Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Department Of Ayush - Rajasthan

29715042 university equipment e tender 15908 dt 28 10 2021 university equipment e tender 15908 dt 28 10 2021 as per tender documents , microscopes with oil immersion , sahli’s haemoglobinometer , haemocytometer , electrocardiograph , water distillation still , digital balances , centrifuge with speed control , colorimeter ( photoelectric ) , ph meter electric , color comparator with disc , sphygmomanometer , stethoscopes , clinical thermometer , knee hammer , tuning forks , sterilizer , tank with a capacity to preserve 2 bodies ( stainless steel with cover and outlet of tap ) , machines for bones and brain sectioning , dissection sets , dissecting table full size with stainless steel top or marble top , half size with steel top or marble top stainless , x ray viewing box , bone cutter of the number ¾ , ½ , ¼, 1 / 8 – , binocular microscope with oil emersion , incubator , autoclave ( different size 20 l – 3, 40 l 2 , ultraviolet lamp , cell counter ( manual ) , tongue depressor , physical balance , hot air oven , bunsen burner , torch , measuring tape , ent examination set , weighing machine ( 200 kg capacity ) , nasal speculum , laryngoscope , probes , sterile disposable lancet / needle , syringe needle destroyer , magnifying lens , shadowless lamp , suction machine ( neonatal ) , oxygen cylinder and mask , foetaltoco cardiograph , radiant warmer , photo therapy unit , weighing machine ( paediatric ) , patient trolly , anaesthesia trolley , infantometer , vacuum extractor , foetal doppler , low cavity forceps , instruments for labour and episiotony. ( scissors, forceps, needle holders etc. ) , baby tray , nebuliser , foetoscope , dressing drums small 5 medium 5 large 5 , instrumental trolley , ot tables and head up and head low facility , pulse oximeter , resuccitation kit , boyle’s apparatus , electrocautery , mtp suction machine , blunt and sharp curettes , dilators set ( hegar’s, hawkins ) , sims’s speculum , cusco’s speculum , anterior vaginal wall retractor , uterine sound , volsellum , mtp suction canula , retractors abdominal ( doyne’s etc. ) , sponge holding forceps , green armytage forceps , uterus holding forceps , kocher’s forceps ( 3 straight and 2 curved ) , artery forceps ( straight and curved ) 5, 6, 8, 10 inch10 10 each , scissors different sizes ( 6inch – 15, 8 inch 15 ) , forceps obstetrics , cord cutting appliances , i.u.c.d. removing hook , bladder sound , towelclips , needle holders , spot light ( shadow less ceiling fitted ) , needle holding forceps ( big medium small ) , drum stand , iv stand , cheatlesforceps , scissors straight ( tailor ) , stitch removal scissors , dissection forceps , sinus forceps , pointed scissors , abdominal retractors , bob kock’s forceps4inch 1, 6inch 1, 8inch 1, 10inch 2 , kocher’s forceps 5inch 1, 6inch 1, 8inch 1, 10inch 2 , urethral dilators 2 each , metal catheters ( 5 for females and 5 for males ) , right angle cholecystectomy forceps , stone holding forceps , allies forceps small , allies forceps big each of 7.5, 9.5, 12 and 18 inches , sigmoidoscope rigid / flexible , barron pile’s gun , laryngoscope pediatric , multi parameter monitor , ambu bag , skin grafting knife with handle , gigli saw , scoop , periasteum elevator , maggles forceps , nitrous oxide cylinder , hydrolic operation table , proctoscope 1 with illumination , 2 without illumination , gabriel syringe , strecher with trolley , emergency light , fire extinguisher , fumigator , revolving stool ( patient ) , suturing needle ( straight / curved ) of assorted size , bp handle of different size , lens insertion forceps , keratome , desmarres lid retractors , cat paw lacrimal retractor , mueller lacrimal sac retractor , dastoor iris retractor , meyrhoefer chalazion currete , sinsky lens manipulating hook , iol manipulator , foreign body spud , lewislensloop ( vectis ) , cystotomeandspoon , muleeviscerationspoon , irisrepository ( double ended ) , jamesonmusclehook , willscauterywithcopperball point , langs lacrimal sacdissector , kellyglaucomapunch , elevator ( doubleended ) , wilderpunctumdilator , bowmanlacrimalprobes , hartmanmosquitoforceps , colibriforceps1*2teeth , mc.personcornealforcepswithtyingplatform , dressingforceps, serrated , moorfield conjunctival forceps , fixationforceps , beercilea ( epilation ) forceps , arrugacapsularforceps , snellenentropionclamp , chalazionclamps , vannasstraightscissors , barraquerneedleholder , airinjectioncannula , healonaspiratingcannula , acwashoutcannula , lacrimalcannula , hydrodialysiscannula , j loopcannula ( right / leftwithsilicontubing ) , simcoedirecti / acanulawithsilicontubing , irrigatingaspiratinghandle , lensdialer , superiorrectusforceps , eyewashglasses ( fortarpanakarma ) , ( swimminggoggles fortarpanakarma ) ( 5 adults , 5 kids ) , auralsyringe , jobson’sauralprobe , eustachiancatheter , mastoidretractor , mastoidgouge , nasalforeignbodyhook , nasalpackingforceps , nasalsnare , bayonetshapedgouge , walshamforceps , laryngealforceps , tongueplatewiththroatsuction , tonsilholdingforceps , tonsillarsuction , adenoidcurettewithcage , peritonsillar abcessdrainingforceps , fuller’stracheostomytube , kidney tray , newtons colour wheelln a batch , anaesthesia kit , surgical blades , endotracheal tube , corrugated rubber drainez , self retain retracter , ??? ??? ?? , ??? ????? ??? ?? , ??? ??? ?? , ??? ?????? ?????? , ??????????? , ?????????? ??? ???? ???? , ?????? ???? ???? , ??? ??? ( 6 ???? ) , ?????????? ??? , ?????????? ?????? , ??? ??? , ???????? ??? , ?? ??? ( ???? ) , ???? ????? , ??????? ?????? , ???? ???? , ??? ???? , ??? ???????? , ???????????? ???? , ????????? , ?????????????? , ???? ???????? , ?????? , ??? ???? ?? , ??? ????? , ?? ???? ???? , ????? ???? , ??????? ???? , ?????? ?? ????? ( ???????? ????????? ) , ????????? , ??????? ????? , ??????? ????? ?????? , ???? ?????? ( ??? ) , ??? ??? , ???????????? ???? , knee enema, lumber enema, cervical enema apparatus ( 1 sets for each ) , apparatus for niruh basti , dhoompaan apparatus , gokarna , westergen’s pipette for esr , haematocrit tube , coverslips, glassware, microslides 1 set of each , glass jars of different sizes , wbc pipette , red cell pipette , improved neubauer chamber , wintrobe’s tube , pasteur’s pipette , westergreens’s stand , urinometer , sterile vessels / bottle to collect samples , glass rod , test tube , separating funnels of various sizes , glass jars with lid of different sizes 100ml, 250ml, 1000ml, 2l, 5l ( one of each size ) , capillary tubes , ????? ???? ??? , ????? ???? ??? , ??? ( ?????? ) , measuring glass300 ml , aquarium 3 ft 22 lit 3...

