Department Of Medical Education - Rajasthan

34173859 supply of rate contract for medicine for mndy supply of rate contract for medicine for mndy , laying and jointing pvc pipe. heading , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , liposomol amphotericine injection b 50mg , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mggel , crotamiton 10% + hydrocortisone 0.25% cream , methotrexate gel 1% , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , beclomethasone dipropionate0.064%+ salycylic acid 3% lotion , methoxsalen 1% lotion. each ml contain methoxsalen 1% , deca peptide 6 mg lotion. each ml contain deca peptide 6 mg , minocycline 50mg , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , trichloroacetic acid ( tca ) 50% w / v lotion , inj.hylan g f 20 , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains:ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine100 mg , cojugated estrogen 0.3 mg tab.each tablet contain 0.3 mg cojugated estrogen , telmisartan40mg + hydroclorothiazide12.5 mg, i.p.each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, , telmisartan80mg + hydroclorothiazide25 mg, i.p.each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, , mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg , combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . , dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg , tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg& lamivudine300 mg , efavirenz 600 each film coated tablet contain efavirenz 600 mg , nevirapine 200 each tablet contain nevirapine 200mg , atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg , tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg , abacavir300 eachtablet contain abacavir 300mg ip , lamivudine 100 eachtablet contain lamivudine 100 mg , raltegravir 400each film coated tablet contain raltegravir 400 mg , zideovudine 60+ lamivudine 30 , ultrasound contrast agent ( sulphur hexafluoride ) sonovue , contrast for ct scan / ivp / special investigations , iopamidol ct contrast solution for injectiuon , iopamidol ct contrast solution for injectiuon , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate paste ) , oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) , oral contrast forct ( diatrozoate sodium & diatrozoate meglumine ) , iopromide ct contrast usfda / ce approved , iopromide ct contrast usfda / ce approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iotrolon ct contrastusfda / ce approved , iotrolon ct contrast usfda / ce approved , venlafaxime tab. , olanzapineinj. , flupentixol inj. , memantine tab. , glycopyrrolate tab. , pramipexole tab. , pramipexole tab. , pramipexole tab. , inj. propofol mct / lct with oleic acid inj.iv , inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag , nalbuphine inj. , chlorprocaine inj , desflurane, 100ml , gelofusion infusion , albumin 5% infusion , inj.0.9% normal saline500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 1000 ml in100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate1000 ml in 100% biodegradablenon dehp double sterilized polyolefin closed system bag , inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed systempolyolefin 500 ml bag , inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin , inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag , nifedipine sublingual , nifedipine sublingual , papaverine inj. , nicardipine tab. , topical heparin solution 1000iu / ml , anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicumanti toxin 5000 iu ) , basiliximab 20 mg inj , betamethasone and neomycin cream ( 0.10%+0.5% ) , solution silver nitrate 2% , solution silver nitrate 5% , solution silver nitrate 10% , alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) , ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v , ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) , nasal drops haemcoagulase topical solutioneach ml contain aqueous solution of haemocoagluase 0.2 cu , triamcinolone oromucosal paste bp 0.1% w / w , ethiodized oil ( lipiodol ) inj. , htk solution1 lit ( histidine tryptophan ketoglutarate solution ) , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life factor viii , glycopegylated extended half life factor viii , tenofovir alafenamidefumerate ( taf ) 25 mgtab. / cap , entecavir 1mg tab. / cap film coated , dacalatasvir 30 mgtab. / cap , dacalatasvir 60 mgtab. / cap , sofosbuvir 400 mg tab. / cap , ribavirin 200 mg tab. / cap film coated , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007 ml 30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 mg , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab 400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab 1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds 20% , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine 1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab 100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75 iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab 150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension 5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , susp. azithromycin oral suspension 100mg / 5ml , susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 10mg + finofib 60mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride...

Medical Health And Family Welfare - Rajasthan

34173679 supply of generic medicine and surgical items for mndy and jssk supply of generic medicine and surgical items for mndy and jssk , generalanaestheticsandoxygen , halothane , isoflurane , ketamineinjection50mg / ml , propofolinjection10mg / ml , thiopentoneinjection0.5g , localanaesthetics , lignocaineointment5% , lignocaine gelip2% , lignocaineinjection2% , lignocaineandadrenalineinjection20mg+0.01mg , pre operativemedication , atropinesulphateinjection0.6mg / ml , analgesic, antipyretic &anti inflammatory drugs , tramadolcapsule50mg , tramadol injection50mg / ml , pentazocineinjection30mg / ml , naproxentabletip500mg , naproxentabletip250mg , aspirintabletip ( gastro resistant ) 150mg , aceclofenacandparacetamoltablet100mg +325mg , diclofenacgel:diclofenacdiethylamine, methyl salicylate, linseedoilandmenthol 1.16%+10%+3%+5% , diclofenacsodiumandparacetamol tablet50+325mg , diclofenac sodiuminjection for imandiv 25mg / ml , diclofenacsodiumtablet50mg , diclofenac tablet ( sr ) 100mg , etoricoxibtablet90mg , etoricoxibtabletip120mg , ibuprofenandparacetamol tablet400mg +325mg , ibuprofentablet200mg , ibuprofentablet400mg , ibuprofenoralsuspension100mg / 5ml , indomethacincapsule25mg , mefenamicacidtablet500mg , paracetamoldrops150mg / ml , paracetamolsyrupip125mg / 5ml , paracetamoltablet500mg , paracetamolinjection150mg / ml , injdiclofenacsodiumaqueous75mg / ml1ml size, iv&imuse , paracetamol infusionip1%w / v100ml size , tab.ketorolac10mg , chlorzoxazone, diclofenacsodium¶cetamoltablet250mg+50mg+325mg , drugsfor gout& rheumatoid arthritis , allopurinoltablet100mg , hydroxychloroquinesulphatetablet200mg , antiallergics&drugs usedinanaphylaxis , betamethasonetablet0.5mg , betamethasonesodiumphosphateinjection4mg / ml , dexamethasoneinjection8mg / 2ml , dexamethasonetablet0.5mg , hydrocortisonesodiumsuccinateinjection100mgbase / vial , methyl prednisolonesodiumsuccinateforinjection500mg , prednisolone tablet5mg , prednisolonetablet10mg , prednisolonetablet20mg , adrenalineinjection1mg / ml , chlorpheniraminemaleatetablet4mg , hydroxyzine tablet25mg , pheniramineinjection22.75mg / ml , promethazinesyrupip5mg / 5ml , promethazineinjection25mg / ml , promethazinetablet25mg , anticoldsyrup:phenylephrinehcl, chlorpheniraminemaleate, andparacetamol2.5 mg+1mg+125mg / 5ml , cetirizine, phenylephrine¶cetamoltablet5mg+10mg+325mg , cetirizinesyrup5mg / ml , levoceitrizinetablet5mg , montelukast10mg+levocetrizine5mg tablet , antidotesand other substancesused inpoisoning , naloxone injectionip0.4mg / ml , pralidoximechlorideinjection25mg / ml , antiepilepticdrugs , carbamazepinetablet200mg , carbamazepinetabletip100mg , carbamazepineoralsuspensionusp100mg / 5ml , phenobarbitonetablet30mg , phenobarbitoneinjectionip200mg / ml , phenytoininjection50mg / ml , phenytoinoralsuspension25mg / ml , phenytointablet100mg , pregabalincapsuleip75mg , sodiumvalproateipinjection100mg / ml , sodiumvalproatetablet200mg , sodium valproateoral solutionip200mg / 5ml , sodiumvalproate ( gastro resistant ) iptablet500mg , clobazamtablet / capsule5mg , clobazamtablet / capsule10mg , levetiracetamtablet500mg , levetiracetamoralsolutionsuspension100mg / ml , gabapentinetablet / capsule100mg , anti infective drugs , amikacininjection100mg , amikacininjection250mg , amikacininjection500mg , gentamycininjection80mg / 2ml , amoxycillincapsule250mg , amoxycillincapsule500mg , amoxycillintrihydratedispersibletablet125mg , amoxycillinoral suspension ( drysyrup ) 125mg / 5ml , amoxycillinandcloxacillincapsule250mg +250mg , amoxycillinandpotassiumclavulanatetabs500mg+125mg , amoxicillinandclavulanicacidinjection600mg , amoxicillinandpotassiumclavulanateinjection1.2gm , amoxycillin& clavulanicacidsyrup200mg +28.5mg / 5ml , ampicillincapsule500mg , ampicillininjectionip500mg , benzathinebenzylpenicillininjectionip12lacunits , benzathinebenzylpenicillininjection6lacunits , cloxacillinsodiuminjection500mg , tab.amoxycillin250mg+calvulanicacid125mg ipeachfilm coatedtabconatinamoxycillintrihydrateip250mg&potassiumclavulanateip125mg , cefiximetablet100mg , cefiximetablet200mg , cefiximeoralsusp ( drops ) 25mg / ml , cefotaximeinjection1g , cefotaximeinjection250mg , cefpodoximedispersibletablet50mg , ceftriaxoneinjectionip1g / vial , ceftriaxoneinjection250mg , ceftriaxoneinjectionip500mg / vial , cefuroximetablet250mg , cephalexincapsule250mg , cephalexincapsuleip500mg , cephalexinoralsuspension ( cephalexindry syrup ) 125mg / 5ml , cephalexintablet ( dt ) 125mg , tab.cefadroxil250mg , tab.cefadroxil500mg , azithromycintablet ( dt ) 100mg , azithromycintabletip250mg , azithromycintablet500mg , ciprofloxacininjection200mg / 100ml , ciprofloxacintablet250mg , ciprofloxacintablet500mg , levofloxacin tablet250mg , norfloxacintablet400mg , ofloxacintablet200mg , ofloxacinsuspension50mg / 5ml , ofloxacininjection200mg / 100ml , ofloxacinandornidazoletablet 200mg+500mg , tab. levofloxacinip 500mg ( eachfilm coatedtabletcontainslevofloxacinhemihydrateip500mg ) , clindamycincapsule150mg , clindamycincapsule300mg , co trimoxazoleoral suspension40mg+200mgper5ml , co trimoxazole tablet40mg+200mg , co trimoxazoletablet160mg +800mg , doxycyclinecapsule100mg , nitrofurantointablet100mg , framycetinsulphatecream1% , framycetinsulphatecream1% , metronidazoleinjection500mg / 100ml , metronidazolebenzoateoralsuspension100mg / 5ml , metronidazoletablet200mg , metronidazoletablet400mg , tinidazoletabletip300mg ( filmcoated ) , tinidazoletabletip500mg ( filmcoated ) , albendazoleoralsuspension400mg / 10ml , albendazole tabletip400mg , diethylcarbamazinetabletsip100mg , clotrimazole creamip2% w / w , clotrimazolevaginal tablet500mg , fluconazole tablet150mg , griseofulvintablets125mg , artisunateinjection60mg ( combopackwith1mlampouleof5%sodiumbicarbonateinjectionand5mlampouleof0.9%sodiumchlorideinjection ) , chloroquinephosphateinjection40mg / ml , chloroquinephosphatetablet250mg ( =155mgofchloroquinebase ) , chloroquinephosphatesuspension50mg / 5ml , primaquinetablet2.5mg , primaquinetablet7.5mg , quininedihydrochlorideinjection300mg / ml , quininesulphatetablet300mg , actkitcontaining3tabletofartesunate ( eachtabletofartesunate25mgstrength ) and1tabletof sulphadoxinepyremethamine ( 250mg+12.5mg ) , actkitcontaining3tabletofartesunate ( 50mgeach ) and1tabletofsulphadoxine pyremethamine ( 500+25 ) mg , actkitcontaining3tabletof artesunate ( 100mgeach ) and1tabletofsulphadoxine pyremethamine ( 750+37.5 ) mg , actkitcontaining3tabletof artesunate150mgand2tabletof sulphadoxine pyremethamine ( 500mg+25mg ) , actkitcontaining3tabletof artesunate ( each200mg ) and2tabletof sulphadoxinepyremethamine ( 750+37.5 ) mgeachor3tabletsulphadoxinepyremethamine ( 500+25 ) mgeach , artemether+leumefantrinetablet ( 40mgand240mg ) , artemether+leumefantrinetablet ( 80mgand480mg ) , acyclovirtablet200mg , acyclovirtablet800mg , acyclovirsuspension400mg / 5ml , antineoplasticand immuno suppressantdrugs , methotrexatetablet2.5mg , methotrexatetabletip10mg , antiparkinsonismdrugs , levodopaandcarbidopatablet250mg+25mg , trihexyphenidyl hydrochloridetablet2mg , drugsaffectingblood , heparinsodiuminjection5000iu / ml , warfarinsod.tablet5mg , ethamsylateinjection250mg / 2ml , tranexamicacidtablet500mg , vitaminkinjection10mg / ml , tabethamsylatebp500mg ( eachuncoatedcoatedtablet containsethamsylatebp500mg , feracrylum1% w / w sterilesolution100ml , injtranexamicacidip100mg / ml5mlsize , hydroxyethyl starch ( 130 / 4 ) 6%w / vwithsodiumchloride0.9%w / vintravenous infusion , polygeline3.5%solution with electrolytes fori.v. infusion , verapamil tabletsip40mg , aspirindelayedreleasetablet ( entericcoated ) 75mg , clopidogreltabletip 75mg , clopidogrel andaspirintablet75mg+75mg , amlodipinetabletip2.5mg , amlodipinetablet5mg , atenololtablet50mg , atenololtablet25mg , diltiazemtablet30mg , enalapril maleatetablet10mg , enalapril maleatetablet5mg , enalapril maleatetablet2.5mg , labetaloltablet100mg , labetalolhydrochlorideinjection20mg / 4ml , lisinopril tablet2.5mg , lisinopril tablet5mg , lisinopril tablet10mg , losartantablet25mg , losartantablet50mg , amlodipineandenalaprilmaleatetablet5mg+5mg , losartanpotassium&amlodipinetablet50mg+5mg , losartanpotassium&hydrochlorothiazidetablet50mg+12.5mg , amlodipineandlisinopriltablet5mg+5mg , amlodipineandatenololtablet5mg +50mg , methyldopatablet250mg , metoprololtabletip 25mg , metoprololsuscinatetablet ( extendedrelease ) usp50mg , nifedipinecapsule5mg , nifedipinetablet ( sustainedrelease ) 10mg , propranololtablet40mg , ramipriltablet / capsule2.5mg , telmisartantabletip40mg , glyceryl trinitratetablet2.6mg , isosorbidedinitratetablet5mg , isosorbidemononitratetablet20mg , nitroglycerininjection5mg / ml , atorvastatintablet10mg , atorvastatintablet40mg , fenofibratecapsule200mg , digoxininjection0.25mg / ml , digoxintablet0.25mg , dobutamineinjection50mg / ml , dopaminehydrochlorideinjection40mg / ml , noradrenalineinjection2mg / ml , magnesiumsulphateinjection ( 50% ) 500mg / ml , dental drugs , chlorhexidinemouthwashbp0.20% , dental gel:cholinesalicylate+benzalkonium+lignocaine8.75% , desensitizingtoothgelwithsodiummonofluorophosphate&pot.nitrate0.7%+5% , gumpaintcontainingtannicacid, cetrimide, zincchloride2%+0.1%+1% , metronidazoleandchlorhexidinegel1%+0.25% , dermatologicaldrugs , miconazolenitratecream2% , clotrimazolemouthpaint ( clotrimazole1% w / v ) 1% , ketoconazolecream2% , powder clotrimazole1% w / w 30gm , beclomethasone, neomycinandclotrimazolecream0.025%+0.5%+1% , clindamycinphosphategelusp1% , fusidicacidcream2% , neomycin, bacitracinwithsulphacetamidepowder5mg+250units+60mg , betamethasonedipropionatecream0.05% , betamethasonelotion0.05% , clobetasolcream0.05% , acyclovircream 5% , gammabenzenehexachloridelotion ( lindanelotionusp ) 1% , permethrincream5% , permethrinlotion5% , coal tar6%&salicylicacid3% onitment , glycerinip100ml , glycerinip 400gm , calaminelotionip , compoundbenzoicacidointmentipbenzoicacid6%+salicylicacid3% , tretenoincream0.03% , reagents& diagnostic agents , antia bloodgrouping serum ( antia monoclonal serumip ) , antibbloodgroupingserum , antidrhbloodgroupingserum , multistixteststrip , vdrlantigen ( with+ve and vecontrol ) / rprslidekit , disinfectants& antiseptics , cetrimidecreamip0.50% , chlorhexidinegluconatesolution5% , compoundbenzointinctureip , formaldehydesolution ( 34.5% 38% ) , gentianviolettopical solutionusp1% , glutaraldehydesolution2% , hydrogenperoxidesolution6% , lysol ( cresolwithsoapsolution ) ( cresol50% +soap50% ) , povidone iodinesolution5% , povidone iodinesolution5% , povidoneiodinesolution10% , povidoneiodinescrubsolution / cleansing solution7.5%w / v povidoneiodine7.5% , povidoneiodineointment5% , povidoneiodineointment5% , silversulphadiazinecream1% , silversulphadiazinecreamip1% , surgicalspiritbp , surgicalspiritbp , diuretics , acetazolamidetablet250mg , furosemidetablet40mg , furosemideinjection10mg / ml , hydrochlorthiazidetablet12.5mg , hydrochlorthiazidetablet25mg , mannitolinjection20% , spironolactonetablet25mg , spironolactonetablet50mg , torsemidetablet10mg , torsemideinjection10mg / ml , drugsforearailments , ciprofloxacinanddexamethasoneeardrops0.3%+0.1% , clotrimazole1%withbeclomethasonedipropionate0.025%eardrops , neomycin, polymixinb & hydrocortisone ear drops / otic solutionusp ( neomycinsulphate3400iu, polymixinbsulphate10000iu andhydrocortisone10mgperml ) , waxdissolvingeardrops:paradichlorobenzene, benzocaine, chlorobutanol, turpentineoil2%+2.7%+5%+15% , gastro intestinal drugs , antacidtablet , antacidliquid , omeprazolecapsule20mg , pantoprazoleinjection40mg , pantoprazole&domperidonesrcapsule40mg+30mg , ranitidinehcl injection50mg / 2ml , ranitidinetablet150mg , ranitidinetablet300mg , dicyclominetablet10mg , dicyclomineinjection10mg / ml , dicyclomine hydrochloride oralsolutionip10mg / 5ml , dicyclominehydrochlorideandactivateddimethiconesuspension 10mg+40mgperml , dicyclomineandparacetamoltablet20mg+325mg , drotaverinetablet40mg , drotaverinehydrochlorideinjection40mg / 2ml , drotaverine&mefenamicacidtablet80mg+250mg , hyoscinebutylbromidetablet10mg , hyoscinebutylbromideinjectionip20mg / ml , metoclopramideinjection10mg / 2ml , metoclopramidetablet10mg , metoclopramidesyrup5mg / 5ml , domperidonetablet10mg , domperidoneoral drops10mg / ml , domperidonesuspension5mg / 5ml , ondansetronorallydisintegratingmdtablet4mg , ondansetroninjection2mg / ml , tabdoxylaminesuccinate20mg &pyridoxinehydrochloride20mg ( eachentericcoatedtabletcontainsdoxylaminesuccinateusp 20mg & pyridoxinehydrochloride ip 20mg ) , bisacodyltablet5mg , lactic acidbacillustablet60millionspores , lactulosesolution10gm / 15ml , liquidparaffin ip , liquidparaffin ip , loperamide tabletip 2mg , ors powder , ointmentcontaining:lidocaine3%, zincoxide5%, hydrocortisone0.25%, allantoin0.5% , sodiumphosphatesenemabp , probioticsachets1gmsize ( eachgramsachetcontains saccharomycesboulardii250mg&lacticacidbacillus150millionspores ) , ursodeoxycholicacidtablet300mg , hormones, other endocrinedrugs , biphasicisophaneinsulininjection30 / 70 ( 30%solubleinsulin&70%isophane insulin ) 40iu / ml , isophaneinsulininjection40iu / ml , soluble insulininjection40iu / ml , glibenclamidetablet5mg , gliclazidetabletsip40mg , glimepiridetablet2mg , glimepiridetablet1mg , glipizidetabletip5mg , metformintablet500mg , pioglitazone tabletip15mg , metforminhydrochloridesrtablet1000mg , glipizideandmetforminhydrochloridetablet5mg+500mg , glibenclamideandmetforminhydrochloride ( sr ) tablet5mg+500mg , metforminhydrochloride ( sr ) andglimepiridetablet500mg +1mg , metforminhydrochloride ( sustainedrelease ) andglimepiridetablet500mg+2mg , glimepiride, pioglitazoneandmetforminhydrochloride ( sr ) tablet2mg+15mg+500mg , gliclazideandmetformintablet80mg+500mg , insulinglargine100iu / mlwith30insulinsyringeswithneedle , tenaligliptintablet20mg , carboprosttromethamineinjection0.25mg / ml , conjugatedestrogentablet0.625mg , dinoprostonecream0.5mg , ethinyloestradiol tabletip50mcg , hydroxyprogesteroneinjection250mg / ml , norethisteronetablet5mg , progesteroneinjection200mg / 2ml , medroxyprogesteroneacetatetabletip10mg , carbimazoletablet5mg , thyroxinesodiumtablet100mcg , thyroxinesodiumtabletsip50mcg , immunologicals , humanantid immunoglobulininjection ( imuse ) 300mcg , humanantid immunoglobulin150mcg , humanrabiesimmunoglobulininjection150iu / ml , rabiesvaccinehuman ( cellculture ) ( intradermal ) 2.5iu , rabiesvaccinehuman ( cellculture ) ( intramuscular ) 2.5iu / dose , rabiesantiserumip ( equine ) ( i.m. / scuse ) 300units / ml , snakevenom antiserum ( polyvalent antisnake venom ) lyophillized , tetanusvaccine ( adsorbed ) ip , neuromuscular blockers& cholinesteraseinhibitors , atracuriuminjection10mg / ml , neostigmineinjectionip0.5mg / ml , neostigmineinjection2.5mg / 5ml , neostigminetabletsip15mg , succinylcholineinjection50mg / ml , valethamatebromideinjection8mg / ml , vecuroniumbromideforinjection4mg ( freezedried ) , ophthalmologicalpreparations , fluconazoleeyedrops0.3% , flurbiprofensodiumophthalmicsolution0.03% , brimonidinetartrateandtimololeyedrops0.15%+0.5% , phenylephrinehydrochlorideophthalmicsolutionusp / phenylephrineeyedropsbp5% , timololeye drops0.50% , travoprostophthalmicsolution0.004% , atropineeyeointment1% , atropinesulphateophthalmicsolutionusp1% , homatropine eyedrops2% , tropicamideeyedrops1% , chloramphenicoleyedrops0.05% , ciprofloxacineyedrops0.30% , ciprofloxacinophthalmicointment0.30% , tobramycinanddexamethasoneophthalmicsuspension0.30%+0.10% , tobramycineye drops0.30% , tobramycinophthalmicointment0.30% , chloramphenicol 1% w / weyeointmentip, 3gmsize , lidocaine hydrochloridetopical solutionusp4% , carboxymethylcellulosesodiumlubricanteyedrops0.50% , hyaluronidaseinjection1500iu , hydroxypropylmethylcellulose solutionwithprefilledglasssyringe withcannula20mg / ml , drugs acting onuterus , isoxsuprineinjection5mg / ml , isoxsuprinetablet20mg , methylergometrineinjection0.2mg / ml , methylergometrinetabletip0.125mg , misoprostoltablet200mcg , mifepristonetablet200mg , oxytocininjection5iu / ml , psychotropicdrugs , chloridazepoxidetabletsip10mg , chlorpromazinetabletsip100mg , chlorpromazinetabletsip25mg , chlorpromazinetabletsip50mg , chlorpromazineinjectionip25mg / ml , haloperidol injection5mg / ml , haloperidoltablet1.5mg , haloperidoltablet5mg , olanzapinetablet5mg , risperidonetablet2mg , risperidonetablet1mg , trifluperazinetabletsip5mg , amitriptylinetabletsip25mg , fluoxetinecapsuleip20mg , imipraminetablet25mg , imipraminetablet75mg , lithiumcarbonatetablet300mg , sertralinetablet50mg , alprazolamtablet0.25mg , alprazolam tablet0.5mg , clonazepamtablet0.5mg , diazepaminjection10mg / 2ml , diazepamtablet5mg , drugs acting ontherespiratorytract , aminophyllineinjection25mg / ml , beclomethasoneinhalation200mcg / dose , budesonidenebulizersuspension0.25mg / ml , budesoniderotacap200mcg , ipratropiumbromidenebulizersolution250mcg / ml , ipratropiumrotacap40mcg , salbutamoltablet4mg , salbutamol inhalation100mcg / dose , salbutamol nebulisersolution5mg / ml , salbutamoltablet2mg , salbutamolsyrupip2mg / 5ml , terbutalinesulphatetabletip2.5mg , theophyllineandetophyllineinjection50.6mg+169.4mg , theophyllineandetophyllinetablet23mg +77mg , theophyllinetablet ( sr ) 400mg , formoterol &budesoniderotacap6mcg+200mcg , tab.acebrophylline100mg , coughsyrup [ each5mlcontainschlorpheniraminemaleateip3mgammonium chloride130mg, sodiumcitrate65mg, menthol0.5mg ] , dextromethorphanhydrobromidesyrup13.5mg / 5ml , coughsyrup / expectorant ( ambroxolhydrochlorideip15mg, terbutalinesulphate ip1.5mg, guaiphenesinip50mg, menthol ip1mg , salinenasal solution ( drops ) 0.65% , xylometazolinenasaldrops0.1% , solutions correcting water, electrolyte &acid base disturbance , compoundsodiumlactateinjection , dextroseinjection25% , dextroseinjection10% , dextroseinjection5% , multiple electrolytes& dextroseinjectiontype iip ( electrolytepinjection ) , multipleelectrolytes& dextroseinjectiontype iiiip ( electrolyteminjection ) , potassiumchlorideinjection0.15gm / ml , potassiumchlorideoral solutionusp500mg / 5ml , sodiumchlorideanddextroseinjection0.9%+5% , sodiumchlorideinjection , sodiumchlorideinjection , drugsforurology , tamsulosinhcltablet0.4mg , flavoxate tablet200mg , tab.phenazopyridine5mg , syp.alkylizer1.4gm / 5ml ( 100ml ) ( disodiumhydrogencitrate ) , antivertigo , cinnarizinetabletip25mg , cinnarizinetabletip75mg , vitamins&minerals , ascorbicacidtablet500mg , calciumgluconateinjection10% , calcium&vitamind3tablet500mg+250iu , calcium&vitamind3suspension ( each5mlcontainscalciumcarbonateequivalentvtoelementalcalcium250mg+vitamind3 125iu ) , calcitriolcapsule0.25mcg , cholecalciferolgranules60, 000iu / 1gm , ferroussulphateandfolicacidtablet100mg +0.5mg , ferroussulphatewithfolicacidtab. ( paediatric ) 20mg+0.1mg , folicacidtabletip 5 mg , ironandfolicacidsyrupeach5ml containsferrousfumerateequivalentto elemental ron100mg, folicacid500mcg , ironsucroseinjection20mg / ml usp / bp20mg / ml ( forivuse ) eachml contain: ferrichydroxideincompleswithsucroseequivalenttoelementaliron20mg , mecobalamininjection500mcg / ml , multivitamindropseachml containsvit a 3000iu, vitd3 300iu, vit b1 1mg, riboflavinephosphatesodium 2mg, d pantenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin1mcg, lysine hcl10mg , multivitamintabletsnfi formulasugarcoated.vita2500iu , pyridoxinetablet10mg , thiaminetablet100mg , vitaminasolution1laciu / ml , vitaminbcomplextabletnfi ( prophylactic ) , vitaminbcomplexinjectionnfi , zincsulphatedispersibleipelementaltablet10mg , methylcobalmintablet500mcg , methylcobalmintablet1500mcg , vitamind3oral solution60000iu , multivitaminsyrup , miscellaneousdrugs , black disinfectantfluid ( phenyl ) ( as per schedule ograde iii , sodiumbicarbonateinjectionip7.5% , waterfor injectionip , oseltamivir75mgcapsule ( eachcapsulecontainsoseltamivirphosphateequivalent to oseltamivir75mg ) , oseltamivir45mgcapsule ( eachcapsulecontainsoseltamivirphosphateequivalent to oseltamivir45mg ) , oseltamivir30mgcapsule ( eachcapsulecontainsoseltamivirphosphateequivalent to oseltamivir30mg ) , oseltamivirsyrup oseltamivirphosphatefororalsuspension12mg / ml. ( eachmlcontains12mgoseltamivir base after reconstitution ) , oseltamivirphosphateoralsuspensionip12mg / ml ( eachmlcontains:12mg oseltamivirafterreconstitution , vitamink 1 ( phytomenadione ) 1mg / 0.5mlinjection , cap.vitamine400mg , listofsurgicals , absorbentcottonwoolip500gm , bloodadministrationset / bloodtransfusionset • sharpandeasypiercingspikesuitableforbloodbagsandstandardbloodcontainers • transparentcylindricaldripchamberwithfilter.filtersizeshouldbe200+20micrometer. • 150cmlongsmoothkinkresistanttubing • efficientrollerclamptocontrolandadjustthetransfusionrate • shouldconformtois9824 ( part3 ) :1996 , disposablesterilesurgicalrubberglovessize6½inches • madeof naturalrubberlatex, powdered, withouttear, properly foldedinapaper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • powdershouldbenon allergenic • shouldconform to is13422 • isimarked / ce certified / fda approved , disposablesterilesurgicalrubberglovessize6½inches • madeof naturalrubberlatex, powderfree ( polymer / siliconcoated ) , withouttear, properlyfoldedina paper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • shouldconform to is13422 isimarked / ce certified / fda approved ( cecertification / fda approval foritemismandatoryfor importerfirms, thatcannotavail is standards ) , disposablesterilesurgicalrubberglovessize7inches • madeofnaturalrubberlatex, powdered, , withouttear, properly foldedinapaper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • powdershouldbenon allergenic • shouldconform to is13422 • isimarked / ce certified / fda approved , disposablesterilesurgicalrubberglovessize7inches • madeof naturalrubberlatex, powderfree ( polymer / siliconcoated ) , withouttear, properlyfoldedina paper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • shouldconform to is13422 isimarked / ce certified / fda approved ( cecertification / fda approval foritemismandatoryfor importerfirms, thatcannotavail is standards ) , disposablesterilesurgicalrubberglovessize7½inches • madeof naturalrubberlatex, powdered, withouttear, properly foldedinapaper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • powdershouldbenon allergenic • shouldconform to is13422 • isimarked / cecertified / fda approved , disposablesterilesurgicalrubberglovessize7½inches • madeof naturalrubberlatex, powderfree ( polymer / siliconcoated ) , withouttear, properlyfoldedina paper • free ofholes, withacceptable qualitylevel ( aql ) of1.5or less • tensilestrengthasperen455 2 • shouldconform to is13422 isimarked / ce certified / fda approved ( cecertification / fda approval foritemismandatoryfor importerfirms, thatcannotavail is standards , suctioncatheter, sterile.size:fg5 ( foruseinrespiratory tract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg6 ( foruseinrespiratory tract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg8 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg10 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg12 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg14 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg16 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg18 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg20 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , suctioncatheter, sterile.size:fg22 ( foruseinrespiratorytract ) • soft, kinkresistanttubing • roundedopentipwithlateraleye • colourcodeduniversalfunnelconnectorforsafeconnectiontostandardsuctionequipment • length50cm ( min. ) • shouldconformtois08836:2014 , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size 8fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity3 5ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size10fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity3 5ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size16fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30±1ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size18fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30±1ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size20fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30±1ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size22fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30±1ml • shouldconformto is11497 • colorcodingmarkingtoidentify size • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , sterile catheter, single use, for urinarydrainage ( foleyballooncatheter ) , 2way, size 24fg • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30±1ml • shouldconformto is11497 • colorcodingmarkingtoidentify size • length, wallthicknessandballooncapacity shouldbementionedasperis11497. • specificationforb, c, d, e, f, gshouldbementionedasperis11497forparticularsize , infantfeedingtubesize:10fglength50cm ( min. ) • two lateral eyesatdistal end • soft, kinkresistantnon toxicpvctubing, nonirritanttodelicatemucosa • withfemaleflexiblemountwithin builtclosure • radioopaqueline • sterile , infantfeedingtubesize:8fg, length50cm ( min. ) • two lateral eyesatdistal end • soft, kinkresistantnon toxicpvctubing, nonirritanttodelicatemucosa • withfemaleflexiblemountwithin builtclosure • radioopaqueline • sterile , infantfeedingtubesize:5fglength50cm ( min. ) • two lateral eyesatdistal end • soft, kinkresistantnon toxicpvctubing, nonirritanttodelicatemucosa • withfemaleflexiblemountwithin builtclosure • radioopaqueline • sterile , steriledisposableperfusionsetwithairwayandneedle ( adultuse ) • forgravityfeed only • sharpandeasy piercingspikewithairvent • transparentandflexibledripchamber • 150cmlongsmoothkinkresistanttubing • selfsealing latexbulbwhichwill alsoactasanportforextramedication • efficientrollerclampto controlandadjustthefluidrate • 21gneedle • shouldconformtois12655 4standard , steriledisposableperfusionset ( infusionset ) withairwayandneedle ( paediatricuse ) • burettetypemeasuredvolumechamberof 100ml • dropsizeofapprox60dropsperml • injectionport, latexfree, forintermittentmedication. • floating auto shutoffvalve ( latexfree ) inburette. • softandkinkresistantpvctubing. • rollercontrollerforflowcontrol • tubelength150cm • 23gneedle • shouldconform toiso 8536 5 , steriledisposableinfusionsetwithmicrodrip ( i.v. ) • microdripinfusionsetwithdropsizereducedtoapprox60dropsperml • sharpandeasy piercingspike • transparentandflexibledripchamber • 150cmlongsmoothkinkresistanttubing • efficientrollerclampto controlandadjustthefluidrate • shouldconformto is12655 4standard , insulinsyringe ( 40units ) with ( fixed ) 30gneedleshallconform tois 12227 , sterile disposable ( singleuse ) teflon / ptfe i.v.cannula withintegrated3waystopcock.size 16g • shouldbepackedintransparent, singleblisterpack. • shouldconformtois10555standard , sterile disposable ( singleuseteflon / ptfei.v.cannulawithintegrated3waystopcock. ) size 18g • shouldbepackedintransparent, singleblisterpack. • shouldconformtois10555standard , sterile disposable ( singleuse ) teflon / ptfe i.v.cannula withintegrated3waystopcock.size 20g • shouldbepackedintransparent, singleblisterpack. • shouldconformtois10555standard , sterile disposable ( singleuse ) teflon / ptfe i.v.cannula withintegrated3waystopcock.size 22g • shouldbepackedintransparent, singleblisterpack. • shouldconformtois10555standard , sterile disposable ( singleuse ) teflon / ptfe i.v.cannulawithoutport.size24g • suitableforpaediatric&neonataluse • shouldbepackedintransparent, singleblisterpack. • shouldconformtois10555standard , mucusextractorsterile • cleartransparentcontainer • antibacterialfilter • soft, kinkresistantpvctubing • tubesize10fg;length40cm ( min. ) • capacity 25ml , nasal oxygencannula ( set ) , twinbore ( accessoryfor compressedairbreathing ) allsizes ( adult ) • softandkinkresistantpvctubing • multichannel / starlumentopreventingaccidentalkinking • twinboresshouldensureequal volumeofoxygento bothairpassages • connectorforeasyconnectiontotheoxygensource • tubelength200cm , nasal oxygencannula ( set ) , twinbore ( accessoryfor compressedairbreathing ) allsizes ( pediatrics ) • softandkinkresistantpvctubing • multichannel / starlumentopreventingaccidentalkinking • twinboresshouldensureequal volumeofoxygento bothairpassages • connectorforeasyconnectiontotheoxygensource • tubelength200cm , paperadhesiveplaster1x9.0mts ( withcutter ) nonwovenadhesive tape, hypoallergic, shouldhavesomestretchbonding , paperadhesiveplaster2x9.0mts ( withcutter ) nonwovenadhesivetape hypoallergic, shouldhavesomestretchbonding , paperadhesiveplaster3x9.0mts ( withcutter ) nonwovenadhesivetape hypoallergic, shouldhavesomestretchbonding , plasterofparisbandages15cmx2.7mts / roll shouldconformto schedulef ( ii ) ofdrug andcosmeticact1940 , plasterof parisbandages10cmx 2.7mts / roll shouldconformto schedulef ( ii ) ofdrug andcosmeticact1940 , rylestube / nasogastrictube ( p.v.c. ) withradio opaquelining.size:10 • soft, kinkresistantpvctubingforatraumaticintubation • closeddistalendshouldbeconedwithradioopaquematerialforaccurateintubation • fourlateraleyesfor greater efficiency • radioopaqueline • marking at50, 60, 70cmfromtip • colour codedfunnel • withluerconnector / closure • length105cm , rylestube / nasogastrictube ( p.v.c. ) withradio opaquelining.size:12 • soft, kinkresistantpvctubingforatraumaticintubation • closeddistalendshouldbeconedwithradioopaquematerialforaccurateintubation • fourlateraleyesfor greater efficiency • radioopaqueline • marking at50, 60, 70cmfromtip • colour codedfunnel • withluerconnector / closure • length105cm , rylestube / nasogastrictube ( p.v.c. ) withradio opaquelining.size:14 • soft, kinkresistantpvctubingforatraumaticintubation • closeddistalendshouldbeconedwithradioopaquematerialforaccurateintubation • fourlateraleyesfor greater efficiency • radioopaqueline • marking at50, 60, 70cmfromtip • colour codedfunnel • withluerconnector / closure • length105cm , rylestube / nasogastrictube ( p.v.c. ) withradio opaquelining.size:16 • soft, kinkresistantpvctubingforatraumaticintubation • closeddistalendshouldbeconedwithradioopaquematerialforaccurateintubation • fourlateraleyesfor greater efficiency • radioopaqueline • marking at50, 60, 70cmfromtip • colour codedfunnel • withluerconnector / closure • length105cm , rylestube / nasogastrictube ( p.v.c. ) withradio opaquelining.size:18 • soft, kinkresistantpvctubingforatraumaticintubation • closeddistalendshouldbeconedwithradioopaquematerialforaccurateintubation • fourlateraleyesfor greater efficiency • radioopaqueline • marking at50, 60, 70cmfromtip • colour codedfunnel • withluerconnector / closure • length105cm , scalpveinset ( disposable ) :size18g • butterflyshapedwingsforeasy handlingandattachmentwithskin.colourcoded • needleshouldbebevelled, siliconisedandshouldensureatraumaticcannulation • femaleluerfittingatoneend • soft, kinkresistant, non toxic, nonirritanttube • sterile , scalpveinset ( disposable ) :size20g • butterflyshapedwingsforeasy handlingandattachmentwithskin.colourcoded • needleshouldbebevelled, siliconisedandshouldensureatraumaticcannulation • femaleluerfittingatoneend • soft, kinkresistant, non toxic, nonirritanttube • sterile , scalpveinset ( disposable ) :size22g • butterflyshapedwingsforeasy handlingandattachmentwithskin.colourcoded • needleshouldbebevelled, siliconisedandshouldensureatraumaticcannulation • femaleluerfittingatoneend • soft, kinkresistant, non toxic, nonirritanttube • sterile , scalpveinset ( disposable ) :size24g • butterflyshapedwingsforeasy handlingandattachmentwithskin.colourcoded • needleshouldbebevelled, siliconisedandshouldensureatraumaticcannulation • femaleluerfittingatoneend • soft, kinkresistant, non toxic, nonirritanttube • sterile , sterilehypodermicsyringewithneedleattached, 24g, singleuse 2ml • cleartransparentchamber • prominentgraduation • inertmaterialgasketatthepistontominimisefrictionduringmovement&preventleakageandbackflow • sharpneedleensuringminimumtraumaduringpenetration • shallconformto is12050 • packing:needleshouldbeattachedwiththesyringeandpackedinunitribbonpack • the words destroy after single use orequivalent should be written onunitcontainer , sterilehypodermicsyringewithneedleattached, 24g, singleuse 5ml • cleartransparentchamber • prominentgraduation • inertmaterialgasketatthepistontominimisefrictionduringmovement&preventleakageandbackflow • sharpneedleensuringminimumtraumaduringpenetration • shallconformto is12050 • packing:needleshouldbeattachedwiththesyringeandpackedinunitribbonpack • the words destroy after single use orequivalent should be written onunitcontainer. , sterilehypodermicsyringewithneedleattached, 22g, singleuse 10ml • cleartransparentchamber • prominentgraduation • inertmaterialgasketatthepistontominimisefrictionduringmovement&preventleakageandbackflow • sharpneedleensuringminimumtraumaduringpenetration • shallconformto is12050 • packing:needleshouldbeattachedwiththesyringeandpackedinunitribbonpack • the words destroy after single use orequivalent should be written onunitcontainer. , sterilehypodermicsyringewithneedleattached, 22g, singleuse 20ml • cleartransparentchamber • prominentgraduation • inertmaterialgasketatthepistontominimisefrictionduringmovement&preventleakageandbackflow • sharpneedleensuringminimumtraumaduringpenetration • shallconformto is12050 • packing:needleshouldbeattachedwiththesyringeandpackedinunitribbonpack • the words destroy after single use orequivalent should be written onunitcontainer. , surgicalbladesterile, size11 • singlepeelpackinmetalfoil • thetipof thebladeshall bewelldefined, centralandsharp.thereshallbenowaviness, jags, feathers, nicks, orotherdefectsonthecuttingedge.thesurfacesof theblade shallbesmoothandfree fromtoolmarksandanysignofcorrosion. • shouldconformtois3319 , surgicalbladesterile, size15 • singlepeelpackinmetalfoil • thetipof thebladeshall bewelldefined, centralandsharp.thereshallbenowaviness, jags, feathers, nicks, orotherdefectsonthecuttingedge.thesurfacesof theblade shallbesmoothandfree fromtoolmarksandanysignofcorrosion. • shouldconformtois3319 , surgicalbladesterile, size22 • singlepeelpackinmetalfoil • thetipof thebladeshall bewelldefined, centralandsharp.thereshallbenowaviness, jags, feathers, nicks, orotherdefectsonthecuttingedge.thesurfacesof theblade shallbesmoothandfree fromtoolmarksandanysignofcorrosion. • shouldconformtois3319 , sutureneedlescurved1 / 2circleroundbodyassortedsize11 15 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurved1 / 2circleroundbodyassortedsize1 5 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurved1 / 2circleroundbodyassortedsize16 20 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurved1 / 2circleroundbodyassortedsize6 10 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurvedandcutting1 / 2circlecuttingsize6 10 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurvedandcutting1 / 2circlesize11 15 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurvedandcutting1 / 2circlesize16 20 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , sutureneedlescurvedandcuttingsize1 5 • itshouldbementionedwhetherneedleispointedorbluntwithtypeof itspoint. • typeofeyeof theneedleshouldbementioned. • should conform tois 9165 , steriledisposablespinal needleforsingleuse22gx3½inch • clear / transparenthub • sharptipwhichshouldensureminimalpuncturetrauma , steriledisposablespinal needleforsingleuse25gx3½inch • clear / transparenthub • sharptipwhichshouldensureminimalpuncturetrauma , urinecollectingbag, disposable2000ml • transparentsheet • kinkresistantflexibletubingnotlessthan90cminlength • shouldhavenon returnvalve • topdrainageoutlet • graduatedbag • mouldedhandleforeasyhandling , endotrachealtube, plain size2.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size3mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size3.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size4mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size4.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size5.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotracheal tube, plainwithradio opaqueline, sterile, singleuse size6mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size6.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size7mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size7.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size8mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotrachealtube, plain size8.5mm • transparent • standard15mmconnectoratproximalend • radio opaquelinethroughoutthelength • tipsuitablefornasalandoralintubation • singleuse, sterile , endotracheal tube, cuffed size4mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotrachealtube, cuff size4.5mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size5mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size6mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotrachealtube, cuff size6.5mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotrachealtube, cuff size7mm • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size7.5 • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size8 • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size8.5 • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , endotracheal tube, cuff size9 • softcuff towardsthedistalend • kinkresistantinflationtube • murphyeyeatdistalendwithpolishedsmoothness • radio opaqueline • standard15mmconnector • sterile, singleuse • curvedshapedblisterpack–suitingtheshapeofproduct , sterilisedumbilical cottontapewidth3mm, length75cm shouldconformtoschedulef ( iii ) ofdrug andcosmeticact1940 , face mask, disposable • shouldbemanufacturedfrom nonwovenpolypropfabric • shouldbe3plyconstruction • shouldhavehighbacterialfiltrationefficiency • shouldbeheatsealedto keep3layerstogether • standardsize17.5x9cm • color green / blue • thereshouldbeastringeachatallfourcorners, lengthof stringshouldbe40cm • noseclipshouldbethere • noelasticband. , surgical cap, disposable ( forsurgeons ) • shouldbemanufacturedfromnonwovenfabric. • stripfortying thecapstitchedonthebackforpropergripontheforhead. • greencolour • ultrasonically stitched • airpermeable / breathable • shouldretainskinandhairparticle. • stripfortying thecap , surgical cap, disposable ( fornurses ) • shouldbemanufacturedfromnonwovenfabric • blue / greencolour • rounduponwearing, withelastic • airpermeable / breathable • shouldretainskinandhairparticles , foldable intra ocular lense with injector ( size + 11 d to +17.5 d ) size:6mm optics.12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material2. bi convex single piece iol with aspheric optics3.size:6mmoptics.12 13mmtotal diameter. 4.modifiedcloophaptic / platehaptics ( 5.iolshouldhaveuvblockingcapability6.iolshouldhave360°squareedge.. 7. foldableandinsertionbyinjectorwithdisposablecartridgeinsertablebyasub2.8mm incisionsize or smallerincision 8. diopters +11dto+17.5dat0.5dstep. 9. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , foldable intra ocular lense with injector ( size + 18 d to + 24 d ) size:6mm optics.12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material2. bi convex single piece iol with aspheric optics3.size:6mmoptics.12 13mmtotal diameter. 4. modifiedcloophaptic / platehaptics 5. iolshouldhaveuv blockingcapability6.iolshouldhave360°squareedge.. 7. foldableandinsertionbyinjectorwithdisposablecartridgeinsertablebyasub2.8mm incisionsize or smallerincision 8. diopters +18dto+24dat0.5d step. 9. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , foldable intra ocular lense with injector ( size + 24.5 d to + 28.5 d ) size:6mm optics.12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material2. bi convex single piece iol with aspheric optics3.size:6mmoptics.12 13mmtotal diameter. 4. modifiedcloophaptic / platehaptics 5. iolshouldhaveuv blockingcapability6.iolshouldhave360°squareedge.. 7. foldableandinsertionbyinjectorwithdisposablecartridgeinsertablebyasub2.8mm incisionsize or smallerincision 8. diopters +24.5dto+28.5dat0.5dstep. 9. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , standardpmmaintraocularlenses ( size+11dto +17.5d ) • 6mmopticsize12.5 13.0mmtotaldiameter, biconvex 1. pmmaopticsandhapticssinglepiecewithhole 2. 6mmopticsize12.5to13mmtotaldiameter, biconvex 3. iolhaptics–modifiedcshapedwith5° 10°anteriorangulation. 4. shouldhave360°squareedges. 5. iolshouldhaveuv blockingcapability 6. diopters +11dto+17.5dat0.5dstep. 7. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , standardpmma intraocularlenses ( size+18d to+24d ) • 6mmopticsize12.5 13.0mmtotaldiameter, biconvex 1. pmmaopticsandhapticssinglepiecewithhole 2. 6mmopticsize12.5to13mmtotaldiameter, biconvex 3. iolhaptics–modifiedcshapedwith5° 10°anteriorangulation. 4. shouldhave360°squareedges. 5. iolshouldhaveuvblockingcapability 6. diopters +18dto+24dat0.5dstep. 7. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , standardpmmaintraocularlenses ( size+24.5dto+28.5d ) 6mmopticsize12.5 13.0mmtotal diameter, biconvex 1. pmmaopticsandhapticssinglepiecewithhole 2. 6mmopticsize12.5to13mmtotaldiameter, bioconvex 3. iolhaptics–modifiedcshapedwith5° 10°anteriorangulation. 4. shouldhave360°squareedges. 5. iolshouldhaveuv blockingcapability 6. diopters +24.5dto+28.5dat0.5dstep. 7. supplying unitshouldbeisoaccreditedandiolshouldbece / usfda certified. , disposablesterilesurgicalrubberglovessize8inches • madeofnaturalrubberlatexpowdered, withouttear, properlyfoldedinapaper • shouldconformto is13422 • isi marked / cecertified / fdaapproved • colourcodemarkingtodesignatesize , disposablesterilesurgicalrubberglovessize8inches • madeofnaturalrubberlatexpowderfree, withouttear, properlyfoldedinapaper • shouldconformto is13422 • isi marked / cecertified / fdaapproved • colourcodemarkingtodesignatesize , rubberexaminationglovesmadeof naturalrubberlatex.non sterile, ambidextous, aql1.5microtexturedpowderedwithabsorbabledustingpowderusp.extrasmall.shouldconform tois 15354 , rubberexaminationglovesmadeofnaturalrubberlatex.non sterile, ambidextous, aql1.5microtexturedpowderedwithabsorbabledusting powderusp.smallshouldconform tois 15354 , rubberexaminationglovesmadeofnaturalrubberlatex.non sterile, ambidextous, aql1.5microtexturedpowderedwithabsorbabledustingpowderusp.mediumshouldconform tois 15354 , rubberexaminationglovesmadeofnaturalrubberlatex.non sterile, ambidextous, aql1.5micro texturedpowderedwithabsorbabledusting powderusp.largeshouldconform tois 15354 , urinecollectingbagfornewborn / paediatricurinecollectionbag, capacity 100ml • shouldhavesuitabilityforbothmaleandfemalepatients • shouldbeprovidedwithadhesiveforfixationandgoodgripwithminimal risk ofallergyandinjury • capacity 100ml • sterile , umbilical catheter ( fornew born ) all sizes • radioopaqueline • withfemaleflexiblemount • colourcodedconnector • opentipshouldbesoft, rounded, atraumatic • length40cm , umbilical cordclamp • suitableforclampingumbilicalcordof newborn • security locktopreventaccidentalopeningafterclamping • groovedclampingarea , sanitarynapkin, beltless 1. covering –covering oftheabsorbentfillershall begoodqualityknittedsleeveornon wovenfabricwhichhassufficientporosity topermittheassemblednapkintomeettheabsorbencyrequirements.thenapkinsshallhaveanonabsorbentbarrierononesidewhichshall haveanidentifying markindicating thesideof thebarrier. 2. absorbentfiller–thefillermaterial shallconsistof cellulosepulp / wadding, andshallbe freefrom lumps, oil spots, dirtorforeignmaterial, etc. 3. backstrip–abackstripforstickingthesanitary napkinontotheunderwearshouldbe there using goodqualityadhesivematerial. 4. size thesizeofabsorbentsection / completesanitarynapkinshall beasfollows: ( inmm ) absorbentsection total padlength210+_10 230+_10 width 60to 75 70to85 thickness 8+_2 5. weight: notmorethan10gm..instructionforusageshouldbementionedoneverypacket , sanitarynapkin, belttype 1. covering –covering oftheabsorbentfillershall begoodqualityknittedsleeveornon wovenfabricwhichhassufficientporosity topermittheassemblednapkintomeettheabsorbencyrequirements.thenapkinsshallhaveanonabsorbentbarrierononesidewhichshall haveanidentifying markindicating thesideof thebarrier. 2. absorbentfiller–thefillermaterial shallconsistof cellulosepulp / wadding, andshallbe free fromlumps, oilspots, dirtor foreignmaterial, etc 3. size thesizeofabsorbentsection / completesanitarynapkinshall beasfollows: ( inmm ) absorbentsection pad length 220+_10 width 70+_5 thickness 17+_3 4. weight: 12+_3gm 5. pack –sixnapkinsinapack. 6. elasticbeltwithloopsshall beprovidedineachpack. 7. absorbency: thenapkinshouldbeableto absorbnotlessthan30ml ofnormalsalineorcolouredwaterortestfluidwhenpouredontothecentreof thenapkinattherateof 15mlperminute..instructionforusageshouldbementionedoneverypacket. , belt lesssanitarynapkinwithwings 1. covering ( absorbingtopsheetcorrector ) –goodqualityknittedsleeveornonwovenfabricof rashfree, nonirritantandsofttotouchmaterialwhichhassufficientporositytopermittheassemblednapkintomeetabsorbencyrequirements.thenapkinsshallhaveanonabsorbentbarrierononesidewithadhesivecoveredbyadifferentlyidentifiablepaper 2. overalllength ( mm ) 230±5 3. core length 220mm±10 4. fluffcore / padlength 220mm±10 5. over all widthwithwings 160mm+_56.fluffcore / padlength 70mm±57.thicknessof asinglepad9 10mm 8. weightofasinglepad: 8 10gm 9. pack sixnapkinsinapack. 10type. belt lesssanitarynapkinwith wings 11.minimumabsorbency: 50ml12.phvalueofabsorbentmaterial6 8.5 b.disposableindividualpouchorwrapperforeachsanitarynapkin ( asperministryofenvironment, forestandclimatechangedated08.04.2016 ) pouch / wrapperspecifications: 1. pouch / wrappershouldbeofthesizeofsanitary napkinbeingsupplied. 2. itshouldhaveadhesivetosealthesanitary napkinswithin. 3. pouch / wrappershouldnotbetransparent. note:instructionsforuseof disposablepouch / wrappermstbewritteninhindiondisposable pouch / wrapper. blrsekyfd;sgq;slsusvjhusifdudkseksmdjdisposablepouch / wrapperesamkys, oadisposablepouch / wrapperdksxksanyxhiv~vhlscundjlqjf { krrjhdslsdwmsnku esamkysaa , oxygenmask ( adult ) • mouldfacemaskwithadjustableelasticstrapforproperpositionof maskonthemouthandnasalarea • friendlysoftmedicalpvcmaterial withcomfortablefitting. • aluminiumnasalclipprovidesbetterfixation. • anatomicaldesignprovideslighterseal. • latexfreeelasticstrapavailable. , oxygenmask ( paediatric ) • mouldfacemaskwithadjustableelasticstrapforproperpositionof maskonthemouthandnasalarea • friendlysoftmedicalpvcmaterialwithcomfortablefitting. • aluminiumnasalclipprovidesbetterfixation. • anatomicaldesignprovideslighterseal. • latexfreeelasticstrapavailable. • maskconnector4m , sterilecatheter, singleuse, forurinarydrainage ( foleybalooncatheter ) , 2way, size 14 • madeof siliconeelastomerbondedwithlatex • shouldhavehardplasticvalve • smoothdistalendwithsmootheyesforatraumaticintubation • symmetricalfoleyballoon • ballooncapacity30+ 1ml • shouldconformto is11497 • colorcodingmarkingtoidentifysize • length, wallthicknessandballoncapacity shouldbementionedasperis11497 • specificationforb, c, d, e, f, gshouldbementionedasperis11497 , ecgelectrode • reliabletrace, •highconductivity, • easytohandle , urethralcatheter90 ( fg 14 ) , madeupof medicalgradepvc , urethralcatheter91 ( fg 10 ) , madeupof medicalgradepvc , vaccumsuctionset, 2.5meterlength, • suctionhandlewithsuctiontube • sterile, •pyrogenic free, •latexfree, •singleuse , nebulizationmaskadult , nebulizationmaskpaediatric , listofsutures , absorbablesurgicalsuture ( sterilecatgut ) , bp / uspneedledsuturechromic ( 3 / 8cirrb needle40mmlength76cm ) size 1 / 0 , absorbablesurgicalsuture ( sterilecatgut ) , bp / uspneedledsuturechromic ( l / 2cirrb needle30mmlength76cm ) size 2 / 0 , absorbablesurgicalsuture ( sterilecatgut ) , bp / uspneedledsuturechromic ( l / 2cirrb needle30mmlength76cm ) size 1 / 0 , absorbablesurgicalsuture ( sterilecatgut ) , bp / uspneedledsuturechromic ( 1 / 2cirrb needle45mmlength100cm ) size 1 , nonabsorbablesurgical suture, sterilisedsurgical needled sutureblackbraidedsilk ( 3 / 8cirreversecuttingneedle26mm, length76cm ) size3 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolicacidviolet ) 1 / 2circlectroundbodied 40mm, gsneedle, suturelength90cm / size 1 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolicacidviolet ) 1 / 2circlectroundbodied 40mm, gsneedle, suturelength90cm size 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braided coated polyglactin / polyglycolic acidviolet ) 1 / 2 circle round bodied 30mm, suturelength90cm / size 2 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolicacidviolet ) 1 / 2circlereversecutting, os 40mm, suturelength90cm size 1 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolicacidviolet ) 1 / 2circlereversecutting36mm, osneedle, suturelength90cm / size 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolicacidviolet ) 1 / 2circleroundbodied20mm, suturelength70cm size 3 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterialcoatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 3 / 8 circle r cutting, ps 1, 24mm, suturelength70cm ) size 3 / 0...

