f antigen ( 25 test kit ) 96 reticulin stain for histopathology 97 sgpt estimation kit ( 10 x 50ml ) 98 slide microscope 1.15x75x25mm ( pkt of 50 slides ) 99 sodium hypochlorite solution 10% 10 ltr can 100 stain eosin 1% bott of 200ml 101 stain giemsa bott of 200ml 102 stain grams kit k 001 103 stain haematoxylin powder bott of 50 gm 104 stain haemotoxyline ( harris ) bott of 200ml 105 stain leishman`s bott of 200ml 106 steel base plate for block making ( histopathology ) pack of 100 107 strip indicators for sterillisation control ( for testing sterlity of drums ) 108 sulphuric acid 20 % bott of 500 ml 109 swab stick disposable ( pkt of 100 swab ) 110 teicoplanin susceptibility test discs 30 mcg / disc 111 thermal printer paper roll size 110mm x 20 mtr 112 thymol bottle of 100g 113 tissue paper 114 tobramycin susceptibility test discs 30 mcg / disc 115 triglyceride test kit ( 5 x 20 ml ) 116 trimethoprim susceptibility test discs 117 vaccutainer edta 1ml ( pkt of 100 ) 118 vaccutainer edta 2ml ( pkt of 100 ) 119 vaccutainer sodium flouride ( grey ) 3ml ( pkt of 100 ) 120 vaccutainer sterile with gel ( yellow ) 5ml ( pkt of 100 ) 121 vaccutainer sterile without gel ( red ) 3ml ( pkt of 100 ) 122 vancomycin susceptibility test discs 30 mcg / disc 123 vdrl test kit of 100 test 124 xylene ( xylol pure ) bott of 500ml 125 zn acid fast stains kit k 005 => limited tender...