Department Of Ayurveda - Rajasthan

29707608 e tender for supply of university equipment 1 microscopes with oil immersion 170 trinocular lab pathological inclined microscope with 50 blank sides, cover slips box and immersion oil trinocular lab pathological microscope 2 sahli’shaemoglobinomete r 290 haemometer haemometers are used for the determination of blood’s content of haemoglobin. the marienfeld superior haemometer according to sahli is supplied as complete set consisting of: polystyrene support with 2 coloured rods and opal glass plate comparator tube haemoglobin pipette 20 μl acc. 3 haemocytometer 290 the complete set includes one counting chamber, two 0. 5mm cover glasses, one red cell pipette, one white blood cell pipette, tubing, mouthpieces and carrying case. a counting chamber is a precision measuring instrument made of special optical glass. 4 electrocardiograph 6 ecg300g can collect 12 lead ecg signal and print waveform by the thermal printing system. 3.5′′tft color lcd shows the working status and ecg wa 5 water distillation still 6 the unit is recommended for making progeny free distilled water of a very high degree of purity. made out of s.s. special kettle element is fitted with ejection device / auto cut for safety of the element is provided water supply is stopped. the cock fitted to the unit is of brass c.p. a wall mounting clamp is provided with the unit. supplied with cord and plug to work on 220 / 230 volts a.c. 6 digital balances 12 amazing portable 2000g / 0.1g jewelry scale weight electronic digital balance precision ( with 2 battery ) weighing scale ( silver ) 7 centrifuge with speed control 13 droplet 3500 rpm centrifuge machine handi shape 6 tube, 15ml multipurpose high speed centrifuges 8 colorimeter ( photoelectric ) 12 range 400 nm to 700 nm filtersstandard glass filters display 16×2 line alpha numeric led%t 000 & 2.00 accuracy± 0.02 o.d & ± 1%t minimum volume1 ml stability± 0.01 o.d light source6.8 v , 0.3 amp , tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 21 9 ph meter electric 12 ph meter 100% accurate reading ( atc ) ph meter 100% accurate reading ( atc ) water purity tester water purity tester 10 color comparator with disc 6 nessleriser system provides greater depths by using corresponding accessory nessler tubes. this enables the determination of concentrations below the detection limit of the. 11 sphygmomanometer 178 cuffs that cover all arm circumferences not only do the cuffs cover the circumferences of patients arm, but they keep them comfortable with velcro straps that stay in place. durable bag and bulb the rubber like bag and bulb of the device is very strong and hence very durable. for 29 1 monitor, 1 monitor cuff, 4 aaa batteries, user manual pulse rate indicator risk category indicator low battery indication 12 stethoscopes 347 acoustic stethoscope soft ear knobs the stethoscope has soft ear knobs which do not hurt the ears while using it. pvc tubing the seamless pvs tubing enables good sound quality and also makes the instrument durable. 13 clinical thermometer 338 accurately calibered thermometers and either medical digital thermometer or mercury glass thermometer. 14 knee hammer 120 the precisely balanced handle offers increased control of percussion force. thermo plastic rubber triangular head has beveled apex and base employed to elicit myotatic reflex. 15 tuning forks 120 a tuning fork is a metal instrument with a handle and two prongs or tines. tuning forks, will vibrate at a set frequency to produce a musical tone when struck. 16 sterilizer 47 stainless steel electric instrument sterilizer economysize: 8x5x4.5 inch jointed. 17 tank with a capacity to preserve 2 bodies ( stainless steel with cover 12 strong stainless steel frame work construction. all structure polished finishing. tray constructed with heavy duty stainless steel material for heavy drainage of chemical. provision of upside open cover. tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 22 and outlet of tap ) tank made from thick stainless steel, with high boarder. provision of both side manual lifting handles. provision of lock tray at bottom. 18 machines for bones and brain sectioning 6 stainless steel single phase 1.5hp motor power 19 dissection sets 60 premium quality stainless steel dissection kit set with tools for medical students of anatomy 20 dissecting table 20.1 full size with stainless steel top or marble top 24 polished with slope and high border l84*w32*h36 inch and 74*24*36 inch 20.2 half size with steel top or marble top stainless 48 polished with high border l36*w24*h36 inch 21 x ray viewing box 90 single film led with automatic sensor & adjustable dimmer to adjust brightness of screen. x ray view box is a necessary equipment in hospitals, medical institutes and nursing homes. 22 bone cutter of the number ¾ , ½ , ¼, 1 / 8 – 7 fine pointed bone dissector 23 binocular microscope with oil emersion 65 real biological microscope kit. 3 fully glass objectives ( 4x, 15x, 30x ) . glass zoom eyepiece: 10x 20x. top and bottom illumination. product type: compound. usage: professional. starter kit: yes. generic dimensions: 11 h x 3.5 w x 10 d, 1.5 lbs. 24 incubator 6 droplet 45 bacteriological incubator thermostatic control with stainless steel chamber 14x14x14 inch laboratory incubator 25 autoclave ( different size 20 l – 3, 40 l 2 30 all aluminum deep drawn seamless construction size: 300mm x 350mm + 50mm lid. ( 12x16 ) . approx. capacity : 29 liters. with lid. mirror finish, suitable for two sterilizing / dressing drum ( 11x9 ) & ( 11”x4.5” ) 26 ultraviolet lamp 30 tl miniature lamp ( tube diameter 16 mm ) is made of blacklight blue ( dark blue ) glass, which transmits uv a radiation, but gives only a minimum of visible light. it is a perfect solution for quick detection of uv reflecting materials. tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 23 27 cell counter ( manual ) 12 blood cell counter 5 keys use all microscope ( silver ) 28 tongue depressor 155 stainless steel l shape tongue depressor 29 physical balance 6 sensitivity drift – 1 / 05mg, weighing capacity 1 to 10kg hight 105 205inch 30 hot air oven 6 hot air oven 32 litres steel chamber ( 14x14x14 inch ) sunline temperature up to 200c. heating elements are placed in ribs at the bottom and sides are built in lshape thermometer. double walled inside steel chamber 31 bunsen burner 170 bunsen burner has a heavy casted base giving stability to the burner. nickel plated brass burner tube with rotatable air regulator and cylindrical riffled connector mounted on casted base. burner tube 12.5mm , base dia 75mm overall height 120mm ( 4.72 ) for use with lpg / butane. 32 torch 90 medical handy pen light mini energy saving flashlight led torch + stainless steel clip super bright led torch ( silver : rechargeable ) 33 measuring tape 30 right gear wall mounted stature scope height measuring scale for school & clinics measurement tape ( 200 cm ) 34 ent examination set 18 an ent diagnostic set consists of different ent tools that are used in the examination of the ears, nose and throat. these tools are great help for finding out the exact condition of patients nose, ears and throat. 35 weighing machine ( 200 kg capacity ) 76 the design is brushed black having anti skid platform on jet toughened glass surface with curved edges for added safety.reliable features of healthgenie weighing scales are large lcd display shows weight, room temperature and battery status, error, low battery indicator 36 nasal speculum 30 length between 14.05 to 1050mm 37 laryngoscope 12 laryngoscope 4 blades one handle conventional set with silicone resuscitator ( ambu bag ) 1600 ml 1 pc each 38 probes 120 10 x 5 x 2 cm; 30 gms 39 sterile disposable lancet / needle 3000 disposable sterile 30g flat lancet 500 pricking needles for clinic 40 syringe needle destroyer 30 stainless steel needle cutter & syringe destroyer tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 24 41 magnifying lens 60 steel frame 20x magnification magnifying glass ( 50 mm diameter ) 42 shadowless lamp 24 led ceiling mounted 43 suction machine ( neonatal ) 12 medical supplies, suction tubes : olex vm 7e portable phlegm suction machine, olex medical supplies, olex medical consumables 44 oxygen cylinder and mask 12 water capacity – 10 litre gas capacity – 10500 litre 45 foetal toco cardiograph 6 2 inch color display 2.5mhz high sensitivity probe dual display mode: fhr curve display ( waveform ) & big font mode visual alarm indicator ip22 ingress protection 46 radiant warmer 6 radiant heat warmer, simple radiant heat warmer dual sensor with led phototherapy , this 750 watt hospital radiant heat warmer is perfect to be used in clinics, hospitals and nursing homes to treat the infants with heat loss and jaundice. 47 photo therapy unit 6 double surface led phototherapy with single time totaliser with fiber dome 48 weighing machine ( paediatric ) 5 digital baby weighing scale ( ts 500 ) upto 30kg baby tray weighing scale 49 patient trolly 10 size: 2060 x 560 x 800 mm 50 anaesthesia trolley 12 anesthesia centralized lock trolley cart the vehicle adopts plastic steel assembly, beautiful and strong with good handling. stainless steel guardrail, abs table ( with protective soft glass ) , crash proof ring, steel plastic column, utility case, data bag, central lock, single ( double ) layer dumper, garbage can. advanced mute caster. 51 infantometer 6 height measuring device material plastic product dimensions l 49 x b 13.5 x h 4 cm measurement range upto 90 cm 52 vacuum extractor 6 the 7a 23d, a high capacity, compact suction machine for general surgical use and features an oil free, maintenance free suction pump with 20 lpm capcity. 53 foetal doppler 6 fetal doppler with 2.5 mhz water proof probe which is interchangeable monitors foetus>12 weeks. three calculation modes to calculate fetal heart rate instant, average and manual. tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 25 54 low cavity forceps 7 low forceps utility forceps stainless steel 55 instruments for labour and episiotony. ( scissors, forceps, needle holders etc. ) 6 stainless steel drape, surgical, 75x90 cm, without slit, green kidney dish, medium, 250x140x40mm scissors, mayo, 15.5 cm, curved forceps, hemostatic, rochester pean, 16 cm, straight forceps, sponge, foerster, 24cm, serrated jaws, straight bowl, round, 100 ml, 80 x 35 mm, scissors, episiotomy, braun stadler, 21 cm, curved 56 baby tray 12 medical instrument stainless steel baby tray without cover, size 18” x 12” x 3” 57 nebuliser 11 compressor nebuliser blue it has a capacity of 5 milliliters has easy functional valves which provide the flexibility of the operations 58 foetoscope 27 single sided wall thickness : 2 3 mm 59 dressing drums small 5 medium 5 large 5 75 dressing drum 11x9 inch ( large ) , dressing drum 9x9 inch ( medium ) , dressing drum 6x6 inch ( small ) autoclavable heavy duty stainless steel 60 instrumental trolley 60 tubular frame work mounted. three shelves made of ss sheet with three side railing. 61 ot tables and head up and head low facility 18 three section top, backrest adjustable on ratchet. head low / up, height adjustment maneuvered by screw system. provided with thrust ball bearing. both screws easily wind able by an independent handle antigravity spring provided to assist to lift patient easily. 62 pulse oximeter 85 accurately determines the saturation of human hemoglobin ( spo2 ) , pulse rate ( pr ) , and pulse strength. 63 resuccitation kit 6 the emergency resuscitation kit is designed to provide ippv and continuous oxygen inhalation therapy in an emergency. the kit consists of an automatic ventilator, manual resuscitator, manual suction apparatus, a small oxygen cylinder apart from the other diagnostic and surgical items. 64 boyle’s apparatus 7 stainless steel voltage – 240 v 65 electrocautery 11 7 autoclavable electrodes set operation mode of cut, coagulation, cut coagulation. cut through soft tissue access a surgical site. 66 mtp suction machine 6 0.25 h.p. suction machine, ideal for medical and surgical procedures. ward care suction unit with noncollapsible pvc tubing. 67 blunt and sharp curettes 55 one side sharp loop and one side blunt loop tips to accommodate different cases. loops are teardrop shaped & fenestrated. tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 26 made from non corrosive surgical grade stainless steel. silk matte finish. 68 dilators set ( hegar’s, hawkins ) 30 hegar double ended uterine dilator set is a set of 8 manual, probe style instrument used to dilate the cervix these dilators are slightly curved in opposite directions from the center and have smooth, rounded tips this product contains 8 double ended dilators: 1mm / 2mm, 3mm / 4mm, 5mm / 6mm, 7mm / 8mm, 9mm / 10mm, 11mm / 12mm, 13mm / 14mm, and 15mm / 16mm. the overall length of each is 8 inche 69 sims’s speculum 30 sims speculum sterile 3 pack comes sealed ready for use. the sims speculum is a double bladed surgical instrument used for examining the vagina and cervix sims’ speculum is inserted into the vagina to retract the anterior or posterior vaginal wall 70 cusco’s speculum 30 vaginal speculum – cusco stainless steel 71 anterior vaginal wall retractor 30 double ended, blunt heavily serrated, fenestrated angled loops metal : ( heavy duty, extended longevity ) satin chrome finish 72 uterine sound 30 uterine sound sims surgical instrument weight : 45 80 gm material brass length : 8 15cm 73 volsellum 30 stainless steel polished upto 20cm size – 5, 6, 7, 8 inch 74 mtp suction canula 20 silver diameter – 3mm length–230mm • has universal adopter for connecting to suction apparatus • distal end is coned with two large lateral eyes to facilitate the curette • suitable for use with mtp syringe or suction apparatus 75 retractors abdominal ( doyne’s etc. ) 30 doyan abdominal retractor 3 inches length 25.4cm stainless steel 76 sponge holding forceps 30 sponge holding forceps 8 inches sponge forceps stainless steel 77 green armytage forceps 30 green armytageforcep 8 inches obstetric forceps, stainless steel 78 uterus holding forceps 30 stainless steel chrome size – 10 inch corrosion proof tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 27 79 kocher’s forceps ( 3 straight and 2 curved ) 30 the kochers is a hemostaticforcep. 20cm in length 80 artery forceps ( straight and curved ) 5, 6, 8, 10 inch 10 10 each 240 straight and curved artery forceps ( 10 inches, silver ) , ( 8 inches, silver ) ( 6 inches, silver ) ( 5 inches, silver ) 81 scissors different sizes ( 6inch – 15, 8 inch 15 ) 180 blade shape straight size 6 inch and 8 inch made of surgical grade 304 stainless steel 82 forceps obstetrics 30 ovum forceps surgical instrument 10 inch obstetric forceps 83 cord cutting appliances 30 umbilical cord scissors 4 strong cut scissors ( blunt / blunt blades ) 84 i.u.c.d. removing hook 30 i.u.d removing hook 12 inch pack of 1 pcs surgical hook stainless steel 85 bladder sound 30 stainless steel bladder sound 86 towel clips 60 stainless steel 87 needle holders 6 needle holder 6 inches stainless steel 88 spot light ( shadow less ceiling fitted ) 6 with led 89 needle holding forceps ( big medium small ) 30 needle holder 6 inches stainless steel 90 drum stand 27 bearing capacity hospital polished dressing drum 0 50 kg 91 iv stand 12 it is widely used in small to large clinic easy installation professional & stable dripper– fast & easy to setup – saves production time. this kit is specially designed for professionals it is easy to convert the side 92 cheatles forceps 24 cheatle forceps 10 inches hemostats forceps 93 scissors straight ( tailor ) 14 made of high carbon stainless steel beautiful golden handle. extremely sharp blades. s.s. blade metal handle 17 cm 94 stitch removal scissors 30 stainless steel 410 grade stitch cutting scissors ( standard size ) blade and handle 6 inch 95 dissection forceps 14 dissecting forceps ( toothed forceps 6, non toothed forceps 6 ) set of 2pc, stainless steel 96 sinus forceps 14 sinus forceps 6 inch utility forceps, stainless steel 97 pointed scissors 24 dressing scissor / pointed straight / 6 inch / stainless steel straight operating tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 28 scissors ( sharp blades ) 98 abdominal retractors 15 langenbeck retractor with a flat blade bent down at right angle to the handle useful for retraction of soft tissues 99 bob kock’s forceps 4inch 1, 6inch 1, 8inch1, 10inch 2 30 stainless steel with the grade of 410 sizes: 4 10 100 kocher’s forceps 5inch 1, 6inch 1, 8inch1, 10inch 2 30 automation grade manual weight ( g ) 150 color silver size 5, 6, 8 10, 12 material ss 101 urethral dilators 2 each 125 stainless steel, set contains 12 dilators, 28 / 32, 26 / 30, 24 / 28, 22 / 26, 20 / 24, 18 / 22, 16 / 20, 14 / 18, 12 / 16, 10 / 14, 8 / 12, 6 / 10 with and without gide wire passing. 102 metal catheters ( 5 for females and 5 for males ) 55 catheters, female, metaloverall length – 6 inches fr 6 to fr 20 size men 14 fr 103 right angle cholecystectomy forceps 14 22cm forceps 215mm mixter gall cystic duct forceps 23cm 104 stone holding forceps 14 length 15.24 cm type utility forceps material stainless steel 105 allies forceps small 24 stainless steel straight size 6 inch with interlock and 4 to 5 teeth. 106 allies forceps big each of 7.5, 9.5, 12 and 18 inches 24 stainless steel straight size 7.5, 9.5, 12 and 18 inch with interlock and 4 to 5 teeth. 107 sigmoidoscope rigid / flexible 6 rigid 25cm long and flexible 60 cm long biopsy also taken. 108 barron pile’s gun 12 hemorrhoid piles gun with forceps comes in a set of forceps and pile gun for applying pile band 109 laryngoscope pediatric 6 angulation 130° / 130° up / down. led laryngoscope set, blade size 1, 2, 3 and 4. 110 multi parameter monitor 6 multipara monitor multi parameter patient monitor mm 5012, display size: 12.1, tft tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 29 111 ambu bag 12 silicone self inflating bag, reservoir bag 2600 ml, face mask size 4. 112 skin grafting knife with handle 6 100% stainless steel rust proof & peel proof 6 inches 113 gigli saw 12 bristly and bendable finish oxidization resistance durable material stainless steel thickness 2 mm length 8 inch 114 scoop 6 material stainless steel length 17.78 cm 115 periasteum elevator 12 maxilla facial orthopedic instrument length 15.2 cm. double ended. 116 maggles forceps 117 nitrous oxide cylinder 6 weight 70 kg material mild steel working pressure 10kgcm2 118 hydrolic operation table 6 height adjustable range ( in mm ) : 750 mm to 1000 mm trendelenburg ( in degrees ) : 25 degree table length ( in mm ) : 1900 mm 119 proctoscope 1 with illumination , 2 without illumination 18 length 18 cm material brass 120 gabriel syringe 6 haemorrhoidal injection set angled needle, 10ml three finger syringe, drawing up cannula 121 strecher with trolley 24 body material top: crc sheet dimensions 2100x560x810 mm frame material mild steel wheel diameter 150 mm coating epoxy powder tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 30 122 emergency light 24 controller type push button light source wattage 12 watts item dimensions lxwxh 15 x 21 x 15 centimeters power and plug description rechargeable battery, neon indicator, discharge time 5 to 6 hour corded electric 123 fire extinguisher 12 water gas cartridge, hydrolic pressure 35, 9 ltr capacity, iso certified 124 fumigator 12 discharge capacity 0 to 10 litres per hour tank capacity 5 litres motor rating 1200 w / single phase spray particle size 7 30 microns voltage 230v 50hz motor rpm 20, 000 rpm coverage range upto 15 metres motor speed variable from 55% to 99% of 20, 000 rpm weight 3.5 kgs 125 revolving stool ( patient ) 90 revolving and height adjustable patient stool, made of high grade mild steel for long life. height adjustable from 12 to 15 ( approx ) ss top for seating 126 suturing needle ( straight / curved ) of assorted size 6 material stainless steel size 29 g packaging type box tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 31 material grade ss 304 127 bp handle of different size 30 features unique finish and appeal material stainless steel 128 lens insertion forceps 6 titanium angled lens folder, with lock. angled jaws and lock. 129 keratome 6 straight & angled profiles triangular sharp blade ergonomic solid handle 130 desmarres lid retractors 6 tipdimensions 12mm 12 mm material ss non sterile latex free lightweight ss 131 cat paw lacrimal retractor 6 materia l stainless steel size 135 mm prong 4 132 mueller lacrimal sac retractor 6 four wide, blunt prongs. 133 dastoor iris retractor 6 3.5 mm wide, aa 1256 right, stainless steel. 134 meyrhoeferchalazioncurr ete 6 overall length 131 cm, stainless steel, , , ergonomic solid handle 135 sinsky lens manipulating hook 6 4mm diameter tip tip to angle length 9mm 45° angled shaft round handle, overall length 118mm 136 iol manipulator 6 hourglass / teardrop shaped tip, 0.25mm tip. round handle. overall length: 115mm. 137 foreign body spud 6 stainless steel, solid handle ensuring maximum control 138 lewislensloop ( vectis ) 6 straight shaft & curved teardrop shaped logo, singleended. stainless steel with flat handle, 133mm or 134mm overall length tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 32 139 cystotomeandspoon 6 sms 274016 irrigating cystotome 0.40 x 16 mm 27 gauge sms 255016 irrigating cystotome 0.50 x 16 mm 25 gauge 140 muleeviscerationspoon 6 mule evisceration spoon stainless stell, size 11 15mm 141 irisrepository ( doubleended ) 6 iris repositor is made up of stainless steel having double ends. it is flattened at the tip and forked at the tip also. the overall length of the product is 6″ ( approx ) and the weight is 12 gm. 142 jamesonmusclehook 6 hook instrument type: retractor lightweight material: stainless steel 143 willscauterywithcopperb all point 6 material: stainless steel surface finishing: polished length: 6 inch weight: 14 gm 144 langslacrimal sacdissector 6 lacrimal sac dissector with double ended . sharp dissector and curette overall size 140mm mi 450 145 kellyglaucomapunch 6 holding instrument assessary and implant. stainless steel serrated squeeze handle. 146 elevator ( doubleended ) 6 stainless steel, dished double ended 2 / 4 147 wilderpunctumdilator 12 blunt polished tip, round knurled handle, titanium material 148 bowmanlacrimalprobes 18 material: stainless steel tip configuration: round instrument type: probe curvature: straight overall length: 13 cm grade: premium or grade thickness: 1mm to 8 mm 149 hartmanmosquitoforceps 18 width 1 tip / jaw ( mm ) : 1.2 length: 3.5″, 5 “ instrument type: hemostatic forceps curvature: straight working surface style: serrated handle: finger ring material: stainless steel tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 33 150 colibriforceps1*2teeth 12 0.12mm 1 x 2 teeth with 5mm platform and 2mm angled tips. flat serrated handle, dull finish. titanium. overall length: 86mm, 3.3 inches. 151 mc.personcornealforceps withtyingplatform 6 weight : 13gm overall length : 10cm tip: teethed material: stainless steel instrument type: corneal forceps working surface style: smooth 152 dressingforceps, serrated 12 stainless steel, reusable, serrated tips, length 5.6” 153 moorfieldconjunctival forceps 12 metarial – stainless steel serrated ends 154 fixationforceps 12 stainless steel, curved shorter and straight longer forceps, end gripping forceps ( 25g ) 155 beercilea ( epilation ) forceps 12 stainless steel, stout flat ended blunt forceps with thickened end 156 arrugacapsularforceps 12 stainless steel, vaulted shaft, 111mm or 101mm length with 2.5mm or 2.0mm tip 157 snellenentropionclamp 12 right / left overall size 98mm 158 chalazionclamps 12 o / l 90mm clamp diameter 23mm*15mm 159 vannasstraightscissors 12 stainless steel, straight or curved, 8.5cm, 7mm super fine blades, 0.025*0.015mm tips 160 barraquerneedleholder 12 fine 10mm, gently curved jaws, wide short handle, without lock, 125mm length overall. 161 airinjectioncannula 12 stainless steel, 27gauge, blunt tip, 18mm length , 0.7inches 162 healonaspiratingcannula 12 stainless steel cannula 163 acwashoutcannula 12 anterior chamber washout cannula, ( with flattened tip ) , 19g x 25mm, 10 / bx 164 lacrimalcannula 12 malleable tip, 23 gauge with silicon tubing right / left mi 1017, halfman nucleus loop 3mm wide 165 hydrodialysiscannula 12 operation mode manual handling portable type sterilise packaging type poly standard packaging shape bended weight 0.020 kgs 166 jloopcannula ( right / left withsilicontubing ) 12 j loup cannula irrigating aspirating with silicon tubing mi 1017 167 simcoedirecti / acanulawi thsilicontubing 6 23 gauge curved thin wall shaft 0.3mm aspiration through top port, irrigation through side tube opening 168 irrigatingaspiratinghandl 6 titanium material, long handle with luer connecters, tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 34 e overall length 96mm 169 lensdialer 6 stainless steel, curved shaft, length 120mm 170 superiorrectusforceps 6 curved forceps, length 3.5inches, 1*2 teeth, angled, fenestrated thumb, stainless steel 171 eyewashglasses ( fortarpan akarma ) 60 non sterile glass, reusable, smooth edges, 5.84*5.84*5.59cms. 172 swimminggoggles ( fortarp anakarma ) ( 5 adults , 5 kids ) 60 speedo hydropulse for unisex adult ( size: 1sz, color: clear / blue ) junior jet swimming goggles, kids free size ( multicolor ) 173 auralsyringe 24 body material: stainless steel tip type: luer lock color: white 120ml 174 jobson’sauralprobe 12 stainless steel, rust proof, dual end 175 eustachiancatheter 12 eustachian catheters curved otology instruments stainless steel 176 mastoidretractor 12 mastoid retractor ( wound spreader ) , straight arms, 3x4 blunt prongs, 5.25 177 mastoidgouge 12 stainless steel, squared handle and rounded corners, thin sharp edge, concave groove at top and at other end thumbtack like rounded end. 178 nasalforeignbodyhook 12 stainless steel, two ends one is blunt and second one is sccop like with a hole in it 179 nasalpackingforceps 12 material stainless steel, bent at an angle, blades are thin 180 nasalsnare 6 holding instruments stainless steel krause nasal snare size / dimension 120mm overall length 261mm 181 bayonetshapedgouge 6 round pulling edge, 6mm width, tips lies higher than handle, u shaped tip and sharp 182 walshamforceps 6 stainless steel, two lips one lip is guarded with rubber sleeve 183 laryngealforceps 6 stainless steel micro laryngeal forcep oval jaw cups, overall length 6.75inches, 184 tongueplatewiththroatsuct ion 12 tongue plate for boyeldavis frame with anesthetic tube , material stainless steel, effective length 65mm, 75mm, 90mm, 110mm 185 tonsilholdingforceps 6 curved, 4*5 teeth , one open ring, long straight shanks, ratcheted locking 0mechanism, 7.5inch length overall tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 35 186 tonsillarsuction 6 stainless steel material, 140mm length, curved shape 187 adenoidcurettewithcage 6 stainless steel, reusable, 130mm length 188 peritonsillarabcessdrainin gforceps 6 stainless steel material, curved, duplay, 7.5inches length 189 fuller’stracheostomytub e 6 outer tube has 2 flanges, inner tube is longer, made of german silver 190 kidney tray 30 usage / application – clinical material – white bronze brand – esteem packaging type – box diameter – 4.5 cm length – 19.5 cm 191 newtons colour wheelln a batch 1 not specified 192 anaesthesia kit 1 not specified 193 surgical blades 100 different size 194 endotracheal tube 2 for premature and mature size 195 corrugated rubber drainez 1 not specified 196 self retain retracter yoga and naturopathy instruments sit bath tub full imursion bath tub foot bath tub , steam bath box , vibrators , suspinsion bed pulley , belt massage machine , bar set , magnetic set belt , hip bath , spine bath , sun flow , roller massager , shoulder wheel rowing machine, tummy tonner and twisster , quardi shape table , thermolium hydrocluator water distler , trade mill , hot water tub , water neti lotah , dush unit , sutra niti , cloth dhoti , kastha patr , nebulizer , savedan yantra sitting shiro vasti cap waman pit table 232 knee enema, lumber enema, cervical enema apparatus ( 1 sets for each ) 18 set of large, medium and small size, with soft rubber beading 233 apparatus for niruh basti 12 usage / application – clinical material – white bronze diameter – 4.5 cm length – 19.5 cm brass / bronze basti netra with plastic container 234 dhoompaan apparatus 12 brass dhoompaan netra dhoom varti can be fitted. length = 36 angul = 30 inch used along with dhoompan varti stick 235 gokarna 11 brass gokarn glassware 236 westergen’s pipette for esr 60  volumetric 10ml x 3  borosilicate glass pipette graduated  material borosilicate glass  a pipette is a laboratory tool commonly used in chemistry, biology and medicine to transport a measured volume of tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 39 liquid, pipette bulb ( rubber bulbs ) are used in chemistry laboratories, by placing them on top of a glass or plastic pipette.  it serves as a vacuum source for filling reagents through a pipette and also help control the flow of liquid from the dropping. 237 haematocrit tube 60 haematocrit tubes acc. to wintrobe, soda lime glass, straight rim, round bottom, double numbered scale in red / white colour, 105 mm subdivided in 1 mm, outside diameter approx. 6.5 mm, inside diameter approx. 2.9 mm, in cartons of 20 pcs. 238 coverslips, glassware, microslides 1 set of each 11 1. coverglass rectangle 100 pc 9115s02 features shape : square type of product : coverglas s rectangle size : 18 x 18 pack of : 100 pc 2. droplet microscope glass slides ( pack of 50 slides ) 75 x 25 x 1.4 239 glass jars of different sizes 60 transparent square cube glass jars and container with silicone buckle lid ( 400ml pack of 5 ) 240 wbc pipette 60  usage: in various laboratories and medical centers  size: 0.5., 1ml with 0.1ml graduation mark features:  excellent strength  easy to use  fine finish 241 red cell pipette 60 type volumetric capacity 1 ml material borosilicate glass graduated yes red bead clearly visible, marking 0.5, 1, 101 242 improved neubauer chamber 60 depth 0.100 mm to 0.0025 mm2 applicationclinical, hospital tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 40 243 wintrobe’s tube 30 110mm long with internal bore diameter of 3mm 244 pasteur’s pipette 30 capacity 5ml usage / application chemical laboratory material plastic disposable yes weight 2.55gm height 212 mm 245 westergreens’s stand 30 capacity ( milliampere ) 6, 12 automation type manual handle material steel plastic rubber color grey, white material steel, plastic 246 urinometer 60 usage / application hospital parameters specific gravity of urine automation manual display analog application hospital, pathology lab 247 sterile vessels / bottle to collect samples 864 made of: glass bottle type: bottle capacity: 10 ml pack of: 144 248 glass rod 720 labworld glass stirring rod used for chemistry lab set of 12 pcs 150mmx6mm long, laboratory stirrer for mixing chemicals 249 test tube 750 transparent glass test tube, for laboratory, cylindrical usage / application laboratory material glass shape cylindrical color transparent volume 9 ml outer diameter 10 25 mm 250 separating funnels of various sizes 6 100 ml cylindrical separating funnel with glass stopcock and with cone & stem 165.202. type of product : cylindrical separating funnel with glass stopcock and with tender_checked ducument_equipments d: ayurved accounts acct 3 purchase 2020 21 unversity tender 2021 22 equipment tender 2021 22 tender_checked ducument_equipments .docx 41 mdr vkb zvek sa dh ek=k ctv@vu qeksfnr nj ds v / khu de@t;knk dh tk ld saxha cone & stem capacity ( ml ) : 100 bore ( mm ) : 2.5 251 glass jars with lid of different sizes 100ml, 250ml, 1000ml, 2l, 5l ( one of each size ) 36 250 ml hexagonal glass jar with lid ( fully transparent ) glass jars. id: 22739489912 lug cap 2000ml pickle glass jar cube glass jar with round jar plastic red lid for kitchen storage red cep ( 6ltr / 6000 ml / 6kg ) – pack of 1 ( 6000 ml 1 pc ) 252 capillary tubes 600 premium quality glass microcapillary tube ( 90 mm in length 100 pcs ) 253 jaxhu dkap lsv 30 colored glass set 254 jaxhu ckwvy lsv 30 colored glass bottles 255 tkj ¼xykl½ 30 glass jars 256 measuring glass 300 ml 12 material glass capacity 300 milliliters number of pieces 2 257 aquarium 3ft 2 2lit 3 etc...