North Western Railway - Rajasthan

34077154 supply of growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) , growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) ...

Sms Medical College - Rajasthan

33971959 tender invited for supply of generic drug and medicine at zenana hospital jaipur 1. bupivacaine inj. ip 0.5% 2. drotavering hydrochloride inj 40 mg / 2 mi 3• inj.halothane bp 4. inpsoflurane usp 5. ketamine inj ip 50 mg / mi 6. lignocaine inj ip 2 0 / 0 7. propofol inj ip 10 mg / mi 8. thiopentone inj ip 0.5 g 9. diclofenac sodium inj ip 25 mg / mi ( im / iv use ) 10. fentanyl citrate injection ip 2 ml 11. morphone sulphate inj ip 10mg / mi 12. paracetamol inj, 150 mg / mi 13. pentazocine inj ip 30 mg / mi ( im / iv use ) 14. adrenaline injection ip 1mg / ml im / iv use 15. dexamethasone inj ip 8mgj2mi 16. hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 17. pheniramine inj ip 22.75 mg / mi 18. promethazing inj ip 25mg / ml 19. naloxone inj ip 0.4mg / ml 20. amikacin inj ip 100 mg 21. amikacin inj ip 500 mg lir. nmphotericin b inj ip 50 mg 4. i arnold11in injection ip 500 mg benzathine benzylpenicillin inj ip 12 lac units 25. benzathine benzylpenicillin inj ip 6 lac _ units 26. cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium _ eq. to sulbactum 0.5gm ) ( im / iv use ) 27. cefotaxime injection ip 1 g 28. cefotaxime inj ip 500 mg / 250 mg 29. ceftazidime inj ip lg 30. ceftazidime inj ip 250 mg 31. ceftazidime inj ip 500 mg 32. ceftriaxone inj ip lg / vial 33. chloroquine phosphate inj ip 40 mg / ml 34. ciprofloxacin injection ip 200mg / 100m1 35. gentamycin injection ip 80mg / 2m1 ( im / iv use ) 36. meropenem inj ip 500 mg 37. meropenem inj ip 250 mg 38. metronidazole inj ip 500 mg / 100m1 39. bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) 40. leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 41. methotrexate inj ip 50 mg / 2 ml 42. paclitaxel inj ip 260 mg 43. paclitaxel inj ip 100 mg 44. enoxaparin sodium inj ip 60 mg 45. ethamsylate inj 250 mg / 2m1 ( 1m / iv ) 46. heparin sodium inj ip 5000 iu / m1 ( 1m / iv use ) 47. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) or amiodarone hydrochloride inj 50mg / m1 i.; digoxin inj ip 0.25 mg / ml 50. dobutamine inj ip 50mg / m1 / 250mg ( vial / ) dobutamine inj ip 250 mg / 5m1 ( amp ) 51. dopamine hydrochloride inj ip 40 mg / ml 52. magnesium sulphate inj. ip 500mg / m1 ( 50%w / v ) 53. nitroglycerin inj 5 mg / ml 54. diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 55. gadodiamide inj. 0.5mml / m1vial 56. furosemide injection ip 10mg / mi ( im and iv use ) 57. mannitol inj ip 20% w / v 58. dicyclomine inj ip 10 mg / m1 59. hyoscine butylbromide inj ip 20 mg / ml 60. metoclopramide inj ip 10mg / 2m1 61. ondansetron inj ip 2mg / mi 62. pentoprazole inj 40mg 63. ranitidine hcl injection ip 50mg / 2m1 64. biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) 65. carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 66. hydroxyprogesterone inj ip 250mg / m1 67. isophane insulin inj ip 40 iu / m1 68. progesterone inj 200 mg / 2m1 69. insulin injection ip ( soluble insulin / neutral nsu . j . 1 .dna • • 70. human anti d immunoglobulin injection 300mcg ( im use ) 71. atracurium inj 10 mg / ml 72. glycopyrrolate inj ip 0.2 mg / ml 73. midazolam inj ip 1 mg / ml 74. neostigmine inj ip 0.5 mg / ml 75. succinylcholine _ inj. ip 50 mg / ml ( iv use ) 76. valethamate bromide inj 8mg / ml 77. isoxsuprine inj ip 5 mg / ml 78. methylergometrine inj ip 0.2 mg / ml 79. oxytocin inj ip 5 iu / m1 80. diazepam inj ip 10mg / 2m1 ( 1m / iv use ) 81. aminophylline inj ip 25 mg / ml 82. compound sodium lactate inj. ip 83. dextrose inj ip 25% w / v 84. dextrose inj ip 10% 85. dextrose in ] ip 5% 86. multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 87. multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 88. potassium chloride inj. 0.15 gm / ml 89. sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 90. sodium chloride in ] ip 500 ml 91. calcium gluconate inj ip 10% ( iv use ) 92. vitamin b complex inj nfi 93. sodium bicarbonate inj ip 7.5% w / v 94. water for inj ip 95. labetalol hci in } ip 20mg / 4m1 96. betamethasone sod phos inj ip 4mg / m1 97. vecuronium bromide for injection 4mg ( freeze dried ) 98. phenobarbitone inj ip 200mg / m1 99. hyaluronidase injection ip each vial contains hyaluronidase ip 1500i.u. 100. piperacillin + tazobactum for injection ip 4gm+500mg 101. torsemide inj 10 mg / ml y .02. meropenem inj. ip 1gm 103 lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 104. iron sucrose injection usp / bp 20mg / m1 ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 105. 106. acetylcystine solution usp ( injection ) 200 mg / ml amikacin inj ip 250 mg 107. amoxicillin and potassium clavulanate inj ip 1.2gm 108. artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1m1 ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5mlampoule ) 109. aztreonam injection usp 500 mg 110. linezolid inj 200mg / 100m1 111. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 112. carboplatin injection ip 150 mg 113. carboplatin injection ip 450 mg 114. cisplatin inj ip 10 mg / 10 ml 115. adenosine injection ip 6 mg / 2m1 116. isoprenaline injection ip 2mg / ml 117. noradrenaline injection ip 2 mg / ml 118. sodium chloride injection ip 100 ml 119. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 120. neostigmine injection ip 2.5mg / sml vitamin k 1 ( phytomenadione ) ip 1mg / 0.5m1 injection with syringe ( detail in rc ) 121. 122. atropine sulphate injection 0.6mg / m1 123. fentanyl citrate injection 50mcg / m1 124. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous 0........, solution 350 mg iodine / ml. lir levetiracetam injection 500mg / 5m1 126 aztreonam injection 1gm 4 , , , clindamycin phosphate injection ip 300 mg 128. polymixin sulphate b injection usp 5 lac i.u. 129. meropenem injection ip 250 mg 130. colistimethate injection ip 1m iu powder for solution 131. n butyl alcohol injection 0.26mg / smi, citric acid 2.5mg / 5m1 and sod. chloride solution 5 ml size 132. tranexamic acid injection ip 100mg / m1 5misize 133. i esmolol hydrochloride injection 10mg / m1 10mi size 134. i hepatitis b immunologlobin injection ip 200 i.0 135. hepatitis b immunologlobin injection ip 100 i.0 136. human chorionic gonadotropin injection ip 5000 i.u. 137. ferric carboxymaltose injection 50 mg / ml 10 ml size 138. caffeine citrate usp injection 20mg / m1 ( equivalent to 10 mg caffeine base / mi ) 3mi size 139. amino acid 10% injection 100mi size 140. amino acid 10% injection 250m1 size 141. inj poractant alpha 80 mg / mil in pack of 1.5 ml ( detail in rc ) 142. human immunoglobulin inj with 12%igm, 12%iga, 76%i gg in pack of 10m1 ( 0.5gm ) 143. human immunoglobulin inj with 12%igm, 12%ig4, 76%1 gg in pack of 10m1 ( 0.5gm ) 144. kabalyte ( multipal electrolyte inj ) 145. inj mephentermine 146. amphotericin b inj . ( iiposonal ) 147. fluconazole inj .48. 149. inj propfol with mct+ict isolyte —p inj 150 inj teicoplain 151. 152. inj sidenafil 10mg !nj prostagladine 500mg 153. inj placentrax 154. inj sodium chloride 1000m1 155. inj insulin detemir / levemir ( long aceting ) 156. inj tt 0.5 ml 157. inj leuprolide 158. inj xylocard 159. inj metoprolol 160. inj fentanyl 161. inj esmlol 162. progesterone injection 50 163. glyceryl trinitrate injection, diluted 5mg / m1 164. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50m1 165. polymyxin b for injection 1 million 166. potassium chloride for injection 167. sodium bicarbonate injection 168. inj. dopamine 169. inj.adrenaline 170. inj.dobutamine 171. inj.phenobarbitone 172. inj.midazolam 173. inj.calcium gluconate 174. inj.caffine citrate 175. inj.amikacin 177 inj amphoterlcin b ( liposomal ) inj.surfactant ( porectent ) 179 inj.human albumin 180. inj.prostoglandin 181. inj.linazolid 182. inj.ciplox 183. inj.levofloxacin 184. polygeline 3.5% solution with electrolytes for i.v. infusion 185. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 186. ofloxacin infusion ip 200mg / 100 ml ( in naci inj ) 187. vancomycin for intravenous infusion ip 500 mg 188. vancomycin for intravenous infusion ip 1 gm 189. mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 190. hepatitis b immunoglobulin 2001110.4mi. im / sc pfs vial 191. paracetamol infusion ip 1% w / v 100m1 size 192. instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 193. medical device sterlizat►on solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499 2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 194. enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 90012015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio 195. nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12. 5% c18 10% 68%c12, 32% c14 10% inert ingredient 80% usepa registration number mandatory usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 :2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. 196. antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries 197. ringer acetate infusion 500 ml itnioil sot ( infusion set ) with airway m1, 1 needle ( paediatric llie ) ster110 111110%.111le 1111thioti ••i %%fill alk roc.. ) starlio 1.11 to amy sodium 1. 111011, 1r and 0extrose 0 .0.. ) , immo!, won, pal a, et.ilika illtml, , 11 410 n►g with both i empri e idollt ‘ aw. ..tilay 10% 1`, 11, 1 ( ot.ffilol tiltwooli i000 rug with both i olupel e% mott caps spray 10% ki161% al spirit ip ( 100 ml ) . 204• surgical spirit ip ( 500 ml ) 205. savalon 11. 206, savlon 500 ml 207. dextrose with sod.chlorlde polypack 5% soomi 208. distilled water 10m1 209. 210. distilled water 500m1 distilled water 5 ltr — 211. sodium chloride and dextrose 0.45% infusion 500m1 212. folinic acid 200mg / vial 213, sodium chloride 3% 100m1 214. prostaglandin 500mcg / m1 215. azithromycin 10 ml vial equalvelent to 500 mg 216. caffeine cirate 20mg / mi 217. carbetocin 1m1 / 100micro. 218. ceftriaxone and sulbactam 1.5g 219. clindamycin 600mg / 4m1 220. compound sodium lactate ( ringer lactate ) in glass bottle 500m1 221. folinic acid 200mg / vial 222. azithromycin 10 ml vial equaivelent to 500 m 223. fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography 224. folic acid +methylcobalamine 10 ml pack fsh 150 ill gdw 5% glass bottle / 500m1 228. glyceryl trinitrate injection, diluted 5mg / m1 229. hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu 230. insulin aspen 231. insulin lispro 232. i invert sugar 10% ( fructodex 10% ) 500 cc 233. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg iodine / ml non ionic 50 ml 234. isolyte p 10% 500 ml 235. levofloxacine 500mg / 100 ml 236. lignocaine ( preservative free ) 2% 237. low molecular wt. heparin 0.4mg 238. mephentermine 50mg / m1 239. methylene blue 240. metotrexate 15mg ( preservative free ) 241. midazolam 5mg / m11 ml 242. multivitamin 10 ml 243. nandrolone decanoate 100mg 244. nandrolone decanoate 50 mg 245. normal saline 500 nil glass bottle 246. normal saline 1000 ml glass bottle 247. paracetamol infusion 500 mg with both temper evident caps spray 10% 248. paracetamol infusion 1000 mg with both temper evident caps spray 10% 249. procaine penicillin fortified 2 lack 250. teicoplanln 200 mg 251. teicoplanln 400 mg 7 vitt / min 0 ( 600000 iu ) insulin glargine 100 iu per mlinrefilled pen ____ _. insulin. 50 / 50 — as human albumin 20% in 50 ml vial 25 8. tetanus vaccine ( adsorbed ) ip in 0.5 ml 257. in ) . propofol mctact with olelcacid in ) . iv 258. in ) . paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag 259. inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 260. inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 261. in ) . ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag_ 262. int ringers lactate 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 263. inj.5% dextrose 500 ml in 100% .., , r tail biodegradable non dehp double sterilized polyolefin closed system bag 264. inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 265. inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag 266. inf. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin 267. inj. hydroxy ethyl 6%o tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin ablets 268. amlodlpine tab ip 2.5 mg 269. amiodipine tablets ip 5 mg 270. atenolol tab ip 50 mg 271. atorvastatin tab ip 10 mg 272. clopidogrel tab ip 75 mg digoxin tab ip 0.25 mg. 274. diltiatem tabs ip 30 mg film coated 27, enalaprll maleate tab ip 5mg — 276. enalaprll maleate tab ip 2.5mg 277. isosorbide dlnitrate tab ip 5 mg 278. isosorblde mononitrate tabs ip 20 mg 279. usinopril tab ip 5mg 280. losartan tab ip 50 mg 281. methyldopa tab ip 250mg film coated 282. propranolol tab ip 40 mg 283. verapamil tab ip 40 mg film coated 284. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 285. frusemide tab ip 40 mg 286. hydrochlorthiazide tab ip 12.5 mg 287. torsemlde tab 10 ip mg 288. antacid tablets.formula, each chewable tablet contains magnesium trisllicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 289. blsacodyl tab ip 5mg 290. dicyclomine tab ip 10 mg 291. domperldone tab ip 10 mg 292. loperamide tab ip 2 mg 293. metoclopramide tab ip 10 mg 294. ranitidine tab ip 150mg 500. glimepiride tab ip 1mg 301. metformin tab ip 500 mg ( film coated ) 302. norethisterone tab ip 5 mg 303. thyroxine sodium tablets ip 100mcg 304. thyroxine sodium tablets ip 50mcg 305. neostigmine tab ip 15 mg 306. isoxsuprine tab ip 20 mg 307. methylergometrine tab ip 0.125 mg 308. misoprostol tab ip 200 mcg 309. alprazolam tab ip 0.25 mg 310. alprazolam tab ip 0.5mg 311. salbutamol tablet ip 4 mg 312. salbutamol tab ip 2 mg 313. theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 314. theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 315. tinidazole tab ip 300 mg 316. tinidazole tab ip 500 mg 317. ranitidine tab ip 300mg 318. dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 319. aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 320. metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 211 athaffnern;n 1 liselrnekinrirla ici ietaineta • release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) 322. glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 323. losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 324. losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 325. amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine smg, atenolol 50mg ) 326. atenolol tab ip 25 mg 327. hydrochlorthiazide tab ip 25mg 328. losartan tab ip 25 mg 329. ascorbic acid tab ip 500 mg 330. ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 331. ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 332. folic acid tab ip 5 mg 333. multivitamin tablets nfi formula sugar coated vit a 2500 iu vit 81 2mg vit b6 0.5mg vit c 50mg calcium pantothenate lmg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 334. vitamin b complex tablet nfi ( prophylactic ) 81 2mg 82 2mg 86 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 335. labetalol tab ip 100mg 336. nitrofurantoin tab ip 100mg 337. hyoscine butyl bromide tablets ip 10mg 338. drotaverine tab ip 40 mg 339. zinc sulphate dispersible ta blets ip elemental zinc 10 mg 340. diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 341. aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 342. mefenamic acid tablets bp 500 mg 343. 344. cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab levofloxacin tablets ip 250 mg 345. linezolid tablets ip 600 mg 346. ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 347. methotrexate tablets ip 10 mg 348. bromocriptlne tablets ip 2.5 mg 349. atorvastatin tablets ip 40 mg 350. clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 351. metoprolol tablets ip 25 mg 352. metoprolol succinate extended release tablets ip 50 mg 353. telmisartan tablets ip 40 mg 354. finasteride tablets ip 5 mg 355. flavoxate tablets ip 200 mg ( coated tablet ) 356. drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 357. lactic acid bacillus tab 60 million spores 358. ondansetron orally disintegrating tablets ip 4mg 359. ursodeoxycholic acid tablets ip 300 mg 360. medroxyprogesterone acetate tablets ip 10 mg 361. chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 362. mifepristone tab ip 200mg 363. calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 364. ramipril tablets ip 2.5 mg 365. levoceitrizine tablet 5mg 366. montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 367. levetiracetam tablet ip 500 mg 368. levetiracetam oral solution / suspension 100mg / m1 369. co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) 370. tenaligliptin tablet ip 20mg 371. levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 372. letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 373. ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 374. rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) 375. rosuvastatin tablet 10 mg 376. doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 377. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 378. cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 379. diclofenac+ parcetamol+ serratiopeptidsase tab 380. dehydrogestrone tab 381. estradiol tab 382. povidon vaginal pessaries tab 383. vit b 12 tab 384. tab levtiracetcetam 500 mg 385. tab conjugated estrogen 386. tab mirabegum 387. tab derifenacin 388. tab propar 389. tab alone / ramloxifene 390. tab cyproterone acetate & ethinyloestradiol 391. tab centchronam 392. tab dinogest 393. progestron only pills 394. tab chymoral forte 395. lasix tab 396. tab lactare 397. faskit ( fluconazole / azthomycine & secnidazole tab 398. tab telmisarton +hidrocylorthiaozide 399. tab mefenamic acid +dicyclomine hydro 400. coq 300mg ( capsule of coenzyme 010 with lycopene, selenium & omega 3 fatty acid ) 401. clindamycin capsule ip 150mg 402. clindamycin capsule ip 300 mg 403. oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 404. oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 405. oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 406. natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 407. vitamin e capsule 400 mg 408. coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) 409. aceclofenac+paracetamoi+ serratiopeptidase ( 100+325+15 mg ) 410. cefpodoxime 200mg cefpodoxime cv 375 cyproheptadine 4mg 411. 412. 413. cyproterone acetate 2 mg +ethynil estradiol. 035mg 414. dienogest 2mg 415. dydrogesterone 10mg 416. estradiol valerate 2 mg 417. ethynil estradiol 0.02mg+ tab desogestral 0.15mg 418. inositol + myoinositol 1000rng 419. levetiracetam ip 250 mg 420. mirabegeron 25 mg 421. mifepristone 25mg 422. nifidipine 20mg 423. paracetomol 650 mg 424. progesterone only pills 425. propranolol 40 mg sr 426. rosuvastatin 10mg + fenofibrate 160mg 427. serratiopeptidase 10mg 428. serratiopeptidase 20 mg 429. tramadol 37.5mg + paracetamol 325mg 430. trypsin chymotripsin 431. ulipristal 5mg 432. hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l•aspartate 150mg pyridoxine hydrochloride 3 mg 433. spores of polyantibiotic resistant bacillus clausii 2 billion capsules 434. iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mg eq. to elemental iron 30mg phospholopid 167 mg eq. to phosphatidylserine 100 mg 435. cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen 436. telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet contain telmisartan40mg + hydroclrothaizide 12.5 mg 437. telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet contain telmisartan80mg + hydroclrothaizide 25 mg 438. 439. mefonamic acid 250mg+ dicyclomine hydrochloride each tablet contain mefonamic acid 250mg+ dicyclomine hydrochloride cornbitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazolelsomg + azithromycin 1 gm 7 secnidazole 1 gm 440. zideovudine 60 + lamivudine 30 441. lung surfactent 1.2 ml ( 50 mg ) lypholised 442. amphotericin b lipid complex 10 mg 443. ionic solution of silver nutrate with tween twenty 100 ml :ream 444. 445. 446. 447. 448. 449. 450. clotrimazole cream ip 2% w / w acyclovir cream 5% cetrimide cream ip 15 gm fusidic acid cream ip 2% silver sulphadiazine cream ip 1% 50gm tube dinoprostone cream / gel 0.5 mg dinoprostone in syringe beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 451. betamethasone diproplonate cream ip 0.05% 452. silver sulphadiazine cream ip 1% 500 gm jar 453. framycetin sulphate cream 1 0 / 0 30gm pack 454. framycetin sulphate cream 10 / 0 100 gm pack 455. 456. 457. estradiol cream estrogen cream sumag cream 458. neomycin sulphate cream ointment 459. neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 ili / gm 460. lignocaine gel 1p 2% a 461. compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 0 / 0 462. ointment containing lidocaine ip 3 0 / 0 zinc oxide ip 5 ao , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ) 463. povidone iodine ointment 5% 15 gm 464. povidone iodine ointment usp 250 gm 465. coal tar 6% & salicylic acid 3% ointment 466. acyclovir eye ointment ip 3% w / w 5gm size 467. chloramphenicol 1% w / w eye ointment ip, 3gm size 468. thrombophobe ointment gel 469. i 470. f r` cc is antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil antacid liquid, each 5mi contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 471. diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 472. clindamycin phosphate gel usp 10 / 0 473. i metronidazole 1% and chlorhexidine gluconade 0.25% gel drops 474. ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / 0, enzocaine 2.7 0 / 0 , chlorbutol 5 olo, turpentine oil 15 o / o 475. domperidone oral drops 10mg / ml ( 10m1 ) 476. carboxymethylcellulos e eye drops ip 0.5% 477. phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% 478. kylometazoline nasal drops ip 0.1% 479. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) 480. ciprofloxacin eye drops ip 0.3 o / o w / v 481. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 482. multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 lmg, riboflavine phosphate sodium 2mg, d•panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl lmg, cyanocobalamin lmcg, lysine hcl 10mg 483. lactulose solution 484. i digoxin 0.25% solution 485. vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 486. lohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 487. acetylcystine solution usp ( injection ) 200 mg / ml 488. colistimethate injection ip 1m iu powder for solution 489. n butyl alcohol injection 0.26mg / 5m1, citric acid 2.smg / smi and sod. chloride solution 5 ml size ecaffiene citrate oral solution human albumin solution ip 20% 490. x491. 492. povidone iodine solution ip 5 % 500 ml 493. formaldehyde solution ( 34.5 per. — 38 per. ) 494. gentian violet topical solution usp lob 495. gluteraldehyde solution 2% 496. hydrogen peroxide solution ip 6 % ( 20vol ) 497. lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) ( 249 ] 498. povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 499. dicyclomine hydrochloride oral solution ip 10mg / 5m1 500. ipratropium bromide nebulizer solution 250 mcg / ml 501. salbutamol nebuliser solution bp 5 mg / ml 502. saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 503. chlorhexidine gluconate solution 5% 250 ml 504. povidone iodine solution ip 5% 100m1 bottle 505. potassium chloride oral solution u.s.p 500mg / 5m1 506. vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 507. hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 508. povidone iodine solution ip 10 % 509. lactulose solution usp / bp 10gm / 15ml or 3.35 gm / sml 510. vitamin d3 oral solution 60000 iu 511. concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans 512. feracrylum 1% w / v sterile solution 100 ml 513 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5misize 514. balancesalt solution with ph.of 7.2 to 7.4 osrnolarity 292 to294 in 100% biodegradable bag with potyofin syrup 515. i cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, arlip ‘4. ) . 516. cough syrup / expectorant ( 50 ) ml 517. alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate 518. multi vitamin syrup 519. b. complex 520. calcium phosphate 200 ml 521. dextromethorphan hcl + chlorpheniramine 522. each 15 ml contains: milk of magnesia 11.25 ml• liquid paraffin 3.75 ml 170 ml 523. each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml 524. linezolid 100mg / 5m1in 30m1 525. sodium picosulphate oral suspension 526. sorbitol + tricholine citrate suspension 527. 528. 529. paracetamol drops paediatric paracetmol oral suspension ip ( each mi contains paracetamol 150mg ) albendazole oral suspension 1p 400 mg / 10m1 domperidone suspension ip 5mg / 5m1 530. 531. budesonide nebulizer suspension 0.25mg / m1 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 532. 533. 535. surgical cap disposable ( for surgeons ) ampicillin cap ip 500mg pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets pregabalin cap ip 7s m8 536. tramadol cap ip 50 mg — _ 537. tramadol cap ip 50 mg 538. amoxycillin cap ip 250mg 539. amoxycillin cap ip 500mg 540. doxycycline cap ip 100 mg 541. itraconazole cap 100 mg 542. danazol cap ip 50 mg 543. deferiprone cap 250mg 544. deferiprone cap 500mg 545. nifedipine cap ip 5mg 546. omeprazole cap ip 20 mg 547. l•ornithine l•aspartate ( 150mg ) + pancreatin ( 100mg ) 548. nifedipine sublingual pessary 549. povidone iodine powder 550. infant milk formula term 400 gm 551. infant milk pre trem baby ( lbw ) 400 gm sachet 552. hmf for pretem 553. l arginine+proanthocynadine granules 3mg / 5 mg tablets and in cation 554. 1 l arginine 3 gm + proantho cyaniding 75 mg 555. tab dehydro epiondrosterone sr 75 mg 556. tab anastrozole 3. mg 557. tab letrozole 2.5 mg 558. inj. certrorelix acetate 0.25 mg 559. lnj. menotropin 150 re 0.5 nil 560. lnj. menotropin 225 iu / 0.75 ml 561. highly purified hmg 75 / 150 iu 562. highly purified follicle stimulating hormone 75 / 150 iu 563. highly purified hcg 2000 / 5000 / 7500 / 10000 iu 564. natural microhized progesterone soft caps 100 / 200 mg 565. natural microhized progesterone soft caps 200 / 400 mg 566. inj enoxaparin 40 mg et 567. estradiol & dydrogesterone tab. 1 / 5 mg 568. combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg 569. combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg 570. ubidecarenone capsules lisp 0100 / q300 ( co enzyme 010 ) 571. inj leuprolide acetate 3.75 mg 572. inj leuprolide acetate 1 mg / 0.5 ml 573. inj leuprolide acetate 4 mg / 4 ml 574. inj. buserlin acetate 0.5 mg / 0.5 ml 575. inj. buserlin acetate 7 mg / 7 ml 576. tab. diclofenac gastro resistant ip so mg 577. tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg 578. tab. ibuprofen ip 400 mg 579. tab. paracetamol ip 500mg 580. tab. paracetamol ip 650mg 581. cap. tramadol ipsomg 582. tab. chlorpheniramine maleate ip 4mg 583. tab. prednisolone ip smg 584. tab. acyclovir 200mg 585. tab. albendazole ip 400mg 586. tab. amoxycillin and potassium clavulamate ip 500mg+125mg 587. cap. amoxycillin ipsoomg 588. tab. azithromycin ip 500mg 589. tab. cefixime ip 200mg 590. tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated 591. tab. ciproflixacin ip 500mg 592. capometrazole ip 20mg 593. tab. clotrimazole vaginal ip 500mg 594. cap. doxycycline ip 100mg 4011frar 70 595. tab. fluconazone ip150mg 596. cap. itraconazole ip 100mg 597. tab. metronidazole ip 200mg 598. tab. metronidazole ip 400mg 599. tab. norfloxacin ip 400mg 600. cap nifedipine ip 5mg 601. tab. nitedipine ip 10mg 602. dinoprostone cream / gel 0.5mg dinoprostone in syringe 603. tab. trenexamic acid 604. tab. clindamycin 150mg 605. tab. clindamycin 300mg 606. inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg 607. inj. phenytoin 50mg 608. inj. cisplatin 50mg 609. inj. vancomycin 500mg 610. inj. vancomycin 1 gm 611. inj, normal human intravenous immunoglobuline 612. inj. surfactant 3m1 613. inj. feracrylum 1% w / v solution 614. dinoprostone gel 615. tab. ramipril tablets ip 5mg 616. cap. evening primosa 1000mg...

Medical College - Rajasthan

33970279 tender invited for supply of generic drug and medicine at zenana hospital, jaipur , bupivacaine inj. ip 0.5% , drotavering hydrochloride inj 40 mg / 2 ml , inj.halothane bp , inj.isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , fentanyl citrate injection ip 2 ml , morphone sulphate inj ip 10mg / ml , paracetamol inj, 150 mg / ml , pentazocine inj ip 30 mg / ml ( im / iv use ) , adrenaline injection ip 1mg / ml im / iv use , dexamethasone inj ip 8mg / 2ml , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , pheniramine inj ip 22.75 mg / ml , promethazing inj ip 25mg / ml , naloxone inj ip 0.4mg / ml , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amphotericin b inj ip50 mg , ampicillin injection ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 500 mg / 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , chloroquine phosphate inj ip 40 mg / ml , ciprofloxacin injection ip 200mg / 100ml , gentamycin injection ip 80mg / 2ml ( im / iv use ) , meropenem inj ip 500 mg , meropenem inj ip 250 mg , metronidazole inj ip 500 mg / 100ml , bleomycin injection ip 15mg ( bleomycin sulphate injection 15units ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , methotrexate inj ip 50 mg / 2 ml , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , amiodarone hydrochloride inj 50mg / ml , digoxin inj ip 0.25 mg / ml , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , nitroglycerin inj 5 mg / ml , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , furosemide injection ip 10mg / ml ( im and iv use ) , mannitol inj ip 20% w / v , dicyclomine inj ip 10 mg / ml , hyoscine butylbromide inj ip 20 mg / ml , metoclopramide inj ip 10mg / 2ml , ondansetron inj ip 2mg / ml , pentoprazole inj 40mg , ranitidine hcl injection ip 50mg / 2ml , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70% isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , human anti d immunoglobulin injection 300mcg ( im use ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , isoxsuprine inj ip 5 mg / ml , methylergometrine inj ip 0.2 mg / ml , oxytocin inj ip 5 iu / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , aminophylline inj ip 25 mg / ml , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , calcium gluconate inj ip 10% ( iv use ) , vitamin b complex inj nfi , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , labetalol hcl inj ip 20mg / 4ml , betamethasone sod phos inj ip 4mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , phenobarbitone inj ip 200mg / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , piperacillin + tazobactum for injection ip 4gm+500mg , torsemide inj 10 mg / ml , meropenem inj. ip 1gm , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , acetylcystine solution usp ( injection ) 200 mg / ml , amikacin inj ip 250 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , linezolid inj 200mg / 100ml , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , adenosine injection ip 6 mg / 2ml , isoprenaline injection ip 2mg / ml , noradrenaline injection ip 2 mg / ml , sodium chloride injection ip 100 ml , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , neostigmine injection ip 2.5mg / 5ml , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection with syringe , atropine sulphate injection 0.6mg / ml , fentanyl citrate injection 50mcg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , levetiracetam injection 500mg / 5ml , aztreonam injection 1gm , clindamycin phosphate injection ip 300 mg , polymixin sulphate binjection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , tranexamic acid injection ip 100mg / ml 5ml size , esmolol hydrochloride injection 10mg / ml 10ml size , hepatitis b immunologlobin injection ip 200 i.u , hepatitis b immunologlobin injection ip 100 i.u , human chorionic gonadotropin injection ip 5000 i.u. , ferric carboxymaltose injection 50 mg / ml 10 ml size , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , amino acid 10% injection 250ml size , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , kabalyte ( multipal electrolyte inj ) , inj mephentermine , amphotericin b inj . ( liposonal ) , fluconazole inj , inj propfolwith mct+lct , isolyte –p inj , inj teicoplain , injsidenafil 10mg , inj prostagladine 500mg , inj placentrax , inj sodium chloride 1000ml , inj insulin detemir / levemir ( long aceting ) , injtt0.5 ml , inj leuprolide , inj xylocard , inj metoprolol , inj fentanyl , inj esmlol , progesterone injection 50 , glyceryl trinitrate injection, diluted 5mg / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50ml , polymyxin b for injection 1 million , potassium chloride for injection , sodium bicarbonate injection , inj. dopamine , inj.adrenaline , inj.dobutamine , inj.phenobarbitone , inj.midazolam , inj.calcium gluconate , inj.caffine citrate , inj.amikacin , inj.polymixin b , inj.amphotericin b ( liposomal ) , inj.surfactant ( porectent ) , inj.human albumin , inj.prostoglandin , inj.linazolid , inj.ciplox , inj.levofloxacin , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , hepatitis b immunoglobulin 200iu 0.4ml im / sc pfs vial , paracetamol infusion ip 1% w / v 100ml size , instrument rust remover composition: phosphoric acid 25% and cleaner. instrument strains rust remover with chelating agent with amphoteric solution compatible with manual and ultrasonic machine. test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001 , medical device sterlization solution nabo3 nh2o 50% w / w aldehyde free, biodegradable, safe and non hazardous. it can be used for sterilization in all medical device and instrument test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , enzymatic instrument cleaner enzymatic detergent consists of neutral ph. or low alkaline to which one or more enzyme have been added to surfactant and stabilizing agent. protease, lipase amylase cellulose. test report from nabl certified lab to be submitted. the product should be ce / is certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. 5lit 5 medical device sterlization solutio , nanosol gel polymer disinfectant 60%c14, 30% c16, 5% c12, 5% c18, …….10% 68%c12, 32% c14………10% inert ingredient ………80% usepa registration number mandatory. usepa certificate claim on n corona virus to be submitted. test report from internationally acclaimed certified lab to be submitted. the product should be ce / iso certified. the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries. certificate should be authorized by a member of multilateral recognition arrangement. american / european certificate of free sale mandatory. product should be registered under fifra section 3 ( c. ) 9 under the provisions of pr notice 98 10. , antiseptic surgical and scrub composition: chlorohexidine gluconate 20% v / w with organic surfactants and free from sls with moisture and skin softener test report from nabl certified lab to be submitted. the product should be ce / is certified . the company should be en 1499:2013 certified for chemical disinfectant and antiseptics & iso 9001:2015 by a notified body in regulated countries , ringer acetate infusion 500 ml , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , sodium chloride and dextrose 0.45% infusion 500ml , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , savalon1 l , savlon 500 ml , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , distilled water 500ml , distilled water 5 ltr , sodium chloride and dextrose0.45% infusion 500ml , folinic acid 200mg / vial , sodium chloride 3% 100ml , prostaglandin 500mcg / ml , azithromycin 10 ml vial equaivelent to 500 mg , caffeine cirate 20mg / ml , carbetocin 1ml / 100micro. , ceftriaxone and sulbactam 1.5g , clindamycin 600mg / 4ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , folinic acid 200mg / vial , azithromycin 10 ml vial equaivelent to 500 mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , folic acid +methylcobalamine 10 ml pack , fsh 75 iu , fsh 150 iu , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , hp hmg ( highly human menopausal parodied gonadotropin ) 150 iu , insulin aspart , insulin lispro , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , isolyte p 10% 500 ml , levofloxacine 500mg / 100 ml , lignocaine ( preservative free ) 2% , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , methylene blue , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , multivitamin 10 ml , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , normal saline 500 ml glass bottle , normal saline 1000 ml glass bottle , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , procaine penicillin fortified 2 lack , teicoplanin 200 mg , teicoplanin 400 mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in0.5 ml , inj. propofol mct / lct with oleicacid inj. iv , inj. paracetamol infusion 1000 mg in double sterilized closed system 100 % biodegradable eco friendly polyolefin 100 ml bag , inj.0.9% normal saline 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 1000 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 1000 mlin 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj.0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. balance hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , inj. hydroxy ethyl 6 % tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100 % biodegradable bag with polyolefin , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10 mg , clopidogrel tab ip 75 mg , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , methyldopa tab ip 250mg film coated , propranolol tab ip 40 mg , verapamil tab ip 40 mg film coated , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , frusemide tab ip 40 mg , hydrochlorthiazide tab ip 12.5 mg , torsemide tab 10 ip mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , domperidone tab ip 10 mg , loperamide tab ip 2 mg , metoclopramide tab ip 10 mg , ranitidine tab ip 150mg film coated , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , ethinyloestradiol tabs ip 50 mcg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , thyroxine sodium tablets ip 100mcg , thyroxine sodium tablets ip 50mcg , neostigmine tab ip 15 mg , isoxsuprine tab ip 20 mg , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , salbutamol tablet ip 4 mg , salbutamol tab ip 2 mg , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , tinidazole tab ip 300 mg , tinidazole tab ip 500 mg , ranitidine tab ip 300mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustain ed release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , hydrochlorthiazide tab ip 25mg , losartan tab ip 25 mg , ascorbic acid tab ip 500 mg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , labetalol tab ip 100mg , nitrofurantoin tab ip 100mg , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mgand paracetamol 325 mg , mefenamic acid tablets bp 500 mg , cetirizine, phenylephri ne & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , methotrexate tablets ip 10 mg , bromocriptine tablets ip 2.5 mg , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , telmisartan tablets ip 40 mg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , ondansetron orally disintegrating tablets ip 4mg , ursodeoxycholic acid tablets ip 300 mg , medroxyprogesterone acetate tablets ip 10 mg , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , mifepristone tab ip 200mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , ramipril tablets ip 2.5 mg , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethox azole 800mg ) , tenaligliptin tablet ip 20mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20mg ) , rosuvastatin tablet 10 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , diclofenac+ parcetamol+ serratiopeptidsase tab , dehydrogestrone tab , estradiol tab , povidon vaginal pessaries tab , vit b 12 tab , tab levtiracetcetam 500 mg , tab conjugated estrogen , tab mirabegum , tab derifenacin , tab propar , tab alone / ramloxifene , tab cyproterone acetate & ethinyloestradiol , tab centchronam , tab dinogest , progestron only pills , tab chymoral forte , lasix tab , tab lactare , faskit ( fluconazole / azthomycine & secnidazole tab , tab telmisarton +hidrocylorthiaozide , tab mefenamic acid +dicyclomine hydro , coq 300mg ( capsule of coenzyme q10 with lycopene, selenium & omega 3 fatty acid ) , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , vitamin e capsule 400 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , cefpodoxime 200mg , cefpodoxime cv 375 , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dienogest 2mg , dydrogesterone 10mg , estradiol valerate 2 mg , ethynil estradiol 0.02mg+ tab , desogestral 0.15mg , inositol + myoinositol 1000mg , levetiracetam ip 250 mg , mirabegeron 25 mg , mifepristone 25mg , nifidipine 20mg , paracetomol 650 mg , progesterone only pills , propranolol 40 mg sr , rosuvastatin 10mg + fenofibrate 160mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , tramadol 37.5mg + paracetamol 325mg , trypsin chymotripsin , ulipristal 5mg , hepato protective tablet each film coated tablet to contain matadoxine 500mg silymarin 140mg l ornithine l aspartate 150mg pyridoxine hydrochloride 3 mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains ferne saccharate ( in micro encapsulated form ) 75mgeq. to elemental iron 30mg phospholopid 167 mgeq. to phosphatidylserine 100 mg , cojugated estrogen 0.3 mg tab. each tablet contain 0.3 mg conjugated cstrogen , telmisartan40mg + hydroclrothaizide 12.5 mg i.p. each tablet containtelmisartan40mg + hydroclrothaizide 12.5 mg , telmisartan80mg + hydroclrothaizide 25 mg i.p. each tablet containtelmisartan80mg + hydroclrothaizide 25 mg , mefonamic acid 250mg+ dicyclominehydrochloride each tablet contain mefonamic acid 250mg+ dicyclominehydrochloride , combitkit of ( tab ) fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm each kit contain tab fluconazole150mg + azithromycin 1 gm 7 secnidazole 1 gm , zideovudine 60 + lamivudine 30 , lung surfactent1.2 ml ( 50 mg ) lypholised , amphotericin b lipid complex 10 mg , ionic solution of silver nutrate with tween twenty 100 ml , clotrimazole cream ip 2% w / w , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , silver sulphadiazine cream ip 1% 50gm tube , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , betamethasone dipropionate cream ip 0.05% , silver sulphadiazine cream ip 1% 500 gm jar , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , estradiol cream , estrogen cream , sumag cream , neomycin sulphate cream , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , lignocaine gel ip 2% , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o [ 219 ] , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , coal tar 6% & salicylic acid 3% ointment , acyclovir eye ointment ip 3% w / w 5gm size , chloramphenicol 1% w / w eye ointment ip, 3gm size , thrombophobe ointment , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , clindamycin phosphate gel usp 1 o / o , metronidazole 1% and chlorhexidine gluconade 0.25% gel , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , domperidone oral drops 10mg / ml ( 10ml ) , carboxymethylcellulos e eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , xylometazoline nasal drops ip 0.1% , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , ciprofloxacin eye drops ip 0.3 o / o w / v , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , lactulose solution , digoxin 0.25% , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , acetylcystine solution usp ( injection ) 200 mg / ml , colistimethate injection ip 1m iu powder for solution , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , caffiene citrate oral solution , human albumin solution ip 20% , povidone iodine solution ip 5 % 500 ml , formaldehyde solution ( 34.5 per. – 38 per. ) , gentian violet topical solution usp 1o / o , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 % ( 20vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) [ 249 ] , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , dicyclomine hydrochloride oral solution ip 10mg / 5ml , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol nebuliser solution bp 5 mg / ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , chlorhexidine gluconate solution 5% 250 ml , povidone iodine solution ip 5% 100ml bottle , potassium chloride oral solution u.s.p 500mg / 5ml , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , povidone iodine solution ip 10 % , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , vitamin d3 oral solution 60000 iu , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10litre cans , feracrylum 1% w / v sterile solution 100 ml , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , balancesalt solution with ph.of 7.2 to 7.4 osmolarity 292 to294 in 100 % biodegradable bag with polyofin , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate , multi vitamin syrup , b. complex , calcium phosphate 200 ml , dextromethorphan hcl + chlorpheniramine , each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin3.75 ml 170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen100 mg 60 ml , linezolid 100mg / 5ml in 30ml , sodium picosulphate oral suspension , sorbitol + tricholine citrate , paracetamol drops paediatric paracetmol oral suspension ip ( each ml contains paracetamol 150mg ) , albendazole oral suspension ip 400mg / 10ml , domperidone suspension ip 5mg / 5ml , budesonide nebulizer suspension 0.25mg / ml , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , ampicillin cap ip 500mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , pregabalin cap ip 75 mg , surgical cap disposable ( for surgeons ) , tramadol cap ip 50 mg , tramadol cap ip 50 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , doxycycline cap ip 100 mg , itraconazole cap 100 mg , danazol cap ip 50 mg , deferiprone cap 250mg , deferiprone cap 500mg , nifedipine cap ip 5mg , omeprazole cap ip 20 mg , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , nifedipine sublingual , povidone iodine , infant milk formula term 400 gm , infant milk pre trem baby ( lbw ) 400 gm , hmf for pretem , l arginine+proanthocynadine granules 3mg / 5 mg , l arginine 3 gm + proantho cyaniding 75 mg , tab dehydro epiondrosterone sr 75 mg , tab anastrozole 1 mg , tab letrozole 2.5 mg , inj. certrorelix acetate 0.25 mg , inj. menotropin 150 iu / 0.5 ml , inj. menotropin 225 iu / 0.75 ml , highly purified hmg 75 / 150 iu , highly purified follicle stimulating hormone 75 / 150 iu , highly purified hcg 2000 / 5000 / 7500 / 10000 iu , natural microhized progesterone soft caps 100 / 200 mg , natural microhized progesterone soft caps 200 / 400 mg , inj enoxaparin 40 mg , estradiol & dydrogesterone tab. 1 / 5 mg , combipack of estradiol and estradiol & dydrogesterone tab. 1 / 10 mg , combipack of estradiol and estradiol & dydrogesterone tab. 2 mg 2 / 10 mg , ubidecarenone capsules usp q100 / q300 ( co enzyme q10 ) , inj leuprolide acetate 3.75 mg , inj leuprolide acetate 1 mg / 0.5 ml , inj leuprolide acetate 4 mg / 4 ml , inj. buserlin acetate 0.5 mg / 0.5 ml , inj. buserlin acetate 7 mg / 7 ml , tab. diclofenac gastro resistant ip 50 mg , tab. ibuprofen and paracetamol ip ibuprofen 400 mg+ paracetamol 325 mg , tab. ibuprofen ip 400 mg , tab. paracetamol ip 500mg , tab. paracetamol ip 650mg , cap. tramadol ip50mg , tab. chlorpheniramine maleate ip 4mg , tab. prednisolone ip 5mg , tab. acyclovir 200mg , tab. albendazole ip 400mg , tab. amoxycillin and potassium clavulamate ip 500mg+125mg , cap. amoxycillin ip500mg , tab. azithromycin ip 500mg , tab. cefixime ip 200mg , tab. chloroquine phosphate ip 250mg eq tov155mg of chloroquine base film coated , tab. ciproflixacin ip 500mg , capometrazole ip 20mg , tab. clotrimazole vaginal ip 500mg , cap. doxycycline ip 100mg , tab. fluconazone ip150mg , cap. itraconazole ip 100mg , tab. metronidazole ip 200mg , tab. metronidazole ip 400mg , tab. norfloxacin ip 400mg , cap nifedipine ip 5mg , tab. nitedipine ip 10mg , dinoprostone cream / gel 0.5mg dinoprostone in syringe , tab. trenexamic acid , tab. clindamycin 150mg , tab. clindamycin 300mg , inj. bupivacaine hydochloride in dextrose usp each ml contains bupivacaine hydrochloride 5.0mg dextrose 80.0mg , inj. phenytoin 50mg , inj. cisplatin 50mg , inj. vancomycin 500mg , inj. vancomycin 1 gm , inj, normal human intravenous immunoglobuline , inj. surfactant 3ml , inj. feracrylum 1% w / v solution , dinoprostone gel , tab. ramipril tablets ip 5mg , cap. evening primosa 1000mg...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Indian Army - Rajasthan

33653335 procurement of drugs and pharmaceuticals products drugs and consumables , inj insulin lispro 25 / 75 100 iu / ml , glucostix accucheck, pack of 100 strips , inj insulin lispro 50 / 50 , tab sitagliptin 50 mg , tab actifed , eye drop latenoprost + prednisolone ( lotepred ) , tab tricagelor 90 mg , inj erythropoietien 4000 iu , inh formetrol + budesunide 400 mcg , disp lumber belt ( small , medium , large ) , inhaler duolin ( levosalbutamol & ipratropium ) 250 mcg , inj recombinant human growth hormone 5 mg to 15 mg , tab metformin sr 1 gm , resp budecort , tab vit b1, b6 & b12 ( neurobion ) ...