Bhagwan Mahavir Hospital - Rajasthan

27414824 supply of medical items 1 auto active 8 enzymatic cleaner (srs) 2 abg cassettes (b lac) (25 nos.) 3 ro sponge 30cmx30cm 12ply (tulip) 4 bowie & dick test (srs) 5 mgp paper packing roll 100mm x 200mtr. (srs) 6 biopsy needle magnum mn1816 (bard) 7 documentation label steam (srs) 8 formaldehyde solution (fisher scientific) 9 gauze plain 7.5cmx7.5cm 12ply (tulip) 10 gauze than 16 mtr. x 80cm. tulip surgical 11 package monitoring indicator class iv (srs) 12 package monitoring indicator class vi (srs) 13 shoe cover 14 abg gas cylinder 15 biopsy gun (mc 1816) (bard) 16 bms strip steam (srs) 17 mgp paper packing roll 300mm x 200mtr. (srs) 18 truguide coaxial biopsy needle c1816b (bard) 19 acetone 25 ltr. (fisher scientific) 20 bandage 6 (14cm. x 4.5 mtr.) (tulip) 21 face mask 3 ply 22 gloves sterile 7.5 primecare p/f 23 gloves sterile 7½ truskin 24 handshield rub 500ml pink (microgen) 25 micro cover glass 22x50 no 0 blue ribbon 26 ro gauze 10cmx10cm 12 ply (tulip) 27 skin prep chg+ipa 500ml 2% (3m) 28 xylene 25 ltr. (fisher scientific) 29 anti a blend (10ml) (diagast) 30 anti b (10 ml) (diagast) 31 anti d blend (10ml) (diagast) 32 bandage 4 (9cm. x 4.5 mtr.) (tulip) 33 blood bag 450ml quadruple with sagm (t.penpol) 34 cap disposable (surgeon) (3m) 35 gloves examination medium size (sykacare) 36 gloves non sterile 7½ (truskin) 37 isoflurane 250 ml (abott) 38 microslides (blue ribbon) 72 pc 39 syringe 20 ml 21g (b. braun) 40 vdrl test card biocard syphilis 41 anti abd 3x12ml (tulip) 42 biopsy gun mc 1410 (bard) 43 blood bag 450 ml (triple) with sagm (t. penpol) 44 digital temprature & hygrometer 45 embedding cassettes white colour (imported)(sapsun) 46 ethylene oxide gas cartridge 100gms. (ernix) 47 gastrolek 100ml (lekar) 48 gloves examination medium size (instacare) 49 gloves non sterile 7 (truskin) 50 gloves sterile 8 primecare p/f 51 omnipeque inj 300mg 100ml 52 procalcitonin (pct q) 25 test (thermo 53 tab. anastroz 1mg 54 truguide coaxial biopsy needle c1816a 55 3m surgical paper tape 2 without cutter 56 acd solution 500ml (t.penpol) 57 autoclave tape (srs) 58 blood bag 350 ml (triple) with sagm (t. penpol) 59 cap disposable male 60 cotton 500 gm (tulip) 61 d 256 ( didecyl dimethyl ammonium chloride 8.70% +alkyl diethyl benzyl ammo. cholo. 8.19 62 face mask 3ply (3m) 63 gloves nitrile lavndra (medium) (halyard) 64 gloves non sterile 6½ (truskin) 65 gloves sterile 7 primecare p/f 66 isopropyl alcohol 25 lts (fisher scientific) 67 microshield 4 (747) 500 ml (schulke) 68 microshield pvp (727) 500 ml (schulke) 69 microsteril 500ml blue (microgen) 70 nitric acid 500ml (fisher scientific) 71 paraffin wax (fisher scientific) 72 povidone iodine solution 10% (handshield) 500ml (microgen) 73 sevoflurane (sevorane) 250ml (abott) 74 synthes® maintenance spray 400ml (05.001.098) 75 trima kit (terumo penpol 80300) 76 urine culture vial 50ml 77 3m surgical paper tape 3 without cutter 78 blood lancet (naulakha) 100 nos. 79 cap disposable female 80 di sodium hydrogen orthophosphate anhydrous 500gms. (fisher scientific) 81 gloves gammex 7 (ansell) 82 gloves gammex 7.5 (ansell) 83 gloves microptic encore 7.5 (ansell) 84 gloves nitrile lavndra (small) (halyard) 85 gloves sterile 6½ 86 grams stain kit hi media (k 0001) 125ml 87 hbsag card j mitra 88 hydrogen peroxide 400 ml (kaytee) 89 jamshedi needle 11g 90 mgp paper packing roll 150mm x 200mtr. (srs) 91 microgen d 125 1ltr. 92 sd code free gluco strips (100 strips) 93 soda lime mx50050 5 ltr. (drager) 94 sodium di hydrogen phosphate (di hydrate crystal pure) fisher 500gms. 95 surgical blade 15 (surgeon) 96 top & bottom bag inline filter bag 450 ml 97 zn acid fast stain kit (hi media) (a001) 125ml 98 dpx mountant 250 ml (fisher scientific) 99 ecg paper rim schiller at 2 100 embedding cassettes yellow colour 101 eosin yellow staining powder (water 102 gloves examination small size (sykacare) 103 glutaraldehide monitor strip (r&w) 104 hbsag elisa (96 test) labsystem 105 hcv elisa (96 test) labsystem 106 hiv elisa (96 test) labsystem 107 petri plates autoclable 90mm (sapsun) 108 sheep blood agar plate 1301 109 sodium hypochlorite 4% 5 ltr. (fisher 110 spinal needle 20g bd 111 surgical blade 22 (surgeon) 112 tab. zutam 20mg 113 transfer bag 300ml (t.penpol) 114 veneport 22g single way romsons 115 x ray film 14 x 17 (50 sheet) green base (kodak) 116 1292e attest rapid eur 3 hr. r.o. steam bio ind sterile 50/box 117 absolute alcohoal 500 ml 118 ambu bag silicon adult 119 appron plastic (jackson) 120 asepti lubricant 121 biopsy gun mc 1616 (bard) 122 digital weighing scale 123 ecg gel 250ml (suja) 124 ecg paper 6108t ( 50mm x 20 mtr) 125 gentlepore 2 without cutter 126 gentlepore 3 without cutter 127 giemsas stain solution 100ml (fisher scientific) 128 gloves nitrile lavndra (large) (halyard) 129 gloves protecto (romsons) 130 gloves sterile 6.5 primecare p/f 131 glutihyde 2.45% 5 ltr. (raman & well) 132 hcv card (j mitra) 133 hiv tridot card (j mitra) 134 leishman stain solution 250ml (fisher 135 methanol 2.5 ltr. (fisher scientific) 136 scalp vein set 20 (romsons) 137 sono jelly 250 ml 138 stethoscope microtone 139 surgical blade 11 (surgeon) 140 surgical blade 20 (surgeon) 141 syringe 5 ml (b.braun) 142 tips blue 1000 tips (sapsun) 143 tips white 1000 tips (sapsun) 144 aliquotis 145 barbour linen thread 40 146 barbour linen thread 60 147 biological indicator steam (srs) 148 clinieupore 2 with cutter 149 clinieupore 3 with cutter 150 cuvettes for hemocue hb301 151 documentation label eo 152 dressing scissor 6 s/b straight 153 flask 1 ltr. 154 gloves examination large size (sykacare) 155 gloves sterile 7 (truskin) 156 harmonic handpiece 220 v (hpblue) 157 hbsag elisa 96 test (meril) 158 hcv elisa 96 test (meril) 159 hiv elisa 96 test (meril) 160 laryngoscope with 4 blade 161 macconkey agar 500gms. (hi media) 162 malaria strip (pv/pf) meriscreen (meril) 163 mgp paper packing roll 200mm x 200mtr. (srs) 164 mgp paper packing roll 350mm x 200 mtr. (srs) 165 monarch 1153 label gun ink 166 nutrient agar 500gms. (hi media) 167 paraffin liquid 400 ml (allied) 168 potassium alum 500 gms. (fisher scientific) 169 reticulocytes 25ml (biolab) 170 ro sponge 40cmx40 8ply (tulip) 171 stylet set of 3 anaesthetics 172 suture needle cutting 11 (sab.) 173 syringe 10ml (b.braun) 174 syringe 5 ml (dispovan) 175 typbar 2.5ml multidose 176 visipaque 270mg 100ml 177 anti a (10ml) tulip 178 anti b (10ml) tulip 179 anti d (10ml) igm tulip 180 anti h lectin 5ml (tulip) 181 bab cock 6 ( iskon ) 182 bactorub pink handrub 500ml (raman & 183 barbour linen thread 20 184 biopsy gun (mc1825) (bard) 185 bms strip eto 186 bowl steel small regular 187 c t injector syringe 200ml (b) high pressure t connecting 188 cap disposable romsons (female) 189 chiba needle 22g x 20cm (cn 2220) 190 chiba needle 22g x 25cm (cn 2020) 191 cled agar himedia mv792 500gms. 192 clinieupore 1 with cutter 193 cuscos speculam medium 194 cyto brush 195 elastic adhesive bandage 10cm 3m 196 elastic adhesive bandage 8cm 3m 197 esr pipettes (unique) 198 filter paper 11cm (whatman) 199 formalin tab 200 gloves examination large size (instacare) 201 gloves examination small size (instacare) 202 gloves microptic encore 8 (ansell) 203 gloves sterile 7 (truskin) 204 gold (iii) chloride trihydrate 1gm 205 hbsag card test (meril) 206 hcv tredro card test (meril) 207 hiv quadro card test (meril) 208 hydrochloric acid 500ml (fisher scientific) 209 kidney tray medium 210 kiran 5 hanger mounted wall rack 211 laryngoscope with 2 blade 212 magnum needle bard 1410 213 malaria strip (pv/pf) biocard 214 maygrauwald stain solution 125ml (loba) 215 merbromin solution (400 ml) 216 microscope lense 100x labomed 217 microscope lense 40x labomed make 218 mouth piece for ndd spirometer 219 nibp cuff 220 pa coliform kit 221 patients id bands orange colour with 222 pregnancy strip (one step) 223 renovate plus instrument cleaner (srs) 224 spinal needle 22g bd 225 steple removal 226 suture needle cutting 10 (sab.) 227 suture needle rb 14 (sab.) 228 syringe 10 ml (dispovan) 229 syringe 200ml stellant (medrad) 230 test tube without cap plastic (1x500) (sapsun) 231 tourniquet cuff small 232 vascular forceps 10 (iskon) 233 vdrl test card meril syphilis 234 10 lead ecg patient cable bpl 235 1294 attest rapid readout eo bio ind sterile 236 adson non tooth forcep 5 237 alies forcep 8 (iskon) 238 ambu bag silicon child 239 ammonia solution 25% 500ml (fisher 240 anti human globulin 10ml tulip 241 artery forcep 6 curved 242 atr forceps de bakey 2mm 20cm (kls martin) 243 atr forceps de bakey 2mm 25cm (kls martin) 244 att af02 legend f2 (b 1) 2.4mm stem 245 b.p. handle no.4 246 bab cock 7 (iskon) 247 bacillol spray bottle (250ml) (raman & well) 248 barbour linen thread no. 100 249 benzoin tincture 400 ml 250 blood bag penta pack 450ml with sagm 251 bowl steel large regular 252 bp bulb silicon 253 calibration cassettes src level 3 (opti) 254 carmine staining powder 5gms. (fisher 255 castrovejo calipers 256 chart paper for sanyo refrigerator 2 6 d. 257 citrosterle 5 ltr. (fresenius) 258 clinieupore 1 without cutter 259 coupling jar plastic 260 curved artery 6.5 261 curved artery full sarated f 10 (iskon) 262 curved artery full sarated f 8 (iskon) 263 curved mosquito 5 (iskon0) 264 cuscos speculam large 265 dca media (deoxycholate citrate agar) hi media 266 deionized water 5 ltr 267 dfm 100 ecg paper roll 268 diasafe plus filter 269 disecting forcep 6 270 disposable biopsy forcep with spike for broncho fb 231d 271 disposable blanket for patient warmer 272 diss. forceps, adson 1x2 t. 15cm (kls martin) 273 dissecting forceps plain 6 274 dissecting forceps toothed 6 275 double sided kiran lead appron 0.50/0.25mmpb 276 doynes mouth geg. medium. (iskon) 277 dressing drum 9 x 11 (ss 304 grade) 278 dressing forceps adson 15cm (kls martin) 279 dressing scissor 8 straight 280 ecg clip 281 embedding cassettes red colour (sapsun) 282 face mask 3 ply (jackson) 283 fan for blood gas analyzer 284 fergusen mouth geg medium (iskon) 285 forceps overholt mini 15cm (kls martin) 286 forceps overholt mini 20cm (kls martin) 287 frame of stethoscope 288 gafchromic rtqa2 1010p film 289 gafchromic rtqa2 1417 film 290 gigasept opa 5 ltr. (schulke) 291 gigly saw handle. medium. (iskon) 292 gloves gammex 6.5 (ansell) 293 gloves microptic encore 6.5 (ansell) 294 gloves nitrile powder free n30 (small) 295 halfround plate ( laproscopy system karl stroz ) 296 harmonic ace laparoscopic shears 36cm har36 297 harmonic focus shears 9cm length har9f 298 harmonic probe ace 36e ( johnson ) 299 harmonic probe focus 17f ( johnson ) 300 harmonic probe focus 9f ( johnson ) 301 harmonic probe har17f 302 height scale 303 hemospot 304 hub cutter (crystal care) 305 hydrocholoric acid 1000ml 306 ice box container 307 infrared thermometer with lcd display 308 insulated metel outer tube with luer lock connector size 5 mm length 36cm (karl 309 jamshedi needle 13g 310 kidney tray small 311 kiran 3 hanger mounted wall rack 312 lead appron 0.5mm (kiran) 100 x 60cm 313 lens tissue holding forcep 6 (iskon) 314 lens tissue holding forcep 7.5 (iskon) 315 lobolene 5 ltr. (fisher scientific) 316 lugol iodine 5% 317 machanical stage for vision 2000 318 machintosh sheet 319 magills forcep adult 320 magnum needle bard 1825 321 malleable retractors (iskon) 322 me acetonitrile 500ml emparta (1.07031.0521) 323 me ammonium acetate emparta 500gms. (1.93217.0521) 324 me ph indicator paper ph 1.0 14.0 (6177060001) 325 me sodium hydroxide pellets emparta 500gms. (1.93102) 326 me water for chromatography 1 ltr. (6176501000) 327 mega soft universal (0845) with megasoft 328 mgp paper packing roll 250mm x 200mtr. (srs) 329 micro cover glass 18x18 no 0 blue ribbon 330 microbar hd powder 300gms. 331 micropipette fixed volume 1000ul 332 mosquito artery forceps 5 curved 333 mosquito artery forceps curved armour 334 nebulizer oxymed hepa 335 needle holder 6 336 needle holder 7 337 needle holder 8 (iskon) 338 needle holder 9 (iskon) 339 nibp cuff adult large size 340 nontooth adson forceps 5 (iskon) 341 nst red forceps ang bl 1,0 mm 20cm ( kls martin ) 342 nst red forceps bay downw b 0,1 mm 23cm ( kls martin ) 343 nst red forceps bay str bl 0,6 mm 23cm ( kls martin ) 344 nst red forceps str bl 1,0 mm 20cm ( kls martin ) 345 oxygen sensor for ventillator ( philips ) 346 perforated tray 12,15 (iskon0 347 perforator cutter (medtronic) 348 periostem elevator blunt . medium. (iskon) 349 peristaltic pump for blood gas anlyzer 350 proctoscope adult 351 punch biopsy forcep armour 352 r control board endoflator ( karl stroz ) 353 r pressure manifold with high pressure ( karl stroz ) 354 rubber ring ( laproscopy system karl stroz ) 355 seal bonnet 50/2.6 ( laproscopy system karl stroz ) 1 x 10 pcs set 356 sealing cap for trocars size 11mm 60/10 ( laproscopy system kal stroz ) 1 x 10 pcs 357 silicon face mask no. 1 358 silver nitrate 25gms. (fisher scientific) 359 skin hook 4 no (iskon) 360 sodium di hydrogen phosphate (di hydrate 361 spo2 extension cable 362 sponge holder 10 (iskon) 363 sponge holder forcep 8 364 ss hammer with fibber handle 700gms. 365 sterile hi culture collecting device 150mm x 366 straight faspators medium.(iskon) 367 straight mosquito 5 (iskon0 368 surgical blade 10 369 surgical blade 23 (surgeon) 370 suture cutting scissor 371 suture needle cutting 12 (sab.) 372 suture needle rb 12 (sab.) 373 syringe 2 ml (b. braun) 374 syringe knob 375 tc dissecting scissors curved 17.5cm (kls 376 tc dissecting scissors curved 23cm (kls 377 tc dissecting scissors curved 28.5cm (kls 378 tc dress.forceps potts smith 20cm (kls 379 tc dress.forceps potts smith 25cm (kls martin) 380 tc dressing forceps adson 15cm (kls martin) 381 tc forceps micro adson 1x2 t 15cm (kls martin) 382 tc needle holder de bakey 23cm (kls martin) 383 tc needle holder de bakey 31cm (kls martin) 384 tc needle holder hegar 20cm (kls martin) 385 tc needle holder mayo hegar 24cm (kls martin) 386 test tube without rim 12x75m glass 387 thermal paper roll 55 mm 388 tips yellow (sapsun) 389 tool 14ba30 legend 14cm 3mm ba (medtronic) 390 tool 14mh30 legend 14cm 3mm (medtronic) 391 tool 9ba30 legend 9cm 3mm ba (medtronic) 392 tool 9ba30d legend 9cm 3mm ba diam (medtronic) 393 tool 9ba40 legend 9cm 4mm ba fluted (medtronic) 394 tool f2/8ta23 legend 8cm 2.3mm taper (medtronic) 395 tooth adson forceps 5 (iskon) 396 tourniquet cuff large 397 towel clip 5 (iskon) 398 transpore 1 (3m) 399 urinal pot 400 vascular forceps 7 (iskon) 401 vascular forceps 8 (iskon) 402 x ray developer 13.5 ltr (premier) 403 xld agar m031f 100gram 404 yaunkers suction canula .medium. (iskon) 405 dry imaging film 10x12 (150 sheets} 406 dry imaging film 14x17 (100 sheets) 407 dry imaging film 8x10 (150 sheets)...

Dr. S.N.Medical College - Rajasthan

26654838 supply of reagents and chemicals for microbiology 1 paradimethyl amino benzaldehyde 2 ammonium oxalate crystals 3 actidione 4 phenyl crystal 5 sodium hydrogen phosphate (nah2po4) 6 nnnn tetramethylparaphenylenediaminedihydrochloride (oxidase powder) 7 basic carbolfuschin powder (practical grade) 8 barium chloride 9 glycerol 10 glucose anhydrous 11 iso amyl alcohol 12 malachite green (practical grade) 13 sulphanililc acid 14 toluidine blue 15 magnesium sulphate (mgso4.7h2o) 16 n acetyl l cystine 17 formaldehyde solution 40 % 18 nigrocin 19 koh pallets 20 naoh pallets 21 concentrated hcl 22 albert’s stain a and b for diphtheria (staining solution) 23 brilliant cresyl blue 24 liquid paraffin 25 sodium acetate 26 sodium sulphite 27 sodium carbonate 28 potassium bromide 29 spirit 30 poly vinyl alcohol 31 ammonium chloride 32 sodium bicarbonate extra pure 33 crystal violet (practical grade) 34 bromothymol blue powder 35 cetylpyridinium chloride 36 alpha naphthylamine 37 sodium deoxycholate 38 magnesium citrate 39 asparagine 40 lactophenol(cotton blue) 41 omera reagent/ v p reagent 42 potassium tellurite 43 cyanogen bromide 44 andrade’s indicator 45 dimethyl sulphoxide (dmso) 46 iodine crystal 47 potassium idodide 48 safarnine 49 neutral red 50 dpx mount 51 paradimethylaminocinnamaldehyde 52 alpha – naphthalamine 53 sodium hippurate 54 alpha – naphthol 55 creatinine 56 l – pyrolidonyl b – nephthalamide 57 gelatin 58 sodium borohydrate 59 cobalt chloride 60 agarrose with high eeo 61 dextrose anhydrous 62 lactose 63 maltose 64 mannitol 65 dulcitol 66 sucrose 67 xylose 68 arabinose 69 sorbitol 70 schaudinns solution 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 nonidet p 40 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm (plastic) 82 test tube racks 48 holes for 15 mm test tubes (plastic) 83 latex gloves 6.5” unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5” unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile (individually packed) 50ml capacity. 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) rad cap without gel 95 vacutainer (5 ml without edta) rad cap with gel 96 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 97 wash bottle (100 ml) 98 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 99 test tubes 12x100mm borosil 100 durham’s tube 25 mm x 6 to 7 mm dia. 101 bijou bottle with aluminium cap and silicon rubber washer 102 petri dish 110 mm glass 103 petri disc 90mm glass 104 glass funnel with 10 cm dia. (small & medium) 105 150 x 15 mm dia. glass borosil 106 pasteur pipette with rubber bulbs capacity of 1 ml 107 pasteur pipette with rubber bulbs capacity of 2 ml 108 amphotericin b 0.002 32 mcg/ml 109 caspofungin 0.002 32 mcg/ml 110 fluconazole 0.016 256 mcg/ml 111 flucytosine 0.002 32 mcg/ml 112 itraconazole 0.002 32 mcg/ml 113 micafungin 0.002 32 mcg/ml 114 posaconazole 0.002 32 mcg/ml 115 voriconazole 0.002 32 mcg/ml 116 ketoconazole 0.002 32 mcg/ml 117 adonitol 1 x25 118 arabinose 1 x25 119 cellobiose 1 x25 120 dextrose 1 x25 121 dulcitol 1 x25 122 galactose 1 x25 123 fructose 1 x25 124 inositol 1 x25 125 inulin 1 x25 126 lactose 1 x25 127 maltose 1 x25 128 mannitol 1 x25 129 mannose 1 x25 130 melibiose 1 x25 131 raffinose 1 x25 132 rhamnose 1 x25 133 salicin 1 x25 134 sorbitol 1 x25 135 sucrose 1 x25 136 trehalose 1 x25 137 xylose 1 x25 138 d arabitol 1 x25 139 colistin 25µg 100 x1 140 fusidic acid 30 µg 100 x1 141 polymyxin b 300 units 100 x1 142 nitrofurantoin 300 µg 100 x1 143 nalidixic acid 30 µg 100 x1 144 cefixime 10 µg 100 x1 145 cefpodoxime 10 µg 100 x1 146 doxycycline 30 µg 100 x1 147 co trimoxazole 30 µg 100 x1 148 erythromycin 15 µg 100 x1 149 sulphadiazine 100 µg 100 x1 150 griseofulvin 100 x1 151 terbinafine 100 x1 152 imipenem+ edta 10/750 100 x1 153 oxacillin 1 µg 100 x1 154 pipracillin 100 µg 100 x1 155 tobramycin 10 µg 100 x1 156 ticarcillin – 75 µg 100 x1 157 gatifloxacin 5/10 µg 100 x1 158 levofloxacin 5 µg 100 x1 159 clindamycin 2 µg 100 x1 160 cloxacillin 10 µg 100 x1 161 aztreonan 30 µg 100 x1 162 netilmicin 30 µg 100 x1 163 clathromycin 15 µg 100 x1 164 neomycin 30 µg 100 x1 165 norfloxacin 10 µg 100 x1 166 cefotaxime 30 µg 100 x1 167 novobiocin 5 µg 100 x1 168 bacitracin 8 µg 100 x1 169 ampicillin 10 µg 100 x1 170 cefaperazone 75 µg 100 x1 171 ceftazidime 30 µg 100 x1 172 amoxycilin 10 µg 100 x1 173 cefapim 30 µg 100 x1 174 cephadroxil 30 µg 100 x1 175 cefdinir 5 µg 100 x1 176 azithromycin 30 µg 100 x1 177 vancomycin 10 µg 100 x1 178 methicillin 5 µg 100 x1 179 lincomycin 30 µg 100 x1 180 linezolid 30 µg 100 x1 181 doripenem 10µg 100 x1 182 faropenem 5 µg 100 x1 183 fosfomycin 200 100 x1 184 piperacillin + tazobactam 100/10 µg 100 x1 185 cefoxitin 30 µg100 x1 186 meropenem 10 µg100 x1 187 nystatin100 units 188 chloramphenicol 30 mcg 100x1 189 penicillin 10 unit 190 gentamycin 120 µg 191 amikacin 30 µg 100 x1 192 amoxyclave 10 µg 100 x1 193 cefazolin 30 µg 100 x1 194 ceftizoxime 30 µg 100 x1 195 ceftriaxone 30 µg 100 x1 196 imipenum 10 µg 100 x1 197 lomefloxacin 10 µg 100 x1 198 ofloxacin 5 µg 100 x1 199 tetracycline 40 µg 100 x1 200 itraconazole 10& 30 µg 100 x1 201 ketoconazole 10 µg 100 x1 202 amphotericin b 20,50 &100 µg 100 x1 203 fluconazole 25 µg 100 x1 204 clotrimmazole 10 µg 100 x1 205 mecillinam 10 µg 100 x 1 206 mezocillin 75 µg 100 x 1 207 mupirocin 200 µg 100 x 1 208 ampicilline + clavulinic acid 10/10 µg x 10 209 mupirocin 5 µg 100 x1 210 ceftaroline 30 µg100 x1 211 miconazole 50 mcg 212 tigecycline 15 mcg 100 x1 213 voriconazole 1µg 214 fluconazole 10 µg 215 amoxycilin&clavulanic acid 20/10 mcg 216 amoxycilin&sulbactum 10/10 mcg 217 ceftazidime&clavulanic acid 30/10 mcg 218 ticarcillin&clavulanic acid 75/10 mcg 219 cefaperazone&sulbactum 75/10 mcg 220 ceftazidime&tazobactam 30/10 mcg 221 parafloxin&mezulate 222 imipenam&cilastatin 10/10 mcg 223 piperacillin&tazobactam 30/6 mcg 224 clavulanic acid 10 mg &cefotaxime 30 mg 225 ampicillin &cloxacillin10/10 mcg 226 lysine hydrochloride 227 arginine hydrochloride 228 ornithine hydrochloride 229 onpg disc 230 oxidase disc 231 bacitracin disc 232 optochine disc 233 plain disc 234 nitrate reagent disc 235 x factor disc 236 v factor disc 237 x/v factor disc 238 vibrio 0129 differential disc 239 pyr disc 240 bile esculin disc 241 kovac’s reagent disc 242 lead acetate paper strip for h2s 243 spore strips 244 cefepime/cefepime+clavulanic acid range µg/ml cpm 0.25 16 245 cefotaxime/ cefotaxime+clavulanic acid range µg/ml ctx 0.25 16 246 ceftazidime/ceftazidime+clavulanic acid range µg/ml caz 0.5 32 247 ceftriaxone/ceftriaxone+clavulanic acid range µg/ml ctr 0.025 16 248 esbl and ampc detection strip range µg/ml caz,ctx, cpm & clo with ca & taz 0.032 4 249 amikacin concentration range µg/ml 256–0.15 250 amoxycillin concentration range µg/ml 256–0.015 251 amoxycillin/clavulanic acid concentration range µg/ml 256–0.015 252 ampicillin concentration range µg/ml 256–0.015 253 cefotaxime concentration range µg/ml 32–0.002 254 cefotaxime concentration range µg/ml 256–0.015 255 ceftaroline concentration range µg/ml 32–0.002 256 ceftazidime† concentration range µg/ml 256–0.015 257 ceftriaxone concentration range µg/ml 32–0.002 258 ciprofloxacin concentration range µg/ml 32–0.002 259 clindamycin concentration range µg/ml 256–0.015 260 daptomycin concentration range µg/ml 256–0.015 261 erythromycin concentration range µg/ml 256–0.015 262 levofloxacin concentration range µg/ml 32–0.002 263 linezolid concentration range µg/ml 256–0.015 264 meropenem concentration range µg/ml 32–0.002 265 metronidazole concentration range µg/ml 256–0.015 266 oxacillin concentration range µg/ml 256–0.015 267 penicillin g concentration range µg/ml 32–0.002 268 penicillin g concentration range µg/ml 256–0.015 269 teicoplanin concentration range µg/ml 256–0.015 270 tetracycline concentration range µg/ml 256–0.015 271 tigecycline concentration range µg/ml 256–0.015 272 vancomycin concentration range µg/ml 256–0.015 273 gentamicin concentration range µg/ml 256–0.015 274 imipenem concentration range µg/ml 32–0.002 275 combi 94 for gram positive bacteria 276 combi 92 for gram positive bacteria 277 combi 512 for highly resistant pseudomonas 278 combi 677 for highly resistant staph aureus 279 meropenem with & without edta mpm+edta 1 64 mpm 4 256 280 widal kit 4x5ml rapid slide test kit 281 ra test kit 282 aso test kit 283 crp test kit 284 hbs ag card test kit 285 rapid test for detection of igg&igm antibodies against salmonella infection (lam test) 286 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 287 hepatitis a card test rapid card antibody test with control 288 rotavirus detection of rotavirus ag of all serotypes ( rapid card test) 289 h. pylori detection of all isotypes (igg, igm, iga) 290 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 291 rapid card test for troponin i for acute mi 292 rapid dengue card test for ns antigen igm and igg 293 latex agglutination for cryptococcalneoformans. 294 hiv rapid card test 3/4th generation (nib/who/naco approved) with hiv i + hiv ii detection 295 rapid test kit device for toxoplasma infection with built in control test device 296 fourth generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 297 third generation elisa kit for hcvcag and anti hcv antibody for ns3.ns4,ns5,core ag. who qualified kit should be evaluated by nib/nari/ 298 peptone water powder 299 macconkey agar 300 hichrome uti agar 301 nutrient agar 302 muller hinton agar 303 alkaline peptone water powder 304 hichrome candida differential agar 305 sda with cycloheximide 306 sda with chloramphenicol 307 potato dextrose agar base 308 rpmi 1640 309 glucose phosphate broth 310 simmons citrate agar 311 urease base agar (christensen) 312 c.zapekdox agar 313 triple sugar iron agar 314 phenyl pyruvic acid agar 315 bile esculin agar 316 hugh leifson oxidation fermentation media 317 stuart transport medium 318 dnaase agar media 319 l arginine dihydrolasehiveg medium 320 lysine decarboxylase hiveg broth 321 ornithine decarboxylase hiveg broth 322 cetrimide agar 323 anaerobic hiveg agar 324 thioglycolate agar 325 brain heart infusion broth 326 agar agar powder 327 selenite f broth 328 tetra thionate broth 329 yeast extract “cr 027” 330 bacto peptone (peptone) “rm 015” 331 tryptose soya broth 332 carry blair w/o charcoal 333 tcbs agar 334 dca aagr 335 bile salt agar 336 coagulase manitol broth base 337 soyabincasin digest broth 338 l.j. medium base 339 miu medium 340 xylose lysine deoycholate agar 341 c.l.e.d. agar with andrde indicator 342 cooked meat medium broth 343 mannitol salt agar 344 phenol phthelinediphosphate agar 345 gelatin agar 346 sugar assimilation media (nitrogen base) 500gm (1pkt) 347 hi combi dual performance media (blood culture) 348 media bottle of bact alert 3d blood culture system. (adult) 349 media bottle of bact alert 3d blood culture system (paediatric) 350 yeast nitrogen base 351 muller decarboxylase 352 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 35 litre 353 dustbin with lid ( red, yellow, black, blue, white ) with foot operated (as per office sample) (sample seen in store). 50 litre 354 deionised triple distilled water reagent grade with conductivity <1.0 355 teasing needle for fungus 356 nichrome wire 26g 357 adjustable loop holder 358 self adhesive autoclvable tape (18mmx50mt) 359 self adhesive dry heat tape (a8mmx50mt) 360 hi spark alkaline clear solution biodegradable 361 filter paper full size 46x57 cm 362 spirit lamp glass with batti 363 slide boxes wooden medium size 364 slide boxes plastic medium size 365 sterile polyester tipped cotton swab 366 para film (sealing film for glassware) 2” 367 short range ph paper sticks (3 to 9) 368 (grinded vessel) 5ml 369 (grinded vessel) 10ml 370 (grinded vessel) 20ml 371 stainless steel forceps blunt (rust resistant) 372 stainless steel forceps printed (rust resistant) 373 aluminum tray for slide horizontal & vertical 374 test tube brush for cleaning tubes small 375 test tube brush for cleaning tubes large 376 carbon brush (for centrifuge machine) 377 microscope bulb (projection lamp type 7388 6v 20w g4 409867 (helozen bulb) 378 bamboo stick 379 ph indicator paper 380 slide tray plastic 381 cellophane tape 1’ 382 surgical blade 383 aluminium foil 72 met 384 disposable micropipette tips up to 5 50 µl (yellow colour). (for blood bank ) 385 disposable micropipette tips up to 20 200 µl (yellow colour). (for blood bank and biochemistry lab & pathology lab) 386 disposable micropipette tips up to 100 1000 µl (blue colour). (for blood bank and biochemistry lab) 387 stool occult blood kit 388 micro capillary tube (90mm length 389 paper role for p.t (machine sysmex sm./horiba cell counter) size (57mm x 20m) 390 paper role for p.t (machine (large) stago/esr machine) size (114mmx20m) 391 esr pipette disposable 392 sample transport racks ( big plastic ) 393 sterile lancets for blood grouping 394 filter paper full size no i 395 disposable bone marrow aspiration needle 20 gauge 396 povidone iodine solution ip 500ml 397 eye towel (disposable) 398 ck cocktail kit (6ml) 399 glass pipette 20cm long 400 hemocytometer 401 pipettes for hemoglobin 20 micro ltr. 402 pr diagnostic kit (6ml) 403 rbc pipettes 404 staining jar (glass) 13x11x7 cm 405 staining jars 100ml 406 staining jars 500 ml 407 thermometer 408 wbc pipette 409 cell clean/ equivalent 50 ml for sysmex xs 800i 410 antiseptic solution 411 coated slides 412 metallic slide holders 413 micropipette variable 50 micro ltr to 200 414 tincture iodine 415 msn staining kit 416 mts staining kits 417 white cloth 418 trbc fluid 419 test tube holder 420 spirit rectified 421 peroxide acid 422 bond tm wash solution 10x 423 bond tm epitope retrival 2 424 bond tm epitope retrival 1 425 bond dewax solution 426 bond aspirating probe cleaning kit 427 bond polymer refine detection 428 bond open container 7ml 429 leica universal label 3000/pk 430 bond mixing stations 431 bond universal cover tiles 432 microsystem plus slide for ihc ( 25.5 x 75.5 x 1.0mm) 433 slide label 434 printer ribbon 435 eber 436 antigen retrieval buffer diva decloaker 20x 437 background snipper 438 polylysine coated slides 439 peroxidated block 1 440 betazoid dab chromogen 441 betazoid dab substrate buffer for cytocentrifuge 442 filter card for cytology (funnel reusable) 443 cell slides single circle coated 444 cell slides single circle uncoated 445 double cytology funnel (reusable) 446 cell clip for cell clipotor 447 single cytology funnel (for cryostat) 448 cryomatrix (optimal cooling tool gel coolant) 449 sarasil disinfectant 450 microtome blades (high definition) (for 6 part hematology analyser sysmex xn1000)s 451 lyser cell(wnr) 452 fluorocell (ret) 453 fluorcell plt (plt) 454 e.c.g jelly 455 microcentrifuge tube 2ml with flap cap 456 microcentrifuge tube 1.5/1.7ml conical botton with flap cap 457 cryovials leakproof, screw cap 2 ml self standing with ‘o’ seal 458 1000 ul mricropipette tips (blue) pack size 500 459 250 ul mricropipette tips (yellow) pack size 1000 460 molecular grade ethylalcohol (500 ml) 461 molecular grade isopropyl alcohol (500 ml) 462 ppe kit (with gown, goggles, shoe cover, cap, mask) 463 hand senitizer gel based (500 ml) 464 chikunguniya test card 465 disposable sterile swab sticks tubes 466 manual blood culture media bottles (solid & liquid) adults 100 ml 467 manual blood culture media bottles (solid & liquid) pediatrics 100 ml 468 bal falcon tube 30ml and 50ml ...