All India Institute Of Medical Sciences - Rajasthan

33443744 procurement / rate contract for drugs / medicines / i.v. fluids at all india institute of medical sciences, jodhpur procurement / rate contract for drugs / medicines / i.v. fluids at all india institute of medical sciences, jodhpur , amphotericin b lipid complex , amphotericin b lipid emulsion* , amphotericin b liposomal , amphotericin b plain , anidulafungin 100 mg , atracurium , atracurium , atropine , bupivacaine hclheavy 0.5% , bupivacaine hcl 0.25% , bupivacaine hcl 0.5% , bupivacaine hcl 0.5% + dextrose , bupivacaine hydrochloride 7.5% glucose solution , butorphanol tartarate , butorphanol tartarate , caspofunginvial , caspofunginvial , centhaquine citrate , chlorprocaine 5ml , cisatracurium besylate , cisatracurium besylate , citicholine , colistimethate sodium , colistimethate sodium , colistimethate sodium , colistimethate sodium , desflurane , dexmedetomidine 100 mcg , dexmedetomidine 200 mcg , dexmedetomidine 50 mcg , emla cream ( a eutectic mixture of lidocaine 2.5% and prilocaine 2.5% ) , ephedrine hydrochloride 1 ml , etomidate , etomidate lct / mct , etomidate lct / mct , eutectic lidocaine + prilocaine cream for topical anaesthesia , fosfomycine 4 gm , fosfomycine trometamol , gel choline salicylate & lignocaine hydrochloride 12 g , glyceryl trinitrate transdermal patch , glyceryl trinitrate transdermal patch , glycopyrolate 0.5mg + neostigmine methylsulphate 2.5mg , glycopyrrolate , glycopyrrolate , glycopyrrolate , halothane , human prothrombin complex i.p / e.p. , imipenam + cilastatin 500 mg and 500 mg vial , isavuconazole , isavuconazole 200 mg / 10 ml , isoflurane , isoflurane 100 ml , isoflurane 250 ml , ketamin hydrochloride , ketamin hydrochloride , levobupivacaine5 mg / ml , levobupivacaine 10 ml ampules ( 5 mg / ml ) , levobupivacaine 25% 20 ml , levobupivacaine 5% 20 ml , levobupivacaine .5% + dextrose , lidocaine 200 mg lozenges 1. a solid , single dose preparation designed to be sucked to obtain a local effect in the oral cavity and throat.2. dissolves over 5 10 min in the mouth and releases the drugs in the saliva , lidocaine hydrochloride 5% and dextrose 7.5% , lignocaine2% , lignocaine2% , lignocaine & adrenaline 2% ( 1:200, 000 ) , lignocaine hydrochloride 10% oral spray , lignocaine hydrochloride 4% , lignocaine hydrochloride+ adrenaline bitartrate 2% ( 1:80000 ) , lignocaine hydrochloride1% , lignocaine vicous solution 4% , lignocaine without preservative 2% , magnesium sulfate, urea, and sulphacetamide sodium , sodium proflavin ( glycerine base ) , mephentermine 15mg / ml , mephentermine 30mg / ml , midazolam , midazolam , midazolam , midazolam ( 5mg / ml ) , midazolam ( 5mg / ml ) , molnupiravir , nalbuphine hydrochloride , nalbuphine hydrochloride , neostigmine , neostigmine , phenylephrine 10mg , phosphenytoin 150 mg , physostigmine 1mg / ml , polymyxine –b sulphate , posaconazol , posaconazol , prazosin 1 mg , propofol 1%us fda approved , propofol 1%us fda approved , propofol 1% us fda approved , propofol mct / lct us fda approved , propofol mct / lct us fda approved , propofol mct / lct with olic acid us fda approved , propofol mct / lct with olic acid us fda approved , remdesivir , ribavirin , ribavirin 100 mg / ml , rocuronium , ropivacaine 0.2% vial , ropivacaine 0.2% vial , ropivacaine 0.2% vial , ropivacaine 0.5% vial , ropivacaine 0.5% vial , ropivacaine 0.75% ampules , ropivacaine 0.75% vial , ropivacaine 0.75% vial , ropivacaine 0.75% + dextrose sterile packing , sevoflurane , sterile water , sterile water , succinylcholine , thiopentone sodium , thiopentone sodium , tocilizumab 400 mg , tocilizumab 80 mg , topical lidocaine aerosol 10% , ulinastatin 100000 iu , ulinastatin 200000 iu , vecuronium , vecuronium , antibiotic & antiseptics , acyclovir , acyclovir , acyclovir 5% , albendazole , albendazole , amikacin , amikacin , amikacin , amoxycillin , amoxycillin , amoxycillin , amoxycillin+ clavulanic acid , amoxycillin+ clavulanic acid , amoxycillin + clavulanic acid , amoxycillin kid tablets , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin+ clavulanic acid , amoxycillin + clavulanic acid , amoxycillin+cloxacillin , ampicillin , ampicillin , ampicillin , ampicillin , ampicillin + cloxacillin , ampicillin + cloxacillin , ampicillin + cloxacillin+lb , ampicillin 500 mg , ampicillin+ sulbactam , arbekacin sulphate 200 mg , artemether , artemether+lumefantrine , artemether+lumefantrine , artesunate , artesunate , artesunate+sulfazdoxine+pyrimethamine , artesunate+sulfazdoxine+pyrimethamine , artesunate+sulfazdoxine+pyrimethamine , azathioprine , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , aztreonam , aztreonam , aztreonam , benzylpenicillin , benzylpenicillin , benzylpenicillin , benzylpenicillin , benzylpenicillin , cefaclor , cefadroxil , cefadroxil , cefepime , cefepime , cefazolin sodium , cefepime + tazobactam , cefixime , cefixime , cefixime , cefixime15 gm , cefoperazone , cefoperazone , cefoperazone+ sulbactam , cefoperazone sulbactam , cefotaxime + sulbactam , cefotaxime , cefotaxime , cefotaxime , cefotaxime , cefotaxime + sulbactam , cefpodoxime proxetil , cefpodoxime , cefpodoxime proxetil , cefpodoxime proxetil , cefpodoxime , ceftaroline fosamil , ceftazidime , ceftalazone tazobactam , ceftazidime + avibactum , ceftazidime + tazobactum , ceftriaxone + sulbactum + disodium ethylenediaminetetraacetic acid ( edta ) , ceftriaxone + sulbactum + disodium ethylenediaminetetraacetic acid ( edta ) , ceftriaxone sodium , ceftriaxone sodium , ceftriaxone + tazobactam , ceftriaxone + salbactum , ceftriaxone sodium , ceftriaxone sodium , ceftriaxone sodium , cefuroxime , ceftaroline fosamil , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefpirome sulphate , cephalexin , cephalexin , cephalexin , cephalexin , cephalexin , chloroquine , chloroquine phosphate , chloroquine phosphate , ciproflaxacin 500mg + ornidazole 500mg , ciprofloxacin , ciprofloxacin , ciprofloxacin 200 mg , clarithromycin , clarithromycin , clarithromycin , clindamycin , clindamycin , clindamycin , clindamycin , clindamycin 1% gel , clotrimazole , clotrimazole , cloxacillin sodium , clofazamine 100mg , cotrimoxazole ( sulphamethoxazole200mg + trimethoprim 40mg ) per vial , cotrimoxazole ( sulphamethoxazole 80 mg + trimethoprim 16 mg ) per vial , cotrimoxazole ( sulphamethoxazole + trimethoprim ) , co trimoxazole ( trimethoprim +sulphamethoxazole ) , crizotinib , crizotinib , cycloserine , cyclosporine , cyclosporine , cyclosporine , daclatasvir , daclatasvir , disodium edatate pfs , daptomycin , dapsone 100mg , doripenem , doxycycline , doxycycline + lactic acid , doxycycline injection , ertapenem , erythromycin , erythromycin , ethambutol , ethambutol , ethambutol , ethambutol , ethionamide , faropenem , fluconazole , fluconazole , fluconazole , flucloxacillin , flucloxacillin , gentamicin , flucytosine , fidaxomicin , garenoxacin , hydroxychloroquine , imipenam + cilastatin , imipenam + cilastatin , isoniazid , isoniazid , isoniazid , isoniazid +rifampicin , isoniazid +rifampicin , itraconazole , itraconazole , ketoconazole , kanamycin , ledipasvir + sofosbuvir , levofloxacin , levofloxacin hemihydrate , levofloxacin hemihydrate , linezolid , linezolid , linezolid , meropenem , meropenem , meropenem+ sulbactum , micafungin , micafungin , minocycline , moxifloxacin hcl 400mg , moxifloxacin hcl , nitazoxanide , naloxone , naloxone , netilmicin , netilmicin , norfloxacin , ofloxacin , ofloxacin , ofloxacin , ofloxacin , ofloxacin 200mg , oseltamivir , oseltamivir , phosphomycine 4 mg / iv , piperacillin 1gm +tazobactum 125mg , piperacillin 2gm.+tazobactam 250mg , piperacillin 4gm.+tazobactam 500mg. , inj penicillin g 5 million units , pantoprazole , primaquine , primaquine , primaquine , praziquantel , pyrazinamide , pyrazinamide , pyrazinamide , pyrimethamine , quinine , quinine sulphate , quinine sulphate , rifampicin , rifampicin , rifabutin , roxithromycin , roxithromycin , roxithromycin , roxithromycin , saccharomyces boulardii , saccharomyces boulardii , sodium bicarbonate , sodium bicarbonate 8.4% , sodium bicarbonate 8.4% , sodium bicarbonate 7.5% , sodium bicarbonate 7.5% , sofosbuvir , streptomycin , streptomycin , sulbactum , tenofovir alafenamide , teicoplanin , teicoplanin , thiamine hydrochloride 50 mg , tigecycline , ticarcillin 3gm and clavulanic acid 100mg , tobramycin , tobramycin , tobramycin , tofacinib , topotecan , triamcinolone acetonide , triamcinolone acetonide 0.1%w / w , valgancyclovir , vancomycin hydrochloride , vancomycin hydrochloride , vancomycin hydrochloride , vancomycin hydrochloride , voriconazole , voriconazole , voriconazole , voriconazole , antidotes , activated charcoal , dimercapsulesrol , fulmazenil 1mg / ml , methylthioninium chloride ( methylene blue ) , naloxone , naloxone , pencillamine , pralidoxime chloride ( 2 pam ) , sodium nitrite , sodium thiosulphate , antiseptics and disinfactants , ( 100 gm of granules contain the following active ingredient ) 43 g sodium per carbonete, 22 g tetraacetylethylenediamine.passesen 13624, en 13727, en 14348, en 14561, en 14562en 14563 , en 13704and en 14476 standreds. , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moisturerisers. , 1, 6 dihydroxy 2, 5 dioxyhexane glutaraldehyde benzalkonium chloride alkyl urea derivative , 2 propanol 63gbenzalkonium chloride 0.025g , alcohal free liquid barrier film containing acrylate terpolymer to protect form iad for72 hours , antimicrobial skin gel with ethyl alcohol >60% , back care solution wirh dispenser 7 cap ( aqua , alcohal denat, sodium laureth sulfate, peg 7 glyceryl cocoate , dimethyl urea , disodium pecocamido mipa sulfosuccinate , dibutyl adipate , disodium cocoamphodiacetate , fgragrance , potassium hydroxide ) , benzyl c12 18 alkyl dimethyl ammonium chlorides 19.9g dodecylbispropyle tramine 5g surfactants, corrosion inhibitors , cetrimide 15%+chlorhexidine 7.5% , cetrimide 15%+chlorhexidine 7.5% , chlorhexidinegluconate 2% w / v ( 10%v / v ) with 80% ethanol coloured , sterile with single use applicater for external surgical skin prepartion , chlorhexidine & ethanol based surgical hand antiseptic with moisturizers containing ( chlorhexidine gluconate 1% w / w and ethyl alcohol 61% w / w ) water less scrub fda approval , chlorhexidine & ethanol based surgical hand antiseptic with moisturizers containing ( chlorhexidine gluconate 1% w / w and ethyl alcohol 61% w / w ) water less scrub fda approval , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moistureriser foam based solution , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moisturerisers. , chlorhexidine 2%, menthol, perfume expients, recommended by cdc, usa , chlorhexidine 2%, alcohol free bed bath wipes , chlorhexidine 4% sol. with surfactants, emollients & moisturerisers. , chlorhexidine 4% sol. with surfactants, emollients & moisturerisers. , chlorhexidine 2%, menthol, perfume expients, recommended by cdc, usa , chlorhexidine gluconate 2% ethanol i.p 70 w / v , chlorhexidine gluconate 2% w / v ( 10% v / v ) & isoprophyl alcohol 70% w / v surgical skin prepartion solution with dispenser , chlorohexidine body wash , combination of sodiumlaureth sulphate +nacl+ peg 7 +peg 120 + glycerine , combination of undecylenamidopropyl trimonium methosulphate + phenoxyethanol + skin care addictives , didecyldimethyl ammonium chloride 7g corrosion inhibitors fragrance, excipients q.s , didecyldimethyl ammonium chloride 7g corrosion inhibitors fragrance, excipients q.s , diethyl ether ( solvent ether ) for synthesis , dimethanol ( ethylenedioxy ) 14.1g glutaraldehyde 5.0g specialized, hi tech, inbuilt cleansors , dodecyl bis propylene triamine didecyl dimethyl ammonium chloride 13.0g surfactants, corrosion inhbitors, foam regulators, ph regulators, fragrance , ehtanol 30% with 1% triclosan solution , enzymatic detergent solution with neutral ph , enzymatic detergent solution with neutral ph , ethanol 10gm 2 propanol 9gm 1 propanol 6gm wit corrosion inhibitors , ethyl alcohol 60% w / v based hand sanitizer with moisturiser. , glutaraldehyde :15.2g 1, 6 dihydroxy 2, 5 dioxahexane:19.7g rust inhibitors and hi tech cleansors. , at 4% solution : ph value approx. 7 , glutaraldehyde 2% , gluteraldehyde ( acidic medium 2% ) , gluteraldehyde ( alkaline medium ) 2.45% with powder rust inhibitors , glycerin for oral use , hand gel ethanol 85g, and skin protectors w / w , hydrogen peroxide 11% and 0.01% sliver nitrate with micro jet. , isopropyl alcohol ( 1, 2, propanol ) 75% + macetronium + skin emollients & moisturizers , liquid cleaner for surgical instruments including endoscopes , orthopthalaldehyde 0.55% , povidone iodine 5% , povidone iodine 5% w / w ointement 25g , pre soaked surface and equipment disinfected wipes 20×25 cm with propanol 1.propanol 2, didecyle dimethyl ethyl ammonium chloride , n alkyl dimethylbenzyle ammoniumchloride & poly hexamethylene bigunide hydrochloride with nabl, ce&iso certified , silver sulfadiazine 1%, chlorhexidine gluconate 0.2% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium laureth sulphate peg 7, glycerine, peg 120 sodium benzoate sodium salicylate perfume , tincture of benzoine , tincture of iodine , ultramultiple enzymatic concentrate solution , waterless body bath solution antiseptic waterless body bath hygiene solution with deionized water , betaine , dehydroacetic acid , sodiumbenzoate propyleneglycol, citric acid , sodium hydroxide with chlorhedine & alcohol free , waterless hair shampoo , antiseptic waterless head hygiene solution with deionized water , disodium edta , benzylalcohol benzonic acid , sorbic acid propylene glycol with sodium hydroxide , wettask with surface wiping system ( pre saturated ) , cardio vascular system , abciximab , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , adenosine 6 mg / 2 ml , adreneline 1 mg / ml , amiodarone , amiodarone , amiodarone , amlodipine , amlodipine , amlodipine , amlodipine + atenolol , amlodipine + lisiniopril , amrinone lactae , apixaban , apixaban , aspirin ( asa ) , aspirin ( asa ) , atenolol , atenolol , atenolol + ramipril , atenolol + ramipril , atenolol 25 mg , atorvastatin , atorvastatin , atorvastatin , atorvastatin , atorvastatin + clopidogrel + aspirin asa , atorvastatin + clopidogrel + aspirin asa , bisoprolol usp , bisoprolol usp , cardioplegia solution , carvedilol , carvedilol , carvedilol , cilostazol , cilostazol , cinnarizine + dimenhydrinate + pyridoxine , clonidine hydrochloride , clonidine hydrochloride , clopidogrel , clopidogrel + aspirin asa , clopidogrel + aspirin asa , dabigatran etexilate mesylate , dabigatran etexilate mesylate , dalteparin p f syringe , dalteparin p f syringe, , dalteparin p f syringe, , dalteparin p f syringe, , digoxin , digoxin , digoxin , diltiazem , diltiazem , diltiazem , diltiazem , diltiazem hydrochloride , diltiazem 2% w / w , dobutamine 250 mg / 5 ml , dopamine 40mg / ml , doxazosin , doxazosin , enoxaparinpf syringe , enoxaparinpf syringe , enoxaparinpf syringe , eptifibatide 2mg / ml , eptifibatide 0.75mg / ml , esmolol hydrochloride , ethamsylate , ethamsylate , ethamsylate , ethamsylate , fenofibrate , fenofibrate , fondaparinux sod. pfs , fondaparinux sod. pfs , furosemide , furosemide , furosemide , furosemide , furosemide , furosemide spironolactone , glyceryl trinitrate , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate transdermal patch , haemcoagulase , heparin 1000 iu / ml , heparin 1000 iu / ml , heparin 5000 iu / ml , heparin sodium and benzyl nicotinate , hydrochlorothiazide , hydrochlorothiazide , hydrochlorothiazide , hydrochlorothiazide +losartan , hydrochlorothiazide +losartan , hydrochlorothiazide +nebivolol hydrochloride , hydrochlorothiazide + metoprolol , hydrochlorothiazide + metoprolol , hydrochlorothiazide + metoprolol , isoprenaline sulphate 2mg / ml , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide dinitrate , isosorbide dinitrate , ivabridine , labetalol , labetalol , labetalol , labetalol , levo carnitine , levo carnitine , levodopa+carbidopa , levodopa+carbidopa , levodopa+carbidopa , lignocaine hydrochloride ( cardiac use / xylocard ) , lisinopril , lisinopril , lisinopril , lisinopril , losartan potassium , losartan potassium , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , milrinone , milrinone , milrinone , medium chain triglycerides , nebivolol , nebivolol , nicorandil , nicorandil , nicorandil 2 mg , nicoumalone , nicoumalone , nicoumalone , nicoumalone , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nitroglycerin ampoules , noradrenaline , noradrenaline , olmesartan , olmesartan , olmesartan , olmesartan , papaverine hcl , perindopril + amlodipine , pheniramine maleate 22.75 mg / ml , phenylephrin , prasugrel , prasugrel , prazosin hydrochloride , prazosin hydrochloride , prochlorperazin maleate 5 mg , propranolol , propranolol , propranolol , propranolol + flunnarizine , protamine suplhate 1% , ramipril , ramipril , ramipril , ramipril , ramipril +hydrochlorothiazide , ramipril +hydrochlorothiazide , ramipril + hydrochlorothiazide , reteplase , rivaroxaban , rivaroxaban , rosuvastatin , rosuvastatin , rosuvastatin , rosuvastatin calcium , rosuvastatin calcium , rosuvastatin calcium , rosuvastatin calcium + clopidogrel + aspirin asa , sacubitri + valsartan , sevalemer carbonate , sevelamer hydrochloride , sevelamer hydrochloride , sodium nitroprusside , spironolactone , spironolactone , spironolactone , spironolactone+frusemide , spironolactone+frusemide , streptokinase , streptokinase , tamsulosin , tamsulosin hydrochlorde & dutasteride 0.9 mg , telmisartan , telmisartan , telmisartan , telmisartan + hydrochlorothiazide , tenectaplase , tenecteplase , tenecteplase , tenecteplase , terazosin , terazosin , terazosin , ticagrelor , torsemide , torsemide , torsemide , torsemide , torsemide , torsemide + spironolactone , torsemide + spironolactone , tranexamic acid , tranexamic acid , tranexamic acid , tranexamic acid , trimetazidine , trimetazidine mr , urokinase , urokinase , urokinase , urokinase , verapamil , verapamil , verapamil , verapamil , vesopresin , vitamin k , vitamin k , vitamin k1 , warfarin , warfarin , warfarin , warfarin , central nervous system , alprazolam , alprazolam , alprazolam , alteplase ( tissue plasminogen activator ) , alteplase ( tissue plasminogen activator ) , amitriptyline , amitriptyline , amitriptyline , amitriptyline + chlordiazepoxide , aripiprazole , aripiprazole , betahistine , betahistine , botulinum toxid , botulinum toxid type a , botulinum toxid type a , bupenorphine +naloxone , carbamazepine , carbamazepine , carbamazepine , carbamazepine , carbamazepine sr , carbamazepine sr , chlorpromazine hydrochloride , chlorpromazine hydrochloride , cilnidipine , cilnidipine , clobazam , clobazam , clobazam , clomipramine , clomipramine , clonazepam , clonazepam , clonazepam md , clonazepam md , clonazepam md , clozapine , clozapine , colchicine , colchicine , conivaptan , deferasirox , deferasirox , deferasirox , deferiprone , deferiprone , deferiprone , desvenlafaxine , desvenlafaxine , diazepam , diazepam , diazepam , diazepam , diazepam , diethylcarbamazine citrate , diethylcarbamazine citrate , disulfiram , disulfiram , divalproex equivalent to valproic acid 250 mg , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , donepezil , duloxetine hydrochloride , duloxetine hydrochloride , duloxetine hydrochloride , enalapril maleate , eperisone hydrochloride , eperisone hydrochloride , escitalopram , escitalopram , escitalopram , flumazenil , flunarizine , flunarizine , fluoxetine , fluoxetine , fluphenazile decanoate , flupiritine , fosphenytoin , gabapentine , gabapentine , gabapentine + mecobalamine , gabapentine + nortriptyline , glycerol , haloperidol , haloperidol , haloperidol , haloperidol , hydroxyzine , hydroxyzine , hydroxyzine , imipramine , imipramine , lacosamide , lacosamide , lacosamide , lacosamide , lacosamide , lacosamide , lamotrigin , lamotrigin , lamotrigin , lamotrigin , levetiracetam , levetiracetam , levetiracetam , levetiracetam , levetiracetam 100mg / ml , levetiracetam , lithium carbonate , lithium carbonate , lithium carbonate sr , lorazepam , lorazepam , lorazepam , lorazepam , mecobalamin, pyrodoxine hcl, nicotinamide , methylfolate methylcobalamin & pyridoxal 5 phosphate , methylcobalamin +vitamin b6+folic acid , melatonin , mefloquine , methyldopa , methyldopa , methyldopa , modafinil , naltrexone , naproxen , naproxen , naproxen , naproxen + domperidone , nicotine chewing gum , nicotine chewing gum , nimodipine , nimodipine , nitrazepam , nitrazepam , nortriptyline , nortriptyline , olanzapine , olanzapine , olanzapine , olanzapine , olanzapine , oxcarbamazepine , oxcarbamazepine , oxcarbamazepine , oxcarbamazepine 300 mg , oxcarbamazepine 300 mg / 5 ml , paracetamol , paracetamol , paracetamol10mg / ml ( plastic bot ) , paracetamol + tramadol , paracetamol 10mg / ml ( glass bot ) , phenobarbitone , phenobarbitone , phenobarbitone , phenobarbitone , phenytoin sodium , phenytoin sodium , phenytoin sodium , phenytoin sodium , piperazine , piperazine , piracetam , piracetam , pregabaline , pregabaline , pregabaline , pregabaline + amitriptyline , pregabaline + nortriptyline , pregabaline+methylcobalamine , pregabaline+methylcobalamine , pyridostigmine , quetiapine fumarate , quetiapine fumarate , risperidone , risperidone , risperidone , risperidone , sertraline hcl , sertraline hcl , sertraline hcl , sodium valproate , sodium valproate , sodium valproate , sodium valproate , sodium valproate , sodium valproate + valproic acid , sodium valproate + valproic acid , sodium valproate + valproic acid , sumatriptan + naproxen , tadalafil , tolvaptan , topiramate , topiramate , topiramate , trihexyphenidyl ( benzhexol ) , zolpidem , zolpidem , zolpidem sr , zolpidem sr , ent , absorbable hemostatic powde oxidized regenerated cellulose , budesonide 32mcg , chlorhexidine gluconate 2% mouth wash , chlorhexidine gluconate 2% mouth wash , chlorhexidine mouth wash , clotrimazole , clotrimazole1% , feracrylum ( hemolok ) 1% w / v , fibrin glue , fibrin glue , fibrin glue , floseal , fluticasone 0.05% , fluticasone furoate 50mcg , hemostatic matrix kit , hemostatic matrix kit , hyaluronidase , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors 11a, , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factorsviia, , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors ixa , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors xa , medicated toothpaste containing potassium nitrate 50mg. , mometasone nasal spray , neomycin+bacitracin+hydrocortisone , neomycin+bacitracin+hydrocortisone , neomycin+bacitracin+polymyxin b , neomycin+polymyxin b sulfates+bacitracin zinc , neomycin+polymyxin b sulfates+bacitracin zinc , normal saline drop , paradichlorobenzene 2%+ benzocaine 2.7% + chlorbutol 5% + turpentine oil 15% + butylated hydroxyanisole 0.05% w / v , povidone iodine mouthwash / gargle 1% , sodium chloride 0.65% , wax softener , xylometazoline 0.05% , xylometazoline 1% , enzyme replacement therapy , imiglucerase , aldurazyme , fertility & infertility , betamethasone , cabergoline , cabergoline , cetrorelix acetate ( gnrh antagonist ) , clomiphene citrate , clomiphene citrate , conjugated equine estrogen , conjugated equine estrogen , dinoprostone , dinoprostone vaginal pessary , drotaverine hydrochloride , duvadilan isoxsuprine hydrochloride , estradiol valerate , ethinyl estradiol+desogestral , ethinylestradi+llevo norgestrol , human chorionic gonadotropin ( hcg ) ( uriniary ) highly purified 10000 iu , letrozole , letrozole , magnesium sulphate 50% w / v , medroxyprogesterone ( depot ) 150mg / ml ) ( 1ml / vial ) , methergin , methergin , micronised progesterone , micronised progesterone , micronised progesterone , micronised progesterone vaginal , micronized progesterone , mifepristone , misoprostol , misoprostol , misoprostol , norethisterone , norditropin nordiflex pre fiiled pen , povidone iodine vaginal pessary , recombinant fsh ( follitropin a b ) multidose vials , recombinant fsh ( follitropin a b ) multidose vials , ritodrine hydrochloride , ritodrine hydrochloride , ritodrine hydrochloride , triptorelin acetate pfs , urinary gonadotropin ( menotrophin ) , valethamate bromide , gastroenterology , acetyl cysteine , acetazolamide , antacid [ magnesiumtrisilicate+ alluminium hydroxide ] , bisacodyl , bisacodyl , calcium polystyrenesulfonate , carboprost tromethamine , cinacalcet , darifenacin , desidustat , desidustat , dicyclomine , dicyclomine , dicyclomine , dicyclomine , dicyclomine , dicyclomine , aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethicone , aluminium hydroxide gel ip 6g magnesium hydroxide ip 80mg activated dimethicone ip 100mg / deglycyrrhizinated liquorice 400 mg , diloxanide furoate , domperidone , domperidone , domperidone , domperidone + omeprazole , drotaverine hcl , esomeprazole , esomeprazole , esomeprazole , finasteride , flavoxate , fluoresein 20% ampules , genito urinary system , hydrocortisone rectal , hyoscine butyl bromide , hyoscine butyl bromide , indocyanine green , isoxsuprine , isoxsuprine , ispaghula husk , itopride , itopride , l ornithine l aspartate , l ornithine l aspartate , lactulose 3.3335g , levosulpiride , levosulpiride , levosulpiride , liquid paraffin +milk of magnesia with or without phenolphthalein , mesalazine , mesalazine , methyl ergometrine , methyl ergometrine , methylene blue , metoclopramide , metoclopramide , metoclopramide , metoclopramide , metoclopramide , metronidazole , metronidazole , metronidazole , midodrine , mosapride , n acetylcysteine , n acetylcysteine , n butyl cyanoacrylate glue , nitrofurantoin , nitrofurantoin , nitrofurantoin , norfloxacin 100mg + metronidazole 100mg per 5ml , omeprazole , omeprazole , omeprazole , ondansetron , ondansetron , ondansetron , ondansetron 2 mg / ml , ondansetron 2 mg / ml , ornidazole , ornidazole + ofloxacin , ornidazole 125mg + ofloxacin 50mg , ornidazole 500mg + ofloxacin 200mg , oxethazaine + antacid gel , pantoprazole , pantoprazole , pantoprazole + domperidone , pantoprazole + levosulpride , peginterferon alfa 2b , pirfenidone 200 mg , polidocanol 3% 60 mg , polyethylene glycol , polyethylene glycol +electrolyte powder , posaconazole 100 mg , posaconazole 100 mg , povidone iodine pessary 200 mg , pro biotec , proctoclysis enema , proctoclysis enema , promethazine , promethazine , promethazine , promethazine , rabeprazole + domperidone , rabeprazole + domperidone , rabeprazole sodium , rabeprazole sodium , ranitidine , ranitidine , ranitidine , rifaximin , rifaximin , secnidazole , secnidazole , sodium nitroprusside , somatostatin , somatostatin , sucralfate , sucralfate , sucralfate , sulfasalazine , tenecteplase , tenecteplase , terlipressin , tinidazole , tinidazole , tinidazole + norfloxacin , tinidazole i.p. , tinidazole i.p. , triptorelin pamoate equivalent to triptoreline 3.75 mg , triptorelin pamoate equivalent to triptoreline 3.75 mg , ursodeoxycholic acid , ursodeoxycholic acid , ursodeoxycholic acid , ursodeoxycholic acid , vedolizumab , hormones , acarbose , acarbose & metformine hcl , acarbose & metformine hcl , acotiamide , adrenocorticotropic hormone ( acth ) 60iu / ml , bromocriptine , bromocriptine , buserelin acetate ( multidose vial 1mg / ml concn ) , calcitriol , canagliflozin , carbimazole , carbimazole , carbozatinib , danazol , danazol , dapagliflozin , dehydroepiandrosterone , dehydrotestosterone , denosumab 120 mg pfs , denosumab pfs , desmopressin , desmopressin , desmopressin nasal spray , desmopressin oral lyophilisate , desmopressin oral lyophilisate , dexamethasone , dexamethasone , diazoxide , empagliflozin , glargine , gliclazide , gliclazide , gliclazide modifiedrelease , gliclazide modified release , glimeperide , glimeperide , glimeperide , glimeperide , glimeperide + metformin , glipizide , glipizide , glucagon , goserelin , highly purified chorionic gonadotrophin , human growth hormone ( prefilled pen ) , insulin long acting glargine , human insulin rapid acting analogue , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , hydrocortisone , hydroxyprogesterone , hydroxyprogesterone , lenvatinib , leuprolide , leuprolide , leuprolide , leuprolide acetate , leuprolide acetate , levocarnitine , levocarnitine , levothyroxine , levothyroxine , linagliptin , liraglutide , medroxyprogesterone acetate , medroxyprogesterone acetate , metformin , metformin , metformin , metformin + gliclazide , metformin sr , metformin sr , mitotane , oxytocin , pasereotide pamoate lar , pioglitazone , pioglitazone , pioglitazone , propylthiouracil , propylthiouracil , pruclopride , saxagliptin , sitagliptin , sitagliptin , somatostatin , somatostatin , somatropin recombinant , somatropin recombinant , sorafenib , teneligliptin , teriperitide prefilled pen , testosterone propionate / enanthate , testosterone propionate / enanthate , testosterone propionate / enanthate , testosterone thiomersal 0.01% , testosterone undecanoate , testosterone undecanoate , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , triptorelin ( 0.1 mg ) , vandetinib , vasopressin 20 iu / ml , vasopressin 40 iu / ml , vildagliptin , vildagliptine+metformin , vildagliptine+metformin , vildagliptine+metformin , voglibose , i.v. fluids ( crystalloids ) , 0.9% normal saline 100 ml dehp free double sterilized closed chamber bag. , 0.9% normal saline 500 ml dehp free double sterilized closed chamber bag. , 5% dextrose 1000 ml dehp free double sterilized closed chamber bag. , 5% dextrose 500 ml dehp free double sterilized closed chamber bag. , blanced salt solution 1000 ml lactate and calcium free ph 7.2 7.4 in closed bag systemosmolarity 292 294 non pvc dehp free self collapsible bio degradable bags , blanced salt solution 500 with calcium pvc dehp free self collapsible bottle , custodial ( htk solution ) , custodial ( htk solution ) , dextrose 10% ( plastic ) , dextrose 10% ( plastic ) , dextrose 25% ( plastic ) , dextrose 5% glass , dextrose 5% non pvc dehp free self collapsible bags , dextrose 5% non pvc dehp free self collapsible bags , dextrose 5% non pvc dehp free self collapsible large twin port bottle , dextrose 5% non pvc dehp free self collapsible large twin port bottle , dextrose 5% ( plastic ) , dextrose 5% ( plastic ) , dextrose 5% ( plastic ) , dextrose 5%, sod.choride 0.18%, n / 5 glass , dextrose 5%, sod.choride 0.18%, n / 5 glass , dextrose 5%, sod.choride 0.18%, n / 5 plastic , dextrose 5%, sod.choride 0.18%, n / 5 plastic , dextrose 5%, sod.choride 0.33%, n / 3 glass , dextrose 5%, sod.choride 0.45%, n / 2 ( plastic ) , dextrose 5%, sod.choride 0.9% ( plastic ) , dextrose 5%, sod.choride 0.9% n / 3 glass , dextrose 5%, sod.choride 0.9%. ( plastic ) , dextrose normal saline dextrose 5%, sod.chloride 0.9% ( plastic self collapsible bags ) pvc bags with dehp , dextrose normal saline dextrose 5%, sod.chloride 0.9% ( plastic self collapsible bottle ) non pvc large twin port bottle , dextrose20% ( glass ) , electrolyte e , electrolyte g , glycine 1.5% ( plastic ) , glycine 1.5% ( plastic ) , h.d.fluid low calcium , heamodialysis fluid with dextrose , irrigation solution glycine 1.5 % bottle , irrigation solution glycine 1.5 % polybag , irrigation solution normal saline bottle , irrigation solution normal saline polybag , lactate free balanced solution in non pvc packing with ph of 7.35 7.45 bio degradable bag , lactate free hemodialysis fluid , prismasol hemodialysis / hemofiltration solution bags , mannitol 10% + glycerine 10% ( plastic ) , mannitol 10% + glycerine 10% ( glass ) , mannitol 10% + glycerine 10% ( glass ) , mannitol 20% , mannitol 20% ( glass ) , mannitol 20% ( glass ) , mannitol 20% self collapsible bags pvc bags with dehp , multiple electrolytes& dextrose m , multiple electrolytes& dextrose p , normal saline ( sodium chloride 0.9% ) ( glass ) , normal saline ( sodium chloride 0.9% ) ( glass ) , normal saline ( sodium chloride 0.9% ) ( plastic ) , normal saline ( sodium chloride 0.9% ) non dehp dobule sterile polyolifen closed sysytembag with both temper evident cap , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible bags , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible bags , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible large twin port bottle , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible large twin port bottle , normal saline ( sodium chloride 0.9% ) ( plastic ) , normal saline ( sodium chloride collapsible bag ) , normal saline sodium chloride 0.3% ( plastic ) , normal saline sodium chloride 0.45% , normal saline sodium chloride 0.45% , normal saline sodium chloride 0.9% ( plastic ) , p.d. fluid plastic , p.d. fluid plastic , paracetamol 10 mg / ml ( dehp free non pvc, self collapsibledouble sterilised closed systembio degradablebags ) , pd fluid 1.5 % bags with drain bag setof , peritoneal dialysis fluid 1.7% , ringer lactate ( glass ) , ringer lactate ( plastic ) , ringer lactate ( plastic ) , ringer lactate non pvc dehp free self collapsible bags , ringer lactate non pvc dehp free self collapsible bags , ringer lactate non pvc dehp free self collapsible large twin port bottle , ringer lactate non pvc dehp free self collapsible large twin port bottle , sodium chloride0.9 % repulse10 ml , sodium chloride 0.9%plastic ampule , sodium chloride 0.9% 500 ml glass bottle , sterile water for irrigation , sterile water for irrigation , immunomodulators , aflibercept , anti human t lymphocyte immunoglobulin ( rabbit ) , anti thymocyte immunoglobulin ( rabbit ) , basiliximab , betamethasone , betamethasone , cyclosporine , cyclosporine , cyclosporine , deflazacort , deflazacort , deflazacort , evolocumab pfs , infliximab , methyl prednisolone 40mg , methyl prednisolone 80mg , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , pegfilgrastim prefilled syringe , prednisolone , prednisolone , prednisolone , rituximab , rituximab , tenofovir, lamivudine, and , dolutegravir , tacrolimus , tacrolimus , tacrolimus , tacrolimus , musculoskeletal system , abatacept , aceclofenac , aceclofenac , aceclofenac + paracetamol , aceclofenac + thiocolchicoside , aceclofenac +thiocolchicoside , aceclofenac+chlorzoxazone+paracetamol , ademetionine butanedisulfonate , allopurinol , baclofen , baclofen , baclofen , baclofen , dextromethorphan+ chlorpheniramine+phenylephrine h , diacerein , diclofenac +chlorzoxazone + paracetamol + , diclofenac patch , diclofenac patch , diclofenac sodium 25 mg / ml , diclofenac sodium75mg / ml , diclofenac sodium , diclofenac sodium , diclofenac sodium , diclofenac sodium+ paracetamol , diclofenac sodium+ paracetamol , diclofenac suppository , diclofenac suppository , diclofenac suppository , diclofenadiethylamine linseed methyl salicylate & menthol , diclofenac diethylamine 4% w / v qps based meter dosages , dothiepin hydrochloride + methylcobalamin , etoricoxib , etoricoxib , etoricoxib , etoricoxib , febuxostat , glucosamine sulphate +chondrotin sulphate , glucosamine sulphate+diacerein , hyaluronic acid injectable implant 20mg / ml , hyaluronic acid injectable implant 20mg / ml , ibuprofen , ibuprofen , ibuprofen 100mg. / 5ml , ibuprofen + paracetamol , ibuprofen + paracetamol , ibuprofen + paracetamol , ibuprofen + tizanidine , indomethacin , indomethacin , indomethacin , indomethacin , indomethacin , ketorolac , ketorolac , ketorolac , lactulose 20 % w / v ( lactulose 200 mg sodium benzoate 3 mg , l arginin +l lysine , leflunomide , leflunomide , mefenamic acid , mefenamic acid + dicyclomine , mefenamic acid+ tranexamic acid , mesalamine , mesalamine , mesalamine , mesalamine enema 1 gm , nimesulide +paracetamol , pancreatin minimicrospheres , pancreatin minimicrospheres , pancuronium4mg / 2ml , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol 125mg / 5ml , paracetamol 250 mg / 5ml , paracetamol , paracetamol + aceclofenac , paracetamol 10mg / ml ( plastic bot. ) , paracetamol+ caffiene , paracetamol+tramadol , pentazocin , pinaverium bromide , piroxicam , piroxicam , rivastigmine , rivastigmine , rivastigmine , rivastigmine , serratiopeptidase , serratiopeptidase , thiocolchicoside , thiocolchicoside , thiocolchicoside , thiocolchicoside , tolterodine , tolterodine , tramadol , tramadol , tramadol hcl 100 mg / ml , tramadol hcl 50 mg / ml , trypsin / chymotrypsin , trypsin / chymotrypsin , narcotic drugs , morphine sulphate 10mg / ml , morphine sulphate 15mg / ml ( preservative free , morphine sulphate , morphine sulphate sr , morphine sulphate sr , morphine sulphate ( sr ) , morphine sulphate ( sr ) , morphine sulphate , morphine sulphate , morphine sulphate , fentanyl citrate 50mcg / ml , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal oral transmucosal , pethidine , buprenorphine , buprenorphine , buprenorphine sublingual , buprenorphine sublingual , buprenorphine sublingual , transdermal buprenorphine patch , transdermal buprenorphine patch , transdermal buprenorphine patch , methadone , methadone , neoplastic disorder , 5 flurouracil , 5 flurouracil , 5 fluorouracil , 5 fluorouracil , aberaterone , aberaterone , actinomycin d 0.5 mg , adriamycin , adriamycin , alpha interferon , amifostine , amifostine , anastrzole , aprepetant , axitinib , axitinib , azacytidine , bendamustin , bendamustin , bendamustine , bevacizumab 100 mg , bevacizumab 400 mg , bicalutamide , bleomycin , bortezomib , bortezomib , bortezomib , busulphan , capecitabine , capecitabine , carfilzomib , celecoxib , chlorhexidine gargles , cisplatin , cisplatin , cladribine , clotrimoxazole lozendges , cyclophsophamide , cyclophsophamide , cyclosporine , cytarabine , cytarabine , cytosine arabinoside , cytosine arabinoside , cytosinetarabinoside , cytosinetarabinoside , cytosinetarabinoside , cytranine , cytranine , dacarbazine , dacarbazine , dactinomycin , danazol , danazol , dasatanib , dasatanib , dasatanib , daunorubicin hydrochloride , degarelix room temperature stable , degarelix room temperature stable , docetaxel , docetaxel , docetaxel , docetaxel , docetaxel lipid suspension , docetaxel lipid suspension , doxorubicin liposomal , entecavir , entecavir , enzalutamide , enzalutamide liqid soft capsules , epirubicin , epirubicin , epirubicin , eribulin mesylate , erlotinib , erlotinib , etanercept , etanercept , erlotininb , etanercept prefilled pens , etanercept prefilled pens , etanercept prefilled pens , etoposide , etoposide , everolimus , everolimus , exemestane , filgrastim ( gcsf ) , filgrastim peg , fludarbine 50 mg , flutamide , folinic acid , fosaprepitant , fulvestrant , geftinib , gemcitabine hcl , gemcitabine hcl , gemcitabine hcl , goserelin , granisterone , granisterone , gentian violet paint , hafooz ointment , hydroxyurea ( hydroxycarbamide ) , ibrutnib , idraphos , ifosfamide 1gm.vial + mesna. combipack , ifosphamide , imatinib , imatinib , ipilimumab , irinotecan , irinotecan , itolizumab , ixabepilone , ixabepilone , lapatinib ditosylate , lapatinib ditosylate , lenalidomide , lenalidomide , lenalidomide , lenvatinib , lenvatinib , letrozole , leucovorin calcium , leucovorin calcium , leucovorin calcium , liposomal doxorubicin , melphalan , melphalan , mercaptopurine , mercaptopurine , mesna 1 gm , methotrecate tablets , methotrecate tablets , methotrexate , methotrexate , methotrexate , methotrexate , methotrexate injection for intrathecal , methotrexate injection for iv , methotrexate injection for iv , mistabron , mitomycin c , mitomycin c , mitomycin c , mitomycin c , mitoxantrone , nanoparticle paclitaxel , nanoparticle paclitaxel , nilotinib , nilotinib , nimotuzumab , pirfenidone , non pegaylated liposomal doxorubicin , non pegaylated liposomal doxorubicin , nintedanib 100 mg , nintedanib 150 mg , nivolumab , nivolumab , octreotide , octreotide , octreotide lar , octreotide lar , octreotide lar , omalizumab , osteophos , osteophos , osteophos , oxaliplatin , oxaliplatin , oxaliplatin , paclitaxel , paclitaxel , paclitaxel , paclitaxel , paclitaxellipid suspension , paclitaxellipid suspension , paclitaxel nab , palonosetron , palbociclib , palbociclib , palbociclib , pazopanib , pazopanib , pegylated asparaginase 750 iu / ml , pemetrexed disodium , pemetrexed disodium , pomalidomide , pomalidomide , pomalidomide , procarbazine , ranibizumab , ranibizumab , ranibizumab , rucaparib , rucaparib , ruxolitinib , sargramostim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulbactum , sunitinib , sunitinib , sunitinib , tamoxifen , tamoxifen , temozolomide , temozolomide , temozolomide , tolterodine , transtuzumab ( herceptin ) , transtuzumab ( herceptin ) , trastuzumab emtansine , trastuzumab emtansine , trastuzumab lyophilized , vincristine 2mg / 2 mg , vincristine 1mg / 1ml , vinorelbine , zoledronic acid , zoledronic acid , nutrition & metabolism , 10% amino acid + 20% lipid + 15% dextrose , 10% amino acid + 20% lipid + 30% dextrose , 10% amino acids with electrolytes , 6% blanced hydroxyethyl starch130 / .04 in an isotonic electctrolyte with sodium chloride 110 112 mmol osmolarity 285 290 in non pvc dehp free bage 500 ml , 7% amino acid solution for renal patients , 7% amino acid solution for renal patients , 8% amino acids for hepatic patients , alendronic acid , alfacalcidol , alfacalcidol , alfacalcidol 1mcg , alpha ketoanalogues of essential amino acid , alpha ketoanalogues of essential amino acid , amino acid 10 % , amino acid 10 % , amino acid 10% w / v with electrolyte , aminoacids soln. ( 5%w / v ) , aminoacids soln. ( 5%w / v ) , aplrostadil , ascorbic acid , ascorbic acid , ascorbic acid 1.5 gm , b complex , balanced iso caloric powder ( polymeric diet ) for , enteral tube feeding , calciumcarbonate+vitamine d3 , calcium acetatemaleate , calcium carbonate+vitamine d3 , calcium gluconate , calcium gluconate & calcium lactobionate 10 ml , cap.live freeze dried lacatic acid bacteria and bifidobacteria , cholecalciferol ( vitamin d3 ) , cholecalciferol , cyanocobalamin , cyproheptadine ( 2mg ) + tricholine citrate ( 275mg ) , darbepoietin alfa , darbepoietin alfa , darbepoietin alfa , darbopoetin alfa , darbopoetin alfa , darbopoetin alfa , dextran 40 , dextran 70 , dipeptide of n ( 2 ) alanyl glutamin , dipeptide of n ( 2 ) alanyl glutamin , enteral nutrition powder for diabetic patients , epoetin beta , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin beta , erythropoietin beta , erythropoietin beta , ferric carboxymaltose 1gm , ferric carboxymaltose 500 mg , ferric carboxymaltose 100 mg , ferrous ascorbate + folic acid , ferrous sulphate / fumrate , ferrous sulphate / fumrate , folic acid , folic acid , formula milk powder for preterm / low birth weight newborns , formula milk powder for term newborns , formulated well balanced nutritional supplement for gastro intestinal , glutamine powder , hepatic protien powder , hepatic protien powder , high protein low electrolyte powder for enteral tube feeding in patients on dialysis , high protein powder for enteral tube feeding , high protein powder for pregnancy & lactation , high protein powder for pregnancy & lactation suugar free , high protien powder for renal patients on dialysis , high protienpowder for renal patients on dialysis , human albumin low salt , human albumin 20% , human albumin 20% , human albumin 25% , human albumin 25% , human albumin 5% , human albumin 5% , human milk fortifier , human milk fortifier ( bovine based ) , ibandronate , intralipid phospholipid & fat emulsion solu 20% , intralipid phospholipid & fat emulsion solu 20% , intralipid phospholipid & fat emulsion solu. 30% , intralipid phospholipids & fat emulsion solu 20% , iron , iron + folic acid , iron dextran , iron as ferric saccharate and phospholipid chewable tablets , l alanyl l glutamine , lacticacidbacillus , loperamide 2 mg , l ornithine aspartate , l ornithine aspartate , low salt human albumin solution 20% , low salt human albumin solution 20% , lyophilized erythropoietin , lyophilized erythropoietin , methoxy polyethylene glycol epoetin beta , methoxy polyethylene glycol epoetin beta , methoxy polyethylene glycol epoetin beta , methyl cobalamin , methyl cobalamin , methyl cobalamin , methyl cobalamin , methyl cobalamine +alpha liporic acid+folic , acid+choline+pyridoxine , multivitamin , multivitamin drop , multivitamin with vitamin –a , multivitamin 500 mg , multivitamine, multmineral , nicotinamide , nutritional supplements for patients in liver failure , omega 3 fatty acid , pegylated erythropoietin alfa , pegylated erythropoietin alfa , pegylated erythropoietin alfa , peptide based specialized nutrition to support gi tolerance with 100% hydrolyzed protien , phytomenadione , polygeline , polygeline ( polymer from degraded gelatin ) , potassium chloride , potassium chloride , protein powderfor renal ( low protein for non dialysis patient , renal protien powder , succinylated gelatines , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , vitamin a , vitamin a , vitamin a , vitamin b1 ( thaimine ) , vitamin c , vitamin cwith zinc , pyridoxine , pyridoxine , pyridoxine , pyridoxine , pyridoxine , vitamin.b1, b6, b12 combination , who ors powder sachet , zinc , zinc gluconate , ophthalmic preparations , acyclovir 3% , acyclovir 5% , atropine 1% , betamethosone 0.1%+ neomycin 0.5% , betamethosone 0.1%+ neomycin 0.5% , betaxolol 0.25% , betaxolol 5% , brimonidine tartarate 0.2% , bromonidine 0.2%+timolol 0.5% , carboxymethylcellulose sodium0.5% , cefazolin 0.5% , chloramphenicol , chloramphenicol 1% , chloramphenicol 1% , ciprofloxacin 0.3% w / w , ciprofloxacin 0.3% w / w , cyclopentolate 1% , cyclosporine 0.05% , diclofenac 0.1% , dorzolamide 2% , erythromycin , fluconazole 0.3% , fluorescein 1% , fluorescein sodium 10% , fluorescein sodium 20% , fluoromethalone 0.1% , flurbiprofen 0.03% , gatifloxacin 0.3% , gentamicin 0.30% , homatropine hydrobromide 2% , hydroxy propyl methyl cellulose 0.70% , hydroxyl propyl methyl cellulose 0.3% , hydroxyl propyl methyl cellulose solution –prefilled syringe 2% pfs , hypromellose 0.3% , hypromellose 2% w / v , intravitreal implants dexamethasone 700 microgram ( slow release biodergradable implant ) , intravitreal injection triamcinolone acetonide ( 40 mg / 1ml, sterile preservative free ) , ketorolac 0.5% , latanoprost 50 mcg per ml , latanoprost 50 mcg per ml + timolol 5 mg per ml , lignocaine 4% , methyl cellulose 2% , miconazole 2% , moxifloxacin 0.5% , natamycin 5% , neomycin+polymyxinb+bacitracin zinc , neosporin eye ointment , nepafenac ophthalmic suspension , norfloxacin 0.3% , ofloxacin 0.3% , opthalmic irrigation solution 500 mlsodium chloride 7.44 mg, · sodium chloride 7.44 mg, · potassium chloride0.395 mg, calcium chloride 3.85 mg · magnesium chloride5 mg· dibasic sodium phosphate0.433mg· sodium bicarbonate 2.1 mg · dextrose 23 mg, · glutathione disulfide ( oxidized glutathione ) 4.6 mg, ph of 7.4 osmolality is approximately 305 mosm , paracaine , phenylephrine hcl5% , phenylephrine hcl 10% , pilocarpine 0.25% , pilocarpine 2% , pilocarpine 4% , pilocarpine nitrate preservative free 0.5 w / v , polyvinyl alcohol 1.4% + povidone 0.06% + chlorbutanol 0.5% , povidone iodine 0.60% , povidone iodine 5% , prednisolone acetate 0.01% , prednisolone sodium phosphate 1% , proparacain hci usp 0.5% , sodium cromoglycate 2% , sodium hyaluronate pfs , sodium hyaluronate pfs , sodium hyaluronate pfs , sodium hylauronate 14 mg , tetracaine hydrochloride 0.5% , timolol 0.25% , timolol 0.5% , tobramycin 0.3% , tropicamide 0.8%+ phenylepherine 5% , tropicamide 0.80% , tropicamide 1% , trypan blue dye 0.06% , tropicamide+phenylephrine 1%+5% , vancomycin 50mg / cc , pediatrics , aminoacid based infant formula , aminophylline , biotin , bosentan , caffine citrate , caffine citrate , calcitriol , ceftazidime+ tazobactum , cetrizine chlorpheniranine , clacium phosphate ( 10ml=300 mg ) , clobazam , cloxacillin , digene gel , domperidone , enalapril 5 , enterogermina , furosemide , gancyclovir , hepatitis b immunoglobulin , hydralazine , hydralazine , hydroxazime hcl , junior lanzol , k bind , lactulose , lactulose syrup , lasilactone , leucoverin , levosimendan , levosimendan , metoprolol , multivitamin drops , multivitamin syrup , nitroglycerine , nitroglycerine , nitroprusside , paracetamol suppository , phenergan , polyehtylene glycol , poractant alfa ( curosurf ) , poractant alfa ( curosurf ) , potassium phosphate , prazocin , prostaglandin e1 , ribofalvin , rifaximin , salbutamol , saline nasal drops ( 0.65% ) , sildenafil , sildenafil , sildenafil citrate , sildenafil citrate , surfactant , surfactant , surfactant , beractant intratracheal suspension , beractant intratracheal suspension , thiamine , thrombophobe , triclofos , ursodeoxyxholic acid , vitamin d 3 drops ( 1ml=400iu ) , zinc gluconate oral suspension , zinc oxide , radiology , barium enema disposable kit , barium enema powder , barium paste , barium powder, , barium sulphate , barium sulphate , barium sulphate high density powder , barium suspension , barium suspension , contrast agent containing sulphur hexaflouride microbubbles for intravascular use , disposablect enema kit , gadobenate acid dimglumine , gadobenate acid dimglumine , gadobenate dimeglumine334mg+195mg / ml , gadobenate dimeglumine334mg+195mg / ml , gadodiamide , gadodiamide , gadopentate , gadopentate , gadopentate dimeglumine , gadopentate dimeglumine , gadoterate meglumine , gadoterate meglumine , gadoteric acid ( ionic macro cyclic compound ) , gadoteric acid ( ionic macro cyclic compound ) , gadoteridol , gadoteridol , gastrovedeo ( diatriozoate sod 41.7% w / v ) , iodixanol 270 mg iodine / ml , iodixanol 270 mg iodine / ml , iodixanol 320 mg iodine / ml , iodixanol 320 mg iodine / ml , iohexol , iohexol 300 mg iodine / ml , iohexol 300 mg iodine / ml , iohexol 350 mg iodine / ml , iohexol 350 mg iodine / ml , iohexol 350 mg iodine / ml , iomeprol 400 mg iodine / ml , iomeprol 400 mg iodine / ml , iopamidol 300 mg iodine / ml , iopamidol 300 mg iodine / ml , iopamidol 370 mg iodine / ml , iopamidol 370 mg iodine / ml , iopromide 300 mg iodine / ml , iopromide 300 mg iodine / ml , iopromide 370 mg iodine / ml , iopromide 370 mg iodine / ml , lipiodol , n butyl 2 cyanoacrylate , n butyl 2 cyanoacrylate , n butyl 2 cyanoacrylate , one molar mri contrast agent: gadobutrol , one molar mri contrast agent: gadobutrol , one molar mri contrast agent: gadobutrol , sod. diatrizoate & meglumine diatrizoate 60% eq.to 292mg. / ml. , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sodium megluminediatrizoate , sulphar hexafluoridemicrobubbles 25 mg , respiratory system , aminophylline , aminophylline , beclomethasone , beclomethasone dipropionate , beclomethasone dipropionate , budesonide , budesonide , budesonide , budesonide , budesonide , budesonide , codeine phosphate , codeine phosphate + chlorpheniramine maleate , dextromethorphan , dextromethorphan hydrochloride , 5 mg chlorpheniramine maleate 2.5 mg, guaifenesin 50mg, ammonium chloride 60 mg / 5ml , doxophylline , doxophylline , favipiravir , fluticasone + salmeterol , fluticasone + salmeterol , fluticasone + salmetrol , fluticasone + salmetrol , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + triotropium , formoterol + triotropium , guaiphenesin+dextromethorphan +chlorpheniramine maleate ( sugar free ) , hydrocortisone sodium succinate , hydrocortisone sodium succinate , indacaterol maleate+indacaterol+glycopyrrronium bromide , ipratropium br + levosalbutamol , ipratropium br + salbutamol , ipratropium bromide , ipratropium respirator solu. for nebulisers , ipratropium respirator solu. for nebulisers , levosalbutamol 1.25mg , montelukast , montelukast , montelukast + levocetrizine , montelukast +fexofenadine , phenyephrine + chlorpheniramine maleate , promethazine hydrochloride 1.5mg + pholcodine 1.5mg , salbutamol , salbutamol , salbutamol+ipratropium bromide , salbutamol + theophylline , salbutamol + theophylline , salbutamol +ipratropium bromide , salbutamol 2 mg / 5 ml , salbutamol 5mg / ml , salbutamol sulphate , salbutamol sulphate , salmetrol + fluticasone , salmetrol + fluticasone with accuhaler device , salmetrol + fluticasone with accuhaler device , salmetrol+fluticasone , terbutaline , terbutaline , terbutaline , terbutaline + bromhexine hcr , terbutaline 1.5mg / 5ml , terbutaline nebulising solution 0.5mg / ml , terbutaline sulphate + brohexine hydrochloride + guaiphenesin + menthol , theophylline + etophylline , theophylline + etophylline , theophylline 35 mg + etophylline 115mg , theophylline 70 mg + etophylline 231mg , tiotropium , tiotropium , sera & vaccines , anti d immunoglobulin , anti d immunoglobulin , anti rabies immunoglobulin ( human ) , anti rabies immunoglobulin ( human ) , anti rabies immunoglobulin ( human ) , anti snake venom ( polyvalent ) vial , buvalent poliomyelits vaccine type 1&3 , live oral , diphtheria and tetanus vaccine ( adsorbed ) for adults and adolescents ) , diphtheria, tetanus, pertussis ( acellular component ) ) , diptheria antitoxin , dpt & hepatitis b combination , diphtheria toxoid & tetanus vaccine ( adsorbed ) , diphtheria toxoid, acellular pertussis & tetanus toxoid vaccine , docaravimab and miromavimab 1500 iu , haemophilus influenzae b conjugate vaccine , hepatitis a vaccine 720 elisa unit / ml. , hepatitis b vaccine ( rdna ) adult , hepatitis b vaccine multi dose 20 ?g / ml , hepatitis b vaccine single dose 20 ?g / ml , hepatitis b vaccine single dose paed. , human papilloma virus vaccine ( hpv ) , inactivated hepatitis a vaccine , influenza vaccine , influnza vaccine ( flu quadry ) , influnza vaccine ( flu quadry ) , inactivated influenza vaccine ( split virion ) i.p. tetravalent ( pfs ) , measles vaccine , meningococal vaccine , meningococcal ( groups a, c, y and w 135 ) polysaccharide diphtheria toxoid conjugate vaccine , mmr ( measles, mumps & rubella vaccine ) , oral polio vaccine , pneumococcal conjugated vaccine 10 valent , pneumococcal conjugated vaccine 13 valent , pneumococcal conjugated vaccine 23 valent , polysaccharide typhoid , rabies human monoclonal antibodies ( rdna ) 100iu , rabies human monoclonal antibodies ( rdna ) 50 iu , rabies vaccine ( human diploid cell ) , rabies vaccine, human i. p. vero cell cultured freeze dried vaccine , rubella vaccine ( monovatent ) , scorpion venom anti serum , tetnus immunoglobulin ( human ) vial. , tetnus immunoglobulin ( human ) vial , tetnus toxoid ( human ) , typhoid vaccine. , typhoid vaccine. , vericella vaccine 1vial + 1ml. of diluent , yellow fever vaccine ( live freeze dried , skin preparations , betamethasone dipropionate , betamethasone dipropionate 0.1% + salicyclic acid 3% , betamethasone valerate 0.01% , betamethasone valerate 0.12% + neomycin 0.5% , cetrizine , cetrizine , clobetasol 0.05% , clobetasol 0.05% + fusidic acid 2% , clobetasol 0.05% + gentamicin 0.1% , clobetasol 0.05% + gentamicin 0.1% , clotrimazole cream , clotrimazole cream , clotrimazole lotion 1% , clotrimazole1% + allantoin 0.2 % w / w , fluocinolone + neomycin , fluocinolone 0.025% , fluocinolone acetonide 0.1% , fluticasone 0.05% + mupirocin 2% , fluticasone propionate 0.05% , heparin , hydroquinone , hydroxizine , hydroxyl propyl methyl cellulose2 % , levocetrizine , liposomal dithranol 0.5% w / w , luliconazole cream 1% , methylrosanilinium chloride ( gentianviolet ) , miconazole 2% , minoxidil 2% , mometasone 0.1% , mometasone 0.1% , mometasone 0.1% + fusidic acid 2% , mometasone 1 mg + salicylic acid 50mg , mometasone furoate , mupirocin + betamethasone , mupirocin 2% , neomycin +bacitracin , permethrin 5% , povidone iodine 5% , povidone iodine5% + metronidazole 1% , salicylic acid 5% , sertaconazole 2% , silver sulfadiazine 1% , silver sulfadiazine+chlorhexidine , tacrolimus 0.1% , terbinafine...

Medical And Health Services - Rajasthan

33416389 supply of generic medicines injection tablet syrup bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , atropine sulphate injection 0.6mg / ml , group name ( 1 ) :: 02. analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , group name ( 1 ) :: 03. antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , group name ( 1 ) :: 04. antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , group name ( 1 ) :: 05. anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , group name ( 1 ) :: 06. anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , terbinafine hydrochloride tablet 250 mg , group name ( 1 ) :: 07. anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , group name ( 1 ) :: 08. anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , group name ( 1 ) :: 09. drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , rh erythropoetin inj ip 2000iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , group name ( 1 ) :: 10. cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , carvedilol tablet 3.125 mg , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , group name ( 1 ) :: 11. dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , group name ( 1 ) :: 12. dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , oitment mupirocin ip 2% , group name ( 1 ) :: 13. reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , vdrl antigen ( with + ve and ve control ) / rpr slide kit , multistix test strip , group name ( 1 ) :: 14. disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , group name ( 1 ) :: 15. diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , group name ( 1 ) :: 16. drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , group name ( 1 ) :: 17. gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , group name ( 1 ) :: 18. gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , group name ( 1 ) :: 19. hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , group name ( 1 ) :: 20. immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , group name ( 1 ) :: 21. muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , group name ( 1 ) :: 22. opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , group name ( 1 ) :: 23. oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , group name ( 1 ) :: 24. psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , clonazepam tablet 0.5 mg , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , group name ( 1 ) :: 25. drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , group name ( 1 ) :: 26. solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , group name ( 1 ) :: 27. drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , group name ( 1 ) :: 28. antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , group name ( 1 ) :: 29. vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , group name ( 1 ) :: 30. miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , pregabalin cap ip 75 mg , vitamin e capsule 400 mg , group name ( 1 ) :: 31. swine flu drugs , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , group name ( 1 ) :: 32 anti malerial drugs , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , absorbable surgical suture , sterilised needle , non absorbable surgical suture sterilised surgical needled suture polyglecraprone monofilament sutures absorbable surgical sutures sterilised needeled , monifilament polydioxanone suture antibactterial coated suture absorbable surgical suture , surgical group name ( 1 ) :: 37. surgicas 669 si absorbable gelatin sponge 80 x 50x 1omm ( details in rc ) 67o 52 absorbent cotton wool ip 500 gm 671 s3 asepto syringe with transparent bulb sterile, 60 ml 672 s4 blood administration set blood transfusion set ( details in rc ) 673 s5.a gloves size 6.5 lnches, powdered ( disposable ster’ile surgical rubber gloves ) ( details in rc ) 674 s5.b gloves size 6.5 lnches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) 675 s6.a gloves size 7 lnches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 676 s6.b gloves size 7 lnches, powder free ( disposable sterile 5urgical rubber gloves ) ( details in rc ) 677 s7.a gloves size 7.5 lnches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 678 s7.b gloves size 7 .5lrmches, powder free ( disposablesterile 5urgical rubber gloves ) ( details in rc ) 679 s8.a suction catheter, sterile.size: fg s ( details in rc ) 619 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) 680 58.b suction catheter, 5terile. size: f g 6 ( details in rc ) 681 s8.c suction catheter, 5terile. size: f g 8 ( details in rc ) 682 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) 683 s8.e suction catheter, sterile, size: f g 12 ( details in rc ) 684 s8.f suction catheter, sterile. size: f g. 14 ( details in rc ) 68s s8.g suction catheter, sterile. size: f g 16 ( details in rc ) 686 58.h suction catheter, sterile. size: f g 18 ( details in rc ) 687 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) 6s8 sb.j suction catheter, sterile. size: f 6 22 ( details in rc ) 689 s9.a catheter, size 8 ( foleys f3allon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 690 s9.b catheter, size 1o ( foleys ballon catheter sterile, 2 way for urinary drainage, single usejsihconl coated natural latex material ( details in rc ) 91 s9.c catheter, size 16 ( foieys ballon catheter 7 sterile, 2 way for urnary dralnage, single / usejsiiicon coated natural latex material ( details in rc ) s92 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary dralnage, single use jslhcon coated natural latex material ( details in rc ) 693 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single usejsilicon coated natural latex material ( details in rc ) 694 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary dralnage, single usejsilicon coated natural latex material ( details in rc ) 695 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use jsilicon coated natural latex material ( details in rc ) 696 s1o.a infant feeding tube size 1ofg ( details in rc ) 697 s1o.b intant feeding tube size 8fg ( details in rc ) 698 s1o.s infant feeding tube size sfg ( details in rc ) ____ 699 s11 perfusion set with airway and needle1 ( adult use ) sterile renusiumi 3 wijmnm mhrwd amiu needle, ( adult use ) sterile disposable ( details in rc ) 70o 512 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) 7o1 513 infusion set with microdrip0 ( i.v. ) sterile disposable ( details in rc ) 702 514 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 7o3 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 166 ( details in rc ) 7o4 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 186 ( details in rc ) 7o5 s15.c sterile disposable ( single use ) tefion / ptfe iv. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) 7o6 s15.d sterile disposable ( single use ) tefion / ptfe l.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) 707 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 246 ( details in rc ) 7o8 s1 ( mucus extractor sterile ( detalls in rc ) 709 517.a nasal oxygen set, twin bore all sizes adult ( details in rc ) no s17b nual oxygen set, twin bore all sizes paediatrics ( details en rc ) 711 s1 paper adhesive plasterjwilii l.ullei p4ufl woven adhesive tape ./714 $21 plaster of paris bandage 15cm x 2.7 mts/roll 715 s22 plaster of paris bandage 10cm x 2.7mts 716 s23.a ryles tube / nasogastric tube sizet 1o(detaiis in rc) 717 s23.b ryles tube / nasogastric tube size: 12(detajls in rc) 718 s24.a ryles tube / nasogastric tube size:14 (details in rc) 719 s24.b ryles tube / nasogastric tube size: 16 (details in rc) 720 s24.c ryles tube / nasogastric tube size: 18 (details in rc) 721 s25.a scalp vein set (disposable) site 18g (details in rc) 722 s25b stalp vein set (disposable) site 20g (details in rc) 723 s25.c scalp vein set (disposable) size 22g (details in rc) 724 s25.d scalp vein set (disposable) size 24 g (details in rc) 725 s26 syringe 2 ml hypodermic with needle attached 24g.sterile,single use disposable(details in rc) 726 s27 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 727 528 syringe 10 ml hvoodermic with needledisposable(details in rc) 727 s28 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 728 s29 syringe 2o ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 729 530.a surgical blade sterile, size 11(details in rc) 730 s30.b surgical blade sterile, size 15(details in rc) 731 s30.c surgical blade sterile, size 22(details in rc) 732 531 suture needles curved 1/2 circle round body assorted size 11 15(detalls inrc) 733 532 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 734 533 suture needles curved 1/2 circle round body assorted size 16 20(details inrc) 735 s34 suture needles curved 1/2 circle round body assorted size 6 1o(details in rc) 736 535 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 737 536 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 738 s37 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 739 538 suture needles curved and cutting size 1 5(details in rc) 74o s39.a sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 741 s39.b sterile disposable spinal needle for single uses 25g x 3 1/2 inch (details in rc) 742 s40 urine collecting bag, disposable 2000 ml(details in rc) a4 s43.b endotracheal tube, plain size 3 (details in ( rc) 74s s43.c endotracheal tube, plain size 3.5 (details in rc) 746 s43.d endotracheal tube, plain size 4 (details in rc) 747 s43.e endotracheal tube, plain . size 4.5 (details inrc) 748 s43.f enclotracheal tube, plain size 5 (details in rc) 749 s43.g endotracheal tube, plain size 5.5 (details in rc) 750 s43.h endotracheal tube, plain size 6 (details in rc) 751 s43.i endotracheal tube, plain size 6.5 (details in rc) 752 s43.j endotracheal tube, plain size 7 (details in rc) 7s3 s43.k endotracheal tube, plain size 7.5 (details in rc) 7s4 s431 endotracheal tube, plain size 8 (details in rc) _____w s 755 s43.m endotracheal tube, plain size 8.5 (details in rc) 756 s44.a endotracheal tube, cuffed size 4 (details in rc) unl rw.. 756 s44.a endotracheal tube, cuffed size 4 (details in rc) 757 s44.b endotracheal tube, cuff. size 4.5 (details inrc) 758 s44.c endotracheal tube, cuff size 5 details in rc ____ _ 7s9 s44.d endotracheal tube, cuff size 6 (details in rc) 760 s44.e endotracheal tube, cuff size 6.5 (details in rc) 761 s44f endotracheal tube, cuff size 7 (details in rc) 762 s44.g endotracheal tube, cuff size 7.5 (details in ) 763 s44.h endotracheal tube, cuff size 8 (details in rc) 764 544.i endotracheal tube, cuff size 8.5 (details inrc) 76s 544 j endotracheal tube, cuff. size 9 (details in rc) 766 545 tracheostomy tube, plain all sizes(details inrc) 767 546 tracheostomy tube (pvc). culled all sizes(details in rc) 768 s47.a abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 769 547 b abdominal drain kit, sterile, havng drainage catheter and collection bag (2000 ml) size 24 (details in kc) 770 547.c abdominal drain kit,sterile,havng lfraanawp csther irni cnllprtirwi riy’t cinlii corrrugated drainage sheet , polypropyelne non absorbable synthetic surgical mesh 15cm m3 s74 polyproeylene nonabsorbable syathetic surgical uesh is cm x is cm 774 s79 sterilized umbilical eattoa tape width 3 mm, length 75 cm(deealls in rc) 775 s80 bone wax sterilised 7a6 s82 skie graft knife blade (steaile)(detajls in rc) 777 s84.a k wire. length 375 mm; lmm(detapls in rc) 778 s84.b k wire. lengeh 375 mm, l.6mesdetajls in rc) 779 s84.c k wire. leneth 375 mm; l.8mm(details in rc) 7a0 s85 faee maek, diweesable(detalls ln re) 781 s86.a surgical cap disposabie ifor surgeons)(detaiis in rc) 782 s86.b surgical tae, disposablejuetails in rc) 18 to 24 785 587,c foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 786 s88.a standard pama lntra ocular lenses (details in rc)1j.to 17.5 7s1 s88.b standard pwma intra ocular lenses (detaiis in rc) 18 to 24 788 s88.c standaid pwma intra ocular lenses (details in rc) 24.5 to 28.5 789 s89.a oisposable sterile surgical rubber gloves size 8 inchespowdered 790 s89.b oisposable sterile surgical rubber gloves size 8 lnches,powder free ____________ 791 s90.a rubber exanination gloves, non sterile, extra small(details in rcl 792 590.b rubber examination gloves,site small (details in rc) 793 s90.c rubber examination glovessize medium (details in rc) 794 s90.d rubber examination gloves made of natural rubber latex, non 5terile, site large (details in rc) 79s 591 pressure monitoring line / high pressure extension line (details in rc) 796 592 urine collecting bag for new born /paediatric urine collection bag, capacity 1oom! idetails in rc) ___ — 797 s93 umbilical catheter for new born, all sites (details in rc) 798 594 ; clamp (details in rc) 799 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(detajls in rc) 80o s96.a close wound drainage device under ne8ative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) —re wbunfd drainage device unaer negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 802 597 i tube for common bile duct drainage, length 20x60 cm, size (details in rc) 803 598 bone cement 804 599.a sanitary napkin beltless(details in rc) 805 s99.b sanitary pads belt type(details in rc) 806 s99.p sanitary napkin beltless with wings (details in rc) 807 5100 oxygen mask (adult) 808 5101 oxygen mask (pediatric) 809 s102 foleys catheter no. 14 (detail in rc) 810 5103 nelaton catheter size 14 fg(detail in rc) 811 s104 ecg electrode (detail in rc) 812 slos surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail inrc) . 813 5106 sterile hypodermic syringe with needle attached, 22g. single use 5o ml (detail in rc) kc) 814 s107 urethral catheter 9o (fg 14) made up of medical grade pvc (detail in rc) 81s s108 urethral catheter 91 (fg 1o), made up of medical grade pvc (detail in rc) 816 s109 vaccum suction set, 2.5 meter length (detail in rc) . 817 5119 3 way stop cock, non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 818 5120 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail inrcl 819 5121 3 way stop cock with extension tube (vein o extension uine) size 50cm (non pyrogenic & single use) (detail in rc) 820 s122 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 821 5123 3 way stop cock with extension tube (veino extension line) size 150cm (non pyrogenic & single use) (detail in rc) 822 5124 abdominal drain kit, sterile, having drainage catheter and collection bag (200o ml) (size 16) (detail in rc) 823 512s abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 823 5125 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 824 s126 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detall in rc) 825 5127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quahty sticking property (detail in rc) 826 5128 sterile disposable niv mask (detail in rc) 831 s133 mv mask (noninvasive ventilation mask) oro nasal mask paediatric with dronchoscopy and c02 and 02 port with chin support (detail in rc) 832 5134 nebulization mask adult (detail in rc) 833 s135 nebulization mask paediatric (detail in rc) roup name (1.) :: 38. swine flu drugs 834 639 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 83s 640 oseltamivir capxule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 636 641 oxeltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 837 642 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 838 642a oseltanivir phosphate for oral suspension ip 12 mg/mi (each ml contains 12 mg oseltamivir base after reconstitution) ;roup name (1) :: 4o anti maleral drugs 839 64s act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and — rlfrla (sinph use tellon/pyfe a.v cannula with integrated 3 way stop cock (fer nursas) idetails in rc)(detajls in rc) 783 s87.a foldable intra ocular lense with injector (detalls in rc) 11 to 17,5 784 s87.b foldable intra osular lense with injeeasr (details in rc) 18 to 24 act kit each combi bliste pack containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , etc ...

Medical College - Rajasthan

33408069 rate contract of drugs medicines and injectables items rate contract of drugs medicines and injectables items , rate contract of drug and medicine , artificial saliva , balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg (monopoly) , all trans retinoic acid 10 mg , anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110/50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , ointment(modified lanolin) , aloe vera moisturizing , (six hundred twenty five) 625 , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin,niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene (0.1% w/w) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg/ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec (vitamin c+ essential amino acid) , enzyme , iron (ferrous ascorbate) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg/ml, 400 iu , vitamin d3 400iu/ml , vitamin d3 800iu/ml , cefpodoxime oral suspension 20mg/ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu/gm + neomycin 3400iu/gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w/v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p/r , nifedipine + lidocaine p/r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit(pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg/vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg/ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg(monopoly) , avelumab 200 mg (monopoly) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25,000 iu , bortezomib 2.5 , botulinum toxin type a for injection/botulinum toxin type b for injection100 iu , botulinum toxin type a for injection/botulinum toxin type b for injection50 iu , busulfan 60mg/1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg/ml , calcium chloride 5ml vial , calcium gluconate/folinate , carbetocin 1ml/100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm/vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg/4ml , clonidine 150mcg/ml , compound sodium lactate (ringer lactate) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg (monopoly) , daratumumab400 mg(monopoly) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu/3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg/ml , dextran 40 , diazoxide 300 mg/20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg (monopoly) , durvalumab 500mg (monopoly) , enalapril1.25 mg 1 ml , ephedrine 30 mg/ml , epirubicin 50mg/ml , epirubicin 150mg/ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct/lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection (long acting) 25mg/ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg/ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle/500ml , glyceryl trinitrate injection, diluted 5mg/ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol (long acting) 50mg/ml ampoule , horse atg(anti thymocyte globulin) 250 mg , hp hmg (highly human menopausal parodiedgonadotropin) 150 iu , hp hmg (highly human menopausal parodiedgonadotropin) 75 iu , hydralazine 20mg/ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg(monopoly) , insulinaspart , insulinglulisine(monocomponent insulin glulisine) 100 iu/ml/3 ml cartridges , insulinglulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% (fructodex 10%) 500 cc , iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg/5ml , irinotecan 100 mg/5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% (20mg/4ml) ampule , levofloxacine 500mg/100 ml , levosulpride 12.5 mg/ml , lignocaine (preservative free) 2% , lignocaine + adrenaline (1:10000, 2:10000) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg/ml , meropenem 2gm , mesna 200 mg/2ml (sod. mercaptoethane sulphate) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg (preservative free) , midazolam 5mg/ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg/100ml , multivitamin 10 ml , nabpaclitaxel (paclitaxel nano particle)100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg (monopoly) , neostigmine+ glycopyrrolate2.5 mg/ 0.5 mg , netilmycin 300mg/3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg/50 ml , nimotuzumab 50 mg , nivolumab 40 mg (monopoly) , nivolumab 100 mg (monopoly) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar (long acting release) 20 mg , octreotide lar (long acting release) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg (monopoly) , pembrolizumab100 mg (monopoly) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg/ml , pilocarpine 0.5% w/v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg (anti thymocyte globulin)100 mg , ramucirumab 100 mg(monopoly) , ramucirumab 500 mg (monopoly) , ranizumab 10mg/ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg/10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule (heavy) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg/5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg/ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d (600000 iu) , insulin glargine300 iu per ml/prefilled pen , insuline 50/50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd eob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) , l ornithine l aspartate (150mg) + pancreatin (100mg) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 , clotrimazole 10mg , (medium chain triglyceride) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml/gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg/5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu/gm , sodium chloride 0.9% 3000ml(n.s) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine (nac) 200mg/ml , budesonide 0.5mg/ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30/pack , revolizer/ rotahaler device , root canal sealer (calcium carbonate) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg/0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm/ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg/ ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg /ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg/5ml , clarithromycin for oral suspension 125mg/5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg/ml , rabbit atg (anti thymocyte globulin) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg/30ml , l carnitine 500mg/5ml in 30 ml , l carnosine 100mg/5ml in 200ml , levofloxacin oral solution , linezolid 100mg/5ml in 30ml , mefenamice acid 100mg/5ml , mefenemic acid 50 mg + paracetamol 250 mg /60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg/5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg/5ml in 100ml , prednisoloneip 50mg , piracetam 500mg/5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg/ 5mlin 30ml , ursodeoxycholic oral suspension 125mg/5ml in 100ml , zinc oral suspension 20 mg/100 ml , /susp. azithromycin oral suspension 100mg/5ml , /susp. azithromycin oral suspension 200mg/5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg(capsule of co enzyme q10 with lycopene,selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase (100+325+15 mg) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg (monopoly) , alpelisib 200 mg (monopoly) , alpelisib 250 mg (monopoly) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg (trientine hcl) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg (monopoly) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg (monopoly) , dacomitinib 30 mg (monopoly) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside(60+8 mg) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg/25mg/200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg (monopoly) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg (monopoly) , nilotinib200 mg (monopoly) , nilotinib 300mg (monopoly) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg (monopoly) , olaparib 150 mg (monopoly) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg (monopoly) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10,000mg(with proteiase & amylase) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release/sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg/ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg (monopoly) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin (50/500) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg (monopoly) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine (adsorbed) ip in 0.5 ml , noradranaline 2 mg , heparin sodium 5 ml vial , ethamsylate 250 , vitamin k 10 mg , esmolol hydrochloride 10 mg , amikacin 500 mg , amikacin 500 mg , amoxyclave 1.2 gm , adrenalin , ceftriaxone 1 gm , ceftazidime 1 gm , deriphylline 2cc , diazepam 10 mg/2ml , dopamine , dexamethasone , diclomine , diclofane sodium 3 ml , frusemide 2 cc , gedodemide , hydrocortisone , metrogyl 100 cc , mannitol 100 ml , midazolam 5 ml , meropenam 5 ml , meropenam 1 gm , methyl prednisolone 500 mg , pipracilline+ tezobactum 4 5 gm , phenytain 100 mg , pheniramine malate , inj. paracetamol 1% 100 ml , ranitidine 2 cc , sodium bicarbonate , tramadol 2 cc , vancomycine 1 gm , sodium valproate 5 ml , pantaparazole , nor adrenaline , 5.1 gdw 500 ml , gns 500 ml , r l 500 ml , paracetamol , ibuprofen , lactulose , antacid , cefixime , amoxyclave , cough syrup , phenytain , cefixime 200 mg , ranitidine , mvbc , iron+fa , omeprazole 20 mg , pantaparazole+domperidom 40 mg+30mg , gabapantine 300 mg , diclofanic + pcm , ibu+ pcm , etoricoxib 90 mg , amoxyclave 625 mg , phenytoin 100 mg , naproxen 500mg , levofloxacin 500 mg , ciprofloxacin 500 mg , vitamin c , betanistine , carbamazepine , acetazolamide , levetiracetam 500 mg , mephentermine 50mg/ml , ropivaine 2% , ntg spray , eye ointment neosporine , flexometablic tube 6.5 mm , paracetamol suppositiery 80 mg , inj vasopnessin , inj clonidine , inj dexmeditomidine , vasline , isoflurine 100 ml , injection ketamine , lignocaine gel 2% , inj. lignocaine & adrenaline , inj. bupivacaine , atropine sulphate 0.6 mg/ml , inj. midazolam , tab. paracetamol 500 mg , inj. adrinaline 1mg/ml , propofol injection 10 mg/ml , inj. propofol 1% 50 ml , inj. propofol 1% 10 ml , thiopentone injection 0.5 g , inj. sevoflurane , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , fentanyl citrate injection50 mcg/ml , inj. diclofenacsodium 75 mg/ml aquousprepration 1 ml , diclofenac sodium 50 mg + paracetamol 500 mg , diclofenac sodium tablet 50 mg , diclofenac sodium tablet 50 mg , diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , betamethasone sodiumphosphate injection 4 mg/ml , dexamethasoneinjection 8 mg/2ml , pheniramine injection 22.75 mg/ml , promethazine injection 25 mg/ml , povidine iodine solution 5% , povidine iodine solution 5% , povidine iodine solution 10% , povidine iodinescrub solution , furosemimde 10 mg /ml , furosemide 40 mg , omiprazole 2mg , ranitidine 50mg/ml 2 ml , pantoprazole 40 mg , diclomone , diclomine , metochloromide 10 mg , ondansetron 2 ml , atracurium 10mg/ml , glycopyrolate 0.2mg/ml , neostigmine 0.5mg/ml , neostigmine 2.5mg/5ml , vecuronium bromide 4 mg , succinylcholine 50 mg , amitriphyline 25 mg , salbutamol 100 mg , theophylline+etophylline 50.6mg+169.4mg , finasteride 5 mg , flavoxate 200 , phenazopyridine 5mg , dutasteride 0.5 mg , alkylizer 100 ml , ferrous sulphate+ folic acid 100+0.5mg , amino acid 10% , black disinfectant fluid , phenytoin 50 mg , neloxone 0.4 mg , surgical spirit bp , terlipresin 1mg/10 ml , rivaroxaban 10mg , rivaroxaban 15mg , ketamine injection 50 mg/ml , propofol injection 10 mg/ml , thiopentone injection 0.5 g , lignocaine gelip 2% , lignocaine injection 2% , atropine sulphate injection0.6 mg/ml , midazolam injection ip 1 mg/ml , tramadol capsule 50 mg , tramadol injection 50 mg/ml , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , naproxen tablet ip 500 mg , aceclofenac and paracetamol tablet 100 mg + 325 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg/ml , diclofenac tablet (sr) 100 mg , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , paracetamoltablet 500 mg , paracetamol injection 150 mg/ml , inj diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , paracetamol infusion ip 1% w/v 100ml size , chlorzoxazone,diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , allopurinol tablet 100 mg , dexamethasoneinjection 8 mg/2ml , dexamethasone tablet 0.5 mg , hydrocortisone sodium succinate injection 100 mg base / vial , methyl prednisolone sodium succinate for injection 500 mg , prednisolone tablet 5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , tab dexamethasone ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) , adrenaline injection 1 mg/ml , chlorpheniramine maleate tablet 4 mg , hydroxyzine tablet 25 mg , pheniramine injection 22.75 mg/ml , promethazine injection 25 mg/ml , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml , cetirizine,phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , levoceitrizine tablet 5mg , montelukast 10 mg + levocetrizine 5mg tablet , phenytoin injection 50 mg/ml , phenytoin tablet 100 mg , pregabalin capsule ip 75 mg , sodium valproate oral solution ip 200 mg/ 5 ml , clobazam tablet/capsule 10 mg , gabapentine tablet/capsule 300 mg , amikacin injection250 mg , amikacininjection 500 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxicillin and potassium clavulanate injection1.2 gm , piperacillin and tazobactum for injection 4 gm + 500 mg , inj piperacillin 2 gm + tazobactom 250mg usp , cefepime injection500 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , ceftazidime injection 1 g , ceftriaxone injection ip 1 g/vial , azithromycin tablet 500 mg , ciprofloxacin injection 200 mg/ 100 ml , ciprofloxacin tablet 500 mg , norfloxacintablet 400 mg , ofloxacinand ornidazole tablet 200 mg + 500 mg , aztreonam injection 500 mg , co trimoxazole tablet160 mg + 800 mg , doxycycline capsule 100 mg , linezolid injection 200 mg/100 ml , meropenem injection 500 mg , vancomycin injection 500 mg , aztreonam 1gm injection , metronidazoleinjection 500 mg/ 100 ml , metronidazole tablet 400 mg , fluconazole tablet 150 mg , acyclovir tablet200 mg , bleomycin injection15 units , chlorambucil tablet 5 mg , cisplatin injection 50 mg/ 50 ml , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cytarabineinjection100 mg/5 ml , doxorubicin injection50 mg/ 25 ml , etoposide injection 100 mg/ 5 ml , fluorouracil injection 250 mg/ 5 ml , leucovorin calcium injection 10 mg/ml , methotrexate injection 50 mg/2 ml , paclitaxel injection 260 mg , paclitaxel injection 100 mg , tamoxifen tablet 10 mg , vinblastineinjection 10 mg/10 ml , vincristineinjection 1 mg/ml , carboplatin injection 150mg , carboplatin injection 450mg , cisplatin injection 10 mg/10 ml , dacarbazine injection 500 mg , filgrastim injection 300mcg/ml , gemcitabine injection 200 mg , gemcitabine injection 1gm , ifosfamide injection 1gm , imatinib tablet 400 mg , methotrexate tablet ip 10 mg , mitomycin c injection 10 mg , oxaliplatin injection 50 mg , bendamustine 100 mg , capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) , letrozole usp2.5 mg (each film coated tablet containsletrozole usp2.5 mg) , capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) , inj. bortezomib 2mg , tab abiraterone acetate ip 250 mg(each uncoated tablet contains abiraterone acetate ip 250 mg) , cap thalidomide usp 100 mg(each hard gelatin capsule contains thalidomide usp 100 mg) , inj. bevacizumab 400 mg , inj. bevacizumab 100 mg , tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) , tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) , tab. bicalutamide usp 50 mg(each film tablet contains bicalutamide usp 50 mg) , inj zoledronic acid ip 4mg/100ml 100ml size , tab dasatinib 100 mg , heparin sodium injection 5000 iu/ml , warfarin sod. tablet 5 mg , ethamsylate injection 250 mg/ 2ml , tranexamic acid tablet 500 mg , tab ethamsylate bp 500 mg (each uncoated coated tablet contains ethamsylate bp 500 mg) , inj tranexamic acid ip 100mg/ml 5ml size , rh erythropoetininjection10000 iu , rh erythropoetininjection 4000 iu , humanalbumin solution 20% , dopamine hydrochloride injection40 mg/ml , noradrenaline injection 2 mg/ml , magnesium sulphate injection(50% ) 500 mg/ml , chlorhexidine mouthwash bp 0.20% , clotrimazole mouth paint (clotrimazole 1% w/v) 1% , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , glycerin ip 400 gm , gadodiamide injection0.5 mmol/ml , iohexol usp (solution for injection) non ionic contrastmedium in sterile aqueous solution 350 mg iodine/ml. , compoundbenzoin tinctureip , formaldehyde solution (34.5% 38%) , gentian violet topical solution usp 1% , glutaraldehyde solution 2% , hydrogen peroxide solution 6% , lysol(cresol with soap solution) (cresol 50% + soap 50%) , povidone iodine solution5% , povidone iodine scrub solution / cleansing solution 7.5%w/v povidone iodine 7.5% , povidone iodine ointment 5% , silver sulphadiazine cream 1% , surgical spirit bp , furosemide tablet 40 mg , furosemide injection 10 mg/ml , mannitol injection 20% , spironolactone tablet 25 mg , torsemide tablet 10 mg , antacidliquid , omeprazole capsule 20 mg , pantoprazole injection 40 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , ranitidine hcl injection 50 mg/2ml , ranitidine tablet 150 mg , dicyclominetablet 10 mg , dicyclomineinjection 10 mg/ml , dicyclomine and paracetamol tablet 20mg + 325mg , drotaverine tablet 40 mg , drotaverine hydrochloride injection 40 mg/2ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , metoclopramide injection 10 mg/2ml , metoclopramide tablet 10 mg , domperidone tablet 10 mg , ondansetron orally disintegrating md tablet4 mg , ondansetron injection 2 mg/ml , inj prochlorperazine mesylate 12.5mg/ml 5ml size , bisacodyl tablet 5 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm/15ml , loperamide tablet ip 2 mg , ors powder , sodium phosphates enema bp , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) , ursodeoxycholic acid tablet 300 mg , tab. mesalamine usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) , soluble insulin injection 40 iu / ml , glibenclamide tablet 5 mg , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , olanzapine tablet5 mg , amitriptyline tablets ip 25 mg , alprazolam tablet 0.5 mg , diazepam injection10 mg/ 2ml , lorazepam injection2 mg/ml , tab. zolpidem 5 mg , salbutamol tablet 2 mg , salbutamol syrup ip 2 mg/5ml , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , tab. acebrophylline 100 mg , cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] , cough syrup/ expectorant(ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , compound sodium lactate injection , dextrose injection25% , dextrose injection 5% , potassium chloride injection0.15 gm/ml , potassium chloride oral solution usp500 mg/ 5ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , ringer acetate infusion 500 ml , tamsulosinhcltablet 0.4 mg , flavoxate tablet 200 mg , tab sodium bicarbonate usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) , syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate) , calcium gluconate injection 10% , calcium& vitamin d3 tablet 500 mg + 250 iu , cholecalciferol granules 60,000 iu /1gm , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , folic acidtablet ip 5 mg , iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , pyridoxine tablet40 mg , vitamin b complex tablet nfi (prophylactic) , vitamin b complex injectionnfi , zinc sulphate dispersible ip elemental tablet 10 mg , methylcobalmin tablet 1500 mcg , black disinfectant fluid (phenyl) (as per schedule o grade iii , sodium bicarbonate injection ip 7.5% , water for injection ip , mannitolwith glycerin injection 10% + 10% , tab.morphine , tab.morphine , tab.sunitinib , tab.sunitinib , inj.docetaxel , inj.docetaxel , normal saline(glass bottle) , normal saline(glass bottle) , codon filter , d 5 %(glass bottle) , inj.mitomycin , inj.fludrabine , inj.vinorelbine , inj. mesna , inj ifosphamide with mesna , lenalidamide , codon filter (in line iv filter) , capacity less then 0.22 micrometer , tab.anastrazole , inj.bendamustine , tab.nilotinib , tab.enzalutamide , tab.sunitinib , inj.cytarabine , tab.fludrabine , inj.leuprolide , inj.albumin bound paclitaxel , tab.pilocarpine , cap.nilotinib , tab.enzalutamide , saliva stimulating tablets , inj.degaralix , inj.degaralix , tab.afatinib , inj.transtuzumab , inj.irinotecan , tab.lenolidomide , tab.lenolidomide , inj.liposomal doxorubicin , tab.sorafenib , inj.pemetrexet , inj.pemetrexet , inj.romiplostine , normal saline(glass bottle) , normal saline(glass bottle) , inj.mesna , d 5 %(glass bottle) , tab. granisetron , tab.aprepitanat , tab.aprepitanat , tab.ceritinib , inj.cabazitaxel , inj.epirubicin , tab.etoposide , tab.cyclophosphamide , in. fulvastrant , syp.lignocaine viscus , tab.methotrexate , inj.nandrolone , tab.everolimus , tab.febuxostate , ribociclib , tab.lapatinib , pemetrexed , cytarabine , bone marrow aspiration needle 18g , true cut needle biopsy gun with needle , xylocane 2 % (i.v. use)50 ml vial , xylocard 50 ml 2% , midorine 2.5 mg , chlordiazepoxide 10 mg , drotaverine tablet 40 mg , butrum , buscopan , paraffin , peglec powder , bisacodyl tablet 5 mg , thiamine , isphagulla husk , obleticholic acid 10mg , levofloxacin 500 mg , isphagulla , clonidine 150mg , alpha ketoanalouge , taurine + acetylcysteine 1mg , nefedipine 10 mg , tab teneligliptin 20mg , glimepride 5 mg , itraconazole200 mg , amino acid , methyl prednisolon 1gm , methyl prednisolon 500 mg , losartan 50 mg , telmisartan 40 mg , telmisartan 20 mg , telmisartan 80 mg , digoxin 0.25 , clopidogrel 75 mg , vymada 50 mg , vymada 100 mg (sacubitril+valsartan) , thrombophob ointment , faropenem 200 mg , nicorandil 48 mg , nicorandil 5 mg , ivabradine 5 mg , parasugrel 10 mg , ticagrelor 90 mg , multiple electrolyte isotonic crystaloid, calcium free and lactate free with high balance base excess sloution with ph. of 7.2 to 7.4, osmolarity 292 to 294 in double sterilized closed system polyolefin 1000 ml freeflex bag with both temper evident cap. , paracetamol infusion in double sterilized closed system polyolefin 50 ml freeflex bag with both temper evident cap. , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 38 gm of amino acid with taurine advantage npe ratio 113:1 peripheral line 1000 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 46 gm of amino acid with taurine advantage npe ratio 108:1 peripheral line 1500 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 50 gm of amino acid with taurine advantage npe ratio 113:1 central line 1000 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 75 gm of amino acid with taurine advantage npe ratio 108:1 central line 1500 ml , amino acid 8% 500 ml , multiple electrolyte isotonic crystaloid, calcium free and lactate free with high balance base excess sloution with ph. of 7.2 to 7.4, osmolarity 292 to 294 in double sterilized closed system polyolefin 500 ml freeflex bag with both temper evident cap. , omega 3 fatty acid 50 ml , paracetamol infusion in double sterilized closed system polyolefin 100 ml freeflex bag with both temper evident cap. , tegadrem (10x12 cm) 8526in...