Government Medical College - Rajasthan

23054639 supply of chemical and reagents for microbiology lab : rate contract for 02 years 1 oxalic acid ( powder ) ( 500 gm ) 2 sodium hypochlorite ( liquid 10% ) solution ( 35 lt ) 3 acetone ( 500 ml ) 4 liquid ammonia ( 500 ml ) 5 absolute alcohol ( 500 ml ) 6 ammonium sulphate ( 500 gm ) 7 glacial acetic acid ( 500 ml ) 8 urea powder ( 500 gm ) 9 paradimethyl amino benzaldehyde ( 100 gm ) 10 ammonium oxalate crystals ( 500 gm ) 11 actidione ( 1 gm ) 12 phenyl crystal ( 500 gm ) 13 ferric ammonium sulphate ( 100 gm ) 14 di sodium hydrogen phosphate ( na2hpo4 ) ( 100 gm ) 15 sodium hydrogen phosphate ( nah2po4 ) ( 100 gm ) 16 sulphuric acid conc. ( 5 lt ) 17 nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) ( 5 gm ) 18 basic carbolfuschin powder ( practical grade ) ( 100 gm ) 19 barium chloride ( 100 gm ) 20 glycerol ( 500 ml ) 21 glucose anhydrous ( 500 gm ) 22 iso amyl alcohol ( 500 ml ) 23 malachite green ( practical grade ) ( 100 gm ) 24 sodium nitrite ( 100 gm ) 25 sulphanililc acid ( 100 gm ) 26 toluidine blue ( 100 gm ) 27 magnesium sulphate ( mgso4.7h2o ) ( 100 gm ) 28 n acetyl l cystine ( 25 gm ) 29 formaldehyde solution 40 % ( 5 lt ) 30 nigrocin ( himedia ) ( 100 gm ) 31 koh pallets ( 500 gm ) 32 naoh pallets ( 500 gm ) 33 concentrated hcl ( 500 ml ) 34 albert’s stain a and b for diphtheria ( staining solution ) ( 100 ml ) 35 brilliant cresyl blue ( 100 ml ) 36 liquid paraffin ( 500 ml ) 37 sodium acetate ( 500 gm ) 38 sodium sulphite ( 500 gm ) 39 sodium carbonate ( 500 gm ) 40 potassium bromide ( 500 gm ) 41 sodium thiosulphate ( 500 gm ) 42 spirit ( 500ml ) 43 poly vinyl alcohol ( 250ml ) 44 ammonium chloride ( 500 gm ) 45 sodium meta bisulphite ( 500 gm ) 46 sodium bicarbonate extra pure ( 500 gm ) 47 crystal violet ( practical grade ) ( 100 gm ) 48 bromothymol blue powder ( 25 gm ) 49 cetylpyridinium chloride ( 100 gm ) 50 alpha naphthylamine ( 100 gm ) 51 sodium deoxycholate ( 100 gm ) 52 magnesium citrate ( 500 gm ) 53 asparagine ( 5 gm ) 54 sodium citrate ( 500 gm ) 55 lactophenol ( cotton blue ) ( 100 ml ) 56 omera reagent / v p reagent ( 100 ml ) 57 potassium tellurite ( 25 gm ) 58 ferric chloride ( 500 gm ) 59 cyanogen bromide ( 100 gm ) 60 andrade’s indicator ( 125 ml ) 61 dimethyl sulphoxide ( dmso ) ( 500 ml ) 62 iodine crystal ( 500 gm ) 63 potassium idodide ( 250 gm ) 64 safarnine ( 100 gm ) 65 neutral red ( 100 gm ) 66 dpx mount ( 250 ml ) 67 paradimethylaminocinnamaldehyde ( 100 gm ) 68 hydrogen peroxide ( h2o2 ) ( 100 ml ) 69 alpha – naphthalamine ( 100 gm ) 70 sodium hippurate ( 100 gm ) 71 alpha – naphthol ( 100 gm ) 72 creatinine ( 100 gm ) 73 l – pyrolidonyl b – nephthalamide ( 50 gm ) 74 gelatin ( 500 gm ) 75 sodium borohydrate ( 100 gm ) 76 cobalt chloride ( 100 gm ) 77 agarrose with high eeo ( 100 gm ) 78 dextrose anhydrous ( 500 gm ) 79 lactose ( 500 gm ) 80 maltose ( 500 gm ) 81 mannitol ( 500 gm ) 82 dulcitol ( 500 gm ) 83 sucrose ( 500 gm ) 84 xylose ( 500 gm ) 85 arabinose ( 500 gm ) 86 sorbitol ( 500 gm ) 87 schaudinns solution ( 250 ml ) 88 microsporidiatrichome blue stain ( 250 ml ) 89 merthiolate iodine formalin ( 250 ml ) 90 chloroform ( 500 ml ) 91 formamide ( 500 ml ) 92 methylene blue ( 25 gm ) 93 nonidet p 40 ( 100 ml ) 94 phosphoric acid ( 500 ml ) 95 potassium di hydrogen phosphate ( 500 gm ) 96 potassium permanganate ( 500 gm ) 97 isopropanol ( 500 ml ) 98 sodium bicarbonate ( 500 gm ) 99 giemsa stain solutoin ( 1 kit ) 100 disposable syringe 5ml with needle 101 disposable syringe 10ml with needle 102 disposable syringe 20ml with needle 103 disposable syringe 50 ml with needle 104 measuring cylinder 50 ml plastic 105 measuring cylinder 100 ml plastic 106 measuring cylinder 500 ml plastic 107 measuring cylinder 1000 ml plastic 108 test tube racks 48 holes for 12 mm test tubes 109 test tube racks 48 holes for 15 mm test tubes 110 nitril gloves medium size 6.5 each 111 nitril gloves small size 6.5 each 112 latex gloves 6.5” unsterilized ( pack of 100 pc. ) 113 latex gloves 7.5” unsterilized ( pack of 100 pc. ) 114 disposable needle 18 gauge 115 staining jars 100 ml 116 plastic dropping bottle 125 ml 117 plastic dropping bottles 500 ml 118 sterile disposable petri dish 90mm 119 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 120 disposable plastic test tubes 75 x12 mm 121 beaker plastic various size 50 ml. 122 beaker plastic various size 100 ml. 123 beaker plastic various size 250 ml. 124 beaker plastic various size 500 ml . 125 beaker plastic various size 1000 ml. 126 thumb press disposable dropper 127 screw cap plastic vial 3 ml disposable with label self standing 128 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 129 vacutainer ( 5 ml without edta ) 130 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 131 . sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm, 150x12mm. ) 132 wash bottle ( 100 ml ) 133 microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 134 beaker 50 ml glass borosil ( cornig ) 135 beaker 100 ml glass borosil ( cornig ) 136 beaker 250 ml glass borosil ( cornig ) 137 beaker 500 ml glass borosil ( cornig ) 138 beaker 1000 ml glass borosil ( cornig ) 139 flat bottom conical flask 100 ml borosil ( cornig ) 140 flat bottom conical flask 200 ml borosil ( cornig ) 141 flat bottom conical flask 500 ml borosil ( cornig ) 142 flat bottom conical flask 1000ml borosil ( cornig ) 143 round flat bottom flask 100 ml borosil ( cornig ) 144 round flat bottom flask 250 borosil ( cornig ) 145 round flat bottom flask 500 ml borosil ( cornig ) 146 test tubes 12x100mm borosil 147 durham’s tube 25 mm x 6 to 7 mm dia. 148 bijou bottle with aluminium cap and silicon rubber washer 149 petri dish 110 mm borosil ( cornig ) 150 petri disc 90mm borosil ( cornig ) 151 glass cover slips 18 x 18mm, 8 x 0.1 mm english glass 152 glass funnel with 10 cm dia. ( small ) 153 glass funnel with 10 cm dia. ( medium ) 154 glass cover slip 22 x 22 mm x 0.1 mm, english glass 155 glass slide with concavities 156 test tube glass 12 x75 mm ( borosil ) 157 reagent bottle with cap ( borosil ) ( clear ) size 50 ml 158 reagent bottle with cap ( borosil ) ( clear ) size 100 ml 159 reagent bottle with cap ( borosil ) ( clear ) size 500 ml 160 reagent bottle with cap ( borosil ) ( clear ) size 1000 ml 161 reagent bottle with cap ( borosil ) ( brown ) size 50 ml 162 reagent bottle with cap ( borosil ) ( brown ) size 100 ml 163 reagent bottle with cap ( borosil ) ( brown ) size 500 ml, 164 reagent bottle with cap ( borosil ) ( brown ) size 1000 ml 165 150 x 15 mm dia., glass borosil 166 pasteur pipette with rubber bulbs capacity of 1 ml 167 pasteur pipette with rubber bulbs capacity of 2 ml 168 amphotericin b 169 micafungin 170 caspofungin 171 posaconazole 172 fluconazole 173 voriconazole 174 flucytosine 175 ketoconazole 176 itraconazole 177 adonitol 1 x25 178 arabinose 1 x25 179 cellobiose 1 x25 180 dextrose 1 x25 181 dulcitol 1 x25 182 galactose 1 x25 183 fructose 1 x25 184 inositol 1 x25 185 inulin 1 x25 186 lactose 1 x25 187 maltose 1 x25 188 mannitol 1 x25 189 mannose 1 x25 190 melibiose 1 x25 191 raffinose 1 x25 192 rhamnose 1 x25 193 salicin 1 x25 194 sorbitol 1 x25 195 sucrose 1 x25 196 trehalose 1 x25 197 xylose 1 x25 198 d arabitol 1 x25 199 colistin 25μg 100 x1 200 oxacillin 1 μg 100 x1 201 fusidic acid 30 μg 100 x1 202 pipracillin 100 μg 100 x1 203 polymyxin b 300 units 100 x1 204 tobramycin 10 μg 100 x1 205 nitrofurantoin 300 μg 100 x1 206 ticarcillin – 75 μg 100 x1 207 nalidixic acid 30 μg 100 x1 208 gatifloxacin 5 / 10 μg 100 x1 209 cefixime 10 μg 100 x1 210 levofloxacin 5 μg 100 x1 211 cefpodoxime 10 μg 100 x1 212 clindamycin 2 μg 100 x1 213 doxycycline 30 μg 100 x1 214 cloxacillin 10 μg 100 x1 215 co trimoxazole 30 μg 100 x1 216 aztreonan 30 μg 100 x1 217 erythromycin 15 μg 100 x1 218 netilmicin 30 μg 100 x1 219 sulphadiazine 100 μg 100 x1 220 clathromycin 15 μg 100 x1 221 griseofulvin 100 x1 222 neomycin 30 μg 100 x1 223 terbinafine 100 x1 224 norfloxacin 10 μg 100 x1 225 imipenem+ edta 10 / 750 100 x1 226 cefotaxime 30 μg 100 x1 227 novobiocin 5 μg 100 x1 228 amikacin 30 μg 100 x1 229 bacitracin 8 μg 100 x1 230 amoxyclave 10 μg 100 x1 231 ampicillin 10 μg 100 x1 232 cefazolin 30 μg 100 x1 233 cefaperazone 75 μg 100 x1 234 ceftizoxime 30 μg 100 x1 235 ceftazidime 30 μg 100 x1 236 ceftriaxone 30 μg 100 x1 237 amoxycilin 10 μg 100 x1 238 imipenum 10 μg 100 x1 239 cefapim 30 μg 100 x1 240 lomefloxacin 10 μg 100 x1 241 cephadroxil 30 μg 100 x1 242 ofloxacin 5 μg 100 x1 243 cefdinir 5 μg 100 x1 244 tetracycline 40 μg 100 x1 245 azithromycin 30 μg 100 x1 246 itraconazole 10& 30 μg 100 x1 247 vancomycin 10 μg 100 x1 248 ketoconazole 10 μg 100 x1 249 methicillin 5 μg 100 x1 250 amphotericin b 20, 50 &100 μg 100 x1 251 lincomycin 30 μg 100 x1 252 fluconazole 25 μg 100 x1 253 linezolid 30 μg 100 x1 254 clotrimmazole 10 μg 100 x1 255 doripenem 10μg 100 x1 256 mecillinam 10 μg 100 x 1 257 faropenem 5 μg 100 x1 258 mezocillin 75 μg 100 x 1 259 fosfomycin 200 100 x1 260 mupirocin 200 μg 100 x 1 261 piperacillin + tazobactam 100 / 10 μg 100 x1 262 ampicilline + clavulinic acid 10 / 10 μg x 10 263 cefoxitin 30 μg100 x1 264 mupirocin 5 μg 100 x1 265 meropenem 10 μg100 x1 266 ceftaroline 30 μg100 x1 267 nystatin100 units 268 miconazole 50 mcg 269 chloramphenicol 30 mcg 100x1 270 tigecycline 15 mcg 100 x1 271 penicillin 10 unit 272 voriconazole 1μg 273 gentamycin 120 μg 274 fluconazole 10 μg 275 polymyxin –b 50 units 276 rifampicin 30 μg 277 daptomycin 278 gentamycin 30 μg 279 amoxycilin&clavulanic acid 20 / 10 mcg 280 amoxycilin&sulbactum 10 / 10 mcg 281 ceftazidime&clavulanic acid 30 / 10 mcg 282 ticarcillin&clavulanic acid 75 / 10 mcg 283 cefaperazone&sulbactum 75 / 10 mcg 284 ceftazidime&tazobactam 30 / 10 mcg 285 parafloxin&mezulate 286 imipenam&cilastatin 10 / 10 mcg 287 piperacillin&tazobactam 30 / 6 mcg 288 clavulanic acid 10 mg &cefotaxime 30 mg 289 ampicillin &cloxacillin10 / 10 mcg 290 lysine hydrochloride 1 x25 ( amino acid disc ) 291 arginine hydrochloride 1 x25 ( amino acid disc ) 292 ornithine hydrochloride 1 x25 ( amino acid disc ) 293 onpg disc 294 oxidase disc 295 bacitracin disc 296 optochine disc 297 plain disc 298 nitrate reagent disc 299 x factor disc 300 v factor disc 301 x / v factor disc 302 vibrio 0129 differential disc 303 pyr disc 304 bile esculin disc 305 kovac’s reagent disc 306 lead acetate paper strip for h2s 307 spore strips 308 cefepime / cefepime+clavulanic acid ( cpm 0.25 16 : cpm+ca 0.064 4 ) 309 cefotaxime / cefotaxime+clavulanic acid ( ctx 0.25 16 : ctx+ca 0.016 1 ) 310 ceftazidime / ceftazidime+clavulanic acid ( caz 0.5 32 : caz+ca 0.064 4 ) 311 ceftriaxone / ceftriaxone+clavulanic acid ( ctr 0.025 16 : caz+ca 0.016 1 ) 312 esbl and ampc detection strip ( caz, ctx, cpm & clo with ca & taz 0.032 4 : caz, ctx, cpm & clo 0.125 16 ) 313 amikacin ( 256–0.15 ) 314 amoxycillin ( 256–0.015 ) 315 amoxycillin / clavulanic acid ( 256–0.015 ) 316 ampicillin ( 256–0.015 ) 317 cefotaxime ( 32–0.002 ) 318 cefotaxime ( 256–0.015 ) 319 ceftaroline ( 32–0.002 ) 320 ceftazidime† ( 256–0.015 ) 321 ceftriaxone ( 32–0.002 ) 322 ciprofloxacin ( 32–0.002 ) 323 clindamycin ( 256–0.015 ) 324 daptomycin ( 256–0.015 ) 325 erythromycin ( 256–0.015 ) 326 polymyxine ( 256 .016 ) 327 cefoxitin ( 256 .016 ) 328 levofloxacin ( 32–0.002 ) 329 linezolid ( 256–0.015 ) 330 meropenem ( 32–0.002 ) 331 metronidazole ( 256–0.015 ) 332 oxacillin ( 256–0.015 ) 333 penicillin g ( 32–0.002 ) 334 penicillin g ( 256–0.015 ) 335 teicoplanin ( 256–0.015 ) 336 tetracycline ( 256–0.015 ) 337 tigecycline ( 256–0.015 ) 338 vancomycin ( 256–0.015 ) 339 gentamicin ( 256–0.015 ) 340 imipenem ( 32–0.002 ) 341 colistin ( 256 .016 ) 342 fosfomycin ( 256 .016 ) 343 combi 94 for gram positive bacteria ( od 298 ) 344 combi 92 for gram negative bacteria ( od 293 ) 345 combi 512 for highly resistant pseudomonas ( od 88 ) 346 combi 677 for highly resistant staph aureus ( od 277 ) 347 meropenem with & without edta ( mpm+edta 1 64 mpm 4 256 ) 348 rapideccarba np 349 widal kit 4x5ml rapid slide test kit 350 mp card test ( for antigen pan, pf & pv detection ) 351 ra test kit 352 aso test kit 353 crp test kit 354 rpr 3rd generation / vdrl 355 hbs ag card test kit 356 hcv card test kit 357 rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) 358 rapid specific test for syphilis ( strip test ) kit 3rd generation 359 indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit 360 hepatitis a card test rapid card antibody test with control 361 rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) 362 h. pylori detection of all isotypes ( igg, igm, iga ) 363 brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml 364 rapid card test for troponin i for acute mi 365 rapid dengue card test for ns antigen igm and igg 366 latex agglutination for cryptococcalneoformans. 