Medical Health And Family Welfare - Rajasthan

33338962 supply of medicine items in govt hospital nathdwara supply of medicine items in govt hospital nathdwara , category : drug , budesonide 1ml respule , budesonide 200 mcg. , diltiazem 2%p / r gel , enterogermina 2billion spores 5mlrespule , esmoprazole 10mg granules , estradiolvalerate cream , fluticasone , formeterol 20mcg +budesonide 0.5mg respule , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , glycopyrronium 25mcg. inhalation 2ml. respule , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml respule , minoxidil 2%lotion , multi vitamin syrup , nifedipine + lidocaine p / r gel , povidone iodine gargle , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride 3 % respule , sodium chloride bottel 100ml , syrup l carnitine 500mg / 5ml in 30 ml , tiotropium + glycopyrolate 25mg , tiotropium bromide dry powder30 / pack respule , ( medium chain triglyceride ) oil , / susp. azithromycin oral suspension 100mg / 5ml , / susp. azithromycin oral suspension 200mg / 5ml , 1.5% hydrogen peroxide mouthwash , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , aceclofenac and paracetamol tablet 100 mg + 325 mg , acenocoumarol tablet 2 mg , acetazolamide tablet 250 mg , act kit containing 3 tablet of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg , act kit containing 3 tablet of artesunate ( 50mg each ) and 1tablet of sulphadoxine pyremethamine ( 500+25 ) mg , act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyremethamine ( 500+25 ) mg each , act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and 1 tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir injection250 mg , acyclovir injection500 mg , acyclovir suspension400 mg / 5ml , acyclovir tablet200 mg , acyclovir tablet 800 mg , adenosine injection6 mg / 2ml , adrenaline injection 1 mg / ml , albendazole oral suspension 400 mg / 10 ml , albendazole tablet ip 400 mg , alendronate sodium tablets usp / bp 35 mg , allopurinol tablet 100 mg , alpha interferon injection 3 million unit , alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , amikacininjection100 mg , amikacininjection 500 mg , amikacin injection250 mg , aminophylline injection25 mg / ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg / ml , amitriptyline tablets ip 25 mg , amlodipine and atenolol tablet 5 mg +50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin oral suspension ( dry syrup ) 125 mg / 5ml , amoxycillin trihydrate dispersible tablet 125 mg , amphotericin b injection 50 mg , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , antacidliquid , antacid tablet , anti a blood grouping serum ( anti a monoclonal serum ip ) , anti b blood grouping serum , anti drh blood grouping serum , anti inhibitor coagulation complex [ human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu ] , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg / 5ml , artemether + leumefantrine tablet ( 40 mg and 240 mg ) , artemether + leumefantrine tablet ( 80 mg and 480 mg ) , artificial saliva solution , artisunate injection 60 mg ( combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17%lotion , ascorbic acid tablet 500 mg , aspirintablet ip ( gastro resistant ) 150 mg , aspirin delayed release tablet ( enteric coated ) 75 mg , atenolol tablet 25 mg , atenolol tablet 50 mg , atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , atracurium injection 10 mg / ml , atropine eye ointment 1% , atropine sulphate injection0.6 mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tablet ip 50 mg , azithromycin 1% eye ointment , azithromycin tablet ( dt ) 100 mg , azithromycin tablet 500 mg , azithromycin tablet ip 250 mg , aztreonam 1gm injection , aztreonam injection 500 mg , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , beclomethasone inhalation 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , benzathine benzylpenicillin injection 6 lac units , benzathine benzylpenicillin injection ip12 lac units , betahistine tabletip 8 mg , betahistine tablet ip 16 mg , betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , betamethasone sodiumphosphate injection 4 mg / ml , betamethasone tablet 0.5 mg , betaxolol eye drops 0.50% , biphasic isophane insulin injection30 / 70 ( 30% soluble insulin &70% isophane insulin ) 40 iu / ml , bisacodyl tablet 5 mg , black disinfectant fluid ( phenyl ) ( as per schedule o grade iii , bleomycin injection15 units , brimonidine tartrate and timolol eye drops0.15% + 0.5% , bromocriptine mesylate tablet2.5 mg , budesonide 0.5mg / ml respule , budesonide 400 mcg , budesonide nebulizer suspension0.25 mg / ml , budesonide rotacap 200 mcg , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , caffiene citrate oral solution , calamine lotion ip , calcitriol capsule0.25 mcg , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu ) , calcium gluconate injection 10% , cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , cap. acitretin 10 mg , cap. acitretin 25 mg , cap. alectinib 150 mg ( monopoly ) , cap. all trans retinoic acid 10 mg , cap. alpha+lipoic acid + leycopen +multivitamin and miltiminerals , cap. anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , cap. aprepitant 125 mg , cap. budesonide 9 mg , cap. calcium dobesilate 500mg , cap. ceritinib 100 mg , cap. ceritinib 200 mg , cap. ceritinib 250mg , cap. ceritinib 50 mg , cap. clomipramineip 25 mg , cap. cyclosporine 100 mg , cap. d penicillamine 250mg , cap. danazol 100mg , cap. eveningprimosa 1000 mg , cap. glucosamine + hydrochloride +methylsulfonylmethane , cap. indacaterol andglycopyronium inhalation powder110 / 50 mcg , cap. isotretinoin 10mg , cap. isotretinoin 20 mg , cap. lomustine 40 mg , cap. l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , cap. minocycline 100mg. , cap. mycophenolate mofetil 500mg , cap. netupitant + palonosetron 300 mg + 0.5 mg , cap. rabeprazole +levosulpiride , cap. racecadotril 100mg , cap. ramiprilip 5 mg , cap. rucaparib300 mg , cap. rucaparib 200 mg , cap. silodosin 4 mg , cap. silodosin 8 mg , cap. temozolamide 250 mg , cap. trametinib 0.5mg + davarafenide 150mg ( monopoly ) , cap. vitamin a 25000 iu , cap. vitamin e 400 mg , capsuleprocarbazine hydrochloride usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , capsule lomustine ip 40 mg ( each capsule contains lomustine ip 40 mg ) , capsule mycophenolate mofetil usp 250 mg ( each capsule conatin mycophenolate mofetil usp 250 mg ) , capsule tacrolimus ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg / 5 ml , carbimazole tablet 5 mg , carboplatin injection 150mg , carboplatin injection 450mg , carboprosttromethamine injection0.25 mg / ml , carboxymethylcellulose sodium lubricant eyedrops 0.50% , cefepime injection500 mg , cefixime oral susp ( drops ) 25 mg / ml , cefixime tablet 100 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection 250 mg , ceftriaxone injection ip 1 g / vial , ceftriaxone injection ip 500 mg / vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5ml , cephalexin tablet ( dt ) 125 mg , cetirizine syrup 5 mg / ml , cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetrimide cream ip 0.50% , chlorambucil tablet 5 mg , chloramphenicol0.5% eye ointment , chloramphenicol +polymycin eye ointment , chloramphenicol +polymycine + dexamethasone eye ointment , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops 0.05% , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash bp 0.20% , chloridazepoxide tablets ip 10 mg , chloroquine phosphate injection 40 mg / ml , chloroquine phosphate suspension 50 mg / 5ml , chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) , chlorpheniramine maleate tablet 4 mg , chlorpromazineinjection ip 25 mg / ml , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip50 mg , chlorpromazinetablets ip 25 mg , chlorzoxazone, diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , cholecalciferol granules 60, 000 iu / 1gm , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , ciprofloxacin eye drops0.30% , ciprofloxacin injection 200 mg / 100 ml , ciprofloxacin ophthalmic ointment 0.30% , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , cisplatin injection 10 mg / 10 ml , cisplatin injection 50 mg / 50 ml , clindamycincapsule 150 mg , clindamycin capsule 300 mg , clindamycin phosphate gel usp 1% , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol cream 0.05% , clobetasol+salicylic acid 0.5%+6% , clomiphene tablet 50 mg , clomiphene tablet ip 25 mg , clonazepam tablet 0.5 mg , clopidogrel and aspirin tablet 75 mg +75 mg , clopidogrel tablet ip 75 mg , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , clotrimazole 1%+beclomethasone 0.25% lotion , clotrimazole 10mg lozenses , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1% w / v ) 1% , clotrimazole vaginal tablet 500 mg , cloxacillin sodium injection 500 mg , coal tar 6% & salicylic acid 3% onitment , coloplast60 gm paste , compoundbenzoin tinctureip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , compound sodium lactate injection , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , conjugated estrogen tablet 0.625 mg , continuous ambulatory peritoneal dialysis fluid 2 ltr , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet160 mg + 800 mg , co trimoxazole tablet40 mg + 200 mg , cough syrup [ each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg ] , cough syrup / expectorant ( ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , creamlidocaine 25 mg + prilocaine25mg , cream / ointment ( modified lanolin ) , cream aloe vera moisturizing , cream amophous hydrogel with colloid silver wound dressing , cream amorolfine 0.25% , cream azelaic acid 20% , cream benzoyl peroxide 2.5 % , cream desonide0.05% , cream fenticonazole 2% , cream glycolic acid 6% , cream hydrocortisone 1% , cream hydroquinone 2% , cream kojic acid 2%, arbutin, niacinamide , cream luliconazole 1% , cream mometasone 0.1 % , cream mometasone 2% , cream mupirocin usp 2% ( each gram contains 21.5 mgmupirocin calcium usp in a mineral oil cream base ) 15 gm size , cream permethrin 1%rinse , creamneomycin sulphate cream , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg / 5 ml , dacarbazine injection 500 mg , danazol capsule ip 50 mg , daunorubicininjection 20 mg , deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) 500 mg , dexamethasoneinjection 8 mg / 2ml , dexamethasone tablet 0.5 mg , dextromethorphan hydrobromide syrup 13.5 mg / 5ml , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic stip for sugar, ketone , diagnostic stip for sugar, protein , diatrizoate meglumine and diatrizoate sodium inj usp60% ( iodine conc.292 mg / ml ) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w / v ( iodine conc.370 mg / ml ) 76% , diazepam injection10 mg / 2ml , diazepam tablet 5 mg , diclofenac each transdermal patch contain 200 mg diclofenac , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg / ml , diclofenac sodium tablet 50 mg , diclofenac tablet ( sr ) 100 mg , dicyclomineinjection 10 mg / ml , dicyclominetablet 10 mg , dicyclomine and paracetamol tablet 20mg + 325mg , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine hydrochloride oral solution ip10 mg / 5ml , diethylcarbamazine tablets ip 100 mg , digoxin 0.25% elixir , digoxin injection 0.25 mg / ml , digoxin tablet 0.25 mg , diltiazem tablet 30 mg , dinoprostone cream0.5 mg , diphtheria antitoxin 10, 000 iu , dobutamineinjection 50 mg / ml , domperidone oral drops 10 mg / ml , domperidone suspension 5 mg / 5ml , domperidone tablet 10 mg , dopamine hydrochloride injection40 mg / ml , doxorubicin injection50 mg / 25 ml , doxycycline capsule 100 mg , dried factor viii fraction ( iv use ) 1000 iu , dried factor viii fraction ( iv use ) 250 iu , dried factor viii fraction ( iv use ) 500 iu , dropdiastasepepsin with simethicone 15 ml , drop ambroxol , drop anticold , drop astyminec ( vitamin c+ essential amino acid ) , drop cefpodoxime oral suspension 20mg / ml , drop docosahexaenoic 30ml , drop enzyme , drop furosemide 10mg / ml , drop hydroxyzine oral solution 15 ml , drop iron ( ferrous ascorbate ) , drop ondansetron oral solution 30 ml , drop simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , drop terbutalin , drop vitamin – e50mg / ml, 400 iu , drop vitamin d3 400iu / ml , drop vitamin d3 800iu / ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , drotaverine hydrochloride injection 40 mg / 2ml , drotaverine tablet 40 mg , ear dropacetic acid otic solution 2% , ear dropgentamycin , eeg 400gm paste , enalapril maleate tablet 10 mg , enalapril maleate tablet 2.5 mg , enalapril maleate tablet 5 mg , enema lactulose , enoxaparin sodium injection 60 mg , escitalopram tablets ip10 mg , ethamsylate injection 250 mg / 2ml , ethinyloestradiol tablet ip 50 mcg , etoposide injection 100 mg / 5 ml , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , eye drop carboxymethylcellulose + glycerin , eye drop moxifloxacin+ difluoprednate , eye drop natamycin opthalmic suspension 5% , eye drop olaptadine & ketorolac , eye drop polymyxin b 10000iu / gm + neomycin 3400iu / gm , eye dropbetadin 5% , eye dropbrinozolamide+brimonidine , eye dropcpm+cmc+nephazoline , eye dropcyclopentolate 1% , eye dropdorzolamide 2% , eye dropfluromethalone 0.1% , eye dropgatifloxacin+prednisolone , eye drophpmc 0.3% , eye dropitraconazole 1% , eye droploteprednol 0.25% , eye dropmoxifloxacin 0.5%+ketorolac tromethamine 0.5% , eye dropmoxifloxacin and dexamethasone , eye dropmoxifloxacin and prednisolone , eye dropnepafenac 0.1% , eye dropoloptadine opthalmic solution0.1% , eye droppilocarpine , eye dropprednisolone acetate opthalmic suspension 10 ml , eye dropproparacaine 0.5% w / v , eye dropsodium chloride 5 % , eye dropsulfacetamide 20% , eye droptravapost+timolol , eye droptropicamide+phenylepherine , eye dropvoriconazole , eye drop gatifloxacin 0.3% , eye drop moxifloxacin0.5% w / v ophthalmic solutionip 5ml size , factor – ix concentrate 600 iu , fenofibrate capsule 200 mg , fentanyl 25iu patch , fentanyl 50iu patch , fentanyl citrate injection50 mcg / ml , fentanyl citrate injection50 mcg / ml , feracrylum 1% w / w sterile solution 100 ml , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab. ( paediatric ) 20 mg + 0.1 mg , filgrastim injection 300mcg / ml , finasteride tablet 5 mg , flavoxate tablet 200 mg , fluconazole eye drops0.3% , fluconazole tablet 150 mg , flunarizine tablet 5 mg , fluorouracil injection 250 mg / 5 ml , fluoxetine capsule ip 20 mg , flurbiprofen sodium ophthalmic solution 0.03% , fluticasone ft nasal spray , folic acidtablet ip 5 mg , formaldehyde solution ( 34.5% 38% ) , formetrol 12mcg + budesonide 400 mcg. , formoterol & budesoniderotacap 6 mcg+ 200 mcg , fosfomycin3gm , framycetin sulphate cream 1% , framycetin sulphate cream 1% , furosemide injection 10 mg / ml , furosemide tablet 40 mg , fusidic acid cream2% , gabapentine tablet / capsule 100 mg , gabapentine tablet / capsule 300 mg , gadodiamide injection0.5 mmol / ml , gamma benzene hexachloride lotion ( lindane lotion usp ) 1% , ganciclovir 0.15% eye ointment , gel adaplene ( 0.1% w / w ) , gemcitabine injection 1gm , gemcitabine injection 200 mg , gentamycin injection 80 mg / 2ml , gentian violet topical solution usp 1% , glibenclamide and metformin hydrochloride ( sr ) tablet 5 mg + 500 mg , glibenclamide tablet 5 mg , gliclazideand metformin tablet 80 mg + 500 mg , gliclazide tablets ip 40 mg , glimepiride tablet 1 mg , glimepiride tablet 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sr ) tablet2mg + 15mg + 500mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glipizide tablet ip 5 mg , glucagon injection usp 1 mg / ml , glutaraldehyde solution 2% , glycerin2 gm / ml , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablet 2.6 mg , glycopyrrolate injection 0.2 mg / ml , glycopyrronium 25 , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 50 , griseofulvin tablets 125 mg , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , haloperidol injection 5 mg / ml , haloperidol tablet5 mg , haloperidol tablet 1.5 mg , halothane , hameodialysis bicarbonate solution , heparin 50 iu benzyl nicotinate 2 mg , heparin sodium injection 5000 iu / ml , hmffor pretem , homatropine eye drops 2% , hormonalintra uterine device , humanalbumin solution 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection ( im use ) 300 mcg , human rabies immunoglobulin injection 150 iu / ml , hyaluronidase injection 1500 iu , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , hydrocortisone sodium succinate injection 100 mg base / vial , hydrogen peroxide solution 6% , hydroxychloroquine sulphatetablet 200 mg , hydroxyethyl starch ( 130 / 4 ) 6% w / vwith sodium chloride 0.9% w / v intravenous infusion , hydroxyprogesterone injection 250 mg / ml , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg / ml , hydroxyzine tablet 25 mg , hyoscine butylbromide injection ip 20 mg / ml , hyoscine butylbromide tablet 10 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen oral suspension 100 mg / 5ml , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ifosfamide injection 1gm , imatinib tablet 400 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , indomethacin capsule 25 mg , injbendamustine 100 mg , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg / 500mg ip powder for solution , inj colistimethate ip 1m iu powder for solution , inj diclofenac sodium aqueous 75mg / ml1ml size, iv & im use , inj human chorionic gonadotropin ip 5000 i.u. , inj meropenem ip 250 mg , inj piperacillin 2 gm + tazobactom 250mg usp , inj poractant alpha 80 mg / ml in pack of 1.5 ml , inj prochlorperazine mesylate 12.5mg / ml 5ml size , inj tranexamic acid ip 100mg / ml 5ml size , inj zoledronic acid ip 4mg / 100ml 100ml size , inj.docetaxel 20mg , inj.docetaxel 80 mg , inj.etanercept 25mg / 0.5ml , inj.folinic acid 200mg / vial , inj.sodium chloride 3% 100ml , inj. acth synacthen 250 mcg , inj. adalimumab 40 mg , inj. ado trastuzumab 100 mg , inj. ado trastuzumab 160 mg , inj. alpha beta arteether 2 ml , inj. amino acid 10% 100ml size , inj. aminocaproicacid 20ml , inj. amoxycillin & clavulanic acid 300 mg , inj. ampicillin + salbactum 1.5g , inj. artesunate 120 mg , inj. atezolizumab 1200 mg ( monopoly ) , inj. avelumab 200 mg ( monopoly ) , inj. azacitidine 100mg , inj. azacitidine 50mg , inj. azithromycin 10 ml vial equaivelent to 500 mg , inj. bacitracin for injection 25, 000 iu , inj. bevacizumab 100 mg , inj. bevacizumab 400 mg , inj. bortezomib 2.5 , inj. bortezomib 2mg , inj. botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , inj. botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , inj. busulfan 60mg / 1ml , inj. butorphanol tartrate usp 1mg / ml 1ml size , inj. cabazitaxel 20 mg , inj. cabazitaxel 40 mg , inj. caffeine cirate 20mg / ml , inj. caffeine citrate usp 20mg / ml ( equivalent to 10 mgcaffeine base / ml ) 3ml size , inj. calcium chloride 5ml vial , inj. calcium gluconate / folinate , inj. carbetocin 1ml / 100micro. , inj. carfilzomib 20 mg , inj. carfilzomib 60 mg , inj. carmustine 100 mg , inj. caspofungin 50 mg , inj. caspofungin 70 mg , inj. cefipime 1000mg + tazobactum 125mg , inj. cefoperazone 1gm+tazobactum 125mg , inj. cefoperazone 1mg inj. , inj. cefoperazone 500mg , inj. ceftazidime 1gm+sulbactam500 mg , inj. ceftazidime+ avibactum 2gm+500mg , inj. ceftizoxime 1 gm , inj. ceftriaxoneip 125 mg , inj. ceftriaxone +salbactum+ disodium edta , inj. ceftriaxone 1 gm + tazobactum 1.25 gm , inj. ceftriaxone and sulbactam 1.5g , inj. ceftriaxone1000mg+ tazobactom125mg , inj. cefuroxime 1gm , inj. cetrorelix acetate 0.25 mg , inj. cetuximab 100 mg , inj. cetuximab 500mg , inj. chloramphenicol 1gm / vial , inj. cis atracurium besylate 2 mg / ml in 5 ml vial , inj. cladrabine 10 mg , inj. clarithromycin 500mg , inj. clindamycin600mg / 4ml , inj. clonidine 150mcg / ml , inj. compound sodium lactate ( ringer lactate ) in glass bottle 500ml , inj. crystilline penicillin 2 lakh , inj. cytarabine 1000 mg , inj. dacarbazine 200 mg , inj. daratumumab 100 mg ( monopoly ) , inj. daratumumab400 mg ( monopoly ) , inj. darbepoietin alfa 100mcg , inj. darbepoietin alfa 200 mcg , inj. darbepoietin alfa 500mcg , inj. decitabine 100 mg , inj. decitabine 50 mg , inj. degarelix 120 mg , inj. degarelix 80 mg , inj. degludec insulin 300iu / 3ml , inj. denosumab 120 mg , inj. deriphylline 1 ampul , inj. detemir insuline , inj. dexmedetomidine 100mcg / ml , inj. dextran 40 , inj. dextrose 5% 500 mlglass bottle , inj. diazoxide 300 mg / 20ml , inj. digoxin 2mg , inj. diltiazem 25 mg , inj. distilled water 10ml , inj. docetaxel 120 mg , inj. doxycycline for injection 100 mg , inj. durvalumab 120 mg ( monopoly ) , inj. durvalumab 500mg ( monopoly ) , inj. enalapril1.25 mg 1 ml , inj. ephedrine 30 mg / ml , inj. epirubicin 150mg / ml , inj. epirubicin 50mg / ml , inj. eribulin 0.5mg , inj. eribulin 1 mg , inj. ertapenem sodium 1gm = ertapenem 1.046 gm , inj. esmolol hydrochloride 10mg / ml 10ml size , inj. etomidate 20 mg , inj. etomidate mct / lct 10ml vial , inj. ferric carboxymaltose 50 mg / ml 10 ml size , inj. fluconazole 100mg , inj. fluconazole 200 mg , inj. fludarabine phosphate injection 50mg , inj. fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , inj. fluphenazine deconate injection ( long acting ) 25mg / ml ampule , inj. folic acid +methylcobalamine 10 ml pack , inj. fondaparinux 2.5mg , inj. fosphenytoin sodium 150mg / ml , inj. fsh 150 iu , inj. fsh 75 iu , inj. fulvestrant 250mg , inj. ganciclovir sodium 500mg ( lyophilized powder forreconstitution ) , inj. gdw 5% glass bottle / 500ml , inj. glyceryl trinitrate injection, diluted 5mg / ml , inj. goserelin acetate implant 3.6 mg , inj. haemocoagulase1 ml , inj. haloperidol ( long acting ) 50mg / ml ampoule , inj. hepatitis b immunologlobin ip 100 i.u , inj. horse atg ( anti thymocyte globulin ) 250 mg , inj. hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , inj. hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , inj. human albumin 20% in 50 ml vial , inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml ( 0.5 gm ) 100 mg , inj. hydralazine 20mg / ml , inj. indomethacin lyophilized powder 1mg , inj. inotuzumab1 mg ( monopoly ) , inj. insulinaspart , inj. insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , inj. insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , inj. insulin glargine300 iu per ml / prefilled pen , inj. insulin lispro , inj. insuline 50 / 50 , inj. interferon beta 1 a 30mg , inj. intralipds , inj. invert sugar 10% ( fructodex 10% ) 500 cc , inj. iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , inj. ipilimumab 50 mg , inj. irinotecan 100 mg / 5ml , inj. irinotecan 40mg / 5ml , inj. isolyte g , inj. isolyte p 10% 500 ml , inj. lacosamide infusion , inj. levobupivacaine 0.5% ( 20mg / 4ml ) ampule , inj. levofloxacine 500mg / 100 ml , inj. levosulpride 12.5 mg / ml , inj. lidocaine1% intra cameral , inj. lignocaine ( preservative free ) 2% , inj. lignocaine + adrenaline ( 1:10000, 2:10000 ) , inj. lignocaine 10% spray , inj. lignocaine hydrochloride 2% 50ml vial , inj. liposomal doxorubicin 20mg , inj. liposomol amphotericine b 10 mg , inj. liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , inj. lorazepam5 mg , inj. lorazepam 1.0 mg , inj. l orinithine l aspartate 10 ml , inj. low molecular wt. heparin 0.4mg , inj. mephentermine 50mg / ml , inj. meropenem 2gm , inj. mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , inj. methotrexate 1000 mg , inj. methotrexate 250 mg , inj. methylene blue , inj. methylprednisolon acetate40mg , inj. methylprednisolon acetate 125mg , inj. metoprolol 5ml vial , inj. metotrexate 15mg ( preservative free ) , inj. midazolam 5mg / ml 1 ml , inj. milrinone 10 mg , inj. mitomycin 2 mg , inj. mitomycin 40 mg , inj. mitoxanthrone infusion 10 mg , inj. mitoxanthrone infusion 20mg , inj. moxifloxacin intra cameral 0.5% , inj. moxifloxin 400mg / 100ml , inj. multivitamin 10 ml , inj. n butyl alcohol 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , inj. nabpaclitaxel ( paclitaxel nano particle ) 100 mg , inj. nandrolone decanoate 100mg , inj. nandrolone decanoate 50 mg , inj. natalizumab 300 mg ( monopoly ) , inj. neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , inj. netilmycin 300mg / 3ml , inj. nicardipin 10mg , inj. nicorandil 48 mg , inj. nimodipine infusion 10mg / 50 ml , inj. nimotuzumab 50 mg , inj. nivolumab 100 mg ( monopoly ) , inj. nivolumab 40 mg ( monopoly ) , inj. normal saline 1000 mlglass bottle , inj. normal saline 500 mlglass bottle , inj. octreotide 100mg , inj. octreotide lar ( long acting release ) 20 mg , inj. octreotide lar ( long acting release ) 30 mg , inj. omalizumab 150 mg vial , inj. ornidazole 500mg , inj. palonosetron 0.25mg , inj. paracetamol infusion 1000 mg with both temper evident caps spray 10% , inj. paracetamol infusion 500 mg with both temper evident caps spray 10% , inj. peg asparaginase 3750 iu 5 ml , inj. peg filgrastim injection 6mg , inj. pembrolizumab 50 mg ( monopoly ) , inj. pembrolizumab100 mg ( monopoly ) , inj. pemetrexed 100mg , inj. pemetrexed 500 mg , inj. pertuzumab 100 mg , inj. phenylephrine hydrochloride10 mg / ml , inj. pilocarpine 0.5% w / v , inj. piperacillin 1 gm + tazobactum 125 mg , inj. piracetam 200mg , inj. placental extract 2ml , inj. plerixafor 24 mg , inj. polymixin sulphate b usp 5 lac i.u. , inj. potassium chloride for injection , inj. progesterone injection 50 , inj. prostaglandin 500mcg / ml , inj. protamine sulphate 5ml , inj. rabbit atg ( anti thymocyte globulin ) 250 mg , inj. rabbit atg ( anti thymocyte globulin ) 100 mg , inj. ramucirumab 100 mg ( monopoly ) , inj. ramucirumab 500 mg ( monopoly ) , inj. ranizumab 10mg / ml , inj. rasburicase 1.5 mg , inj. recombinant fsh 150 iu , inj. recombinant fsh 300iu , inj. recombinant hcg 250 iu , inj. recombinant human growth hormone 4iu vial with syringe , inj. recombinant lh 75iu , inj. reteplase 18 mg , inj. risperidone prolonged releaseddepot 25 mg , inj. risperidone prolonged releaseddepot 50mg , inj. rituximab500 mg , inj. rituximab 100 mg , inj. rocuronium 100mg / 10ml , inj. romiplostim 125 mcg , inj. romiplostim 250 mcg , inj. romiplostim 500 mcg , inj. ropivacaine 0.75% 20ml vial , inj. ropivacaine 0.75% 3 ml ampule ( heavy ) , inj. secukinumab 150 mg , inj. sildenafil 0.8mg , inj. sodium bicarbonate injection , inj. sodium chloride and dextrose0.45% infusion 500ml , inj. sodium fluroresceinedye 20% , inj. sodium hyaluronate 1.4mg , inj. sodium nitroprusside25mg / ml2ml size , inj. streptomycin1gm , inj. streptomycin500mg , inj. sugmadex , inj. teicoplanin 200 mg , inj. teicoplanin 400 mg , inj. tenecteplase 20mg , inj. tenecteplase 40 mg , inj. tetanus vaccine ( adsorbed ) ip in 0.5 ml , inj. thiamine 100ml , inj. ticarcillinand clavulanic acid , inj. tigecycline for injection 100mg , inj. tigecycline for injection 50mg , inj. tobaramycin 80mg , inj. topotecan 2.5 mg , inj. topotecan 4 mg , inj. topotecan1 mg , inj. t pa 20mg alteplase for injection , inj. t pa 50mg alteplase for injection , inj. trabectedin 1 mg , inj. tranexamic acid 500mg / 5ml , inj. trastuzumab 440 mg , inj. trastuzumab150mg , inj. triamcinolone acetonide 10 mg per ml , inj. triamcinolone acetonide 40 mg per ml , inj. triptorelin 0.1 mg , inj. triptorelin 11.25 mg , inj. triptorelin 3.75 mg , inj. trypan blue 0.6% , inj. varicella immunoglobulin for iv use , inj. vasopressin 3ml , inj. verapamil2.5 mg / ml , inj. vinorelbine 10mg , inj. vinorelbine 50mg , inj. vitamin d ( 600000 iu ) , inj. voriconazole200mg / vial , inj.dextrose with sod.chloride polypack 5% 500ml , inj.fludarabine phosphate injection 100mg , inj.inj. liposomal doxorubicin 50 mg , inj.polymyxin b for injection 1 million , inj.procaine penicillin fortified 2 lack , inj.testosteron propionate 250mg , inj.testosteron propionate 50mg , insulin glargine100 iu / mlwith 30 insulin syringes with needle , insulin glargine 100 iu / ml with 15 insulin syringes and needles / cartridge 100 iu / ml with 15 needles and 1 pen per 20 cartridges , intravenous fat emulsion 20% w / v ( pl / tg ratio 0.06 ) 250ml , iohexol ( non ionic contrastmedium in sterile aqueous solution ) 300 mg iodine / ml. , iohexol usp ( solution for injection ) non ionic contrastmedium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium rotacap40 mcg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg / ml usp / bp 20 mg / ml ( for iv use ) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , isoflurane , isophane insulin injection40 iu / ml , isoprenaline injection 2mg / ml , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , isoxsuprine injection 5 mg / ml , isoxsuprine tablet 20 mg , itraconazole 1% eye ointment , itraconazole capsule 100 mg , ketaconazole 2% lotion , ketamine injection 50 mg / ml , ketoconazole cream 2% , labetalol hydrochloride injection 20 mg / 4ml , labetalol tablet 100 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm / 15ml , l arginine+proanthocynadine granules 3mg , l asparaginase injection 10000 iu , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , leucovorin calcium injection 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500 mg / 5ml , levetiracetam oral solution suspension 100 mg / ml , levetiracetam tablet 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , levofloxacin tablet250 mg , levosalbutamol 100mcg+ ipratropium bromide 40mcg , levosalbutamol inhalation solution 50ml / gm , lidocaine10%20ml spray , lidocaine hydrochloride topical solution usp 4% , lignocaineointment 5% , lignocaine 1% mouth paint , lignocaine 4%30ml , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , lignocaine gelip 2% , lignocaine injection 2% , lignocaine viscous , linezolid injection 200 mg / 100 ml , linezolid tablet ip 600 mg , liquid paraffin ip , liquid paraffin ip , lisinopril tablet 10 mg , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lithium carbonate tablet 300 mg , loperamide tablet ip 2 mg , lorazepam injection2 mg / ml , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , losartan tablet 25 mg , losartan tablet 50 mg , lysol ( cresol with soap solution ) ( cresol 50% + soap 50% ) , magnesium sulphate injection ( 50% ) 500 mg / ml , magnesium sulphate, sulphacetamide, urea 75 gm , mannitolwith glycerin injection 10% + 10% , mannitol injection 20% , mecobalamin injection 500 mcg / ml , medroxyprogesterone acetate tablet ip 10 mg , mefenamic acid tablet 500 mg , mefloquine tablet250 mg , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , mercunium chloride paint , meropenem injection 1 g , meropenem injection 500 mg , mesalazine , metformin hydrochloride ( sr ) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride ( sustained release ) and glimepiride tablet500 mg + 2 mg , metformin hydrochloride sr tablet 1000 mg , metformin tablet 500 mg , methotrexate injection 50 mg / 2 ml , methotrexate tablet 2.5 mg , methotrexate tablet ip 10 mg , methyl prednisolone sodium succinate for injection 500 mg , methylcobalmin tablet 1500 mcg , methylcobalmin tablet 500 mcg , methyldopa tablet 250 mg , methylergometrine injection 0.2 mg / ml , methylergometrine tablet ip 0.125 mg , metoclopramide injection 10 mg / 2ml , metoclopramide syrup 5 mg / 5ml , metoclopramide tablet 10 mg , metoprolol suscinate tablet ( extended release ) usp 50 mg , metoprolol tablet ip 25 mg , metronidazoleinjection 500 mg / 100 ml , metronidazole and chlorhexidine gel 1%+ 0.25% , metronidazole benzoate oral suspension 100 mg / 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , miconazole nitrate cream2% , midazolam 0.5mg / 5ml nasal spray , midazolam injection ip 1 mg / ml , midodrine 5mg , mifepristone tablet200 mg , milk low birth formula powder , minoxidil 10 % lotion , minoxidil 5% lotion , misoprostol tablet 200 mcg , mitomycin c injection 10 mg , montelukast 10 mg + levocetrizine 5mg tablet , morphine sulphate injection ip 10 mg / ml , moxifloxacin0.5% eye ointment , multiple electrolytes & dextrose injection type iip ( electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip ( electrolyte m injection ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , n acetylcystine injection 200 mg / ml , n acetylcysteine ( nac ) 200mg / ml respule , naloxone injection ip 0.4 mg / ml , naproxen tablet ip 250 mg , naproxen tablet ip 500 mg , natural micronisedprogesteron soft gelatin capsule 200 mg ( each soft gelatin capsule containsprogesteron ip 200 mg ) , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , neomycin, polymixin b & hydrocortisone ear drops / otic solution usp ( neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml ) , neostigmine injection 2.5 mg / 5ml , neostigmine injection ip 0.5 mg / ml , neostigmine tablets ip 15 mg , nifedipine capsule 5 mg , nifedipine tablet ( sustained release ) 10 mg , nitrofurantoin tablet 100 mg , nitroglycerininjection 5 mg / ml , noradrenaline injection 2 mg / ml , norethisterone tablet 5 mg , norfloxacintablet 400 mg , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin injection 200mg / 100 ml , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin suspension 50 mg / 5 ml , ofloxacin tablet 200 mg , oint. terbinafine 1%w / w ( 10 gm tube ) , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , olanzapine tablet5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v usp ( e / d ) 5ml size , omega 3fatty acid 50ml , omeprazole capsule 20 mg , ondansetron injection 2 mg / ml , ondansetron orally disintegrating md tablet4 mg , ors powder , oseltamivir 30 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate oral suspension ip 12 mg / ml ( each ml contains : 12 mg oseltamivir after reconstitution , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg / ml. ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection 50 mg , oxytocin injection 5 iu / ml , paclitaxel injection 100 mg , paclitaxel injection 260 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , pantoprazole injection 40 mg , paracetamoldrops 150 mg / ml , paracetamolsyrup ip 125 mg / 5ml , paracetamoltablet 500 mg , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , paracetamol infusion ip 1% w / v 100ml size , paracetamol injection 150 mg / ml , pentazocine injection 30 mg / ml , peritonial dialysis solution ip , permethrinlotion 5% , permethrin cream 5% , pheniramine injection 22.75 mg / ml , phenobarbitone injection ip 200 mg / ml , phenobarbitone tablet 30 mg , phenylephrine hydrochloride ophthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection 50 mg / ml , phenytoin oral suspension 25 mg / ml , phenytoin tablet 100 mg , pioglitazone tablet ip 15 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , podophyliin toxin lotion , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride injection0.15 gm / ml , potassium chloride oral solution usp500 mg / 5ml , povidone iodine ointment 5% , povidone iodine ointment 5% , povidone iodine pessary , povidone iodine scrub solution / cleansing solution 7.5%w / v povidone iodine 7.5% , povidone iodine solution10% , povidone iodine solution5% , povidone iodine solution5% , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection 25 mg / ml , prazosin tablet ( extended release ) 2.5 mg , prednisoloneip 50mg , prednisolone sodium phosphate1% eye / ear drop , prednisolone tablet 10 mg , prednisolone tablet 20 mg , prednisolone tablet 5 mg , pregabalin capsule ip 75 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesteroneinjection 200 mg / 2ml , promethazinesyrup ip 5 mg / 5ml , promethazine injection 25 mg / ml , promethazine tablet 25 mg , propofol injection 10 mg / ml , propranolol tablet 40 mg , pyridoxine tablet40 mg , pyridoxine tablet 10 mg , quetiapine tablet ip 25 mg , quetiapine tablet ip 50 mg , quinine dihydrochlorideinjection 300 mg / ml , quinine sulphate tablet 300 mg , rabies antiserum ip ( equine ) ( i.m. / sc use ) 300 units / ml , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose , racecadotril sachet 30 mg , ramipril tablet / capsule 2.5 mg , ranitidine hcl injection 50 mg / 2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , revolizer / rotahaler device , rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , ringer acetate infusion 500 ml , risperidone tablet2 mg , risperidone tablet 1 mg , root canal sealer ( calcium carbonate ) , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution 5 mg / ml , salbutamol syrup ip 2 mg / 5ml , salbutamol tablet 2 mg , salicylic acid 16.7% + lactic acid 16.7% paint , saline nasal solution ( drops ) 0.65% , salmetrol 50mcg+fluticasone 500 mcg , sertraline tablet 50 mg , sevoflurane , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , snake venom anti serum ( polyvalent anti snake venom ) lyophillized , sodium bicarbonate injection ip 7.5% , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride 6% eye ointment , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , sodium phosphates enema bp , sodium valproatetablet 200 mg , sodium valproate ipinjection 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate ( gastro resistant ) ip tablet 500 mg , soluble insulin injection 40 iu / ml , solution carbolic acid 100% in 500 ml , solution carbolic acid 50% in 500 ml , solution desfluraneusp 240 ml bottle , solution glycine irrigation solution 1.5% 3ltr , solution hydrogen 11% + silver nitrate .01% , solution polyethyene glycol with elctrolyte approx 130gm , spironolactone tablet 25 mg , spironolactone tablet 50 mg , streptokinase injection 15 lac units , succinylcholine injection 50 mg / ml , sulfasalazine delayed release tablet 500 mg , sulphur + calamine lotion , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 lotion , superoxidized spray , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical spirit bp , surgical spirit bp , syp. alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , syp. posacozazole 40mg / ml , syrup amlodipine oral solution 1 mg / ml , syrup artemether 40mg + lumefantrine 240 mg 30ml , syrup b. complex , syrup baclofen oral solution 5 mg / ml , syrup calcium phosphate 200 ml , syrup cefaclor each 5 ml contain cefaclor 125 mg , syrup cefixime oral suspension50mg , syrup cefixime oral suspension 100mg , syrup cefpodoxime proxetil oral suspension 100mg , syrup cefpodoxime proxetil oral suspension 50mg , syrup cefuroxime axetil oral suspension 125mg / 5ml , syrup clarithromycin for oral suspension 125mg / 5ml , syrup codienephosphate , syrup cyclosporine oral solution 100mg / ml , syrup cyproheptadine200ml , syrup dextromethorphan hcl + chlorpheniramine , syrup diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , syrup drotavarine , syrup each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , syrup each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , syrup enzyme 100 ml , syrup esomperazole , syrup fluconazole oral suspension , syrup furosemide oral solution 10mg / 30ml , syrup l carnosine 100mg / 5ml in 200ml , syrup levofloxacin oral solution , syrup linezolid 100mg / 5ml in 30ml , syrup mefenamice acid 100mg / 5ml , syrup mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , syrup melatonin 60 ml , syrup montelucast+levocetrizine , syrup nitrofurantoin oral suspension 25mg / 5ml in 100 , syrup ondansetron oral suspension , syrup oxybutynin oral suspension5 ml , syrup phenobarbitone 20mg / 5ml in 100ml , syrup piracetam 500mg / 5ml in 100ml , syrup potassium magnesium citrate , syrup ranitidine oral suspension , syrup rifaximin , syrup sodium bicarbonate oral suspension , syrup sodium picosulphate oral suspension , syrup sorbitol + tricholine citrate , syrup sucralphate , syrup triclofos oral suspension500 mg / 5mlin 30ml , syrup ursodeoxycholic oral suspension 125mg / 5ml in 100ml , syrup zinc oral suspension 20 mg / 100 ml , tab abiraterone acetate ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , tab baclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tab cabergoline ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , tab cyclophosphamide ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , tab dasatinib 100 mg , tab dexamethasone ip 4 mg ( each uncoated tablet containsdexamethasone ip 4 mg ) , tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg ) , tab ethamsylate bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , tab gefitinib ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , tab lacosamide 100 mg ( each film coated tablet contains lacosamide 100 mg ) , tab lamotrigine ip50 mg ( eachsustained releasetablet contains lamotrigineip 50 mg ) , tab letrozole usp2.5 mg ( each film coated tablet containsletrozole usp2.5 mg ) , tab levamisol hydrochloride ip 50 mg ( each uncoated tablet conatinlevamisol hydrochloride ip 50 mg ) , tab oxcarbazepine ip150 mg ( each film coated tablet contains oxcarbazepine ip150 mg ) , tab pyridostigmine usp 60 mg ( each tabletcontains pyridostigmine usp 60 mg ) , tab rosuvastatin 10 mg , tab rosuvastatin ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , tab savelamer carbonate 400 mg ( each film coated tablet containssavelamer carbonate 400 mg ) , tab sodium bicarbonate usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , tab tizanidine hydrochloride ip 2 mg ( each uncoated tabletcontainstizanidine hydrochloride ip 2 mg ) , tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , tab.nicoumalone 3 mg , tab.nicoumalone 4 mg , tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , tab. 6 mercaptopurine 20 mg , tab. acebrophylline 100 mg , tab. acebrophylline sr 200 mg , tab. aceclofenac + thiocolchicoside , tab. aceclofenac sr 200 mg , tab. aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , tab. afatinib 20 mg , tab. afatinib 30 mg , tab. afatinib 40 mg , tab. alendronate sodium 70 mg , tab. alfuzosin 10 mg , tab. alpelisib 150 mg ( monopoly ) , tab. alpelisib 200 mg ( monopoly ) , tab. alpelisib 250 mg ( monopoly ) , tab. amantidine 100mg , tab. amisulpride 50 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , tab. apixaban 2.5 mg , tab. apixaban 5mg , tab. aripiprazole 10 mg , tab. aripiprazole 5 mg , tab. aspirinip 300 mg , tab. aspirin dispresible 325mg , tab. atomoxetin 10 mg , tab. atomoxetin 18 mg , tab. atomoxetin 25 mg , tab. atroxentine 250mg ( trientine hcl ) , tab. axitinib 5 mg , tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) , tab. bilastin 20 mg , tab. biotin 5 mg , tab. bosentan62.5 mg , tab. bosutinib 500 mg , tab. brivaracetam 50mg , tab. buprinorphine 2 mg , tab. calcium acetate 667 , tab. calcium folinate 15 mg , tab. capmatinib 200 mg ( monopoly ) , tab. carbimazole 10 mg , tab. carvedilol 3.125 mg , tab. cefixime + potassium clavulanate 200+125mg , tab. cefpodoxime 200mg , tab. cefpodoxime cv 375 , tab. cefpodoxime proxetil 100mg , tab. cefuroxime axetil500 mg. , tab. chlordiazepoxide 25 mg , tab. chlordiazsepoxide 10 mg + clidinium 25 mg , tab. chlorthalidone 6.25 mg , tab. cholchicine 0.5mg , tab. cilnidipine 20 mg , tab. cilnidipine 5 mg , tab. cilnidipine10 mg , tab. cilostazol 100mg , tab. cilostazol 50mg , tab. clarithromycin 250 mg , tab. clarithromycin 500mg , tab. clonazepam 0.25 , tab. clonazepam 1mg , tab. clonidine hydrochloride usp 0.1 mg ( each tablet contains clonidine hydrochloride usp 0.1 mg ) , tab. clozapine 100 mg , tab. clozapine 25 mg , tab. clozapine 50 mg , tab. coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , tab. cotriamazole 480mgs , tab. cyproheptadine 4mg , tab. cyproterone acetate 2 mg +ethynil estradiol. 035mg , tab. dabigatran 110 mg , tab. dabigatran 150 mg , tab. dabrafenib 50 mg , tab. dacomitinib 15 mg ( monopoly ) , tab. dacomitinib 30 mg ( monopoly ) , tab. dapagliflozin 10 mg , tab. dapoxetine 30 mg , tab. dapsone 100 mg , tab. deflazacort 12 mg , tab. deflazacort 6mg , tab. desvenlafaxine 50mg , tab. diclo & sera& para. , tab. diclofenac + thiocolchicoside , tab. dienogest 2mg , tab. diltiazemprolonged released90mg , tab. dimethyl fumarate 240mg , tab. dimethyl fumarate120 mg , tab. disulfiram 125 mg , tab. disulfiram 250mg , tab. donepezil 5 mg , tab. duloxetine gastro resistant 20 mg , tab. duloxitine gastro resistant30 mg , tab. dutasteride 0.5 mg , tab. dydrogesterone 10mg , tab. eltrombopag 25mg , tab. eltrombopag 50mg , tab. empagliflazone 10mg , tab. empagliflazone 25mg , tab. entacapone 200 mg , tab. entecavir ip 0.5 mg ( each film coated tablet conatinsentecavir ip 0.5 mg ) , tab. enzalupamide 40mg , tab. erlotinib 100mg , tab. erlotinib 150 mg , tab. esomeprazole 40 mg , tab. estradiolvalerate 2 mg , tab. ethynil estradiol 0.02mg+ tab desogestral 0.15mg , tab. etizolam 0.5 mg , tab. etoricoxib+thiocolchicoside ( 60+8 mg ) , tab. exemestane 25 mg , tab. faropenem sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , tab. febuxostat 40 mg , tab. febuxostat 80 mg , tab. fexofenadine120 mg , tab. fexofenadine180 mg , tab. fingolimod 0.5 mg , tab. fludrocortisone 100mcg , tab. flunarizine 10mg , tab. fluvoxamine 100 mg , tab. fluvoxamine 50 mg , tab. folinic acid 15mg , tab. formaline , tab. furosemide 20mg + spironolactone 50mg , tab. glucosamine hydrocloride + diacerin 50 mg , tab. hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , tab. hydrocortisone oromucosal 20 mg , tab. hydrocortisone oromucosal 5 mg , tab. hydrocortisone oromucosal10 mg , tab. ibrutinib 140mg , tab. indomethacin 75 mg sr , tab. inositol + myoinositol 1000mg , tab. ivabradine 5mg , tab. ivermectin 12mg , tab. ivermectin 6 mg + albendazole 400 mg , tab. ivermectin 6mg , tab. ketoconazole 200 mg , tab. ketorolac 10 mg , tab. lacosamide 50 mg , tab. lamotrigine dispersible 100mg , tab. lapatinib 500mg , tab. lenalidomide25mg , tab. lenalidomide 10 mg , tab. lenvatinib 10 mg , tab. lenvatinib 4 mg , tab. levetiracetamip 250 mg , tab. levodopa+carbidopa 125 , tab. levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , tab. levofloxacin 750 mg , tab. levofloxacin ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , tab. levosulpiride 25 mg ( each uncoated tablet containslevosulpiride 25 mg ) , tab. levosulpride 75mg , tab. levothyroxine sodium25 mcg , tab. levothyroxine sodium75 mcg , tab. linaglipitin 2.5mg , tab. linaglipitin 5mg , tab. lopinavir 200mg+ritonavir 50 mg , tab. loratadine 10 mg , tab. lorazepam ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , tab. lorlatinib 100 mg , tab. lorlatinib 25 mg , tab. megestrol acetate 160 mg , tab. melatonin 3 mg , tab. melphalan 2mg , tab. mesalamine usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , tab. methimazole10mg , tab. methimazole5 mg , tab. methotrexate 15mg , tab. methotrexate 7.5mg , tab. methylphenidate 10 mg , tab. methylprednisolone4mg , tab. methylprednisolone 16mg , tab. methylprednisolone 8mg , tab. metolazone 5mg , tab. meverberine 135 mg + chlordiazepoxide 10 mg , tab. midostaurin 25 mg ( monopoly ) , tab. mifepristone25mg , tab. mirabegeron50 mg , tab. mirabegeron 25 mg , tab. mirtazapine 15mg , tab. mirtazapine 7.5mg , tab. montelukast 10 mg , tab. montelukast 4mg , tab. montelukast 5 mg , tab. morphine10mg , tab. morphine30mg , tab. moxifloxacin400 mg , tab. moxonidine 0.2 mg , tab. mycophenolate sodium 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , tab. n acetylecystine effervescent form, orange flavour, 600 mg , tab. naltrexone50 mg , tab. nebivolol 10mg , tab. nebivolol 5mg , tab. nicorandil 5mg , tab. nicoumalone 1 mg , tab. nifidipine 20mg , tab. nifidipine 20mg sr , tab. nilotinib200 mg ( monopoly ) , tab. nilotinib 150 mg ( monopoly ) , tab. nilotinib 300mg ( monopoly ) , tab. nitazoxanide 500mg , tab. nitrazepam 10 mg , tab. nitrazepam 5mg , tab. olaparib 150 mg ( monopoly ) , tab. olaparib 50 mg ( monopoly ) , tab. olmesartan medoxomil 20 mg , tab. orciprenaline 10 mg , tab. osimertinib 80 mg ( monopoly ) , tab. oxazepam 15mg , tab. oxcarbazepine 300mg , tab. oxcarbazepine 450mg , tab. pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , tab. pantoprazole 20mg , tab. paracetomol 650 mg , tab. paroxetine 12.5mg , tab. paroxetine 25mg , tab. pazopanib 200mg , tab. pazopanib 400mg , tab. penicillin v 400mg , tab. pentoxifylline extended release / sr 400mg , tab. perampanel 2 mg , tab. perampanel 4mg , tab. pheniramine 25 mg , tab. phenozopyridine 200mg , tab. pirfenidone 200 mg , tab. pirfenidone 400 mg , tab. piroxicam dt 20mg , tab. pomalidomide 2 mg , tab. pomalidomide 4 mg , tab. posacozazole 100mg , tab. prasugrel 10mg tab , tab. prazosin 5mg , tab. prednisoloneip 40mg , tab. primidone 250 mg , tab. primidone 50 mg , tab. prochlorperazine 5mg , tab. progesterone only pills , tab. propranolol 10mg , tab. propranolol 40 mg sr , tab. propylthiouracil 100 mg , tab. pyridoxine100 mg , tab. ranolazine 500mg , tab. rasagiline1mg , tab. regorafenib 40 mg , tab. repaglinamide 0.5mg , tab. repaglinamide 1mg , tab. ribociclib 200 mg ( monopoly ) , tab. rifampicin 150 mg , tab. rifampicin 450 mg , tab. rifampicin 600 mg , tab. rifaximin 200 , tab. rifaximin 550mg , tab. rivaroxaban 10mg , tab. rivaroxaban 15mg , tab. rivaroxaban 20mg , tab. rizatriptan 10mg , tab. ropinirole 0.25mg , tab. rosuvastatin 10mg + fenofibrate 160mg , tab. ruxolitinib 10 mg , tab. ruxolitinib 15 mg , tab. ruxolitinib 20 mg , tab. ruxolitinib 5 mg , tab. sacubitril 24 mg and valsartan 26 mg , tab. selegiline 5mg , tab. serratiopeptidase 10mg , tab. serratiopeptidase 20 mg , tab. sevelamer carbonate 800 mg , tab. sildenafil 20 mg , tab. sildosin + dutasteride , tab. silymarin 70mg. , tab. sitagliptine + metformin ( 50 / 500 ) , tab. sofosbuvir 400 mg+ velpatasvir 100 mg , tab. solifenacin succinate10 mg , tab. sorafenib 200 mg , tab. sotalol hydrochloride usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , tab. sultamicin 375 mg , tab. sunitinib 12.5 mg , tab. sunitinib 25 mg , tab. sunitinib 50 mg , tab. tacrolimus 1mg , tab. tamsulosin + dutasteride , tab. tapentadol50mg , tab. tegafur + uracil 100 mg , tab. tenofovir 300mg , tab. terbinafine hydrochloride 250 mg , tab. tetrabenazine 25mg , tab. ticagrelor 90mg , tab. tofacitinib 5 mg , tab. tolvapatan 15mg , tab. topiramate50mg , tab. torsemide20mg , tab. tramadol 37.5mg + paracetamol 325mg , tab. trimetazidine 35mg , tab. trimetazidine 60mg , tab. trypsin + rutoside+bromelain , tab. trypsin chymotripsin , tab. ulipristal 5mg , tab. valganciclovir 450 mg , tab. verapamil hydrochloride sustained release 120 , tab. verapamil hydrochloride sustained release 40 , tab. vildagliptin 50mg , tab. voglibose 0.2 mg tab , tab. voglibose 0.3 mg tab , tab. voriconazole 200 mg , tab. warfarin 1mg , tab. warfarin 2mg , tab. warfarin 3mg , tab. zinc 50mg , tab. zolpidem 10mg , tab. zolpidem 5 mg , tab. zonisamide 100 mg , tab. zonisamide 50mg , tab. / cap everolimus 10mg , tab. / cap everolimus 5mg , tab. / cap hydroxyurea 500mg , tab. / cap tacrolimus 0.25 , tab. / capnintedanib 150mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , tab.phenazopyridine 5 mg , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , tamoxifen tablet 10 mg , tamsulosinhcltablet 0.4 mg , telmisartan tablet ip 40 mg , tenaligliptin tablet 20 mg , terbutaline sulphate tablet ip 2.5 mg , tetanus immunoglobulin 250iu , tetanus vaccine ( adsorbed ) ip , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet ( sr ) 400 mg , thiamine tablet 100 mg , thiopentone injection 0.5 g , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , timolol eye drops 0.50% , tinidazole tablet ip 300 mg ( film coated ) , tinidazole tablet ip 500 mg ( film coated ) , tiotropium 9mcg inhaler , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , torsemide injection10 mg / ml , torsemide tablet 10 mg , tramadol capsule 50 mg , tramadol injection 50 mg / ml , tranexamic acid tablet 500 mg , travoprost ophthalmic solution 0.004% , tretenoin cream 0.03% , trifluperazine tablets ip5 mg , trihexyphenidyl hydrochloride tablet 2 mg , tropicamide eye drops 1% , urokinase injection 5 lac unit , ursodeoxycholic acid tablet 300 mg , v moxonidine 0.3 mg , valethamate bromide injection 8 mg / ml , vancomycin for intravenous infusion ip 1 gm , vancomycin injection 500 mg , vdrl antigen ( with +ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4 mg ( freeze dried ) , verapamil tablets ip 40 mg , vinblastineinjection 10 mg / 10 ml , vincristineinjection 1 mg / ml , vitamin a solution 1 lac iu / ml , vitamin b complex injectionnfi , vitamin b complex tablet nfi ( prophylactic ) , vitamin d3 oral solution 60000 iu , vitamin k injection10 mg / ml , vitamin k 1 ( phytomenadione ) 1 mg / 0.5ml injection , warfarin sod. tablet 5 mg , water for injection ip , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , xylocaine lubricating30gm , xylometazolinenasal drops 0.1% , zinc oxide +alo vera +semethicone , zinc sulphate dispersible ip elemental tablet 10 mg , category : surgicals , absorbable gelatin sponge ip 66, size 80 ( + 10 ) mm x 50 mm x 10 mm should be sterlized. , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824 ( part 3 ) :1996 , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered, , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic •shouldconform to is 13422 •isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards , suction catheter, sterile. size: fg 5 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 6 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 8 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 10 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 12 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 14 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 16 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 18 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 20 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 22 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size 8 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is 11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size10 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size16 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size18 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size20 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size22 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 •color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size 24 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , infant feeding tube size:10fg length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:8fg, length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:5fg length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , sterile disposable perfusion set with airway and needle ( adult use ) • for gravity feed only • sharp and easy piercing spike with air vent • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • self sealing latex bulb which will also act as an port for extra medication • efficient roller clamp to control and adjust the fluid rate • 21 g needle • should conform to is 12655 4 standard , sterile disposable perfusion set ( infusion set ) with airway and needle ( paediatric use ) • burette type measured volume chamber of 100 ml • drop size of approx 60 drops per ml • injection port, latexfree, for intermittent medication. • floating auto shut off valve ( latex free ) in burette. • soft and kink resistant pvc tubing. • roller controller for flow control • tube length 150 cm • 23g needle • should conform to iso 8536 5 , sterile disposable infusion set with microdrip ( i.v. ) • microdrip infusion set with drop size reduced to approx 60 drops per ml • sharp and easy piercing spike • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the fluid rate • should conform to is 12655 4 standard , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conform to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 16g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable ( single use teflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port.size 24g • suitable for paediatric & neonatal use • should be packed in transparent, single blister pack. • should conform to is 10555 standard , mucus extractor sterile • clear transparent container • antibacterial filter • soft, kink resistant pvc tubing • tube size 10 fg; length 40 cm ( min. ) • capacity 25 ml , nasal oxygen cannula ( set ) , twin bore ( accessory for compressed air breathing ) all sizes ( adult ) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , nasal oxygen cannula ( set ) , twin bore ( accessory for compressed air breathing ) all sizes ( pediatrics ) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , paper adhesive plaster 1 x 9.0 mts ( with cutter ) non woven adhesive tape, hypoallergic, should have some stretch bonding , paper adhesive plaster 2 x 9.0 mts ( with cutter ) non woven adhesive tape hypoallergic, should have some stretch bonding , paper adhesive plaster 3 x 9.0 mts ( with cutter ) non woven adhesive tape hypoallergic, should have some stretch bonding , plaster of paris bandages15cm x 2.7mts / roll should conform to schedulef ( ii ) of drug and cosmetic act 1940 , plaster of paris bandages 10cm x 2.7mts / roll should conform to schedulef ( ii ) of drug and cosmetic act 1940 , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:10 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:12 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:14 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:16 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:18 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , scalp vein set ( disposable ) :size 18g •butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritanttube • sterile , scalp vein set ( disposable ) :size 20g • butterfly shaped wings for easy handling and attachment with skin. colour coded •needle should be bevelled, siliconised and should ensure atraumatic cannulation •female luer fitting at one end •soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set ( disposable ) :size 22g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set ( disposable ) :size 24g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , sterile hypodermic syringe with needle attached, 24g, single use 2 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container , sterile hypodermic syringe with needle attached, 24g, single use 5 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 10 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 20 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , surgical blade sterile, size 11 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 15 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 22 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , suture needles curved 1 / 2 circle round body assorted size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , sterile disposable spinal needle for single use 22g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , sterile disposable spinal needle for single use 25g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , urine collecting bag, disposable 2000 ml • transparent sheet • kink resistant flexible tubing not less than 90 cm in length • should have non return valve • top drainage outlet • graduated bag • moulded handle for easy handling , double j stent, sterile, both ends open size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, both ends open, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , endotracheal tube, plain size 2.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain with radio opaque line, sterile, single use size 6mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 6.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, cuffed size 4mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 4.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 9 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , tracheostomy tube ( pvc ) , plain, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line , tracheostomy tube ( pvc ) , cuffed, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line • balloon with non return valve , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 24 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 28 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 32 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , corrugateddrainage sheet, sterile, multichannel, with radio opaque line, single use all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.5 cmx 15 cm soft to feel fast edges, slightly stretchbonding. , polypropylene nonabsorbable synthetic surgical mesh 15 cmx 15 cm soft to feel fast edges, slightly stretchbonding. , sterilised umbilical cotton tape width 3 mm, length 75 cm should conform to schedulef ( iii ) of drug and cosmetic act 1940 , bone wax sterilised , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; straightcutting60 mm , breakaway , skin graft knife blade ( sterile ) ( disposable ) skin grafting knife blade ( sterile ) made of carbon steel or stainless steel material 158 mm long individually wrapped in wrapper corrosion inhibitor paper in single packet, .in packs of 10. the edge must be sharp enough to cut the skin in a single shave and should snugly fit in the handle should conform to is 3759. 2. skin grafting knife handle ( watson modification of humby’s knife ) stainless steel, ce certified, in which the blade specified in ( a ) above should fit snugly. should conform to 7980 1976. , k wire, length 375 mm; 1mm length of wire should be mentioned with specification. should conformto is 8261 , k wire, length 375 mm;1.6mm • length of wire should be mentioned with specification. • should conformto is 8261 , k wire, length 375 mm; size 1.8mm • length of wire should be mentioned with specification. •should conformto is 8261 , face mask, disposable • should be manufactured from non woven poly prop fabric • should be 3 ply construction • should have high bacterial filtration efficiency • should be heat sealed to keep 3 layers together • standard size 17.5 x9 cm • color green / blue • there should be a string each at all four corners, length of string should be 40cm • nose clip should be there •no elastic band. , surgical cap, disposable ( for surgeons ) • should be manufactured from non woven fabric. • strip for tying the cap stitched on the back for proper grip on the forhead. • green colour • ultrasonically stitched • air permeable / breathable • should retain skin and hair particle. • strip for tying the cap , surgical cap, disposable ( for nurses ) • should be manufactured from non wovenfabric • blue / green colour • round upon wearing, with elastic •air permeable / breathable •should retain skin and hair particles , foldable intra ocular lense with injector ( size + 11 d to +17.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics ( 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 18 d to + 24 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 24.5 d to + 28.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 24.5 d to + 28.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 11 d to +17.5 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 18 d to + 24 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowdered, without tear, properly folded in a paper • should conform to is 13422 • isi marked / ce certified / fda approved • colour code marking to designate size , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowder free, without tear, properly folded in a paper • should conform to is 13422 • isi marked / ce certified / fda approved • colour code marking to designate size , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small. should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large should conform to is 15354 , pressure monitoring line / high pressure extension line • suitable for high pressure monitoring and for connection between syringe infusion pump and patient • male luer lock at one end and female luer lock at other end ; should fit all standard equipment. luer lock connectors should provide secure fitting. • pressure upto 800 psi • length 200 cm • sterile , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml • should have suitability for both male and female patients • should be provided withadhesive for fixation and good grip with minimal risk of allergy and injury • capacity 100 ml • sterile , umbilical catheter ( for new born ) all sizes • radio opaque line • with female flexible mount • colour coded connector • open tip should be soft, rounded, atraumatic • length 40 cm , umbilical cord clamp • suitable for clamping umbilical cord of new born • security lock to prevent accidental opening after clamping • grooved clamping area , absorbable oxidizedregenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure ( closed wound suction unit ) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 16 fg , close wound drainage device under negative pressure ( closed wound suction unit ) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter18 fg , t – tube for common bile duct drainage • kehr’s t tube made from medical grade pvc, and siliconized • smooth, kink resistant • radio opaque line throughout the length • sterile • length 20 x 60 cm • size 10 to 18 fg , bone cement with antibiotics, fast and slow setting , sanitary napkin, beltless 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp / wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc. 3. back strip – a back strip for sticking the sanitary napkin onto the underwear should be there using good quality adhesive material. 4. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm ) absorbent section total pad length 210 +_ 10 230 +_ 10 width60 to 75 70 to 85 thickness8 +_ 2 5. weight : not more than 10 gm . . instructionfor usage should be mentioned on every packet , sanitary napkin, belttype 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp / wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc 3. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm ) absorbent section pad length220 +_ 10 width 70 +_ 5 thickness17 +_ 3 4.weight : 12 +_ 3 gm 5.pack – six napkins in a pack. 6.elastic belt with loops shall be provided in each pack. 7.absorbency: the napkin should be able to absorb not less than 30 ml of normal saline or coloured water or test fluid when poured on to the centre of the napkin at the rate of 15 ml per minute. .instruction for usage should be mentioned on every packet. , belt less sanitary napkin with wings 1. covering ( absorbing top sheet corrector ) –good quality knitted sleeve or non woven fabric of rash free, non irritant and soft to touch material which has sufficient porosity to permit the assembled napkin to meet absorbency requirements.the napkins shall have a non absorbent barrier on one side with adhesive covered by a differently identifiablepaper 2.overall length ( mm ) 230 ± 5 3.core length 220 mm± 10 4.fluff core / padlength220 mm± 10 5. over all width with wings160mm+_5 6.fluff core / padlength70 mm± 5 7.thickness of a single pad9 10mm 8.weight of a single pad : 8 10 gm 9.packsix napkins in a pack. 10type. belt less sanitary napkin withwings 11.minimum absorbency:50ml 12.ph value of absorbent material6 8.5 b. disposable individual pouch or wrapper for each sanitary napkin ( as per ministry of environment, forest and climate change dated 08.04.2016 ) pouch / wrapper specifications : 1. pouch / wrapper should be of the size of sanitary napkin being supplied. 2. it should have adhesive to seal the sanitary napkins within. 3. pouch / wrapper should not be transparent. note : instructions for use of disposable pouch / wrapper mst be written in hindi on disposable pouch / wrapper. blrseky fd;s gq;s lsusvjh usifdu dks eksm dj disposable pouch / wrapper esa mkys , oa disposable pouch / wrapper dks xksan yxh iv~vh ls cun dj lqjf { kr rjhds ls dwmsnku esa mkysaa , oxygen mask ( adult ) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. , oxygen mask ( paediatric ) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc materialwith comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. • mask connector 4m , sterile catheter, single use, for urinary drainage ( foley baloon catheter ) , 2 way, size 14 • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for a traumatic intubation • symmetrical foley balloon • balloon capacity 30+ 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and ballon capacity should be mentioned as per is 11497 • specification for b, c, d, e, f, g should be mentioned as per is 11497 , nelaton catheter size 14 fg distal end is close and proximal end has female colour code connector • soft, kink resistant medical grade pvc tube • length:40 cm • individually packed in poly and sterile , ecg electrode •reliable trace, •high conductivity, • easy to handle , surgical blade sterile, size 23 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction duringmovement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , urethral catheter90 ( fg 14 ) , made up of medical grade pvc , urethral catheter91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length, •suction handle with suctiontube •sterile, • pyrogenic free, •latex free, • single use , epidural minipack 18g, 90 mm, metal stylet for single use only, •sterile, •epidural catheter 20g, l 90 cm, •6 lateral holes closedend, •borst adapter •epidural catheter flat filter 0.2 micro meter •thread assist guide•lor ( loss of resistance ) plastic syringe 6 ml , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no.22double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv. ) , vascular catheter with metal guide no.18 double lumen size 45 cm ( longline iv. ) , vascular catheter with metal guide no.20 double lumen size45 cm ( longline iv. ) , vascular catheter with metal guide no. 22 double lumen size 45cm ( longline iv. ) , 3 waystop cock , non pyrogenic & single use, should be leak proof, with smooth movements , 3 waystop cock with extension tube ( vein o line ) size 10cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 50cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 100cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 150 cm ( non pyrogenic & single use ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) • graduated bag, • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp1m x 10cm adhesive material should have good quality sticking property, non allergic , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g · should be packed in transparent single blister pack · should confirm to is 10555 standard · ( neonatal iv cannula size 26 ) , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) paediatric · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads in small size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear · should be single use with bronchoscopy and co2 &o2 port with chin support · non allergic, leak proof, contour should be maintained , nebulization mask adult , nebulization mask paediatric , chemotherapy port &non coring needles ( adult ) · valved catheter need only saline flush, catheter with intermediate size port with small septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 8fr with silicon material with peel apart percutaneous introducer system. · chemo port huber needle 20g and 22g. , chemotherapy port &non coring needles ( pediatric ) · valved catheter need only saline flush, catheter with intermediate size power port with large septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 6fr with silicon material with peel apart percutaneous introducer system · .chemo port huber needle 20g and 22g. , category : suture , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 3 / 8 cir rb needle 40mm length 76 cm ) 1 / 0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet ( 1 / 2 circle rb 30mm needle, length70cm ) 1 / 0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet ( 1 / 2 circle rb 31mm needle, length70cm ) 2 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 30mm, suture length 90 cm / 2 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 3 / 8circle r cutting, ps 1, 24mm, suture length 70 cm 3 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 1 / 2circle ctroundbodied40mm, gsneedle, suture length 90 cm 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm / , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolic acidviolet ) 1 / 2 circle ctroundbodied40mm, gsneedle, suture length 90 cm / 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 20mm, suture length 70 cm 3 / 0 , absorbablesurgical suturespolyglecaprone / polyglyconate, monofilament sutures ( 3 / 8 circle cutting24 26mm needle, suture length of 70 90cm ) 3 / 0 , absorbable surgicalsuturesmonofilament sutures polyglecaprone / polyglyconate ( l / 2 circle cutting 16mm needle, suture length 70cm ) 4 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 3 / 8 rb needle 30mm length 76 cm ) 2 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) 1 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 40mm length 76 cm ) 1 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir cutting needle 8mm, length 35 cm ) 6 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 16mm, length 76 cm ) 5 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 19mm length 76 cm ) , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 4 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) 1 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 20mm length 76 cm ) 3 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) 2 / 0 , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanoneviolet ( 1 / 2 circle reverse cutting 40 50 mm length 70 90cm ) 1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm 2 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 20mm length 70 cm ) 4 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle 30mm length 90 cm 2 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir conventional 25mm length 90 cm ) undyed3 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm ) 1 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle 20mm length 70 cm 3 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle40mm length 90 cm1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle 30mm length75 90 cm1 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir tapercut needle ( heavy ) 35 40mm length 75 90 cm 1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 3 / 8 circle cutting 16mm needle, suture length70cm 4 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 3 / 8 circle cutting needle 22mm length 45 cm3 / 0 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures ( 1 / 2 circle oval rbneedle 26mm needle, suture length of 70cm ) 2 / 0 , absorbable surgical suturespolyglecaprone / polyglyconate, monofilament sutures ( l / 2 circle oval rbcontrast needle 26mm, suture length 70cm ) 3 / 0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided ( green / blue ) *with 1 / 2 circle taper cut , 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 2 / 0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided ( green / blue ) 1 / 2 circle taper cut , 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm2 / 0 , non absorbable surgical suture, , sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 8 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitecoated polyster braided ( green / blue ) with 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided green / blue ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided white ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 1 / 2 cir rb needle 20mm, length 76 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturebraided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided green / blue ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 30mm length 90 cm ) 1 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut double needle 17mm length 70 90 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb13 mm needle, length 75cm ) double arm 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb heavy needle 40 45mm length 75 90 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 16 mm length 70 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 30mm, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut double needle cutting size 16 17mm length 70 90 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle tapercut 13mm double needle 70cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir cutting needle 25mm length 45 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 70 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8cir rb 16mm needle, length 90 cm ) 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( l / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue usp ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cirr cutting needle 40 45mm length 60 70 cm. ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 conventional cutting needle 16 mm length 70 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 10 / 0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk ( 3 / 8 cir rb needle 16mm, length 76 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk ( 3 / 8 cir rb needle 20mm, length 76 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 8 / 0 , non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue ( 3 / 8cir rb double 8mm needle, length 60 cm ) 7 / 0...