367 hiv rapid card test 4th generation ( nib / who / naco approved ) 368 rapid test kit device for toxoplasma infection with built in control test device 369 peptone water powder 370 macconkey agar 371 hichrome uti agar 372 nutrient agar 373 muller hinton agar 374 alkaline peptone water powder 375 hichrome candida differential agar 376 sda with cycloheximide 377 sda with chloramphenicol 378 potato dextrose agar base 379 rpmi 1640 380 glucose phosphate broth 381 simmons citrate agar 382 urease base agar ( christensen ) 383 c.zapekdox agar 384 triple sugar iron agar 385 phenyl pyruvic acid agar 386 bile esculin agar 387 hugh leifson oxidation fermentation media 388 stuart transport medium 389 dnaase agar media 390 l arginine dihydrolasehiveg medium 391 lysine decarboxylase hiveg broth 392 ornithine decarboxylase hiveg broth 393 cetrimide agar 394 anaerobic hiveg agar 395 thioglycolate agar 396 brain heart infusion broth 397 agar – agar powder 398 selenite f broth 399 tetra thionate broth 400 yeast extract “cr 027” 401 bacto peptone ( peptone ) “rm 015” 402 tryptose soya broth 403 carry blair w / o charcoal 404 tcbs agar 405 dca aagr 406 bile salt agar 407 coagulase manitol broth base 408 soyabincasin digest broth 409 l.j. medium base 410 miu medium 411 xylose lysine deoycholate agar 412 c.l.e.d. agar with andrde indicator 413 cooked meat medium broth 414 mannitol salt agar 415 phenol phthelinediphosphate agar 416 gelatin agar 417 sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) 418 cetrimide agar 419 hi combi dual performance media ( blood culture ) 420 bact alert blood culture bottle ( adult ) 421 bact alert blood culture bottle ( paediatric ) 422 yeast nitrogen base 423 muller decarboxylase 424 biomedical waste bags ( red, yellow, black, blue ) 25 lit. capacity 425 dustbin ( red yellow black blue ) 25 lt. 426 deionised triple distilled water reagent grade with conductivity <1.0 427 liquid soap dettol 428 teasing needle for fungus 429 markers blue red and black, finetip 430 nichrome wire 26g 431 adjustable loop holder 432 self adhesive autoclvable tape ( 18mmx50mt ) 433 self adhesive dry heat tape ( a8mmx50mt ) 434 hand guard disinfectant gel 435 hi spark alkaline clear solution biodegradable 436 filter paper full size 46x57 cm 437 spirit lamp glass with batti 438 slide boxes wooden / plastic 439 sterile polyester tipped swab 440 para film ( sealing film for glassware ) 2” 441 short range ph paper sticks ( 3 to 9 ) 442 ( grinded vessel ) 5, 10, 20ml 443 halogen bulb for microscope 6 v, 20w 444 stainless steel forceps blunt ( rust resistant ) 445 stainless steel forceps printed ( rust resistant ) 446 match box 447 disposable gloves 448 broom 449 disposable face masks 450 disposable apron 451 disposable shoe cover 452 disposable caps 453 aluminum tray for slide horizontal & vertical 454 phenyl solution 455 glass marking pencil white & red 456 test tube brush for cleaning tubes small / large 457 diamond pencil 458 rubber tourniquet 459 triple layer surgical mask with elastic earband 460 serology reporting register 461 koh reporting form 462 culture reporting form 463 serology reporting form 464 carbon brush ( for centrifuge machine ) 465 microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) 466 bamboo stick 467 cotton roll 468 ph indicator paper 469 slide tray plastic 470 cellophane tape 1’ 471 surgical blade 472 aluminium foil 473 match boxes 474 tissue paper roll 475 distilled water 476 disposable sterile container for urine sample / sputum for c / s 477 disposable plastic test tube 75x12mm 478 falcons tubes 50ml 479 falcons tubes 15ml 480 hav igm ( 96 well ( 1kit ) ) 481 hev igm ( 96 well ( 1kit ) ) 482 anti hbs ag ( 96 well ( 1kit ) ) 483 anti adenovirus iga ( 96 well ( 1kit ) ) 484 anti rotavirus antigen in stool elisa & serum ( 96 well ( 1kit ) ) 485 anti ebv igm ( 96 well ( 1kit ) ) 486 anti herpes simplex 2 igg ( 96 well ( 1kit ) ) 487 anti herpes simplex 2 igm ( 96 well ( 1kit ) ) 488 anti parainfluenzaigg ( 96 well ( 1kit ) ) 489 anti parainfluenza iga ( 96 well ( 1kit ) ) 490 measles igm ( 96 well ( 1kit ) ) 491 rubella igm ( 96 well ( 1kit ) ) 492 anti varicella zoster igg ( 96 well ( 1kit ) ) 493 anti varicella zoster igm ( 96 well ( 1kit ) ) 494 elisa ns1 antigen for dengue ( 96 well ( 1kit ) ) 495 anti respiratory syncitial virus igm ( 96 well ( 1kit ) ) 496 anti measles igg, igm ( 96 well ( 1kit ) ) 497 anti parainfluenzaigm ( 96 well ( 1kit ) ) 498 mumps igm ( 96 well ( 1kit ) ) 499 anti nmda receptor encephalitis ( 96 well ( 1kit ) ) 500 elisa for enterovirus ( 96 well ( 1kit ) ) 501 anti varicella zoster iga ( 96 well ( 1kit ) ) 502 hcvigm elisa ( 96 well ( 1kit ) ) 503 anti ds dna ( 96 well ( 1kit ) ) 504 ( apla ) anti phospholipid antibody igg, igm ( 96 well ( 1kit ) ) 505 ttg iga ( 96 well ( 1kit ) ) 506 dengue antigen elisa ( 96 well ( 1kit ) ) 507 chikunguniyaigm elisa ( 96 well ( 1kit ) ) 508 anti h. pylori iga ( 96 well ( 1kit ) ) 509 anti h. pylori igg elisa ( 96 well ( 1kit ) ) 510 anti rota virus ( antigen ) elisa ( 96 well ( 1kit ) ) 511 anti japanese b encephalitis igm ( 96 well ( 1kit ) ) 512 anti paravovirus 19 igg ( 96 well ( 1kit ) ) 513 anti paravovirus 19 igm ( 96 well ( 1kit ) ) 514 anti sm ( 96 well ( 1kit ) ) 515 anti rnp ( 96 well ( 1kit ) ) 516 anti panca, canca ( 96 well ( 1kit ) ) 517 scrub typhus ( 96 well ( 1kit ) ) 518 anti cardilopin igg ( 96 well ( 1kit ) ) 519 anti cardilopin igm ( 96 well ( 1kit ) ) 520 anti echinococcaligg ( 96 well ( 1kit ) ) 521 hbs antibodies ( 96 well ( 1kit ) ) 522 anti hsv 1 igm ( 96 well ( 1kit ) ) 523 anti hsv 1 igg ( 96 well ( 1kit ) ) 524 cmv igm ( 96 well ( 1kit ) ) 525 cmv –igg ( 96 well ( 1kit ) ) 526 anti parainfluenzaigg ( 96 well ( 1kit ) ) 527 anti parainfluenzaigm ( 96 well ( 1kit ) ) 528 anti brucellaigg ( 96 well ( 1kit ) ) 529 anti brucellaigm ( 96 well ( 1kit ) ) 530 anti thyroid peroxidase antibodies ( microsomall ) ( 96 well ( 1kit ) ) 531 west nile igm elisa ( 96 well ( 1kit ) ) 532 hbeag elisa ( 96 well ( 1kit ) ) 533 hbs ag elisa ( 96 well ( 1kit ) ) 534 anti neulear antibody ( elisa ) ( 96 well ( 1kit ) ) 535 nucleic acid isolation ( rna & dna both ) ( 250 rxn ) 536 nucleic acid isolation kits ( from blood & bacterial culture ) ( 250 rxn ) 537 viral rna isolation kit ( 250 rxn ) 538 viral dna isolation kit ( 250 rxn ) 539 gel extraction / purification kit ( 250 rxn ) 540 quantitative estimation pcr kits for hbv ( available pack size ) 541 quantitative estimation pcr kits for hcv ( 100 rxn ) 542 quantitative estimation pcr kits for hpv 16 ( 100 rxn ) 543 quantitative estimation pcr kits for hpv 18 ( 100 rxn ) 544 rt pcr kits for japanese enchephalitis ( 100 rxn ) 545 rt pcr kit for zika virus. ( 100 rxn ) 546 rt pcr multiplex kits for viral meningitis ( ( ftd neuro 9 ) ( 100 rxn ) 547 rt pcr multiplex kits for neonatal meningitis ( 100 rxn ) 548 rt pcr multiplex kits for respiratory tract virus ( 100 rxn ) 549 quantitative estimation pcr kits for viral encephalitis. ( 100 rxn ) 550 steel instrument tray medium size ( 1 pc. ) 551 lab trays ( 6 ) 450 x 350 x 75 ( 1 pc. ) 552 cryo box ( 100 places ) ( plastic ) ( 5 pc. / per box ) 553 falcons tubes50ml, ( 100 pc. / pkt. ) 554 falcons tubes 15 ml ( 100 pc. / pkt. ) 555 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) a )       2 ml ( 500 pc. / pkt. ) 556 micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) b )       1.5 ml ( 500 pc. / pkt. ) 557 brush ( nylon bristles seated in galvanized wire with a wire handle ) ( 90 x 150 x 340 mm ) 558 volumetric flask brush ( 50 x 70 x 170 mm ) 559 beaker brush ( 30 x 110 x 260 mm ) 560 test tube brush 561 float rack ( 6 pc. / pkt. ) 562 pipette stands for every pipette set vertical revolving ( 1 pc. ) 563 multipurpose racks / stand ( 5 pc. / pkt. ) 564 laboratory spatula 565 micro spatula, set of 3 (  220 mm ) 566 spatula, spoon end ( ) 567 thermometer, mercury ( 0 150°c x 1°c ) 568 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 50 ml ) 569 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 100 ml ) 570 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 500 ml ) 571 beaker ( graduated, with spout ) beaker with handle, graduated, with spout ( 1000 ml ) 572 flat bottom conical flask ( with screw cap, graduated, clear ) ( 100 ml ) 573 flat bottom conical flask ( with screw cap, graduated, clear ) ( 250 ml ) 574 flat bottom conical flask ( with screw cap, graduated, clear ) ( 1000 ml ) 575 glass funnel ( 5 cm dia. ) 576 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 577 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 578 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 579 reagent bottle clear ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 580 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 50 ml ) 581 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 100 ml ) 582 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 500 ml ) 583 reagent bottle amber brown ( with screw cap, wide mouth, graduated, leakage free ) ( 1000 ml ) 584 measuring cylinder plastic ( 100 ml ) 585 measuring cylinder plastic ( 500 ml ) 586 measuring cylinder plastic ( 1000 ml ) 587 nitril gloves small ( 6.5 inch. ( 100 / pack ) 588 latex gloves ( 6.5 inch. ( 100 / pack ) 589 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 0.5 – 10 μl ) 590 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 10 – 100 μl ) 591 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 20 – 200 μl ) 592 micro pipette tips for pcr specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ( 100 – 1000 μl ) 593 beaker plastic ( with spout, graduated, autoclavable ) ( 50 ml ) 594 beaker plastic ( with spout, graduated, autoclavable ) ( 100 ml ) 595 beaker plastic ( with spout, graduated, autoclavable ) ( 500 ml ) 596 beaker plastic ( with spout, graduated, autoclavable ) ( 1000 ml. ) 597 screw cap plastic vial 2 ml disposable with label self standing, autoclavable ( 500 pc / pkt. ) 598 k3 edta blood collection vials vaccunized 599 pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat cap ( 500 pc / pkt. ) 600 pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml ( 500 pc / pkt. ) 601 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 602 micro amp fast reaction caps ( 8 tubes / strips ) compatable in use with quants studio ( abi ) system  ( 0.2 ml ) 603 micro amp fast reaction tubes ( 8 tubes / strips ) compatable in use with 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 604 micro amp fast reaction caps ( 8 tubes / strips ) 7500 fast dx system, stepone,  steponeplus system  ( 0.1 ml ) 605 ptfe magnetic stir bar retrievers ( 18 24 inch ) 606 rapid test for detection of igm antibodies against salmonella infection ( lam test ) ( 96 test ) 607 rapid specific test for syphilih ( card test ) kit 3rd generation ( igg / igm / iga ) tpha ( 96 test ) 608 hepatitis a card test rapid card antibody test with control ( 96 test ) 609 rotavirus detetion of rota virus detecation ag of all serotypes ( 96 test ) 610 h. pylori detection of all isotypes ( igg, igm, iga ) ( 96 test ) 611 brucellaantibodyslide agglutination test b. abortus 5 mlb.mclitersis 5ml ( 96 test ) 612 rapid card test for troponin i foracute mi ( 96 test ) 613 rapid dengue card test for ns1 antigen igm and igg ( 96 test ) 614 hiv rapid card test4th generation ( nib / who / naco approved ) ( 96 test ) 615 acetone 4x2.5 ltr ( 4x2.5 ltr ) 616 agar agar powder 2x500 gm ( 2x500 gm ) 617 amikacin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 618 amoxycillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 619 amoxyclave 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 620 ampicillin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 621 aslo 5 box = 500 ( 1 box = 500 ) 622 azithromycin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 623 bijou bottle with aluminium cap and silicon rubber washer ( each ) ( each ) 624 blue tips ( 5000 nos ) ( 5000 ) 625 cefaperazone 75μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 626 cefapim 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 627 cefdinir 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 628 cefixime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 629 cefotaxime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 630 cefoxitin 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 631 cefpodoxime 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 632 ceftazidime 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 633 ceftriaxone 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 634 cephadroxil 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 635 chromogenic uti agar ( 5x500 gm ) ( 5x500 gm ) 636 clindamycin 2μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 637 colistin 25μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 638 disinfecctent soap ( 150 nos. ) ( 150 nos. ) 639 disinfectent solution for hand wash 500ml ( 20 nos ) ( 20 nos ) 640 disposable container for urine ( 40000 nos. ) ( 40000 nos. ) 641 disposable plastic test tube 75x12ml ( 10000 nos. ) ( 10000 nos. ) 642 distilled water ( 2000 nos. ) ( 5000 nos. ) 643 gulcose phosphate broth ( 2x500 gm ) ( 2x500 gm ) 644 hugh leifson oxidation fermentation ( 2x500 gm ) ( 2x500 gm ) 645 imipenum 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 646 itraconazole 10&30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 647 ketoconazole 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 648 levofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 649 linezolid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 650 lomefloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 651 mac conkey agar ( 6x500 gm ) ( 6x500 gm ) 652 methicillin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 653 mr. vp medium ( 2x500 gm ) ( 1x500 gm ) 654 muller hinton agar ( 10x500 gm ) ( 5x500 gm ) 655 nalidixic acid 30μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 656 nitrofurantoin 300μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 657 normal saline solution ( 500mlx510 ) ( 500mlx510 ) 658 novobiocin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 659 nrfloxacin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 660 nutrient agar ( 10x500 gm ) ( 10x500 gm ) 661 ofloxacin 5μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 662 paraffin liquid ( 2x500 ml ) ( 2x500 ml ) 663 peptone water ( 2x500 gm ) ( 2x500 gm ) 664 pipracillin 100μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 665 procalcitonin ( 300 box = 3000 test ) ( 300 box = 3000 test ) 666 rpmi 1640 ( 6x500 ml ) ( 6x500 ml ) 667 simmons citrate agar ( 2x500 gm ) ( 2x500 gm ) 668 spirit lamp ( 2 nos ) ( 5 nos ) 669 sterile cotton swab in screw capped polypropylene tube ( 20x100 = 2000 nos ) ( 20x100 = 2000 nos ) 670 sterile disposable petri dises 99 mm ( 200x100=20, 000 nos ) ( 200x100=20, 000 nos ) 671 suborounds d extrose agar with cyclohexmide ( 2x500 gm ) ( 2x500 gm ) 672 teasing needle for fungus ( 10xeach ) ( 5xeach ) 673 test tube borosilicate with rim ( 12x100 ) ( 10000 ( piece ) tube nos ) ( 10000 ( piece ) tube nos ) 674 test tube borosilicatee with rim ( 18*150 ) ( 1000 nos ) ( 1000 nos ) 675 test tube brushes for cleaning tube small / large ( 50 nos ) ( 50 nos ) 676 tissue paper roll ( 4450 nos ) ( 4450 nos ) 677 tobramycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 678 triple blood bag with sagm 350ml ( 12000 nos ) ( 12000 nos ) 679 urease base agar ( 2x500 gm ) ( 2x500 gm ) 680 vancomycin 10μg 100x1 ( 50vl=5000 disc ) ( 50vl=5000 disc ) 681 xyline ( 1x25 ltr ) ( 1 bottle ) 682 sterile cotton swab in screw capped polyprohylietube ( 10x100 box ) ( 10x100 box ) 683 hicrome rapid mrsa agar base ( 1x500gm ) ( 1x500gm ) 684 sabouraved agar+chlormphnicol+ gentamicin ( 1x500gm ) ( 1x500gm ) 685 loeffler serum slant ( 100 slants ) ( 50 slants ) 686 v.t.m. ( 500 nos ) ( 500 nos ) 687 ethanol ( 1 bottle ) 688 isoamylalcohal ( 1 bottle ) 689 paradimethyl diamobenjaldenyde ( 100 ml ) 690 hcl ( 1 ltr ) 691 h2o2 ( 1 ltr ) 692 gycerol ( 1 ltr ) 693 lpcb ( 1 ltr ) 694 grams staining ( 1 bottle ) 695 zn staining ( 1 bottle ) 696 albert staining a&b ( 1 bottle each for a&b ) 697 bhi ( brain heart infusion ) ( 1 bottle ) 698 foceps ( 12 pcs ) 699 methanol ( 5 ltr ) 700 bile exulin agar ( 1x500 ) 701 ppa ( phenyl pyrumi acid ) ( 1x500 ) 702 feu3 ( 100 ml ) 703 dtm ( dermatophyte testing media ) ( 1x500 ) 704 pda ( potato dextrose agar ) ( 2x500 ) 705 formaline ( 10 ltr ) 706 paraffin oil ( 1 ltr ) 707 petri dish ( 15000 ) 708 tecopanin anitibiotic ( 50vl=5000 disc ) 709 ciprofloxacin ( 50vl=5000 disc ) 710 cefuroxime ( 50vl=5000 disc ) 711 gentamycin ( 50vl=5000 disc ) 712 piperacillin & tazobactum ( 50vl=5000 disc ) 713 ampicillin and sulbactum ( 50vl=5000 disc ) 714 ticarcillin & clavulinic ( 50vl=5000 disc ) ...