Jhalawar Medical College and SRG Hospital - Rajasthan

33337326 rate contract for drug medicine items at srg hospital jhalawar rate contract for drug medicine 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 3 bupivacaine inj ip 0.5% 4 drotaverine hydrochloride inj 40 mg/2 ml 5 halothane bp 6 isoflurane usp 7 ketamine inj ip 50 mg/ml 8 lignocaine ointment 5% 9 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 10 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 11 lignocaine gel ip 2% 12 lignocaine inj ip 2 % 13 propofol inj ip 10 mg/ml 14 thiopentone inj ip 0.5 g 15 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 16 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 17 fentanyl citrate injection ip 2 ml 18 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 19 ibuprofen tab ip 200 mg (coated) 20 ibuprofen tab ip 400 mg (coated) 21 morphine sulphate inj ip 10mg/ml 22 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg 23 paracetamol syrup ip 125 mg/5ml (detail in rc) 24 paracetamol tab ip 500 mg 25 paracetamol inj. 150 mg/ml 26 pentazocine inj ip 30mg/ml (im/iv use) 27 tramadol cap ip 50 mg 28 tramadol inj 50 mg/ml 29 adrenaline injectiori ip img/ml im/iv use 30 betamethasone tab ip 0.5mg 31 chlorpheniramine maleate tab ip 4mg 32 dexamethasone inj ip 8mg/2ml 33 dexamethasone tab ip 0.5 mg 34 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 35 hydroxyzine tab ip 25 mg 36 methyl prednisolone sodium succinate for injection usp 500 mg 37 pheniramine inj ip 22.75mg /ml 38 prednisolone tab ip 5 mg 39 promethazine syrup ip 5 mg/5ml 40 promethazine inj ip 25mg/ml 41 promethazine tab ip 25 mg 42 naloxone inj ip 0.4mg/ ml 43 pralidoxime chloride injection ip 25 mg/ml / 500 mg 44 carbamazepine tab ip 200 mg 45 carbamazepine tab ip 100 mg 46 phenobarbitone tab ip 30 mg 47 phenytoin injection bp 50mg/ml 48 phenytoin oral suspension ip 25mg/ml 49 phenytoin tab ip 100 mg (film coated) 50 sodium valproate inj 100 mg/ ml 51 sodium valproate gastro resistant tablets ip 200 mg 52 acyclovir oral suspension ip 400mg/5ml 53 acyclovir tab ip 200 mg 54 acyclovir tab ip 800 mg 55 albendazole oral suspension ip 400 mg/10ml 56 amikacin inj ip 100 mg 57 amikacin inj ip 500 mg 58 amoxycillin and cloxaciiiin cap 250 + 250 mg 59 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 60 amoxycillin cap ip 250mg 61 amoxycillin cap ip 500mg 62 amoxycillin dispersible tablets ip 125 mg 63 amphotericin b inj ip 50 mg 64 ampicillin injection ip 500 mg 65 benzathine benzytpenicillin inj ip 12 lac units 66 benzathine benzylpenicillin inj ip 6 lac units 67 cefixime tab ip 100 mg 68 cefixime tab ip 200 mg 69 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone lgm and sulbactum sodium eq. to sulbactum 0.5gm)(lm/lv use) 70 cefotaxime injection ip 1g. 71 cefotaxime inj ip 250 mg. 72 ceftazidime inj ip 1g. 73 ceftazidime inj ip 250 mg 74 ceftazidime inj ip 500 mg 75 ceftriaxone inj ip lg /vial 76 ceftriaxone inj ip 250 mg/vial 77 ceftriaxone inj ip 500mg/vial 78 cephalexin cap ip 250 mg 79 cephalexin cap ip 500 mg 80 chloroquine phosphate inj ip 40 mg/ ml 81 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 82 ciprofloxacin injection ip 200mg/100ml 83 ciprofloxacin tablets ip 250 mg film coated 84 ciprofloxacin tablet ip 500 mg film coated 85 clotrimazole cream ip 2% w/w 86 clotrimazole vaginal tab ip 500mg 87 compound benzoic acid ointment ip benzoic acid 6% + salicylic acid 3% 88 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 89 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 90 diethyicarbamazine tab ip 100 mg 91 doxycyciine cap ip 100 mg 92 gentamycin injection ip 80mg/2ml (1m/ iv use) 93 griseofuivin tab ip 125 mg 94 ltraconazole cap 100 mg 95 meropenem inj ip 500 mg 96 metronidazole inj ip 500 mg/100ml 97 metronidazole benzoate oral suspension ip 100 mg of base/ 5ml 98 metronidazole tablet ip 200 mg (film coated) 99 metronidazole tablets p 400 mg (film coated) 100 norfloxacin tab ip 400mg film coated 101 ofloxacin tab ip 200 mg 102 primaquine tab ip 2.5 mg 103 primaquine tab ip 7.5 mg 104 quinine dihydrochloride inj ip 300 mg/ml 105 quinine sulphate tablets ip 300 mg (film coated) 106 azathioprine tab ip 50 mg 107 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 108 chlorambucil tab ip 5 mg 109 cisplatin inj ip 50 mg/ 50 ml 110 cyclophosphamide inj ip 200 mg 111 cyclophosphamide inj ip 500 mg 112 cytarabine injection bp 500mg 113 danazol cap ip 5.0 mg 114 daunorubicin inj ip 20mg. 115 doxorubicin inj ip 50 mg/ 25ml . 116 etoposide inj ep 100 mg 117 flunarizine tab 5mg 118 fluorouracil inj ip 250 mg/ 5ml 119 l asparaginase inj 10000 iu 120 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 121 melphalan tab ip 5 mg 122 mercaptopurine tab ip 50 mg 123 methotrexate inj ip 50 mg/ 2 ml 124 methotrexate tab ip 2.5 mg 125 paclitaxel inj ip 260 mg 126 paclitaxel inj ip 100 mg 127 tamoxifen täb ip 10 mg 128 vinblastine inj ip 10mg/ 10ml 129 vincristine inj ip img(vial)/vincristin injection usp img/ml (amp) 130 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 131 levodopa and carbidopa tab 250 mg+ 25 mg 132 trihexyphenidyl hci tab ip 2 mg 133 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 134 deferasirox tab 100 mg 135 deferasirox tab 500 mg 136 deferiprone cap 250 mg 137 deferiprone cap 500 mg 138 desferrioxamine injection ip 500 mg / vial (for t.m. inj and i.v s.c. infusion) 139 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 lu/ vial (iv use) 140 enoxaparin sodium inj ip 60 mg 141 ethamsylate inj 250 mg/ 2ml (im/iv) 142 heparin sodium inj ip 5000 iu/ml (im/iv use) 143 human albumin solution ip 20% 144 rh erythropoetin inj ip 10000 iu 145 rh erythropoetin inj ip 2000 iu 146 rh erythropoetin inj 4000 iu 147 vitamin k injection each ml contains menadione sodium bisulphite equivalent to 5.2 mg of menadione. (aqueous solution) 148 amiodarone tab ip 100 mg 149 amiodarone tab ip 200 mg 150 amiodarone hydrochloride inj 50 mg/ml 151 amlodipine tab ip 2.5 mg 152 amlodipine tablets ip 5 mg 153 atenolol tab ip 50 mg 154 atorvastatin tab ip 10mg 155 clopidogrel tab ip 75 mg 156 digoxin inj ip 0.25 mg/ml 157 digoxin tab ip 0.25 mg. 158 diltiazem tabs ip 30 mg film coated 159 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 160 dopamine hydrochloride inj ip 40 mg/ml 161 enalapril maleate tab ip 5mg 162 enalapril maleate tab ip 2.5mg 163 isosorbide dinitrate tab ip 5 mg 164 isosorbide mononitrate tabs ip 20 mg 165 lisinoprii tab ip 5 mg 166 losartan tab ip 50 mg 167 magnesium sulphate inj. ip 500mg/ml (50%w/v) 168 methyldopa tab ip 250mg film coated 169 nifedipine cap ip 5mg 170 nifedipine tablets ip 10 mg (sustained release) 171 nitroglycerin inj 5 mg/ ml 172 propranolol tab ip 40 mg 173 streptokinase injection 15 lac units ip 174 verapamil tab ip 40 mg film coated 175 acyclovir cream 5% 176 glycerin ip 400 gm 177 liquid paraffin ip 400 ml 178 ointment containing lidocaine ip 3% zinc oxide ip 5 % , hydrocortisone ip 0.25%, allantoin ip 0.5% 179 miconazole nitrate cream ip 2% 180 povidone iodine ointment 5% 15 gm 181 povidone iodine solution ip 5% 500 ml 182 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 183 silver sulphadiazine cream ip 1% 50gm tube 184 anti a blood grouping serum ip(anti a monoclonal serum) 185 anti b blood grouping serum ip(anti b mono clonal serum) 186 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 187 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 188 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 189 gadodiamide inj. 0.5mrnl/ml vial 190 tropicamide eye drop ip 1% 191 vdrl antigen (with + ve and ve control) / rpr slide kit 192 compound benzoin tincture ip 193 formaldehyde solution (34.5 per. 38 per.) 194 gentian violet topical solution usp 1% 195 gluteraldehyde solution 2% 196 hydrogen peroxide solution ip 6% (20 vol) 197 lysol (cresol with soap solution) ip (cresol 50 %+ soap 50 %) 198 povidone iodine scrub solution / cleansing solution 7.5 0/0 w/v povidone iodine (suitable for hand wash) 199 surgical spirit ip (500 ml) 200 acetazolamide tab ip 250mg 201 frusemide tab ip 40 mg 202 furosemide injection ip 10mg/ml (1m and iv use) 203 hydrochlorthiazide tab (p 12.5 mg 204 spironofactone tab ip 25mg 205 torsemide tab 10 ip mg 206 bisacodyl tab ip 5 mg 207 dicyclomine tab ip 10 mg 208 dicyclomine inj ip 10 mg/ml 209 dicyclomine hydrochloride oral solution ip 10mg /5m) 210 domperidone suspension ip 5mg/5ml 211 domperidone tab ip 10 mg 212 hyoscine butylbromide inj ip 20 mg/ml 213 loperamide tab ip 2mg 214 metoclopramide inj ip 10mg/2ml 215 metoclopramide tab ip 10 mg 216 omeprazole cap ip 20 mg 217 oddansetron inj ip 2mg/ml 218 ors powder 219 pentoprazole inj 40 mg 220 ranitidine hcl injection ip 50mg/2ml 221 ranitidine tab ip 150mg film coated 222 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 % disodium hydrogen phosphate dodecahydrate 8% 223 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 224 carbimazole tab. ip 5 mg (film coated) [280] 225 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml [2811 226 clomifene tab ip 25 mg [282] 227 clomiphene tab ip 50 mg [283) 228 conjugated estrogen tab. usp 0.625 mg. 229 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 230 ethinyloestradiol tabs ip 50 mcg 231 glibenclamide tab ip 5 mg 232 gliclazide tab ip 40 mg 233 glimepiride tab ip 2 mg 234 glimepiride tab ip 1mg 235 glipizide tab ip 5mg 236 hydroxyprogesterone inj ip 250mg /ml 237 isophane insulin inj ip 40 iu /ml 238 metformin tab ip 500 mg(fiim coated) 239 norethisterone tab ip 5mg 240 pioglitazone tab ip 15mg 241 progesterone inj 200 mg/2ml 242 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 243 thyroxine sodium tablets ip 100mcg 244 human anti d immunoglobulin injection 300mcg (1m use) 245 human anti d immunoglobulin 150 mcg 246 human rabies immunoglobulin inj 150 iu/ ml 247 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 248 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 249 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.l ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 250 tetanus immunoglobulin ip 250 iu/ vial 251 tetanus vaccine (adsorbed) ip 5 ml vial 252 atracurium inj 10 mg/ml 253 glycopyrrolate inj ip 0.2 mg/ml 254 midazolam inj ip 1 mg/ml 255 neostigmine inj ip 0.5 mg/ml 256 neostigmine tab p 15 mg 257 succinylcholine inj. ip 50 mg/ml (iv use) 258 valethamate bromide inj 8mg / ml 259 atropine eye ointment ip 1% 260 atropine sulphate ophthalmic solution usp 1% 261 chloramphenicol eye drops ip 0.5% 262 ciprofloxacin eye drops ip 0.3% w/v 263 ciprofloxacin ophthalmic ointment usp 0.3% 264 hydroxypropylmethyl cellulose solution 20 mg/ml 265 tobramycin and dexamethasone ophthalmic suspension usp 0.3% + 0.1% 266 tobramycin eye drops 0.3% 267 tobramycin ophthalmic ointment usp 0.3% 268 isoxsuprine inj ip 5 mg/ml 269 isoxsuprine tab ip 20 mg 270 methylergometrine inj ip 0.2 mg/ml 271 methylergometrine tab ip 0.125 mg 272 misoprostol tab ip 200 mcg 273 oxytocin inj ip 5 iu/ml 274 alprazolam tab p 0.25 mg 275 alprazolam tab ip 0.5mg 276 amitriptyline tab ip 25mg film coated 277 chlordiazepoxide tablets ip 10mg 278 chlorpromazine tablets ip 100 mg (coated tablet) 279 chlorpromazine tablets ip 25 mg (sugar coated) 280 chlorpromazine tablets ip 50 mg (coated tablets) 281 chlorpromazine inj. (p 25mg/ml 282 diazepam inj ip 10mg/2ml (1m/lv use) 283 diazepam tab ip 5 mg 284 escitalopram tab ip 10 mg 285 fluoxetine cap ip 20 mg 286 haloperidol inj ip 5 mg/ml 287 haloperidol tab ip 1.5 mg 288 haloperidol tab ip 5 mg 289 imipramine tab ip 25 mg (coated tab) 290 imipramine tab ip 75 mg (coated) 291 lithium carbonate tab ip 300 mg 292 lorazepam inj ip 2 mg/ml 293 olanzapine tab ip 5 mg 294 risperidone tab 2mg 295 risperidone tab 1mg 296 sertraline tab 50 mg 297 trifluperazine tab ip 5 mg coated 298 aminophylline inj ip 25 mg/ml 299 beclomethasone inhalation ip 200 mcg/dose 300 budesonide nebulizer suspension 0.25mg/ml 301 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 302 ipratropium bromide nebulizer solution 250 mcg/ ml 303 salbutamol tablet ip 4 mg 304 salbutamol inhalation 100 mcg /dose 305 salbutamol nebuliser solution bp 5 mg/ml 306 salbutamol tab ip 2 mg 307 theophyltine and etofyuine injection (anhydrous theophylline 50,6mg + etofyiiine 169.4 mg) 308 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 309 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 310 compound sodium lactate inj. ip 311 dextrose inj 25% w/v 312 dextrose inj 10% 313 dextrose inj ip 5% 314 multiple electrolytes and dextrose injection type ip (electro)yte p injection ) 315 multiple electrolytes and dextrose injection type ill ip electroylte m injection (i.v.) 316 potassium chloride inj. 0.15 gm/ml 317 potassium chloride oral solution u.s.p 500mg/ 5m) 318 sodium chloride and dextrose injection ip 0.9 % + 5 % 319 sodium chloride inj ip 500 ml 320 ascorbic acid tab ip 500 mg 321 calcium gluconate inj ip 10% (iv use) 322 ferrous sulphate with folic acid tab ip each film coated tab. containing dried 323 ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 324 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. 325 containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip ioo mcg 326 folic acid tab ip 5 mg 327 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit bl img, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl img, cyanocobalamin imcg, lysine hcl 10mg 328 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit bi 2mg vit b6 0.5mg vit c 50mg calcium pantothenate lmg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 329 vitamin b complex inj nfi 330 vitamin b complex tablet nfi (prophylactic) bl 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate img (with appropriate overages) 331 black disinfectant fluid (phenyl) as per schedule o grade iii 332 conc haemodialysis fluid b.p acetate concentrate 10 litre can 333 peritonial dialysis solution ip 334 sodium bicarbonate inj ip 7.5% w/v 335 water for inj ip 336 polygeline 3.5% solution with electrolytes for i.v. infusion 337 factor ix concentrate (purified) ip 500 600 1.u.(human coagulation factor ix) 338 anti inhibitorcoagulation complex (human plasma protein with a factor vlll inhibitor bypassing activity of 500 1.u. per vial) 339 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 340 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 341 labetalol tab ip 100mg 342 labetalol hci inj. ip 20mg/4ml 343 ampicillin cap ip 500mg 344 nitrofurantoin tab ip 100mg 345 hyoscine butyl bromide tablets ip 10mg 346 drotaverine tab ip 40 mg 347 hydroxyethyl starch (130/0.4) 6 % w/v with sodium chloride 0.9 % w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 348 cloxacillin sodium inj. ip 500mg 349 betamethasone sod phos inj. jp 4mg/ml 350 vccuronium bromide for injection 4mg (freeze dried) 351 phenobarbitone inj ip 200mg/ml 352 flurbiprofen sodium ophthalmic solution ip 0.03% w/v 353 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 l.u. 354 lidocaine hci topical solution usp 4% 355 fluconazole eye drops 0.3% 356 cephalexin oral suspension ip (cephalexin dry syrup [p) 125mg/ 5 ml 357 ofloxacin oral suspension ip 50mg/ 5ml 358 tinidazole tab ip 300 mg (film coated) 359 tinidazole tab ip 500 mg (film coated) 360 salbutamol syrup ip 2mg/ 5ml 361 ranitidine tab ip 300mg film coated 362 indomethacin cap ip 25 mg 363 diclofence prolonged release tablet ip 100 mg 364 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 365 dextromethorphan hbr syrup ip 13.5mg/5ml 366 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 367 saline nasal solution (drops) (sodium chloride 0.65%) 368 clotrimazofe mouth paint (clotrimazoie 1% w/v) 369 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 370 beclomethasone, neomycin and clotrimazo)e cream (beclomethasone dipropionate 0.025%, neomycin sulphate 0.5% arid clotrimazote 1%) 371 gamma benzene hexachloride lotion 1%(lindane lotion usp). 372 chlorhexidine gluconate solution 5% 250 ml. 373 iron and folic acid suspension. each 5m] contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 374 surgical spirit ip(100 ml) 375 povidone iodine solution ip 5% 100m) bottle 376 metformin hydrochloride(sustained release tablets ip 1000 mg 377 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 378 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 379 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 380 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 381 glimepiride, pioglitazone and metformin hydrochloride (sustained re(ease) tablets each tablet contains glimepiride 2mg, piogiitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 382 amtodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 383 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 384 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 385 amlodipine and lisinopril tablets amlodipine besiiate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 386 amtodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 387 atenolol tab ip 25 mg 388 enalapril maleate tablets ip 10 mg 389 hydrochiorthiazide tab ip 25mg 390 lisinopril tablets ip 10 mg 391 lisinopril tab 2.5 mg 392 losartan tab ip 25 mg 393 piperacillin + tazobactum for injection ip 4gm+500mg 394 prednisolone tablet ip 10 mg 395 prednisofone tab ip 20 mg 396 torsemide inj 10 mg/ml 397 zinc sulphate dispersible tablets ip elemental zinc 10 mg 398 amoxycin oral suspension ip (dry syrup) 125 mg/5ml 399 carbamazepine oral suspension usp 100 mg/5ml 400 cefpodoxime dispersible tab 50 mg 401 cephalexin tablets 125 mg (dispersible tablets) 402 lbuprofen oral suspension bp /usp 100 mg/ 5 ml 403 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 404 sodium valproate oral solution ip 200 mg/5 ml 405 diphtheria antitoxin 10000 iu 406 meropenem inj. ip 1gm 407 lohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 408 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 409 timolol eye drops ip 0.5 0% w/v 410 homatropine eye drops ip 2% 411 travoprost eye drops ip 0.004% 412 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 413 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 414 sevoflurane 415 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 416 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 417 etoricoxib tab ip 120mg 418 mefenamic âcid tablets bp 500 mg 419 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg chlorpheniramine maleate 1 mg, and paracetamol 125 mg 420 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamot 325 mg tab 421 cetirizine syrup ip 5mg/5 ml 422 acetylcystine solution usp (injection) 200 mg/ml 423 acyclovir intravenous infusion ip 250mg 424 acyclovir intravenous infusion ip 500mg 425 amikacin inj ip 250 mg 426 amoxicillin and potassium clavulanic ip inj 600mg 427 amoxicillin and potassium clavulanate inj ip 1.2gm 428 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottie) 429 aztreonam injection usp 500 mg 430 cefepime injection ip 500 mg 431 cefixime oral suspension ip 25mg/ml (paediatric drops) 432 cefuroxime axetil tab ip 250 mg 433 clindamycin capsule ip 150mg 434 clindamycin capsule ip 300 mg 435 levofloxacin tablets ip 250 mg 436 linezolid tablets ip 600 mg 437 linezolid inj 200mg/100ml 438 mefloquine tablets ip 250 mg 439 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 440 ofloxacin infusion ip 200mg/100 ml(in nacl inj) 441 vancomycin for intravenous infusion ip 500 mg 442 vancomycin for intravenous infusion ip 1gm 443 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 444 carboplatin injection ip 150 mg 445 carboplatin injection ip 450mg 446 cisplatin inj ip 10 mg/10 ml 447 dacarbazine injection 500 mg usp/ bp 448 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 449 gemcitabine for injection 200 mg 450 gemcitabine for injection ip lgm 451 ifosfamide injection ip/bp/usp l gm 452 imatinib tab ip 400mg 453 methotrexate tablets ip 10 mg 454 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 455 oxaliplatin injection usp 50 mg 456 bromocriptine tablets ip 2.5 mg 457 betahistine tab ip 8 mg 458 betahistine tab ip 16 mg 459 cinnarizine tablets ip 25 mg 460 cinnarizine tablet ip 75 mg 461 tranexamic acid tablets ip 500 mg 462 warfarin sodium. tab ip 5mg 463 adenosine injection ip 6 mg/ 2m) 464 atorvastatin tablets ip 40 mg 465 clopidogrel and aspirin tables, clopidogrei 75 mg and aspirin 75 mg 466 fenofibrate capsules/ tab ip 200 mg 467 isoprenaline injection ip 2mg / ml 468 metoprolol tablets ip 25 mg 469 metoprolol succinate extended release tablets ip 50 mg 470 noradrenaline injection ip 2 mg/ml 471 prazosin tablets (extended release) 2.5 mg 472 telmisartan tablets ip 40 mg 473 urokinase injection s lac unit (lyophilized) 474 betamethasone dipropionate cream ip 0.05% 475 betamethasone lotion ip 0.05% 476 clindamycin phosphate gel usp 1% 477 clobetasol propionate cream ip 0.05 % 478 glycerin ip 100 ml 479 ketoconazole cream 2% 480 permethrin lotion 5% 481 permethrin cream 5% 482 tretenoin cream usp 0.025% 483 povidone iodine ointment usp 250 gm 484 povidone iodine solution ip 10 % 485 silver sulphadiazine cream ip 1% 500 gm jar 486 spironolactone tablets ip 50 mg 487 finasteride tablets ip 5 mg 488 tamsulosin hci tablets/capsute 0.4 mg 489 flavoxate tablets ip 200 mg (coated tablet) 490 chlorhexidine mouthwash ip 0.2% 491 dental gel choline salicylate 8.7%, benzalkonium chloride 0.01%, lignocaine hci 2% (flavoured gel base) 492 tooth gel sodium monofluorophosphate 0.7% and potassium nitrate 5% (in flavoured base) 493 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 494 metronidazole 1% and chlorhexidine gluconade 0.25% gel 495 ciprofloxacin 0.3% and dexamethasone 0.1% ear drops ciprofloxacin and dexamethasone otic suspension usp 496 clotrimazole 1% with bectomethasone dipropionate 0.025% ear drops 497 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 498 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2% , benzocaine 2.7% , chlorbuto) 5%, turpentine oil 15% 499 dohperidone oral drops 10mg/ ml (10ml) 500 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 501 lactic acid bacillus tab 60 million spores 502 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 503 liquid paraffin ip 100 ml 504 ondansetron orally disintegrating tablets ip 4mg 505 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 506 ursodeoxycholic acid tablets ip 300 mg 507 allopurinol tablets ip 100 mg 508 hydroxychloroquine sulphate tablets 200mg 509 leflunomide tablets ip 10mg(film coated) 510 leflunomide tablets ip/usp 20mg (film coated) 511 sulfasalazine gastroresistant tablets ip 500 mg ip 512 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500mg) 513 glucagon for injection usp 1mg/ml 514 medroxyprogesterone acetate tablets ip 10 mg 515 thyroxine tablets ip 50 mcg 516 octreotide injection 50 mcg/ml 517 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazoné 250mg , diclofenac sodium 50mg paracetamol 325 mg) 518 betaxolol eye drops 0.5% 519 carboxymethylcellulose eye drops ip 0.5% 520 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 521 mifepristone tab ip 200mg 522 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 523 budesonide powder for inhalation 200 mcg 524 ipratropium powder for inhalation ip 40 mcg 525 terbutaline tablets ip 2.5 mg 526 xylometazoline nasal drops ip 0.1% 527 sodium chloride injection ip 100 ml 528 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (nonchewable) 529 cholecalciferol granules 60,000 iu /gm 530 mecobalamin inj 500 mcg/ml 531 pyridoxine tablet ip 10 mg 532 pyridoxine tablet ip 40mg 533 thiamine tablets ip 100 mg 534 calcitriol capsules ip 0.25 mcg 535 alendronate sodium tablets usp / bp 35 mg 536 mannitol with glycerin injection 10% + 10% w/v (for intravenous infusion) 537 normal human intravenous immunoglobulin 5g/100ml 538 pregabalin cap ip 75 mg 539 surfactant for intratrecheal instillation (natural bovine lung surfactant) 540 ramipril tablets ip 2.5 mg 541 neostigmine injection ip 2.5mg/5ml 542 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 543 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivirphosphate equivalent to oseltamivir 45 mg) 544 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 545 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 546 vitamin k 1 (phytomenadione) ip 1mg/o.5ml injection (detail in rc) 547 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 548 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 549 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 550 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 551 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(50q+25)mg 552 giyceryl trinitrate tablets 2.6 mg controlled release tablets 553 artemether and leumefantrine tablet (80 mg and 480 mg) 554 methyl cobalmine tablet 500mcg 555 methyl cobalmine tablet 1500mcg 556 atropine sulphate injection 0.6mg/ml 557 fentanyl citrate injection 50mcg/ml 558 naproxen tablet ip 500mg 559 naproxen tablet ip 250mg 560 etoricoxib tablet ip 90 mg 561 levoceitrizine tablet 5mg 562 montelucast(10mg) + levocetrizine tablet (5mg) 563 sodium valproate tablet(gastro resistant) ip 500mg 564 clobazam tablet/capsule 5 mg 565 clobazam tablet/capsute 10 mg 566 levetiracetam tablet ip 500 mg 567 levetiracetam oral solution/suspension 100mg/ml 568 levetiracetam injection 500mg/5ml 569 gabapentine tablet/capsuie 100mg 570 gabapentine tablet/capsule 300mg 571 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 572 coal tar 6% & salicylic acid 3% ointment 573 calamine lotion ip 100ml 574 lohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 575 quetiapine tablet ip 50mg 576 quetiapine tablet ip 25mg 577 vitamin d3 oral solution 60000 iu 578 cyclosporin capsule usp/ip 50 mg 579 clonazepam tablet 0.5 mg 580 aspirin tablet (p (gastro resistant) 150 mg 581 insulin glargine 3ml (100 lu/ml) with 15 insulin syringes and needles/cartridge 3ml (100 lu/mt) with 15 needles and 1 pen per 20 cartridges 582 tenaligliptin tablet ip 20mg 583 aztreonam injection lgm 584 framycetin sulphate cream 1% 30gm pack 585 framycetin sulphate cream 1% 100 gm pack 586 artemether and leumefantrine tablet (40 mg and 240 mg) 587 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 588 dried factor vjii fraction ip (iv use) 500 iu/vial 589 dried factor vili fraction ip (iv use) 1000 iu/vial 590 recombinant coagulation factor vila 1mg 591 redombinant coagulation factor vila 2mg 592 cough syrup/expectorant(50) ml 593 insulin glargine 10 ml vial (100 lu/ml) with 30 insuline syringes with needle 594 butorphanol tartrate injection usp lmg/ml lml size 595 diclofenac sodium aqueous injection 75mg/ml lml size, iv & im use 596 paracetamol infusion ip 1% w/v 100ml size 597 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 598 baclofen tablet fp 10 mg (each uncoated tablet contains baclofen ip 10 mg) 599 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 600 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 601 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 602 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 603 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 604 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100mg) 605 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25mg) 606 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 607 piperacillin injection 2 gm + tazobactom 250mg ip 608 ceftriaxone 1 gm + tazobactum 125 mg injection 609 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 610 cefadroxil tablet 500 mg 611 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 612 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 613 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 614 clindamycin phosphate injection ip 300 mg 615 imipenem + cilastatin injection 500mg/500mg ip powder for solution 616 polymixin sulphate b injection usp 5 lac i.u. 617 meropenem injection ip 250 mg 618 colistimethate injection ip im 1u powder for solution 619 voriconazole injection 200mg/vial 620 terbinafine hydrochloride tablet 250 mg 621 valganciclovir tablet 450 mg 622 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 623 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 624 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 625 bendamustine injection 100 mg 626 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 627 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 628 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 629 bortezomib injection 2mg 630 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 631 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 632 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 633 bevacizumab injection 400 mg 634 bevacizumab injection 100 mg 635 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50mg) 636 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250mg) 637 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 638 tacrolimus capsule ip 0.5 mg (each hard gealtin capsüle tacrolimus ip 0.5 mg) 639 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 640 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip so mg) 641 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 642 zoledronic acid injection ip 4mg vial 643 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5m) and sod. chloride solution 5 ml size 644 ethamsy!ate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 645 feracrylum 1% w/v steriie solution 100 ml 646 tranexamic acid injection ip 100mg/ml 5ml size 647 recombinant f ix 500 iu with diluent 648 3rd generation recombinant f viii 250 iu with diluent 649 3rd generation recombinant f viii 1000 iu with diluent 650 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 651 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotatol hydrochloride usp/bp 40mg) 652 esmolol hydrochloride injection 10mg/ml 10ml size 653 sodium nitroprusside injection 25mg/ml 2ml size 654 carvedilol tablet 3.125 mg 655 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 656 rosuvastatin tablet 10 mg 657 sacubitril 24 mg and valsartan 26 mg tablet 658 powder clotrimazole 1% w/w 30 gm 659 terbinafine cream 1%w/w (10 gm tube) 660 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 661 oitment mupirocin ip 2% 662 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 663 prochlorperazine mesyiate injection 12.5mg/ml 5ml size 664 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 665 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 666 hepatitis b immunologlobin injection ip 200 1.u 667 cis atracurium besylate injection 2 mg/ml in 5 ml vial 668 acyclovir eye ointment ip 3% w/w 5gm size 669 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 670 chloramphenicol 1% w/w eye ointment ip, 3gm size 671 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 672 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 673 human chorionic gonadotropin injection ip 5000 1.u. 674 leurprolide acetate depot 3.75 mg 675 leurprolide acetate depot 11.25 mg 676 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 677 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 678 zolpidem tablet 5 mg 679 acebrophylline tablet/capsule 100 mg 680 ringer acetate infusion 500 ml 681 sodium chloride 0.45% w/v polypack 500 ml 682 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 683 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 684 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 685 phenazopyridine tablet 5 mg 686 dutasteride tablet 0.5 mg 687 alkylizer syrup 1.4 gm/5100 ml )(disodium hydrogen citrate) 688 ferric carboxymaltose injection 50 mg/ml 10 ml size 689 multi vitamin syrup 690 intravenous fat emulsion 20% w/v 250ml 691 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 692 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 693 amino acid 10% injection 100ml size 694 vitamin e capsule 400 mg 695 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 696 dasatinib tab 100 mg 697 human immunoglobulin inj with 12% lgm, 12% iga, 76% lgg in pack of 10ml (o.5gm) 698 liquid medical oxygen (lmo) 699 liposomol amphotericine injection b 50mg 700 multistix test strip 701 chloroquine phosphate suspension ip 50 mg/5ml 702 fluconazole tablets ip 150mg 703 cetrimide cream ip 15 gm 704 fusidic acid cream ip 2% 705 mannitol inj ipw/v 706 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 707 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyt siloxane 50mg 708 dicyclomine and paracetamol tablets dicyctomine hydrochloride 20 mg + paracetamol 325 mg tablets 709 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5% w/v (iml ampoule),sodium chloride injection ip 0.9% w/v (5m! ampoule) 710 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 711 albendazole tablets ip 400 mg(detaii in rc) 712 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 713 azithromycin tablets ip 250mg 714 azithromycin tab ip 500 mg 715 artificial saliva solution 716 all trans retinoic acid capsule 10mg 717 cyclopentolate 1% eye drop 718 dorzolamide 2% eye drop 719 fluromethalone 0.1% eye drop 720 gatifloxacin and prednisolone eye drop 721 hpmc 0.3% eye drop 722 ltraconazote 1% eye drop 723 loteprednol 0.25% eye drop 724 moxifloxacin 0.5% and ketorolac tromethamine 0.5% eye drop 725 moxifloxacin and dexamethasone eye drop 726 moxifloxacin and prednisolone eye drop 727 anti oxidants capsule (beta carotene 10 mg,vit e 25mg,vit c 100 mg, copper 1.5 mg, managanese 1.5 mg,z 728 nepafenac 0.1% eye drop 729 oloptadine opthalmic solution 0.1% eye drop 730 pilocarpine eye drop 731 prednisolone sodium phosphate 1% eye/ear drop 732 proparacaine 0.5% w/v eye drop 733 sodium chloride 5 % eye drop 734 sulfacetamide 20% eye drop 735 travapost and timolol eye drop 736 tropicamide and phenylepherine eye drop 737 voriconazole eye drop 738 aprepitant capsule 125mg 739 azithromycin 1% eye ointment 740 chloramphenicol 0.5% eye ointment 741 chloramphenicol and polymycin eye ointment 742 chloramphenicol and polymycine and dexamethasone eye ointment 743 ganciclovir 0.15% eye ointment 744 traconazole ointment 745 moxifloxacin 0.5% eye ointment 746 sodium chloride 6% eye ointment 747 povidone iodine gargle 748 gatifloxacin 0.3% eye drop 749 budesonide capsule 9mg 750 diltiazem 2% p/r gel 751 nifedipine and lidocaine p/r gel 752 glycine irrigation solution 1.5% 3ltr solution 753 esmoprazole 10mg granules 754 hormonal intra uterine device 755 hp kit (pantoprazole 40 mg and metronidazole 400 mg and clarithromycin tablet 500 mg 756 hydrocortisone oromucosal tablet 5mg 757 hydrocortisone oromucosal tablet 10mg 758 hydrocortisone oromucosal tablet 20mg 759 hydrogen 11% and silver nitrate .01% solution 760 calcium dobesilate capsule 500mg 761 tiotropium and glycopyrolate 25mg inhaler 762 metoprolol 5ml vial injection 763 docetaxel 20mg injection 764 docetaxel 80 mg injection 765 folinic acid 200mg/vial injection 766 sodium chloride 3% ioomi injection 767 acth synacthen 250 mcg injection 768 adalimumab 40 mg injection 769 ado trastuzumab 100 mg injection 770 ado tras!uzumab 160 mg injection 771 ceritinib capsule 50mg 772 alpha beta arteether 2 ml injection 773 prostaglandin 500mcg/ml injection 774 aminocaproic acid 20ml injection 775 amoxycillin & clavulanic acid 300 mg injection 776 ampicillin and salbactum 1.5g injection 777 progesterone injection 50 tnjection 778 artesunate 120 mg injection 779 atezolizumab 1200 mg injection 780 avelumab 200 mg injection 781 azacitidine 50mg injection 782 ceritinib capsule 100mg 783 azacitidine 100mg injection 784 azithromycin 10 ml vial equaivelent to 500 mg injection 785 bacitracin for injection 25,000 lu injection 786 bortezomib 2.5 injection 787 botulinum toxin type a for injection/botulinum toxin type b for injection 100 lu injection 788 botulinum toxin type a for injection/botulinum toxin type b for injection. 50 lu injection 789 busulfan 60mg/1ml injection 790 cabazitaxel 20 mg injection 791 cabazitaxel 40 mg injection 792 caffeine cirate 20mg/ml injection 793 ceritinib capsule 200mg 794 calcium chloride 5ml vial injection 795 calcium gluconate/folinate injection 796 carbetocin imi/100micro. injection 797 carfilzomib 20 mg injection 798 carfilzomib 60 mg injection 799 carmustine 100 mg injection 800 caspofungin 50 mg injection 801 caspofungin 70 mg injection 802 cefipime 1000mg and tazobactum 125mg injection 803 cefoperazone igm and tazobactum 125mg injection 804 ceritinib capsule 250mg 805 cefoperazone 500mg injection 806 ceftazidime igm and sulbactam500 mg injection 807 ceftazidime and avibactum 2gm and 500mg injection 808 ceftizoxime 1gm injection 809 ceftriaxone ip 125 mg injection 810 ceftriaxone and salbactum and disodium edta injection 811 ceftriaxone and sulbactam 1.5g injection 812 ceftriaxone1000mg and tazobactom125mg injection 813 cefuroxime 1gm injection 814 cetrorelix acetate 0.25 mg injection 815 clomipramine capsule ip 25mg 816 cetuximab 100 mg injection 817 cetuximab 500mg injection 818 chloramphenicol 1gm/viaf injection 819 cladrabine 10 mg injection 820 clarithromycin 500mg injection 821 clindamycin 600mg/4ml injection 822 clonidine 150mcg/ml injection 823 compound sodium lactate (ringer lactate) in glass bottle 500ml injection 824 crystilline penicillin 2 lakh injection 825 cytarabine 1000 mg injection 826 balanced satt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag solution 827 cyclosporine capsule 100mg 828 d penicillamine 250mg capsule 829 dextrose 5% 500 ml glass bottle injection 830 daratumumab 100 mg injection 831 daratumumab 400 mg injection 832 darbepoietin alfa 100mcg injection 833 darbepoietin alfa 200 mcg injection 834 darbepoietin alfa 500mcg injection 835 decitabine 50 mg injection 836 decitabine 100 mg injection 837 degarelix 80 mg injection 838 dacarbazine 200mg injection 839 degarelix 120 mg injection 840 degludec insulin 300lu/3ml injection 841 denosumab 120 mg injection 842 deriphylline 1 ampul injection 843 detemir insuline injection 844 dexmedetomidine 100mcg/ml 845 dextran 40 injection 846 diazoxide 300 mg/20ml injection 847 digoxin 2mg injection 848 diitiazem 25 mg injection 849 danazol capsule 100mg 850 docetaxel 120 mg injection 851 doxycyciine for injection 100 mg injection 852 durvalumab 120 mg injection 853 durvalumab 500mg injection 854 enalapril 1.25 mg 1 ml injection 855 ephedrine 30 mg/ml injection 856 epirubicin 50mg/ml injection 857 epirubicin 150mg/ml injection 858 eribulin 0.5mg injection 859 eribulin 1 mg injection 860 evening primosa capsule 1000mg 861 ertapenem sodium igm = ertapenem 1.046 gm injection 862 etomidate 20 mg injection 863 etomidate mct/lct 10ml vial injection 864 fentanyl 25 lu patch 865 fentanyl 50 lu patch 866 fluconazole 100mg injection 867 fluconazo!e 200 mg injection 868 fludarabine phosphate injection 100mg injection 869 fludarabine phosphate injection 50mg tnjection 870 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography injection 871 formetrol 12mcg and budesonide 400 mcg respule 872 fluphenazine deconate injection (long acting) 25mg/ml ampule injection 873 folic acid and methylcobalamine 10 ml pack injection 874 fondaparinux 2.5mg injection 875 fosphenytoin sodium 150mg/ml injection 876 fsh 75 lu injection 877 fsh 150 lu injection 878 fulvestrant 250mg injection 879 gdw 5% glass bottle/500ml injection 880 glyceryl trinitrate injection, diluted 5mg/ml injection 881 goserelin acetate implant 3.6 mg injection 882 indacaterol and glycopyronium inhalation powder capsule 110/50 mcg 883 haemocoagulase 1 ml injection 884 haloperidol (long acting) 50mg/ml ampoule injection 885 horse atg(anti thymocyte globulin) 250 mg injection 886 hp hmg (highly human menopausal parodied gonadotropin) 150 lu injection 887 hp hmg (highly human menopausal parodied gonadotropin) 75 lu injection 888 hydralazine 20mg/ml injection 889 indomethacin lyophilized powder 1mg injection 890 inotuzumabl mg injection 891 insulin aspart injection 892 insulin glulisine (monocomponent insulin glulisine) 100 lu/ml/3 ml cartridges injection 893 isotretinoin capsule 10mg 894 insulin glulisine (monocomponent insulin glulisine) 100 lu/ml/3 ml prefilled pen injection 895 insulin lispro injection 896 interferon beta 1 a 30mg injection 897 intralipds injection 898 invert sugar 10% (fructodex 10%) 500 cc injection 899 lohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml injection 900 ipilimumab 50 mg injection 901 irinotecan 40mg/5ml injection 902 irinotecan 100 mg/5ml injection 903 isolyte g injection 904 isotretinoin capsule 20mg 905 isolyte p 10%500 ml injection 906 lacosamide infusion injection 907 levobupivacaine 0.5% (20mg/4ml) ampute injection 908 levofloxacine 500mg/100 ml injection 909 levosulpride 12.5 mg/ml injection 910 lignocaine (preservative free) 2% injection 911 lignocaine and adrenaline (1: 10000, 2: 10000) injection 912 lignocajne 10% spray injection 913 lignocaine hydrochloride 2% 50ml vial injection 914 liposomal doxorubicin 20mg injection 915 lomustine capsule 40mg 916 liposomal doxorubicin 50 mg injection 917 lorazepam 1.0 mg injection 918 lorazepam 5 mg injection 919 l orinithine l aspartate 10 ml injection 920 low molecular wt. heparin 0.4mg injection 921 mephentermine 50mg/ml injection 922 meropenem 2gm injection 923 mesna 200 mg/2ml (sod. mercaptoethane sulphate) injection 924 methotrexate 250 mg injection 925 methotrexate 1000 mg injection 926 minocycline capsule 100mg. 927 methylene blue injection 928 methylprednisolon acetate 40mg injection 929 methylprednisolon acetate 125mg injection 930 metotrexate 15mg (preservative free) injection 931 midazolam 5mg/ml 1 ml injection 932 milrinone 10 mg injection 933 mitomycin 2 mg injection 934 mitomycin 40 mg injection 935 mitoxanthrone infusion 10 mg injection 936 mitoxanthrone infusion 20mg injection 937 alpha and lipoic acid and leycopen and multivitamin and miltiminerals capsule 938 mycophenoiate mofetii capsule 500mg 939 moxiftoxacin intra cameral 0.5% injection 940 moxifloxin 400mg/100ml injection 941 multivitamin 10 ml injection 942 nabpaclitaxel (paclitaxel nano particle)100 mg injection 943 nandrojone decanoate 100mg injection 944 nandroione decanoate 50 mg injection 945 natalizumab 300 mg injection 946 neostigmine and glycopyrrolate 2.5 mg/ 0.5 mg injection 947 netiimycin 300mg/3ml injection 948 nicardipin 10mg injection 949 netupitant and palonosetron capsule 300mg and 0.5mg 950 nicorandil 48 mg injection 951 nimodipine infusion 10mg/50 ml injection 952 nimotuzumab 50 mg injection 953 nivolumab 40 mg injection 954 nivolumab 100 mg injection 955 normal saline 500 ml glass bottle injection 956 normal saline 1000 ml glass bottle injection 957 octreotide 100mg injection 958 octreotide lar (long acting release) 20 mg injection 959 octreotide lar (long acting release) 30 mg injection 960 ramipril capsule ip 5mg 961 lidocaine l% intra cameral injection 962 omalizumab 150 mg vial injection 963 ornidazdle 500mg injection 964 palonosetron 0.25mg injection 965 paracetamol infusion 500 mg with both temper evident caps spray 10% injection 966 paracetamol infusion 1000 mg with both temper evident caps spray 10% injection 967 peg asparaginase 3750 fu 5 mi injection 968 peg filgrastim injection 6mg injection 969 pembrolizumab 50 mg injection 970 pembrolizumab100 mg injection 971 rucaparib capsule 200mg 972 pemetrexed 100mg injection 973 pemetrexed 500 mg injection 974 pertuzumab 100 mg injection 975 phenylephrine hydrochloride 10 mg/ml injection 976 pilocarpine 0.5% w/v injection 977 piperacillin 1 gm and tazobactum 125 mg injection 978 piracetam 200mg injection 979 placental extract 2ml injection 980 pierixafor 24 mg injection 981 polymyxin b for injection 1 million injection 982 rucaparib capsule 300mg 983 potassium chloride for injection injection 984 procaine penicillin fortified 2 lack injection 985 protamine sulphate 5ml injection 986 rabbit atg (anti thymocyte globulin)100 mg injection 987 ramucirumab 100 mg injection 988 ramucirumab 500 mg injection 989 ranizumab 10mg/ml injection 990 rasburicase 1.5 mg injection 991 recombinant fsh 150 lu injection 992 recombinant fsh 3001u injection 993 silodosin capsule 4mg 994 recombinant hcg 250 lu injection 995 recombinant lh 751u injection 996 reteplase 18 mg injection 997 risperidone prolonged released depot 25 mg injection 998 risperidone prolonged released depot 50mg injection 999 rituximab 100 mg injection 1000 rituximab 500 mg injection 1001 rocuronium ioomg/10ml injection 1002 romiplostim 125 mcg injection 1003 romiplostim 250 mcg injection 1004 silodosin capsule 8mg 1005 romiplostim 500 mcg injection 1006 ropjvacaine 0.75% 20m] vial injection 1007 ropivacaine 0.75% 3 ml ampule (heavy) injection 1008 secukinumab 150 mg injection 1009 sildenafil 0.8mg injection 1010 sodium bicarbonate injection 1011 sodium fluroresceine dye 20% injection 1012 sodium hyaluronate 1.4mg injection 1013 streptomycin igm injection 1014 streptomycin 500mg injection 1015 temozolamide capsule 250mg 1016 sugmadex injection 1017 teicoplanin 200 mg injection 1018 teicoplanin 400 mg injection 1019 tenecteplase 20mg injection 1020 tenecteplase 40 mg injection 1021 testosteron propionate 50mg injection 1022 testosteron propionate 250mg injection 1023 thiamine 100ml injection 1024 ticarcillin and clavulanic acid injection 1025 tigecycline for injection 50mg injection 1026 vitamin a capsule 25000 lu 1027 tigecycline for injection 100mg injection 1028 tobaramycin 80mg injection 1029 topotecan 1 mg injection 1030 topotecan 2.5 mg injection 1031 topotecan 4 mg injection 1032 t pa 20mg alteplase for injection 1033 t pa 50mg alteplase for injection 1034 trabectedin 1 mg injection 1035 tranexamic acid 500mg/5ml injection 1036 trastuzumab 440 mg injection 1037 carbolic acid solution 50% in 500 ml solution 1038 trastuzumab 15()mg injection 1039 triamcinolone acetonide 10 mg per mt injection 1040 triamcinolone acetonide 40 mg per ml injection 1041 trypan blue 0.6% injection 1042 triptoretin 0.1 mg injection 1043 triptorelin 3.75 mg injection 1044 triptorelin 11.25 mg injection 1045 varicella immunoglobulin for iv use injection 1046 vasopressin 3ml injection 1047 verapamil 2.5 mg/ml injection 1048 glucosamine and hydrochloride and methylsulfonylmethane capsule 1049 carbolic acid solution 100% in 500 ml solution 1050 vinorelbine 10mg injection 1051 vinorelbine 50mg injection 1052 vitamin d (600000 lu) injection 1053 insulin glargine 300 lu per mt/prefitled pen injection 1054 insuiine 50/50 injection 1055 xylocaine lubricating 30gm jelly 1056 lignocaine 4% 30ml 1057 lignocaine viscous 1058 liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd ob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) injection 1059 l ornithiné l aspartate (150mg) and pancreatin capsule 100mg 1060 continuous ambulatory peritonedialysis fluid 2 ltr 1061 asceptic chlorhexadine gluconate 7.5% and =15% cetrimide solu and isopropyl 17% lotion 1062 clotrimazole 1% and bectomethasone 0.25% lotion 1063 ketaconazole 2% lotion 1064 minoxidil 2% lotion 1065 minoxidil 5% 1066 minoxidit 10 % lotion 1067 podophyliin toxin lotion 1068 sulphur and calamine lotion 1069 sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 lotion 1070 clotrimazole 10mg lozenses 1071 lidocaine 25mg and prilocaine 25mg cream 1072 medium chain triglyceride oil 1073 budesonide 200 mcg. mdi 1074 formeterol 6mcg, and fluticasone 250 mcg. inhalation mdi 1075 formoterol 6 mcg. and budesonide 200 mcg. mdi 1076 formoterol 6 mcg. and budesonide 400 mcg. mdi 1077 leosalbutamol 50mcg. and ipratopium 40mcg. mdi 1078 levosalbutamol inhalation solution 50ml/gm mdi 1079 lignocaine 1% mouth paint 1080 hydrogen peroxide 1.5% mouthwash 1081 fluticasone ft nasal spray 1082 ointment (modified lanolin) cream 1083 midazolam 0.5mg/5ml nasal spray 1084 neomycin sulphate and bacitracin zinc ointment usp 5 mg and 500 lu/gm ointment 1085 sodium chloride 0.9% 3000ml(n.s) injection 1086 sodium chloride bottel 100ml injection 1087 magnesium sulphate, sulphacetamide, urea 75 gm ointment 1088 clobetasol and salicylic acid 0.5% and 6% ointment 1089 heparin 50 lu benzyl nicotinate 2 mg ointment 1090 fluticasone ointment 1091 neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip ointment 1092 tacrolimus o .03% 15 gm ointment 1093 aloe vera moisturizing cream 1094 tacrolimus o .1% 15 gm ointment 1095 zinc oxide and alo vera and semethicone ointment 1096 omega 3fatty acid 50ml 1097 caffiene citrate oral solution oral drop 1098 mercunium chloride paint 1099 salicylic acid 16.7% and lactic acid 16.7% paint 1100 coloplast 60 gm paste 1101 eeg 400gm paste 1102 diclofenac each transdermal patch contain 200 mg diclofenac patch 1103 povidone iodine pessary 1104 amophous hydrogel with colloid silver wound dressing cream 1105 milk low birth formula powder 1106 recombinant human growth hormone 41u vial with syringe injection 1107 enterogermina 2billion spores 5ml respules 1108 formeterol 20mcg and budesonide 0.5mg respules 1109 levosalbutamol 2.5 mg and ipratropium 500 mcg 2.5 ml respules 1110 n acetylcysteine (nac) 200mg/ml respule 1111 budesonide 0.5mg/ml respules 1112 budesonide imi respules 1113 glycopyrronium 25mcg. inhalation 2ml. respules 1114 sodium chloride 3 % respules 1115 amorolfine 0.25% cream 1116 tiotropium bromide dry powder 30/pack respules 1117 revolizer/ rotahaler device 1118 root canal sealer (calcium carbonate) 1119 fosfomycin 3gm sachet 1120 hmf for pretem sachet 1121 l arginine and proanthocynadine granules 3mg sachet 1122 polyethyene glycol and sodium chloride and sodium bi carbonate and potassium chloride sachet 1123 racecadotril sachet 30 mg sachet 1124 etanercept 25mg/o.5ml injection 1125 polyethyene glycol with elctrolyte approx 130gm solution 1126 azelaic acid 20% cream 1127 lidocaine20ml spray 1128 super 1129 mesa 1130 glycerin 2 gm/ml suppsitory 1131 paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory 1132 cefaclor each 5 ml contain cefaclor 125 mg syrup 1133 codiene phosphate syrup 1134 amlodipine oral solution 1 mg/ ml syrup 1135 artemether 40mg and lumefantrine 240 mg 30m! syrup 1136 b. complex syrup 1137 benzoyl peroxide 2.5 % cream 1138 badöfen oral solution 5 mg /mi syrup 1139 calcium phosphate 200 ml syrup 1140 cefixime oral suspension 5()mg syrup 1141 cefixime oral suspension 100mg syrup 1142 cefpodoxime proxetil oral suspension 50mg syrup 1143 cefpodoxime proxetil oral suspension 100mg syrup 1144 cefuroxime axetil oral suspension 125mg/5ml syrup 1145 clarithromycin for ora! suspension 125mg/5ml syrup 1146 cefoperazone 1mg inj. injection 1147 cyclosporine oral solution 100mg/mi syrup 1148 desonide 0.05% cream 1149 rabbit atg (anti thymocyte globulin) 250 mg injection 1150 cyproheptadine 200ml syrup 1151 dextromethorphan hci and chiorpheniramine syrup 1152 diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml syrup 1153 drotavarine syrup 1154 each 15 ml contains: milk of magnesia 11.25 ml and liquid paraffin 3.75 mt 170 mt syrup 1155 each 5 ml containing : paracetamol 125 mg and ibuprofen 100 mg 60 ml syrup 1156 enzyme 100 ml syrup 1157 esomperazole syrup 1158 fluconazole ora) suspension syrup 1159 racecadotril capsule 100mg 1160 fenticonazole 2% cream 1161 furosemide oral solution 10mg/30ml syrup 1162 l carnitine 500mg/5ml in 30 ml syrup 1163 l carnosine ioomg/5mi in 200m) syrup 1164 levofloxacin oral solution syrup 1165 linezolid ioomg/5m! in 30ml syrup 1166 mefenamice acid 100mg/5mi syrup 1167 mefenemic acid 50 mg and paracetamol 250 mg /60 ml syrup 1168 melatonin 60 ml syrup 1169 montelucast and levocetrizine syrup 1170 nitrofurantoin oral suspension 25mg/5ml in 100 syrup 1171 glycolic acid 6% cream 1172 ondansetron oral suspension syrup 1173 oxybutynin oral suspension5 ml syrup 1174 phenobarbitone 20mg/5mi in 100ml syrup 1175 prednisolone tablet ip 50mg 1176 piracetam 500mg/5ml in 100mt syrup 1177 potassium magnesium citrate syrup 1178 ranitidine oral suspension syrup 1179 rifaximin syrup 1180 sodium bicarbonate oral suspension syrup 1181 sodium picosulphate oral suspension syrup 1182 hydrocortisone 1% cream 1183 sorbitol and trichotine citrate syrup 1184 sucralphate syrup 1185 triclofos ora! suspension500 mg/ smi in 30m} syrup 1186 ursodeoxycholic oral suspension 125mg/5ml in 100ml syrup 1187 zinc oral suspension 20 mg/loo ml syrup 1188 azithromycin oral suspension 100mg/5ml syrup 1189 azithromycin oral suspension 200mg/5ml syrup 1190 midodrine tablet 5mg 1191 hydroxyurea tablet/capsuie 500mg 1192 coq tablet/capsule 300mg(capsule of co enzyme qio with lycopene, selenium & omega 3 fatty acid ) 1193 hydroquinone 2% cream 1194 everolimus tablet/capsule 5mg 1195 everolimus tablet/capsute 10mg 1196 tacrolimus tablet/capsule 0.25 1197 nintedanib tablet/capsule 150mg 1198 6 mercaptopurine tablet 20mg 1199 acebrophylline sr tablet 200mg 1200 aceclofenac and thiocofchicoside tablet 1201 aceclofenac sr tablet 200mg 1202 aceclofenac and paracetamol and serratiopeptidase tablet (100 and 325 and 15 mg) 1203 afatinib tablet 20mg 1204 kojic acid 2%, arbutin,niacinamide cream 1205 afatinib tablet 30mg 1206 afatinib tablet 40mg 1207 alendronate sodium tablet 70mg 1208 alfuzosin tablet 10mg 1209 alpelisib tablet 150mg 1210 alpelisib tablet 200mg 1211 ajpejjsjb tablet 250mg 1212 amantidine tablet 100mg 1213 amisulpride tablet 50mg 1214 apixaban tablet 2.5mg 1215 luliconazole 1% cream 1216 apixaban tablet 5mg 1217 aripiprazole tablet 10mg 1218 aripiprazole tablet 5mg 1219 aspirin tablet ip 300mg 1220 aspirin dispresible tablet 325mg 1221 atomoxetin tablet 10mg 1222 atomoxetin tablet 18mg 1223 atomoxetin tablet 25mg 1224 atroxentine tablet 250mg (trientine hcl) 1225 axitinib tablet 5mg 1226 mometasone 0.1 % cream 1227 bilastin tablet 20mg 1228 biotin tablet 5mg 1229 bosentan tablet 62.5mg 1230 bosutinib tablet 500mg 1231 brivaracetam tablet 50mg 1232 buprinorphine tablet 2mg 1233 calcium acetate tablet 667 1234 calcium folinate tablet 15mg 1235 capmatinib tablet 200mg 1236 carbimazole tablet 10mg 1237 mometasone 2% cream 1238 cefixime and potassium clavulanate tablet 200 and 125mg 1239 cefpodoxime proxetil tablet 100mg 1240 cefpodoxime tablet 200mg 1241 cefpodoxime tablet 375 1242 chlordiazepoxide tablet 25mg 1243 chlordiazsepoxide tablet 10 mg and clidinium 25 mg 1244 chlorthalidone tablet 6.25mg 1245 choichicine tablet 0.5mg 1246 cilostazol tablet 50mg 1247 cilostazol tablet 100mg 1248 neomycin sulphate cream 1249 clarithromycin tablet 250mg 1250 clarithromycin tablet 500mg 1251 cilnidipine tablet 5mg 1252 cilnidipine tablet 10mg 1253 cilnidipine tablet 20mg 1254 clonazepam tablet 0.25 1255 clonazepam tablet 1mg 1256 clozapine tablet 25mg 1257 clozapine tablet 50mg 1258 clozapine tablet ioomg 1259 permethrin 1% rinse cream 1260 cotriamazole tablet 480mg 1261 cefuroxime axetil tablet 500mg. 1262 cyproheptadine tablet 4mg 1263 cyproterone acetate 2 mg and ethynil estradiol. tablet 035mg 1264 dabigatran tablet 150mg 1265 dabigatran tablet 110mg 1266 dabrafenib tablet 50mg 1267 dacomitinib tablet 15mg 1268 dacomitinib tablet 30mg 1269 dapagliflozin tablet 10mg 1270 rabeprazole and levosulpiride capsule 1271 adaplene (0.1% w/w) gel 1272 dapoxetine tablet 30mg 1273 dapsone tablet 100mg 1274 deflazacort tablet 6mg 1275 deflazacort tablet 12mg 1276 desvenlafaxine tablet 50mg 1277 diclo & sera & para. 1278 diclofenac and thiocolchicoside tablet 1279 dienogest tablet 2mg 1280 diltiazem prolonged released tablet 90mg 1281 dimethyl fumarate tablet 120mg 1282 desflurane usp 240 ml bottle solution 1283 dimethyl fumarate tablet 240mg 1284 disulfiram tablet 125mg 1285 disulfiram tablet 250mg 1286 donepezil tablet 5mg 1287 duloxetine gastro resistant tabiet 20mg 1288 duloxitine gastro resistant tablet 30mg 1289 dydrogesterone tablet 10mg 1290 eltrombopag tablet 25mg 1291 eltrombopag tablet 50mg 1292 empagliflazone tablet 10mg 1293 dextrose with sod.chloride polypack 5% 500ml injection 1294 empag!iflazone tablet 25mg 1295 entacapone tablet 200mg 1296 eriotinib tablet 150mg 1297 eriotinib tablet ioomg 1298 esomeprazole tablet 40mg 1299 estradioi valerate tablet 2mg 1300 estradiol valerate cream 1301 enzalupamide tablet 40mg 1302 ethynil estradiol tablet 0.02mg and desogestrat tablet 0.15mg 1303 etizolam tablet 0.5mg 1304 distilled water 10ml injection 1305 etoricoxib and thiocolchicoside tablet (60mg and 8mg) 1306 exemestane tabiet 25mg 1307 febuxostat tablet 40mg 1308 febuxostat tablet 80mg 1309 fexofenadine tablet 120mg 1310 fexofenadine tablet 180mg 1311 fingolimod tablet 0.5mg 1312 fludrocortisone tablet 100mcg 1313 flunarizine tablet 10mg 1314 fluvoxamine tablet 100mg 1315 sodium chloride and dextrose 0.45% infusion 500ml injection 1316 ftuvoxamine tablet 50mg 1317 folinic acid tablet 15mg 1318 formaline tablet 1319 furosemide tablet 20mg and spironoåactone tablet 50mg 1320 glucosamine hydrocloride tablet and diacerin 50 tablet mg 1321 brutinib tablet 140mg 1322 indomethacin tablet 75mg 1323 inositol and myoinositol tablet 1000mg 1324 ivabradine tablet 5mg 1325 ivermectin tablet 6mg and albendazole tablet 400mg 1326 salrhetrol 50mg and fluticasone 500 mcg dpi 1327 ivermectin tablet 6mg 1328 ivermectin tablet 12mg 1329 ketoconazole tablet 200mg 1330 lacosamide tablet 50mg 1331 lamotrjgine dispersible tablet 100mg 1332 lapatinib tablet 500mg 1333 lenalidomide tablet 25mg 1334 lenalidomjde tablet 10mg 1335 lenvatinib tablet 4mg 1336 lenvatinib tablet 10mg 1337 budesonide 400 mcg dpi 1338 levetiracetam tablet ip 250mg 1339 levodopa and carbidopa tablet 125 1340 levodopa and carbidopa and entacapone tablet 100mg/25mg/200mg 1341 levofloxacin tablet 750mg 1342 levosulpride tablet 75mg 1343 levothyroxine sodium tablet 25mcg 1344 levothyroxine sodium tablet 75mcg 1345 linaglipitin tablet 2.5mg 1346 linaglipitin tablet 5mg 1347 lopinavirtablet 200mg and ritonavir tablet 50mg 1348 glycopyrronium 25 and formoterol 6 mcg dpi 1349 loratadine tablet 10mg 1350 loriatinib tablet 25mg 1351 loriatinib tablet 100mg 1352 megestrol acetate tablet 160mg 1353 melatonin tablet 3mg 1354 melphalan tablet 2mg 1355 metolazone tablet 5mg 1356 methimazole tablet 5mg 1357 methimazole tablet 10mg 1358 methotrexate tablet 7.5mg 1359 glycopyrronium 25 dpi 1360 methotrexate tablet 15mg 1361 methylphenidate tablet 10mg 1362 methylprednisolone tablet 4mg 1363 methylprednisolone tablet 16mg 1364 methylprednisolone tablet 8mg 1365 meverberine tablet 135mg and chlordiazepoxide tablet 10mg 1366 midostaurin tablet 25mg 1367 mirabegeron tablet 25mg 1368 mirabegeron tablet 50mg 1369 mirtazapine tablet 7.5mg 1370 glycopyrronium 50 dpi 1371 mirtazapine tablet 15mg 1372 mifepristone tablet 25mg 1373 montelukast tablet 4mg 1374 montelukast tablet 5mg 1375 montelukast tablet 10mg 1376 morphine tablet 10mg 1377 morphine tablet 30mg 1378 moxifloxacin tablet 400mg 1379 moxonidine tablet 0.2mg 1380 moxonidine tablet 0.3mg 1381 acitretin cap ip 10 mg 1382 levosalbutamol 100mcg and ipratropium bromide 40mcg dpi 1383 n acetylecystine effervescent form, orange flavour tablet 600 mg 1384 naitrexone tablet 50mg 1385 nebiv.olol tablet 5mg 1386 nebivolol tablet 10mg 1387 nicorandil tablet 5mg 1388 nicoumalone tablet 1mg 1389 nicoumalone tablet 3mg 1390 nicoumalone tablet 4mg 1391 nifidipine tablet 20mg 1392 nifidipine tablet 20mgsr 1393 diastase pepsin with simethicone 15 ml drop 1394 nilotinib tablet 150mg 1395 nilotinib tablet 200mg 1396 nilotinib tablet 300mg 1397 nitazoxanide tablet 500mg 1398 nitrazepam tablet 5mg 1399 nitrazepam tablet 10mg 1400 olaparib tablet 50mg 1401 olaparib tablet 150mg 1402 olmesartan medoxomil tablet 20mg 1403 orciprenaline tablet 10mg 1404 furosemide 10mg/ml drop 1405 osimertinib tablet 80mg 1406 oxcarbazepine tablet 300mg 1407 oxcarbazepine tablet 450mg 1408 oxazepam tablet 15mg 1409 pancreatin gastroresistant tablet 10,000mg (with proteiase & amylase) 1410 pantoprazole tablet 20mg 1411 paracetomol tablet 650mg 1412 paroxetine tablet 12.5mg 1413 paroxetine tablet 25mg 1414 pazopanib. tablet 200mg 1415 ondansetron oral solution 30 ml drop 1416 pazopanib tablet 400mg 1417 penicillin tablet v400mg 1418 pentoxifyiline extended release/sr tablet 400mg 1419 perampanel tablet 2mg 1420 perampanel tablet 4mg 1421 pheniramine tablet 25mg 1422 phenozopyridine tablet 200mg 1423 pirfenidone tablet 200mg 1424 pirfenidone tablet 400mg 1425 piroxicam tablet dt20mg 1426 prednisoione acetate opthalmic suspension 10 mt eye drop 1427 pomalidomide tablet 2mg 1428 pomalidomide tablet 4mg 1429 posacozazole tablet 100mg 1430 posacozazole tablet 40mg/ml 1431 prasugrel tablet iomgtab 1432 prazosin tablet 5mg 1433 prednisolone tablet ip 40mg 1434 primidone tablet 50mg 1435 primidone tablet 250mg 1436 prochlorperazine tablet 5mg 1437 terbutalin drop 1438 progesterone tablet onlypills 1439 propranofol tablet 10mg 1440 propranoloi tablet 40mg sr 1441 propylthiouracil tablet 100mg 1442 pyridoxine tablet 100mg 1443 ranolazine tablet 500mg 1444 rasagiline1mg tablet 1445 regorafenib tablet 40mg 1446 repaglinamjde tablet 0.5mg 1447 repagiinamide tablet 1mg 1448 hydroxyzine oral solution 15 ml drop 1449 ribociclib tablet 200mg 1450 rifampicin tablet 150mg 1451 rifampicin tablet 450mg 1452 rifampicin tablet 600mg 1453 rifaximin tablet 200 1454 rifaximin tablet 550mg 1455 rivaroxaban tablet 10mg 1456 rivaroxaban tablet 15mg 1457 rivaroxaban tablet 20mg 1458 rizatriptan tablet 10mg 1459 ambroxol drop 1460 ropinirole tablet 0.25mg [nrd.770] 1461 rosuvastatin tablet 10mg and fenofibrate tablet 160mg 1462 ruxolitinib tablet 5mg 1463 ruxolitinib tablet 10mg 1464 ruxolitinib tablet 15mg 1465 ruxolitinib tablet 20mg 1466 selegiline tablet 5mg 1467 serratiopeptidase tablet 10mg 1468 serratiopeptidase tablet 20mg 1469 seveiamer carbonate tablet 800mg 1470 anticoid drop 1471 sildosin and tablet dutasteride 1472 silymarin tablet 70mg. 1473 sitagliptine and metformin tablet (50/500) 1474 sifdenafi tablet 20mg 1475 sofosbuvir tablet 400mg and velpatasvir tablet 100mg 1476 solifenacin succinate tablet 10mg 1477 sorafenib tablet 200mg 1478 sultamicin tablet 375mg 1479 sunitinib tablet 12.5mg 1480 sunitinib tablet 25mg 1481 astymine c (vitamin c and essential amino acid) drop 1482 sunitinib tablet 50mg 1483 tacrolimus tablet 1mg 1484 tamsulosin and dutasteride tablet 1485 tapentadol tablet 50mg 1486 tegafur and uracil tablet 100mg 1487 tenofovir tablet 300mg 1488 tetrabenazine tablet 25mg 1489 ticagrelor tablet 90mg 1490 tofacitinib tablet 5mg 1491 tolvapatan tablet 15mg 1492 acitretin capsule 25mg 1493 enzyme drop 1494 topiramate tablet 50mg 1495 torsemide tablet 20mg 1496 tramadol tablet 37.5mg and paracetamol tablet 325mg 1497 trametinib tablet 0.5mg and davarafenide tablet 150mg 1498 trimetazidine tablet 35mg 1499 trimetazidine tablet 60mg 1500 trypsin and rutoside and bromelain tablet 1501 trypsin chymotripsin tablet 1502 ulipristal tablet 5mg 1503 voriconazole tablet 200mg 1504 iron (ferrous ascorbate) drop 1505 verapamil hydrochloride tablet sustained release 40mg 1506 verapamil hydrochloride tablet sustained release 120mg 1507 vildagliptin tablet 50mg 1508 voglibose tablet 0.2mg 1509 voglibose tablet 0.3mg 1510 warfarin tablet 1mg 1511 warfarin tablet 2mg 1512 warfarin tablet 3mg 1513 zinc tablet 50mg 1514 zolpidem tablet 10mg 1515 simethicon 40mg and dili oil 0.005ml and fennel oil 0.0007m130 ml drop 1516 zonisamide tablet 50mg 1517 zonisamide tablet 100mg 1518 tiotropium 9mcg inhaler 1519 human albumin 20% injection 50 ml vial 1520 tetanus vaccine (adsorbed) injection ip in 0.5 ml 1521 vitamin e 50mg/ml, 400 drop 1522 vitamin d3 4001u/ml drop 1523 vitamin 03 8001u/ml drop 1524 cefpodoxime oral suspension 20mg/ml drop 1525 lactulose enema 1526 docosahexaenoic 30ml drop 1527 acetic acid otic solution 2% ear drop 1528 alectinib capsule 150mg 1529 gentamycin ear drop 1530 digoxin 0.25% elixir 1531 carboxymethylceellulose and glycerin eye drop 1532 moxifloxacin and difluoprednate eye drop 1533 natamycin opthalmic suspension 5% eye drop 1534 olaptadine & ketoroiac eye drop 1535 polymyxin b 100001u/gm and neomycin 34001u/gm eye drop 1536 betadin 5% eye drop 1537 brinozolamide and brimonidine eye drop 1538 cpm and cmc and nephazoline eye drop 1539 potassium permanganate powder 1540 potassium permanganate powder 1541 formula feedlbw powder 1542 nitroglycerin 2.6 tablet 1543 activated charcol tab. 500 mg 1544 sodium hyaluronate 1.4 % opthamalic solution 1545 proparacaine 0.5% w/v eye drop ...

Medical Health And Family Welfare - Rajasthan

33304789 supply of medicine and surgical items supply of medicine and surgical items , anaesthetics , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , butorphanol tartrate injection usp 1mg / ml 1ml size , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , absorbable sutures , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 , non absorbable surgical suture sterilised surgical needled suture , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 , polyglecraprone 25 monofilament sutures , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , monofilament polydioxanone suture , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , antibacterial coated suture , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , surgicals , absorbable gelatin sponge 80 x 50x 10mm , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set blood transfusion set , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) , suction catheter, sterile.size: fg 5 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , suction catheter, sterile. size: f g 20 , suction catheter, sterile. size: f g 22 , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , infant feeding tube size 10fg , infant feeding tube size 8fg , infant feeding tube size 5fg , perfusion set with airway and needle, ( adult use ) sterile disposable , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g , mucus extractor sterile , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size:14 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , scalp vein set ( disposable ) size 18g , scalp vein set ( disposable ) size 20g , scalp vein set ( disposable ) size 22g , scalp vein set ( disposable ) size 24 g , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , surgical blade sterile, size 11 , surgical blade sterile, size 15 , surgical blade sterile, size 22 , suture needles curved 1 / 2 circle round body assorted size 11 15 , suture needles curved 1 / 2 circle round body assorted size 1 5 , suture needles curved 1 / 2 circle round body assorted size 16 20 , suture needles curved 1 / 2 circle round body assorted size 6 10 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 , suture needles curved and cutting 1 / 2 circle size 11 15 , suture needles curved and cutting 1 / 2 circle size 16 20 , suture needles curved and cutting size 1 5 , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , urine collecting bag, disposable 2000 ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal tube, plain size 5 , endotracheal tube, plain size 5.5 , endotracheal tube, plain size 6 , endotracheal tube, plain size 6.5 , endotracheal tube, plain size 7 , endotracheal tube, plain size 7.5 , endotracheal tube, plain size 8 , endotracheal tube, plain size 8.5 , endotracheal tube, cuffed size 4 , endotracheal tube, cuff size 4.5 , endotracheal tube, cuff size 5 , endotracheal tube, cuff size 6 , endotracheal tube, cuff size 6.5 , endotracheal tube, cuff size 7 , endotracheal tube, cuff size 7.5 , endotracheal tube, cuff size 8 , endotracheal tube, cuff size 8.5 , endotracheal tube, cuff size 9 , tracheostomy tube, plain all sizes , tracheostomy tube ( pvc ) , cuffed all sizes , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , corrugated drainage sheet all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm , bone wax sterilised , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , skin graft knife blade ( sterile ) , k wire, length 375 mm; 1mm , k wire, length 375 mm; 1.6mm , k wire, length 375 mm; 1.8mm , face mask, disposable , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , foldable intra ocular lense with injector 11 to 17.5 , foldable intra ocular lense with injector 18 to 24 , foldable intra ocular lense with injector 24.5 to 28.5 , standard pama intra ocular lenses 11 to 17.5 , standard pama intra ocular lenses 18 to 24 , standard pama intra ocular lenses 24.5 to 28.5 , disposable sterile surgical rubber gloves size 8 inches, powdered , disposable sterile surgical rubber gloves size 8 inches, powder free , rubber examination gloves, non sterile, extra small , rubber examination gloves, size small , rubber examination gloves, size medium , rubber examination gloves made of natural rubber latex, non sterile, size large , pressure monitoring line / high pressure extension line , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , umbilical catheter for new born, all sizes , umbilical cord clamp , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 , t tube for common bile duct drainage, length 20x60 cm, size , bone cement , sanitary napkin beltless , sanitary pads belt type , sanitary napkin beltless with wings , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 , nelaton catheter size 14 fg , ecg electrode , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support , nebulization mask adult , nebulization mask paediatric , chemotherapy port and non coring needles ( adult ) , chemotherapy port & non coring needles ( pediatric ) , swine flu drugs , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , anti malerial drugs , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , covid19 , liposomol amphotericine injection b 50mg , non edl items , proparacaine eye drops , tryphan blue dye , keratome 2.8 mm , crescent , side pot 15 degree , pilocarpine injection...

Indian Army - Rajasthan

33283758 supply of consumables and expendable medical stores , abdominal binder xl size , abipyllin 100 mg tab , aceclofenac 100 mg tab , aceclofenac 100mg+paracetamol 325mg+serratiopeptidase 10mg tab , acitrom 2 mg tab ( nicoumalone ) , acotinamide 100 mg tab , adhesive micropore , adsan ( sadonein, methonine ) 400mg tab , albendazole 400 mg tab , albumin kit , aldectone 50 tab ( spironolactone ) , alfuzocin 10 mg tab , alpha ketoanalogue tab , alphacalcidol 0.25 mcg cap , amiodarone hcl 100 mg tab , amlodipine 10 mg tab , amlodipine 2.5 mg tab , amloride 5mg+frusemide 40mg tab , ampicillin 220mg + sulbactum 148mg tab , anti haemorrhoidal oint tube of 20 gm , apixaban 2.5 mg tab , aspirin 75 mg + atorvastatin 10 mg , aspirin 75 mg + clopidogrel 75 mg tab , atarax 25 mg tab , atenolol 50 mg + amlodipine 5 mg tab , atorvastatine 10mg +fenofibrate 160 mg tab , atorvastatine 40mg tab , b complex forte with zinc & vit c tab , baclofen 10mg tab , baclofen 20 mg tab , bandage crepe: 10 cm , bandage crepe:15 cm , bandage roller 2.5 cm pkt of 10 , bandage roller 9 cm pkt of 10 , beclomethasone & salicylic acid oint tube of 20 gm , bethanechol 25 mg tab , bisacodyle 5 mg tab ( vegilex ) , bisoprolo 5 mg , bisoprolol 2. 5 mg tab , blood grouping kit , blood sugar kit , bosentan 62.5 mg tab , brivaracetam ( briviact ) 50 mg tab , calcitonin nasal spray , calcium + vit d3 syp 200ml bott , calcium aspartate 500 mg + calcium orotate 500 mg + cholecalciferol 0.25 mg + em 50 mg + fa 1.5 mg + hydroxycobalamin tab , cap vit e 400 mg ( evion ) , carbamazepine 400 cr tab , carbamazepine 400mg sr tab , carbidopa 25mg + levodopa 100 mg tab , carbidopa 50 mg + levodopa 200 mg tab , carbimazole 10 mg tab ( neomercazole ) , carvedilol 25 mg tab , carvedilol 6.25 mg tab , catheter k 91 , catheter male med size , cerevate 90 mg + vit d3 tab , cervical collar soft , cetrizine 5mg+paracetamol 325mg+phenylephrine hcl 5mg ( cold plus ) , chlordiazepoxide 10 mg tab , chloroxylenol sol jar of 5 ltr , chlorthalidone 6.25 mg + cilinidipine 10 mg tab , chlorthalidone 6.25 mg tab , chlorzoxazone 500 mg+diclofenec sodium 50 mg +paracetamol 500 mg tab , cholecalciferol 60000 iu tab , cilastozole 50 mg tab , cilinidipine 10 mg tab , citicoline 500 mg + piracetam 400 mg tab , citicoline 500 mg tab , clarithromycin 500 mg tab , clindamycin 100+clotrimazole 100 mg vaginal pessary ( clingen ) , clindamycin 300 mg tab , clindamycin gel , clobetasole propionate 0.05% cream , clonazepam 0.5 mg tab , clopidogrel 75 mg + aspirin 75 mg + atorvastatin 10 mg cap , clopidogrel 75 mg + aspirin 75 mg tab , common cold ( antihistaminics + paracetamol 325 mg without pseudoephedrine ) tab , cotton absorbant packet of 500 gm , cough syp ambroxol+ terbutalin + guphapensin bott of 100 ml , cream betamethasone dipropionate usp 0.5 mg and gentamycin sulphate 1 mg per gm tube of 5 gm. , cream miconazole nitrate 2% skin tube of 15 g , cremaffin white each 15 ml containing milk of magnesia 11.25 ml liquid paraffin 3.75 ml bottle of 170 ml , dapagliflozin 10 mg tab , decadurabolin 50 mg / ml inj , deflazacort 6 mg tab , desensitising pastetube of 50 gm. , desvenlafexine 50 mg tab , diazepam 5mg tab , diclofenac 50mg+paracetamol 325mg tab , diclofenac gel linseed oil, menthol, methyl salisylate tube of 20 gm , diclofenac sodium 100 mg sr ( voveran sr ) tab , diclofenac sodium 50 mg + paracetamol 500 mg tab , diclofenac+pcm+serratiopeptidase tab , dicyclomine 20 mg + mefenamic acid 250 mg tab , dicylomine 10 mg + mefanimic acid 250 mg tab , digoxin 0.25 mg tab , disposable face mask , disposable insulin pen needles 4mm , divalporex sodium 500mg tab , dologel mouth ulcer gel , doxofylline 400 mg + ambroxol 30 mg tab , doxophyllin 400 mg tab , doxycycline cap , drotavarin 40 mg tab , duloxetine 20 mg tab , dutasteride 0.5 mg+ tamsulosin 0.4 mg , ear drop clear wax , ear drop clotrimazole , ebastin 20mg tab , ecg paper roll 80 mm x 20 20 mtr pack of 3 rolls , ecosprin 150 mg tab , edta vacutainer tube , enalapril 5 mg ( envas ) tab , enalapril maleate2.5mg ( envas ) tab , entecavir 0.5 mg cap , eosinophil diluting fluid , epeleron 25 mg tab , ethamsylate 500 mg tab , etiozolam 1 mg tab , etophyllin + theophyllin retard 150 mg tab , etoricoxib 90 mg + thiocolchicoside 8 mg tab , eye drop aquagic , eye drop brimonidine + timolol , eye drop bromfenac , eye drop carboxy methyl cellulose 0.5% bott of 5 ml ( cmc e / d ) , eye drop carboxymethylcellulose 0.5% bott of 10 ml , eye drop ciprofloxacin , eye drop ciprofloxacin + dexamethasone , eye drop ciprofloxacin 0.3% w / v bott of 5ml , eye drop dorzolamide , eye drop dorzolamide + timolol , eye drop fluorometholone , eye drop flurbiprofen sodium 0.3% bott of 5 ml , eye drop gatifloxacin + dexamethasone bott of 5 ml , eye drop gatifloxacin 0.3% bott of 5 ml , eye drop ketorlec , eye drop latanoprost 50mcg bott of 2.5 ml , eye drop moxifloxacin 5ml , eye drop moxifloxacin+dexamethasone bott of 5 ml , eye drop nephafenac , eye drop ocupol d , eye drop oflox , eye drop olapat kt , eye drop olapetadine , eye drop olopatodine 0.1% w / v bott of 5 ml , eye drop phenylephrine hydrochloride naphazoline hydrochloride chlorpheniramine maleate menthol camphor , eye drop prednisolone acetate , eye drop sodium hyaluronate , eye drop sulphacetamide , eye dropchlorphenarmine 0.1% nephazoline 0.05%+phenylphrine hcl 0.12%+menthol0.005%+camphor0.01% , eye dropofloxacin 0.3% bott of 5 ml , febuxosat 40 mg tab , fenofibrate 135 mg cap , fexofenadine 120mgtab , fexofenadine hydrochloride 120 mg tab , flohale 0.5mg / 2ml respules , fluconazole 150 mg cap , flunarizine 10mg tab , flupentixol 0.5 mg + melitracen 10 mg tab ( placida ) , flurbiprofen 5% w / wgel tube of 20 gm , flurbiprofen gel tube of 30 gm , foleys catheter 2 way size 16 fr , folic acid 5 mg tab , foracort 200 rotacap bott of 30 , foracort 400 rotacap bott of 30 , formetrol + budesonide 200 mcg synchrobreath mdi , fouchet reagent , framycetin sulphate cream bp 1% cream 15 / 20 gm , frusemide 20mg + spironolactone 50mg ( lasilactone ) tab , fusidic acid 2% w / wcream , fusidic acid oint tube of 10 gm , gabapentin 100 mg tab , galantamine 4 mg tab , gauze surgical pkt of 18 mtr , gliclazide 60 mg tab , glimipride 1 mg + metformin 1 gm sr tab , glimipride 1 mg + metformin 500 mg tab , glipizide 5 mg tab , glucometer strip , glucosamine 250mg+chondroitin sulphate 200 mg cap , glucosamine 500 mg + chondroitin sulphate 400 mg + akba tab , glucose strip one touch ultra bott of 50 with meter , glycopyrronium powder for inhalation 50 mcg bott of 30 cap , haematinic containnnig ferrous fumarate, vit b 12, folic acid vit c cap , hand gloves, size 7.5 pair of , hb a1c kit , heamatinic tab / cap containing ferrous fumarate vit b 12 folic acid and vit c, strength: 300mg, 1.5mg, 75mg min , hydrochlorothiazide 12.5mg tab , hydrocortisone 20 mg tab , hydrocortisone oint tube of 10 gm , hydroxychloroquin 200 mg tab , hyoscine 10 mg tab , indapamide 2.5 mg tab , indomethacin 25 mg cap , inh ipratropium bromide 20mcg + levosalbutamol 50 mcg mdi , inh salmeterol 25mcg + fluticasone 125mcg 120 mdi , inj decaduraboline 25mg / ml , inj dicyclomine 10 mg per amp , inj etophyllin 84.7+ theophyllin 25.3 mg / amp , inj insulin isophane / nph ( 70% ) + human insulin / soluble insulin ( 30% ) ( insulin wosulin 30 / 70 vial of 10 ml ) , inj methylcobalamine1500 mg , insulin actrapid inj , insulin aspart cartridge 100 iu / ml ( cart 0f 3 ml ) , insulin glargin 300 iu / cart ( cart of 3 ml ) , insulin glargine monocomponent 100 iu / ml 3ml cartridge , insulin glulisine ( apidra ) , insulin humolog 100iu / ml , insulin mixtard 30 / 70 inj vial of 15 ml , insulin mixtard 30 / 70 pen , ipratropium bromide 500 mcg + levosalbutamol 1.25mg / 2.5ml respules , iron syp bott of 200 ml , isabgol sachet 3.5gm , isapgol husk pkt of 100 gm , isosorbide dinitrate 5 mg tab , itopride 150 mg + rabeprazole 20 mg tab , ketoconazole 2% cream 20 gm , ketoconazole lotion , ketoconazole shampo bott of 100 ml , ketorol dt tab , ketorolac 10 mg tab , ketostaril cap , kit for estimationof bilirubin erba , kit for estimation ofuric acid erba , kit for estimation of glucose erba , knee cap size large , knee cap size medium , lacosamide 100mg tab , lacosamide 200 mg tab , lactobacilus 120 mil spores tab , lactulose 10gm / 15 ml syp bott of100 ml , lamino nephro inj 250 ml / bott , lamivudine 150mg + stavudine 30 mg + nevirapine 200mg tab , lamotrigine50 mg tab , leflunomide 10 mg tab , leviteracetam 500 mg dt tab , levocarnitine 500mg tab , levo cetrizine 5 mg tab , levocetrizine 5mg + montelukast 10mg tab , levosulpride 75 mg + rabeprazole tab , lignocaine jelly2% 30 gm withplastic nozzle , liquid paraffin + milk of magnesia bott of 170 ml , lorazepam 1 mg tab , luliconazole cream , lumbar belt size 44 , lycopene with vit & minerals cap , magesterol acetate 40 mg tab , mecobalamine inj 1500 mcg , mecobalamine1500 mcg +alphalipoic acid 200 mg+bentothiamine 150 mg +fa+chromium myo inositol 200 mg +pyridoxin hcl tab , memantine 5 mg tab , mesalamine dr 800mg tab , metformin 0.5 g sr tab , methotrexate 5 mg tab , methyl prednisolone 4mg tab , methylated spirit bott 500 ml , methylperdinosolone 8 mg tab , metolazone 0.5 mg tab , metoprolol sr 50 mg tab , metoprolol xl 12.5 mg tab , micro tips 100 1000 , mirabegron 50 mg tab , mometasone lotion , montair+levocetrizine+ambroxol , monteleukast 10 mg tab , moxifloxacin 0.5% w / veye dropbott of 5 ml , moxinidine 0.3 mg tab , multivitamin syp , multivitamin tab , multivitamin with zinc syp bott of 200ml , multi vitamine mineral cap , n acetylcystine 600mg effervecent tab , naproxen 500 mg + domperidome 10 mg tab , nasal drops oxymetazoline 0.025% , natrilix sr 1.5 mg tab , nebivilol 5 mg tab , needle disposable pkt of 100 , neomercazole 5 mgtab , nicorandil 5mg tab , nicoumalone 2 mg tab , nifedipine retard 20 mg cap , nimesulide tab , nintadanib 150 mg , nitrocontine 2.6 mg tab ( bott of 30 tab ) , nitrofurantoin 100 mg tab , normaxin tab , oin beclomethasone .025%w / w+ salisylic acid 3%w / w tube of 20 gm , oin beclomethasone0.025%w / w+lignocaine 2.5%w / w +phenylephrine 0.1%w / w ( no pile ) tube of 20gm , oin miconazole 2% w / w , oint alovera+ vit e cream tube of 50 gm , oint betamethasone 0.05 %w / w + gentamycin 1 %w / w , oint clobetasole cream 0.05% of 10 15gm , oint diclofenac gel 1% tube of 30 gm ( voveran ) , oint hydrocortisone 1% , oint sertaconazole 2% , oint terbinafine 1% w / w , olanzapine 10 mg tab , olanzapine 5 mg tab , olmesartan 20 mg tab , omega d3 fatty acid tab , ondansetron 4 mg tab , ornidazole 500 mg tab , oxcarbazepine 300 mg tab , pamoralin 11.25 mg inj , pancreoflate 300 mg tab , pantoprazole 40 mg + domperidone 10 mg tab , pantoprazole 40 mg + levosulpiride 75 mg cap , paracetamol 325mg + tramadol hcl 37.5mg tab , paroxetin cr 12.5 mg tab , phophatidyl serine 200 mg cap ( liposerin ) , pioglitazone 15 mg tab , piracetam 800 mg tab , pirfenidone 200 mg tab , piroxicam 20mg tab , plastic bott ( urine container ) , polyantibiotic resistant spores bacillus clausiicap ( enzispor ) , pramipexolol 0.125mg tab , pramipexolol 0.5mg tab , prasugrel10 mg tab , prazocin xl 5mg tab , predinisolone 5 mg tab , printerpaperrollerbachem 5+ , prochlorpromezine 5 mg tab ( stemetil ) , propranolol 40 mg tab , propranolol hcl 10 mg tab , prucalopride 2 mg tab , pyrazinamide 750 mg tab , ra kit , rabeprazole 20 mg +domperidone 10 mg tab , ramipril 2.5 mgtab , ranitidine 150 mg + domperidone 10 mg tab , ranolazine 500mg tab , recombinant human growth hormone 15 iu ( hgh ) , residronate 35mg tab , resperidone 0.5mg tab , respules fluticasone 0.5 mg , rifaximine 200 mg tab , rivaroxabin 2.5 mg tab , ropark 0.5mg tab , rosehip extract, boswellia serrata, vit c& piprine , rosuvastatin 15 mg tab , rotacap budesonide 200mcg + formeterol 6 mcgpkt of 30 cap , rotacap formeterol 6 mcg + budesonide 400mcg , pkt of 30 cap , rotacap indacaterol 110 mg + glycopyrronium 60 mcg , rotahaler device for inhalation cap , s metoprolol 12.5 mg tab , s metoprolol 25 mg tab , s metoprolol 50 mg tab , salbutamol + ipratropium bromide rotacaps bott of 30 cap , salbutamol 100 mcg + ipratropium 40 mcg inhaler , salbutamol 200 mdi ( each metered dose supplies 100mcg of salbutamol ) mdi , salbutamol aerosol inhalation pack of200 metered doses ( each metered dose supplies 100 mcg of salbutamol ) . ( asthaline ) , salmetrol + fluticasone ( 50+ 250mcg ) synchrobreath mdi , salmetrol 25mcg + fluticasone 250mcgmdi , scabiol lotion bott of 100 ml , serratiopeptidase 10mg tab , sertaconazole cream , sertaline 50 mg tab , serum albuminerba kit for testing , serum vacutainer tube , sevelamer 800mg tab , shalcal 500 mg ( calcium carbonate + vit d3 ) tab , silodosin 8 mg + dutasteride 0.5 mg tab , silodosin 8mg tab , sitagliptin 50mg tab , sobisis 500 mg tab , sodium valporate 333 mg + valporic acid 145 mg tab , sodium valproate 500 mg tab , sofosbuvir 400 + velpatasvir 100 mg tab , soframycin oint tube of 30 gm , solifenacin 10mg tab , sr bilirubin total & direct kit , sr cholestrol kit , stocking dvt below knee size med , syp antacid gel bott of 170 ml ) , syp cough expectorant 100 ml , syp cyprohepatadine 2 mg / 5ml , bott of 200 ml , syp ironcontaining cyanocobalamin 7.5 mcg + ferric ammonium citrate 160 mg + folic acid 0.5 mg / ml bott of 200 ml , syp tricholine citrate 0.55 gm + sorbitol 7.15 gm / 10 ml , syringe disposable 2 ml , tamsulosin 0.4+dutasteroide 0.5 tab , telmisartan 20mg tab , teneligliptin 20 mg tab , teriparatide 750 mcg / 3ml inj , test tube borosil 10 x 75 mm ( box of 100 ) , test tube borosil 12 x 100 mm ( box of 100 ) , theophylline 400 mg tab , thiocolchicoside 4 mgtab , thyroxine 12.5 mcg tab , ticagrelol 90 mg tab , tofacitinib 5 mg tab , tolvaptan 15 mg tab , topiramate 50 mg tab , torsemide 20mg tab , torsemide 40 mg tab , tramadol 37.5 + paracetamol 325 mg tab , trihexyphenidyl hcl 2 mg ( pacitane ) tab , trimetazidine 35mg mr tab , trypsin & chymotrypsin tab ( chymoral forte ) , ubidecarenone 180 mg tab ( renoque ) , urea kit erba , vildagliptin 50 mg + metformin 500 mg tab , vildagliptin 50 mg tab , vitamin b complex with a minimum concentration of vit b1 5 mg, vit b6 3 mg vit b12 5 mcg therapeutic tab / cap , vitamin e200 mg cap , vitamin e400 mg cap , voglibose 0.3 mg tab , widal test kit , zokon as kit , zolendronic acid 5 mg inj , zolpidem 10 mg tab...

Indian Army - Rajasthan

33279598 bids are invited for laboratary consumables dimension â®glucose flex â® ( gluc ) tests 1440 dimension â®urea nitrogen flex â® ( bun ) tests 480 dimension â®creatinine flex â® ( cre2 ) tests 480 dimension â®uric acid flex â® ( urca ) tests 480 dimension â®calcium flexâ® ( ca ) tests 480 dimension â®total bilirubin flex â® ( tbi ) tests 480 dimension â®direct bilirubin flex â® ( dbi ) tests 320 dimension â®total protein flex â® ( tp ) tests 480 dimension â®albumin flex â® ( alb ) tests 480 dimension â®alanine aminotransferase flex â® ( alti ) tests 240 dimension â®aspartate aminotransferase flex â® ( ast ) tests 360 dimension â®alkaline phosphatase flex â® ( alpi ) tests 360 dimension â®î³ glutamyl transferase flex â® ( ggt ) tests 288 dimension â®cholosterol flex â® ( chol ) tests 480 dimension â®triglycerides flex â® ( tgl ) tests 480 dimension â®automated hdl cholesterol flex â® ( ahdl ) tests 240 dimension â®urinary / cerebrospinal fluid protein flex â® ( ucfp ) tests 80 dimension â®amylase flex â® ( amy ) tests 240 dimension â®lipase flex â® ( lipl ) tests 120 dimension â®hemoglobin a1c kit ( hb1c ) tests 120 dimension â®ahdl calibrator ( ahdlcal ) ml 2x3x1 dimension â®bilirubin calibrator ( tbi / dbical ) ml 2x3x1.0 dimension â®chemistryi calibrator ( chemical ) ml 2x3x2 dimension â®chemistryii calibrator ( chemiical ) ml 2x3x1.2 dimension â®cholesterol calibrator ( cholcal ) ml 2x3x1.0 dimension â®enzyme verifier ml 2x3x2.0 dimension â®lipase calibrator ( liplcal ) ml 2x3x1.0 dimension â®totalprotein / albumin calibrator ( tp / albcal ) ml 2x3x2.0 dimension â®urinary / cerebrospinal fluidprotein calibrator ( ucfpcal ) ml 2x5x4 dimension â®alkaline phosphatase calibrator ( alpical ) ml 2x3x1.0 dimension â®enzymeii calibrator ( enziical ) ml 2x3x1.5 dimension â®cuvette cartridge n 12000 quiklyte â®integrated multisensor pack 1x4 quiklyte â®integrated multisensor flush solution ml 1x1000 quiklyte â®integrated multisensor sample diluent ml 6x500 quiklyte â®integrated multisensor standarda ml 3x1000 quiklyte â®integrated multisensor standardb ml 3x300 dimension â®salt bridge solution pack 3x150 dimension â®sample cupwith lids1.5ml pack 1 dimension â®cki / mbi calibrator ( cki / mbical ) ml 4x2.0 dimension â®creatine kinase mb flexâ® ( mbi ) tests 120 dimension â®creatine kinase flex â® ( cki ) tests 480 dimension â®enzymei calibrator ( enzical ) ml 4x1.5 dimension â®lactate dehydrogenase flex â® ( ldi ) tests 480 dimension â®loci vitamin d total ( vitd ) tests 200 dimension â®loci vitamin d calibrator ( loci vitd cal ) box 1 dimension â®totaliron binding capacity ( ibct ) calibrator ( ibctcal ) pack 6x1.0 dimension â®total iron binding capacity flexâ® ( ibct ) tests 240 dimension â®ferritin flex â® ( ferr ) tests 120 dimension â®ferritin calibrator ( ferrcal ) ml 10x2.0 dimension â®iron flex â® ( iron ) tests 240 dimension â®iron calibrator ( ironcal ) ml 4x1.2 dimension â®phosphorus flexâ® ( phos ) tests 480 quiklyte â®integrated multisensor dilution check ml 1x50 dimension â®chemistry wash pack 1 dimension â®reagent probe cleaner pack 1 dimension â®sample probe cleaner pack 1 sample probetips ( pkg3 ) ( ueg734520.503 ) reagent probetip ( 2 ) kit 1 ( ueg715871.505 ) assy exlwaste tubing pack 1 svsp source lamp aligned kit 1 ( ueg716762.504 ) generic pm kit dimension exl 200 kit 1 dimension â®loci free triiodothyronine flexâ® ( ft3 ) pack 1 dimension â®loci free thyroxine flex â® ( ft4l ) pack 1 dimension â®loci thyroid stimulating hormone flex â® ( tshl ) pack 1 dimension â®loci thyroid calibrator ( loci thyr cal ) box 1 total quantity : 504...

Medical And Health Services - Rajasthan

33263927 supply of rmse edl injection tablet syrup capsule etc : 01. anaesthetics , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , atropine sulphate injection 0.6mg / ml , group name ( 1 ) :: 02. analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , group name ( 1 ) :: 03. antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , group name ( 1 ) :: 04. antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , group name ( 1 ) :: 05. anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , group name ( 1 ) :: 06. anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , terbinafine hydrochloride tablet 250 mg , group name ( 1 ) :: 07. anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , group name ( 1 ) :: 08. anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , group name ( 1 ) :: 09. drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , rh erythropoetin inj ip 2000iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , group name ( 1 ) :: 10. cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , carvedilol tablet 3.125 mg , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , group name ( 1 ) :: 11. dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , group name ( 1 ) :: 12. dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , oitment mupirocin ip 2% , group name ( 1 ) :: 13. reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , vdrl antigen ( with + ve and ve control ) / rpr slide kit , multistix test strip , group name ( 1 ) :: 14. disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , group name ( 1 ) :: 15. diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , group name ( 1 ) :: 16. drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , group name ( 1 ) :: 17. gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , group name ( 1 ) :: 18. gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , group name ( 1 ) :: 19. hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , group name ( 1 ) :: 20. immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , group name ( 1 ) :: 21. muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , group name ( 1 ) :: 22. opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , group name ( 1 ) :: 23. oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , group name ( 1 ) :: 24. psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , clonazepam tablet 0.5 mg , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , group name ( 1 ) :: 25. drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , group name ( 1 ) :: 26. solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , group name ( 1 ) :: 27. drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , group name ( 1 ) :: 28. antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , group name ( 1 ) :: 29. vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , group name ( 1 ) :: 30. miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , pregabalin cap ip 75 mg , vitamin e capsule 400 mg , group name ( 1 ) :: 31. swine flu drugs , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , group name ( 1 ) :: 32 anti malerial drugs , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , absorbable surgical suture , sterilised needle , non absorbable surgical suture sterilised surgical needled suture polyglecraprone monofilament sutures absorbable surgical sutures sterilised needeled , monifilament polydioxanone suture antibactterial coated suture absorbable surgical suture , surgical group name ( 1 ) :: 37. surgicas 669 si absorbable gelatin sponge 80 x 50x 1omm ( details in rc ) 67o 52 absorbent cotton wool ip 500 gm 671 s3 asepto syringe with transparent bulb sterile, 60 ml 672 s4 blood administration set blood transfusion set ( details in rc ) 673 s5.a gloves size 6.5 lnches, powdered ( disposable ster’ile surgical rubber gloves ) ( details in rc ) 674 s5.b gloves size 6.5 lnches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) 675 s6.a gloves size 7 lnches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 676 s6.b gloves size 7 lnches, powder free ( disposable sterile 5urgical rubber gloves ) ( details in rc ) 677 s7.a gloves size 7.5 lnches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 678 s7.b gloves size 7 .5lrmches, powder free ( disposablesterile 5urgical rubber gloves ) ( details in rc ) 679 s8.a suction catheter, sterile.size: fg s ( details in rc ) 619 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) 680 58.b suction catheter, 5terile. size: f g 6 ( details in rc ) 681 s8.c suction catheter, 5terile. size: f g 8 ( details in rc ) 682 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) 683 s8.e suction catheter, sterile, size: f g 12 ( details in rc ) 684 s8.f suction catheter, sterile. size: f g. 14 ( details in rc ) 68s s8.g suction catheter, sterile. size: f g 16 ( details in rc ) 686 58.h suction catheter, sterile. size: f g 18 ( details in rc ) 687 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) 6s8 sb.j suction catheter, sterile. size: f 6 22 ( details in rc ) 689 s9.a catheter, size 8 ( foleys f3allon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 690 s9.b catheter, size 1o ( foleys ballon catheter sterile, 2 way for urinary drainage, single usejsihconl coated natural latex material ( details in rc ) 91 s9.c catheter, size 16 ( foieys ballon catheter 7 sterile, 2 way for urnary dralnage, single / usejsiiicon coated natural latex material ( details in rc ) s92 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary dralnage, single use jslhcon coated natural latex material ( details in rc ) 693 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single usejsilicon coated natural latex material ( details in rc ) 694 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary dralnage, single usejsilicon coated natural latex material ( details in rc ) 695 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use jsilicon coated natural latex material ( details in rc ) 696 s1o.a infant feeding tube size 1ofg ( details in rc ) 697 s1o.b intant feeding tube size 8fg ( details in rc ) 698 s1o.s infant feeding tube size sfg ( details in rc ) ____ 699 s11 perfusion set with airway and needle1 ( adult use ) sterile renusiumi 3 wijmnm mhrwd amiu needle, ( adult use ) sterile disposable ( details in rc ) 70o 512 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) 7o1 513 infusion set with microdrip0 ( i.v. ) sterile disposable ( details in rc ) 702 514 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 7o3 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 166 ( details in rc ) 7o4 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 186 ( details in rc ) 7o5 s15.c sterile disposable ( single use ) tefion / ptfe iv. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) 7o6 s15.d sterile disposable ( single use ) tefion / ptfe l.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) 707 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 246 ( details in rc ) 7o8 s1 ( mucus extractor sterile ( detalls in rc ) 709 517.a nasal oxygen set, twin bore all sizes adult ( details in rc ) no s17b nual oxygen set, twin bore all sizes paediatrics ( details en rc ) 711 s1 paper adhesive plasterjwilii l.ullei p4ufl woven adhesive tape ./714 $21 plaster of paris bandage 15cm x 2.7 mts/roll 715 s22 plaster of paris bandage 10cm x 2.7mts 716 s23.a ryles tube / nasogastric tube sizet 1o(detaiis in rc) 717 s23.b ryles tube / nasogastric tube size: 12(detajls in rc) 718 s24.a ryles tube / nasogastric tube size:14 (details in rc) 719 s24.b ryles tube / nasogastric tube size: 16 (details in rc) 720 s24.c ryles tube / nasogastric tube size: 18 (details in rc) 721 s25.a scalp vein set (disposable) site 18g (details in rc) 722 s25b stalp vein set (disposable) site 20g (details in rc) 723 s25.c scalp vein set (disposable) size 22g (details in rc) 724 s25.d scalp vein set (disposable) size 24 g (details in rc) 725 s26 syringe 2 ml hypodermic with needle attached 24g.sterile,single use disposable(details in rc) 726 s27 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 727 528 syringe 10 ml hvoodermic with needledisposable(details in rc) 727 s28 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 728 s29 syringe 2o ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 729 530.a surgical blade sterile, size 11(details in rc) 730 s30.b surgical blade sterile, size 15(details in rc) 731 s30.c surgical blade sterile, size 22(details in rc) 732 531 suture needles curved 1/2 circle round body assorted size 11 15(detalls inrc) 733 532 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 734 533 suture needles curved 1/2 circle round body assorted size 16 20(details inrc) 735 s34 suture needles curved 1/2 circle round body assorted size 6 1o(details in rc) 736 535 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 737 536 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 738 s37 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 739 538 suture needles curved and cutting size 1 5(details in rc) 74o s39.a sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 741 s39.b sterile disposable spinal needle for single uses 25g x 3 1/2 inch (details in rc) 742 s40 urine collecting bag, disposable 2000 ml(details in rc) a4 s43.b endotracheal tube, plain size 3 (details in ( rc) 74s s43.c endotracheal tube, plain size 3.5 (details in rc) 746 s43.d endotracheal tube, plain size 4 (details in rc) 747 s43.e endotracheal tube, plain . size 4.5 (details inrc) 748 s43.f enclotracheal tube, plain size 5 (details in rc) 749 s43.g endotracheal tube, plain size 5.5 (details in rc) 750 s43.h endotracheal tube, plain size 6 (details in rc) 751 s43.i endotracheal tube, plain size 6.5 (details in rc) 752 s43.j endotracheal tube, plain size 7 (details in rc) 7s3 s43.k endotracheal tube, plain size 7.5 (details in rc) 7s4 s431 endotracheal tube, plain size 8 (details in rc) _____w s 755 s43.m endotracheal tube, plain size 8.5 (details in rc) 756 s44.a endotracheal tube, cuffed size 4 (details in rc) unl rw.. 756 s44.a endotracheal tube, cuffed size 4 (details in rc) 757 s44.b endotracheal tube, cuff. size 4.5 (details inrc) 758 s44.c endotracheal tube, cuff size 5 details in rc ____ _ 7s9 s44.d endotracheal tube, cuff size 6 (details in rc) 760 s44.e endotracheal tube, cuff size 6.5 (details in rc) 761 s44f endotracheal tube, cuff size 7 (details in rc) 762 s44.g endotracheal tube, cuff size 7.5 (details in ) 763 s44.h endotracheal tube, cuff size 8 (details in rc) 764 544.i endotracheal tube, cuff size 8.5 (details inrc) 76s 544 j endotracheal tube, cuff. size 9 (details in rc) 766 545 tracheostomy tube, plain all sizes(details inrc) 767 546 tracheostomy tube (pvc). culled all sizes(details in rc) 768 s47.a abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 769 547 b abdominal drain kit, sterile, havng drainage catheter and collection bag (2000 ml) size 24 (details in kc) 770 547.c abdominal drain kit,sterile,havng lfraanawp csther irni cnllprtirwi riy’t cinlii corrrugated drainage sheet , polypropyelne non absorbable synthetic surgical mesh 15cm m3 s74 polyproeylene nonabsorbable syathetic surgical uesh is cm x is cm 774 s79 sterilized umbilical eattoa tape width 3 mm, length 75 cm(deealls in rc) 775 s80 bone wax sterilised 7a6 s82 skie graft knife blade (steaile)(detajls in rc) 777 s84.a k wire. length 375 mm; lmm(detapls in rc) 778 s84.b k wire. lengeh 375 mm, l.6mesdetajls in rc) 779 s84.c k wire. leneth 375 mm; l.8mm(details in rc) 7a0 s85 faee maek, diweesable(detalls ln re) 781 s86.a surgical cap disposabie ifor surgeons)(detaiis in rc) 782 s86.b surgical tae, disposablejuetails in rc) 18 to 24 785 587,c foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 786 s88.a standard pama lntra ocular lenses (details in rc)1j.to 17.5 7s1 s88.b standard pwma intra ocular lenses (detaiis in rc) 18 to 24 788 s88.c standaid pwma intra ocular lenses (details in rc) 24.5 to 28.5 789 s89.a oisposable sterile surgical rubber gloves size 8 inchespowdered 790 s89.b oisposable sterile surgical rubber gloves size 8 lnches,powder free ____________ 791 s90.a rubber exanination gloves, non sterile, extra small(details in rcl 792 590.b rubber examination gloves,site small (details in rc) 793 s90.c rubber examination glovessize medium (details in rc) 794 s90.d rubber examination gloves made of natural rubber latex, non 5terile, site large (details in rc) 79s 591 pressure monitoring line / high pressure extension line (details in rc) 796 592 urine collecting bag for new born /paediatric urine collection bag, capacity 1oom! idetails in rc) ___ — 797 s93 umbilical catheter for new born, all sites (details in rc) 798 594 ; clamp (details in rc) 799 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(detajls in rc) 80o s96.a close wound drainage device under ne8ative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) —re wbunfd drainage device unaer negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 802 597 i tube for common bile duct drainage, length 20x60 cm, size (details in rc) 803 598 bone cement 804 599.a sanitary napkin beltless(details in rc) 805 s99.b sanitary pads belt type(details in rc) 806 s99.p sanitary napkin beltless with wings (details in rc) 807 5100 oxygen mask (adult) 808 5101 oxygen mask (pediatric) 809 s102 foleys catheter no. 14 (detail in rc) 810 5103 nelaton catheter size 14 fg(detail in rc) 811 s104 ecg electrode (detail in rc) 812 slos surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail inrc) . 813 5106 sterile hypodermic syringe with needle attached, 22g. single use 5o ml (detail in rc) kc) 814 s107 urethral catheter 9o (fg 14) made up of medical grade pvc (detail in rc) 81s s108 urethral catheter 91 (fg 1o), made up of medical grade pvc (detail in rc) 816 s109 vaccum suction set, 2.5 meter length (detail in rc) . 817 5119 3 way stop cock, non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 818 5120 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail inrcl 819 5121 3 way stop cock with extension tube (vein o extension uine) size 50cm (non pyrogenic & single use) (detail in rc) 820 s122 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 821 5123 3 way stop cock with extension tube (veino extension line) size 150cm (non pyrogenic & single use) (detail in rc) 822 5124 abdominal drain kit, sterile, having drainage catheter and collection bag (200o ml) (size 16) (detail in rc) 823 512s abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 823 5125 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 824 s126 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detall in rc) 825 5127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quahty sticking property (detail in rc) 826 5128 sterile disposable niv mask (detail in rc) 831 s133 mv mask (noninvasive ventilation mask) oro nasal mask paediatric with dronchoscopy and c02 and 02 port with chin support (detail in rc) 832 5134 nebulization mask adult (detail in rc) 833 s135 nebulization mask paediatric (detail in rc) roup name (1.) :: 38. swine flu drugs 834 639 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 83s 640 oseltamivir capxule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 636 641 oxeltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 837 642 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 838 642a oseltanivir phosphate for oral suspension ip 12 mg/mi (each ml contains 12 mg oseltamivir base after reconstitution) ;roup name (1) :: 4o anti maleral drugs 839 64s act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and — rlfrla (sinph use tellon/pyfe a.v cannula with integrated 3 way stop cock (fer nursas) idetails in rc)(detajls in rc) 783 s87.a foldable intra ocular lense with injector (detalls in rc) 11 to 17,5 784 s87.b foldable intra osular lense with injeeasr (details in rc) 18 to 24 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg liposomol amphotericine injection b 50mg etc...

Medical And Health Services - Rajasthan

33198526 supply of medicine and surgical items bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , butorphanol tartrate injection usp 1mg / ml 1ml size , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , absorbable sutures , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 , non absorbable surgical suture sterilised surgical needled suture , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 , polyglecraprone 25 monofilament sutures , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , monofilament polydioxanone suture , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , antibacterial coated suture , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , surgicals , absorbable gelatin sponge 80 x 50x 10mm , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set blood transfusion set , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) , suction catheter, sterile.size: fg 5 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , suction catheter, sterile. size: f g 20 , suction catheter, sterile. size: f g 22 , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , infant feeding tube size 10fg , infant feeding tube size 8fg , infant feeding tube size 5fg , perfusion set with airway and needle, ( adult use ) sterile disposable , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g , mucus extractor sterile , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size:14 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , scalp vein set ( disposable ) size 18g , scalp vein set ( disposable ) size 20g , scalp vein set ( disposable ) size 22g , scalp vein set ( disposable ) size 24 g , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , surgical blade sterile, size 11 , surgical blade sterile, size 15 , surgical blade sterile, size 22 , suture needles curved 1 / 2 circle round body assorted size 11 15 , suture needles curved 1 / 2 circle round body assorted size 1 5 , suture needles curved 1 / 2 circle round body assorted size 16 20 , suture needles curved 1 / 2 circle round body assorted size 6 10 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 , suture needles curved and cutting 1 / 2 circle size 11 15 , suture needles curved and cutting 1 / 2 circle size 16 20 , suture needles curved and cutting size 1 5 , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , urine collecting bag, disposable 2000 ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal tube, plain size 5 , endotracheal tube, plain size 5.5 , endotracheal tube, plain size 6 , endotracheal tube, plain size 6.5 , endotracheal tube, plain size 7 , endotracheal tube, plain size 7.5 , endotracheal tube, plain size 8 , endotracheal tube, plain size 8.5 , endotracheal tube, cuffed size 4 , endotracheal tube, cuff size 4.5 , endotracheal tube, cuff size 5 , endotracheal tube, cuff size 6 , endotracheal tube, cuff size 6.5 , endotracheal tube, cuff size 7 , endotracheal tube, cuff size 7.5 , endotracheal tube, cuff size 8 , endotracheal tube, cuff size 8.5 , endotracheal tube, cuff size 9 , tracheostomy tube, plain all sizes , tracheostomy tube ( pvc ) , cuffed all sizes , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , corrugated drainage sheet all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm , bone wax sterilised , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , skin graft knife blade ( sterile ) , k wire, length 375 mm; 1mm , k wire, length 375 mm; 1.6mm , k wire, length 375 mm; 1.8mm , face mask, disposable , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , foldable intra ocular lense with injector 11 to 17.5 , foldable intra ocular lense with injector 18 to 24 , foldable intra ocular lense with injector 24.5 to 28.5 , standard pama intra ocular lenses 11 to 17.5 , standard pama intra ocular lenses 18 to 24 , standard pama intra ocular lenses 24.5 to 28.5 , disposable sterile surgical rubber gloves size 8 inches, powdered , disposable sterile surgical rubber gloves size 8 inches, powder free , rubber examination gloves, non sterile, extra small , rubber examination gloves, size small , rubber examination gloves, size medium , rubber examination gloves made of natural rubber latex, non sterile, size large , pressure monitoring line / high pressure extension line , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , umbilical catheter for new born, all sizes , umbilical cord clamp , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 , t tube for common bile duct drainage, length 20x60 cm, size , bone cement , sanitary napkin beltless , sanitary pads belt type , sanitary napkin beltless with wings , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 , nelaton catheter size 14 fg , ecg electrode , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support , nebulization mask adult , nebulization mask paediatric , chemotherapy port and non coring needles ( adult ) , chemotherapy port & non coring needles ( pediatric ) , swine flu drugs , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , anti malerial drugs , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , covid19 , liposomol amphotericine injection b 50mg , non edl items , proparacaine eye drops , tryphan blue dye , keratome 2.8 mm , crescent , side pot 15 degree , pilocarpine injection etc ...

North Western Railway - Rajasthan

32981569 supply of growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs)growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs),growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs)...

Medical Health And Family Welfare - Rajasthan

32968287 supply of drug and medicine ( rate contract ) supply of drug and medicine ( rate contract ) , group name ( 1 ) :: 01. anaesthetics , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , atropine sulphate injection 0.6mg / ml , group name ( 1 ) :: 02. analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , group name ( 1 ) :: 03. antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , group name ( 1 ) :: 04. antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , group name ( 1 ) :: 05. anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , group name ( 1 ) :: 06. anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , terbinafine hydrochloride tablet 250 mg , group name ( 1 ) :: 07. anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , group name ( 1 ) :: 08. anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , group name ( 1 ) :: 09. drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , rh erythropoetin inj ip 2000iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , group name ( 1 ) :: 10. cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , carvedilol tablet 3.125 mg , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , group name ( 1 ) :: 11. dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , group name ( 1 ) :: 12. dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , oitment mupirocin ip 2% , group name ( 1 ) :: 13. reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , vdrl antigen ( with + ve and ve control ) / rpr slide kit , multistix test strip , group name ( 1 ) :: 14. disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , group name ( 1 ) :: 15. diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , group name ( 1 ) :: 16. drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , group name ( 1 ) :: 17. gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , group name ( 1 ) :: 18. gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , group name ( 1 ) :: 19. hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , group name ( 1 ) :: 20. immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , group name ( 1 ) :: 21. muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , group name ( 1 ) :: 22. opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , group name ( 1 ) :: 23. oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , group name ( 1 ) :: 24. psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , clonazepam tablet 0.5 mg , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , group name ( 1 ) :: 25. drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , group name ( 1 ) :: 26. solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , group name ( 1 ) :: 27. drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , group name ( 1 ) :: 28. antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , group name ( 1 ) :: 29. vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , group name ( 1 ) :: 30. miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , pregabalin cap ip 75 mg , vitamin e capsule 400 mg , group name ( 1 ) :: 31. swine flu drugs , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , group name ( 1 ) :: 32 anti malerial drugs , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg...

Medical And Health Services - Rajasthan

32923490 supply of medicines injection tablet syrup , capsule , cream , eye and ear drops , lotion , etc bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , analgesic antipyretices and anti inflammatory drugs , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , butorphanol tartrate injection usp 1mg / ml 1ml size , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , antiallergics and drugs used in anaphylaxis , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , antidotes and other substances used in poisoning , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , anti epileptic drugs , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate inj 100 mg / ml , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , anti infective drugs , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , anti neoplastic and immuno suppressant drugs palliative care , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , anti parkinsonism drugs , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , drugs affecting the blood , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , cardio vascular drugs , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , dental drugs , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , dermatological drugs , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , reagents and diagnostic agents , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , disinfectants and antiseptics , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , diuretics , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , torsemide inj 10 mg / ml , spironolactone tablets ip 50 mg , drugs for ear ailments , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , gastro intestinal drugs , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , gout and rheumatiod arthritis , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , hormones other endocrine drugs and contraceptives , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg ( film coated ) , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , immunologicals , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , muscle relaxants and cholinestrase inhibitors , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , neostigmine tab ip 15 mg , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , opthamological preparations , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , oxytocics and antioxytocics , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , psychotropic drugs , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorpromazine inj. ip 25mg / ml , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , drugs acting on the respiratory tract , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , solution correcting water electrolyte and acid base disturbance , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , drugs for urology , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , phenazopyridine tablet 5 mg , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , antivertigo , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , vitamins and minerals , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , miscellaneous drugs , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , absorbable sutures , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 , non absorbable surgical suture sterilised surgical needled suture , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 , polyglecraprone 25 monofilament sutures , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , monofilament polydioxanone suture , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , antibacterial coated suture , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , surgicals , absorbable gelatin sponge 80 x 50x 10mm , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set blood transfusion set , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) , suction catheter, sterile.size: fg 5 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 12 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 16 , suction catheter, sterile. size: f g 18 , suction catheter, sterile. size: f g 20 , suction catheter, sterile. size: f g 22 , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , infant feeding tube size 10fg , infant feeding tube size 8fg , infant feeding tube size 5fg , perfusion set with airway and needle, ( adult use ) sterile disposable , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable , infusion set with microdrip, ( i.v. ) sterile disposable , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g , mucus extractor sterile , nasal oxygen set, twin bore all sizes adult , nasal oxygen set, twin bore all sizes paediatrics , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 10 , ryles tube / nasogastric tube size: 12 , ryles tube / nasogastric tube size:14 , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , scalp vein set ( disposable ) size 18g , scalp vein set ( disposable ) size 20g , scalp vein set ( disposable ) size 22g , scalp vein set ( disposable ) size 24 g , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , surgical blade sterile, size 11 , surgical blade sterile, size 15 , surgical blade sterile, size 22 , suture needles curved 1 / 2 circle round body assorted size 11 15 , suture needles curved 1 / 2 circle round body assorted size 1 5 , suture needles curved 1 / 2 circle round body assorted size 16 20 , suture needles curved 1 / 2 circle round body assorted size 6 10 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 , suture needles curved and cutting 1 / 2 circle size 11 15 , suture needles curved and cutting 1 / 2 circle size 16 20 , suture needles curved and cutting size 1 5 , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , urine collecting bag, disposable 2000 ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , endotracheal tube, plain size 2.5 , endotracheal tube, plain size 3 , endotracheal tube, plain size 3.5 , endotracheal tube, plain size 4 , endotracheal tube, plain size 4.5 , endotracheal