Medical College - Rajasthan

22996828 supply of chemical & reagents for microbiology lab : rate contract for 02 years oxalic acid, sodium hypochloride solution, acetone, liquid ammonia, absolute alcohol, ammonium sulphate, glacial acetic acid, urea powder, paradimethy amino benzaledehyde, ammonium oxalate crystals, actidione, phenyl crystal, ferric ammonium sulphate, di sodium hydrogen phosphate, sodium hydrogen phosphate, sulphuric acid, basic carbofuischin powder, barium chloride, glycol, glucose alcohol, malachite green, sodium nitrate, sulphanillic acid, toluidine blue, magnesium sulphate, n acety l cystine, formaldehyde solution, nigrocin, koh pallets, concentrated hcl, albert stain a and b for diphtheria, brilliant cresyl blue, liquid paraffin, sodium acetate, sodium sulphite, potassium bromide, sodium, thiosulphate, spirit, poly vinyl alcohol, ammonium chloride, sodium metal bisulphite, sodium deoxycholate, magnesium citrate, asparagine, sodium citrate, lactophenol, omera regagent vp reagent, ferric chloride, cyanogen bromide, andrades indicator, dimethyl sulphodie, iodine crystal, safarmine, neutral red, dpx mount, hydrogen peroxide, sodium hippurate, gelatin, sodium borohydrate, cobalt chloride, dextrose anhydrous, lactose, maltose, mannitol, dulcitol, xylose, arabinose, sorbitol, schaudinn solution, microsporidia trichome blue stain, chloroform, formamide, methylene blue, phosphoric acid, potassium di hydrogen phosphate, isopropanol, sodium bicarbonate, giemsa stain solution, disposable syringe, measuring cylinder, test tube rack, nitril gloves, latex gloves, disposable needle, staining jars, plastic dropping bottle, sterile disposable petri dish, disposable container, plastic test tubes, thumb press disposable dropper, screw cap plastic vial 3 ml disposable with label self standing, autoclavable tubes, vacutainer, wash bottle, microslide, breaker, flat bottom conical flask, test tubes, durham tubes, glass funnel with 10 cm dia, glass cover, glass slide with concavities, reagent bottle with cap, pasteur pipette rubber bulbs, antifungal enzyme strips, disc for carbohydrate fermentation test dics, antibiotics disk and antifungal disk, tetracycline, vancomycin, azithromycin, fluconazole, mezocillin, fosfomycin, piperacillin, meropenem, nystain, miconazole, tigercyline, penicillin, voriconazole, gentamycin, fluconazole, rifampicin, daptomycin, gentamycin, amoxycilln&clavulanic acid, ticarcillin&sulbactum, pyr disc, bile esculin disc, kova regaent disc, lead acetate paper, cofepime, ceftazidime, esbl and ampc detection strip, e strip, high media antibiotic, rapiodedcarba np, serological test, widal kit, rapid slide test kit, mp card test, ra test kit, aso test kit, crp test kit, rpr generation, hbs ag card test kit, hcv card test kit, rapid specific test, hiv rapid card test, rapid test kit device, muller hinton agar, alkaline petone water powder, hichrome candida differential agar, sda with cycloheximide, potato dextrose agar base, rpmi 1640, glucose phosphate broth, simmons citrate agar, urease base agar, triple sugar iron agar, phenyl pyruvic acid agar, dna ase agar media, cetrimide agar, thioglycolate agar, brain heart infusion broth, tcbs agar, dca agar, bile salt agar, coagulase manitol broth base, l medium base miu medium, cied agar with andrde indicator, cooked meat medium broth, phenol phtheline diphosphate agar, geltain agar, cetrimide agar, sugar assimilation media, h1 comi dual performance media, bact alert blood culture bottle, yeast nitrogen base, muller decarboxylase, biomedical waste bags, dustbin, deionised triple distilled water reagent grade with conducitivity, liquid soap dettol, teasing needle for fungus, markers blue red and black finetip, adjustable loop holder, self adhesive autoclavable tape, self adhesive dry heat tape, hand guard disinfectant gel, display face masks, disposable shoes cover, disposable caps, phenyl solution, glass marking pencil white and red, test tube brush, diamond pencil, triple layer surgical mask with elastic earband, koh reporting form, culture reporting form, carbon brush, serology reporting form, microscope bulb, cotton roll, ph indicator paper, slide tray, cellophante tape, surgical blade, aluminium foil, distilled water falcons tubes, hav igm, anti hbs ag, anti adenovirus, anti rotavirus antgen in stool elisa and serum, anti herps simplex, measles igm, rubella igm, anti varicella zoster igg, elisa nsi antigen for dengue, anti measles igg igm, mumps igm, anti nmda receptor encephalitis, anti ds dna, dengue antigen elisa, anti rota virus elisa, anti paravovirus, anti sm, anti thyroid peroxidase antibodies, viral rna isolation kit, gel extraction/purification kit, quantitative estimation pcr kits, steel instrument tray, falcoms tubes, micro centrifuge tubes, test tube brush, volumetric flask brush, spatula spoon end, thermometer mercury, glasss ware, breaker with handle, graduated with spout, flat bottom conical flask, reagent bottle clear, measuring cylinder plastic, nitril gloves small, latex gloves, micro pipette tips, breaker plastic, k3 edta blood collection vials vaccunized, pcr tubes autoclavable, pcr tubes, micro amp fast reaction tubes, ptfe magnetic stir bar retrievers, rapid test, hepatitis a card test rapid card antibody test with control, hiv rapid card test, acetone, agar agar powder, amikacilin, aslo 5 box, azithromycin, cefdinir, cefoxitin, ceohadroxil, chromogentic uti agar, disposable plastic test tube, itraconazole, ketoconazole, muller hinton agar, novobiocin, nutrient agar, peptone water, paraffin liquid, rpmi 1640, test tube brushes, tissue paper roll, tobramycin, triple blood bag with sagm, vancomycin, xylene, sterile cotton swab in screw capped polyprohylietube, vtm, ethanol, isoamylachol, hcl, h202, glycerol, lpcb, gram staining, zn staining, bhi, foceps, methanol, bile exulin agar, ppa, feu3 dtm, pda, formaline, petri dish, tecopanin antibiotic, ciprofloxacin, gentamycin, piperacillin & tazobactum, ampicillin and sulbactum, ticarcillin & clavulinic. for microbiology lab : rate contract for 02 years...

Rabindranath Tagore Medical College - Rajasthan

21075080 supply of glassware 1 anatomy 1.01 beaker ( rate per piece ) 1.02 beaker ( rate per piece ) 1.03 beaker ( rate per piece ) 1.04 coverslip ( microcover glass ) ( rate per piece ) 1 packet 10 gm each 1.05 coverslip ( microcover glass ) ( rate per piece ) 1 packet 10 gm each 1.06 funnel glass with long stem conical shape size ( rate per piece ) 1.07 funnel glass with long stem conical shape size ( rate per piece ) 1.08 funnel glass with long stem conical shape size ( rate per piece ) 1.09 measuring cylinder graduated ( rate per piece ) 1.1 measuring cylinder graduated ( rate per piece ) 1.11 microslides ( 1 packet of 50 slides each ) ( rate per packet ) 1.12 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 15 12 ( rate per jar with lid ) 1.13 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 23 16 ( rate per jar with lid ) 1.14 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 28 26 ( rate per jar with lid ) 1.15 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 20 20 12 ( rate per jar with lid ) 1.16 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 25 25 12 ( rate per jar with lid ) 1.17 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.18 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.19 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.2 coupling jar ( rate per each ) 1.21 knife blade ss 22 no. ( rate per pkt. ) 1.22 muslin cloth ( rate per mtr. ) 1.23 biochemistry 1.24 gloves ( post. ) ( rate per pair ) 1.25 gloves sur...

Rabindranath Tagore Medical College - Rajasthan

21067949 supply of glassware 1 anatomy 1.01 beaker ( rate per piece ) 1.02 beaker ( rate per piece ) 1.03 beaker ( rate per piece ) 1.04 coverslip ( microcover glass ) ( rate per piece ) 1 packet 10 gm each 1.05 coverslip ( microcover glass ) ( rate per piece ) 1 packet 10 gm each 1.06 funnel glass with long stem conical shape size ( rate per piece ) 1.07 funnel glass with long stem conical shape size ( rate per piece ) 1.08 funnel glass with long stem conical shape size ( rate per piece ) 1.09 measuring cylinder graduated ( rate per piece ) 1.1 measuring cylinder graduated ( rate per piece ) 1.11 microslides ( 1 packet of 50 slides each ) ( rate per packet ) 1.12 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 15 12 ( rate per jar with lid ) 1.13 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 23 16 ( rate per jar with lid ) 1.14 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 30 28 26 ( rate per jar with lid ) 1.15 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 20 20 12 ( rate per jar with lid ) 1.16 rectangular jar with lid ( lid thikness not more than 3 mm ) for museum specimen mounting jars of size given. h l wcm 25 25 12 ( rate per jar with lid ) 1.17 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.18 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.19 reagent bottle wide mouth with ground & dust proof stopper ( rate per piece ) 1.2 coupling jar ( rate per each ) 1.21 knife blade ss 22 no. ( rate per pkt. ) 1.22 muslin cloth ( rate per mtr. ) 1.23 biochemistry 1.24 gloves ( post. ) ( rate per pair ) 1.25 gloves surgical ( rate per pkt of 50 ) 1.26 test tube brush ( rate per each ) 1.27 test tube ( 18x150 ) mm ( rate per each ) => open tender...

Medical College - Rajasthan

18846699 supply of reagents and chemicals for microbiology 71 microsporidiatrichome blue stain 72 merthiolate iodine formalin 73 chloroform 74 formamide 75 , el, p 40 _ale 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate plastic ware 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm 82 test tube racks 48 holes for 15 mm test tubes 83 latex gloves 6.5 unsterilized ( pack of 100 pc. ) small size 6.5 each 84 latex gloves 7.5 unsterilized ( pack of 100 pc. ) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample / sputum for c / s sterile ( individually packed ) 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter 94 vacutainer ( 5 ml without edta ) e. toclavable petri plates, polycarbonate, clear transparent akable, 90 mm x 15 mm. tivash bottle ( 100 ml ) glass ware microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) isi mark 97 test tubes 12x100mm borosil 98 durhams tube 25 mm x 6 to 7 mm dia. 99 bijou bottle with aluminium cap and silicon rubber washer 100 petri dish 110 mm borosil ( cornig ) 101 petri disc 90mm borosil ( cornig ) 102 103 glass funnel with 10 cm dia. ( small & medium ) 104 150 x 15 mm dia. glass borosil 105 pasteur pipette with rubber bulbs capacity of 1 ml 106 pasteur pipette with rubber bulbs capacity of 2 ml antifungal enzyme strips ( e strip ) 107 amphotericin b 0.002 32 mcg / ml caspofungin 108 0.002 32 mcg / ml 109 fluconazole 0.016 256 mcg / ml 110 flucytosine 0.002 32 mcg / ml 111 itraconazole 0.002 32 mcg / ml icafungin 0.002 32 mcg / ml113 posaconazole 0.002 32 mcg / mi 114 voriconazole 0.002 32 mcg / mi 1...

Dr. S.N.Medical College - Rajasthan

18833899 supply of reagents and chemicals for microbiology 76 phosphoric acid 77 potassium di hydrogen phosphate 78 isopropanol 79 sodium bicarbonate plastic ware 80 disposable syringe 50 ml with needle 81 test tube racks 48 holes for 12 mm 82 test tube racks 48 holes for 15 mm test tubes 83 latex gloves 6.5 unsterilized (pack of 100 pc.) small size 6.5 each 84 latex gloves 7.5 unsterilized (pack of 100 pc.) small size 6.5 each 85 disposable needle 18 gauge 86 staining jars 100 ml 87 plastic dropping bottle 125 ml 88 plastic dropping bottles 500 ml 89 sterile disposable petri dish 90mm 90 disposable container for urine sample/sputum for c/s sterile(individually packed) 91 disposable plastic test tubes 75 x12 mm 92 thumb press disposable dropper 93 autoclavable tubes (pw 1162) 150 x 18 mm diameter 94 vacutainer (5 ml without edta) toclavable petri plates, polycarbonate, clear transparent akable, 90 mm x 15 mm. ittn/ash bottle (100 ml) glass ware 97 microslide 75 x25 x1.25 mm to 1.5 mm (glass) isi mark 98 test tubes 12x100mm borosil 99 durhams tube 25 mm x 6 to 7 mm dia. 100 bijou bottle with aluminium cap and silicon rubber washer 101 petri dish 110 mm borosil (cornig) 102 petri disc 90mm borosil (cornig) 103 glass funnel with 10 lill dia. (small & medium) 104 150 x 15 mm dia. glass borosil 105 pasteur pipette with rubber bulbs capacity of 1 ml 106 pasteur pipette with rubber bulbs capacity of 2 ml antifungal enzyme strips (e strip) 107 amphotericin b 0.002 32 mcg/ml 108 caspofungin 0.002 32 mcg/ml 109 fluconazole 0.016 256 mcg/ml 110 flucytosine 0.002 32 mcg/ml 111 itraconazole 0.002 32 mcg/ml .. icafungin a 0.002 32 mcg/ml 113 posaconazole 0.002 32 mcg/ml 114 voriconazole 0.002 32 mcg/m1 115 ketoconazole 0.002 32 mcg/m1 disc for carbohydrate fermentation test d 116 adonitol 1 x25 117 arabinose 1 x25 118 cellobiose 1 x25 119 dextrose 1 x25 120 dulcitol 1 x25 121 galactose 1 x25 122 fructose 1 x25 123 inositol 1 x25 124 inulin 1 x25 ...

Medical College - Rajasthan

16446177 supply of microbiology 80 disposable syringe 5m1, with needle 81 disposable syringe 82 disposable syringe 20m1 with needle 83 disposable syringe 50 ml with needle 84 test tube racks 48 holes for 12 mm 85 test tube racks 48 holes for 15 mm test tubes 86 nitril gloves medium size 6.5 each 87 nitril gloves small size 6.5 each 88 small size 6.5 each 89 small size 6.5 each 90 disposable needle 18 gauge 91 staining jars 100 ml 92 plastic dropping bottle 125 ml 93 plastic dropping bottles 500 ml 94 sterile disposable petri dish 90mm 95 sterile ( individually packed ) 96 disposable plastic test tubes 75 x12 mm 97 thumb press disposable dropper 98 99 vacutainer ( 5 ml without edta ) 100 autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. 101 wash bottle ( 100 ml ) glass ware 102 microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 103 test tubes 12x100mm borosil 104 durhams tube 25 mm x 6 to 7 mm dia. 105 bijou bottle with aluminium cap and silicon rubber washer 106 petri dish 110 mm borosil ( cornig ) 107 petri disc 90mm borosil ( cornig ) 108 glass funnel with 10 cm dia. ( small & medium ) 109 150 x 15 mm dia. glass borosil 110 pasteur pipette with rubber bulbs capacity of 1 ml 111 pasteur pipette with rubber bulbs capacity of 2m1 antifungal enzyme strips ( e strip ) 112 amphotericin b 0.002 32 mcg / ml 113 caspofungin 0.002 32 mcg / ml 114 fluconazole 0.016 256 mcg / ml 115 flucytosine 0.002 32 mcg / ml 116 itraconazole 0.002 32 mcg / ml 117 micaftmgin 4t0 it. 0 4r, v 0.002 32 mcg / ml 118 posaconazole 0.002 32 mcg / ml 119 voriconazole 0.002 32 mcg / ml 120 ketoconazole 0.002 32 mcg / ml disc for carbohydrate fermentation test discs 121 adonitol 1 x25 122 arabinose 1 x25 123 cellobiose 1 x25 124 dextrose 1 x25 125 dulcitol 1 x25 126 galactose 1 x25 127 fructose 1 x25 128 inositol 1 x25...

Indian Council Of Agricultural Research - Rajasthan

16219805 supply of glass ware/ plastic ware item 1. abdos 2. agile 3. agilent technology 4. asgi 5. axygen 6. axiva/volex 7. axiva sichem biotecm 8. agilent technology 9. bd difco 10. falcon bactec 11. biochem life science 12. biorad 13. blood grouping slides 14. borosil 15. brand scientific 16. biomatrix 17. blue lable 18. blue blue ribbon 19. blue star 20. coverglass 21. eppendorf 22. fisher life science 23. fisher 24. fluka analytical 25. genetix 26. genaxy scientific 27. genei 28. gold coin 29. hi media 30. imperial life sciences 31. jain scientific glass works 32. j sil 33. jsgw 34. labco 35. labmate 36. labnet 37. loba 38. loba chemie 39. merck life science 40. millipore 41. microslides 42. microcavity slides 43. moxcare 44. mpb (suyog)/mbp/mbt 45. nalgene 46. nunc 47. per fit 48. qualigen 49. qualigens/gsk 50. rankem 51. religlas 52. rfcl limited (promega ibt) 53. riviera/duran 54. sds 55. s.d. fine 56. sonar 57. sigma aldrich58. sigma fluka 59. s.r.l. (sisco research laboratories) 60. super tek 61. swagelok 62. sartorious weighing india pvt ltd 63. super tek 64. tarson 65. top tech 66. thermo fisher scientific 67. vensil 68. whatman 69. xcelaris...

Indian Council Of Agricultural Research - Rajasthan

16101456 supply of (1) chemicals, (2) glasswares/plasticwares and (3) petty lab items 91. santa cruz technology 92. sandoor file science 93. serva 94. scigenom labs pvt ltd 95. sigma aldrich 96. sigma 97. vetec products sigma aldrich chemical 98. siscochem (srl) 99. spinchrom life science 100. span 101. spectrochem 102. s.r.l. (sisco research laboratories) 103. sequencing services 104. stress marq/bioscience 105. stratagene 106. tci 107. titan biotech pvt ltd 108. takara 109. takara bio 110. thomus baker 111. thermo fisher scientific 112. vmrd 113. whatman 114. wipro ge helthcare 115. xcelaris 116. xcelgen 117. xcelseq 118. 3b black bio biotech india ltd/biotools b&m labs brands malecular biology reagents, chemicals/pcr reagents/electrophoresis regents 119. bd biosciences culture media, vacculeiners and other readymade reagents 120. vijaylaxmi surgicals 1. abdos 2. agile 3. agilent technology 4. asgi 5. axygen 6. axiva/volex 7. axiva sichem biotecm 8. agilent technology 9. bd difco 10. falcon bactec 11. biochem life science 12. biorad 13. blood grouping slides 14. borosil 15. brand scientific 16. biomatrix 17. blue lable 18. blue blue ribbon 19. blue star 20. coverglass 21. eppendorf 22. fisher life science 23. fisher 24. fluka analytical 25. genetix 26. genaxy scientific 27. genei 28. gold coin 29. hi media 30. imperial life sciences 31. jain scientific glass works 32. j sil 33. jsgw 34. labco 35. labmate 36. labnet 37. loba 38. loba chemie 39. merck life science 40. millipore 41. microslides 42. microcavity slides 43. moxcare 44. mpb (suyog)/mbp/mbt 45. nalgene 46. nunc 47. per fit 48. qualigen 49. qualigens/gsk 50. rankem 51. religlas 52. rfcl limited (promega ibt) 53. riviera/duran 54. sds 55. s.d. fine 56. sonar 57. sigma aldrich...

Indian Council Of Medical Research - Rajasthan

9663343 rate contract of chemicals, plastic wares and consumables : 1. molecular biology chemicals / routine chemicals & reagents 2. glasswares 3. plasticwares & micropipettes. 4. microslides / cover slip 5. filter paper 6. primers 7. dna sequencing services 8. microsatellite genotyping 9. rdt kit 10. pricking needles 11. hplc column & accessories 12. gas refilling liquid nitrogen, argon, nitrous oxide & acytylene...