Medical Health And Family Welfare - Rajasthan

34203102 supply drug and medician in rk govt hospital rajsamand , category : list of drug & medicine , ab+af+anti inflamatory ear drop 5 ml , acardose 50 mgtab. , acebrophylline sr 200 mg tab. , aceclofenac & paracetamol tab 100+325 mg , aceclofenac + thiocolchicoside 4 mgtab. , aceclofenac sr 200 mg tab. , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) tab. , acetazalomide 250mg tab , acetic acid otic solution 2% ear drop , acitic acid , abiraterone acetate tab. ip 250 mg , atrovastatine 80 mg tab , acitretin 10 mg cap. , acitretin 25 mg cap. , activated charcoal ( oral ) tab , acyclovir 250 mg inj , acyclovir 500 mginj , acyclovir cream 5%5 gm , acyclovir tab. 200 mg , acyclovir tablet 800 mg , adalimumab 40 mginj. , adaplene ( 0.1% w / w ) gel , adenosine 3mg / ml inj. , ado trastuzumab 100 mg inj. , ado trastuzumab 160 mg inj. , adrenaline inj1mg / ml , aerocort r / c ( beclomethasone dipropionate and livo salbutamol ) , afatinib 20 mg tab. , afatinib 30 mgtab. , afatinib 40 mg tab. , akt 4 kit , albendazole suspension400 mg / 10ml , albendazole tablet 400 mg , alendronate sodium 70 mg tab. , alfuzosin 10 mgtab. , alkaliser syp , all trans retinoic acid 10 mg cap. , aloe vera moisturizingcream 75 gm , alpelisib 150 mg ( monopoly ) tab. , alpha beta arteether 2 mlinj. , alpha+lipoic acid + leycopen +multivitamin and miltimineralscap. , alpha interferon inj. interferon alpha 2 concentrated soulution ip 3 million unit , alprazolam tablet 0.25mg , alprazolam tablet 0.5mg , aluminium hydroxide tab. nfi formula each chewable tab contains magnesium tricsilicate ip 250mg, dried aluminium hydroxide gel ip 120mg, peppermint oil 0.003ml , azithromycin oral suspension 100mg / 5ml syrup , azithromycin oral suspension 200mg / 5ml syrup , ambroxpl + terbutalline 2.5 mg+guphensine syp , amphotericin 5 inj. , amantidine 100mg tab. , ambroxol drop 15 ml , amicacin 100 mg inj2 ml , amicacin 250 mg inj , amikacin sulphate inj. 500 mg , aminocaproicacid 20ml inj. , aminophylline injection 25 mg / ml10 ml , amiodorane 150mg3 ml , amisulpride 50 mg tab. , amitriptyline tab25mg , amitryptiline + chlordizepoxide 12.5 5 ) , amitryptiline + chlordizepoxide 25+10 , amlodepine 2.5 mg tab , amlodepine at tab , amlodepine l tab , amlodipine tab5 mg , amorolfine 0.25% cream 50 gm , amoxicillin + clavulanic acid tab500 mg + 125 mg , amoxy clav 1.2 gm inj , amoxy+clavanat syp 228.5 ml , amoxycillin & clavulanic acid 300 mg inj. , amoxycillin ( dispersible ) tab. i.p. 125mg , amoxycillin + cloxacillin cap.250mg + 250 mg , amoxycillin 250 mg dt tab , amoxycillin 60 ml syp 125 mg , amoxycillin cap. 250mg , amoxycillin cap. 500mg , ampicillin + salbactum 1.5g inj. , ampicillin 500 mg cap , ampicillin injection 500 mg , antacid syp60 ml , antacid tab , anticold syrup with paracetamole 125 mg / ml ( cpm+pcm +phenyl ) , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) cap. , apixaban 2.5 mg tab. , apixaban 5mg tab. , aprepitant 125 mg cap. , aripiprazole 10 mg tab. , aripiprazole 5 mg tab. , artemether 40mg + lumefantrine 240 mg 30ml syrup , artesunate 120 mginj. , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17%lotion , aspirintablet 150 mg , aspirintablet 300 mg , aspirintablet 75mg , aspirin dispresible 325mg tab. , astyminec ( vitamin c+ essential amino acid ) drop , atenolol tablet 50 mg , atezolizumab 1200 mg ( monopoly ) inj. , atomoxetin 10 mg tab. , atomoxetin 18 mg tab. , atomoxetin 25 mg tab. , atorvastatin 10mg+fenofivrate 72.5 mg tab , atorvastatin tab10mg , atrhesunate inj60 mg , atropine eye drops 1% , atropine sulphate eye ointment 1% , atropine sulphate inj. 0.6 mg / ml , atrovastatin 20 tab , atrovastatin 40 tab , atrovastatin 80 tab , avelumab 200 mg ( monopoly ) inj. , axitinib 5 mg tab. , azacitidine 100mginj. , azacitidine 50mginj. , azelaic acid 20% cream 10 gm , azithromycin 1% eye ointment5 gm , azithromycin 10 ml vial equaivelent to 500 mginj. , azithromycin tab 100 mg ( dispersible ) , azithromycin tab 250 mg , azithromycin tab 500 mg , azathioprinetab. 50 mg , antra inj. , bleomycine injection 15 mg , b complex + antioxident syp 200 ml , b complex syp , b long tab , b1, b6, b12 inj , bacishild 1 lt. , bacitracin for injection 25, 000 iu inj. , baclofen oral solution 5 mg / ml syrup , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bagsolution , b complex +enzyme drop 15 ml , beclomethsone+neomyaine +clotrimazole oint 15 gm , benzathine benzylpenicillin inj ip 12 lac units ( penidura ) , beramethasone dipropionate crème / oint 0.05 %15gm , bendamustine inj. 100 mg , betadine gargle 60 ml povidoneiodine , betadine oint 20 gm povidoneiodine , betamethasone 1 ml inj , betamethasone lotion15 ml , betaxolol eye drop 0.5 0 / 0 { 612 } , bilastin 20 mg tab. , biotin 5 mg tab. , biscodyl tab 5 mg , bortezomib 2.5 inj. , bosentan62.5 mg tab. , bosutinib 500 mg tab. , botroclot topical solution 10 ml , bromocription tab. 2.5 mg , bortezomib 2 inj. , bevacizumab inj. 400 mg , bevacizumab inj. 100 mg , bicalutamide tab. ip 50 mg , botropase 1 ml inj. , brivaracetam 50mg tab. , budesonide 0.5mg / ml respules , budesonide 200 mcg. mdi , budesonide 400 mcgcap. , budesonide 9 mg cap. , budesonide r / c ( budicort ) , bupivacaine inj.0.5% 20 ml , bupivacaine inj. 0.50% +dextrose 8% 4 ml , buprinorphine 2 mg tab. , busulfan 60mg / 1ml inj. , baclofen 10 mgtab , cilosta 20 mg tab , citicholine500mg tab , colchicine 5 mg tab , cyclopentolate eye drop 1% , capecitabine tab 500 mg , carboplatin inj. ip 150 mg15 ml , carboplatin inj. ip 450 mg , cabergoline 05 mg tab , cabazitaxel 20 mginj. , cabazitaxel 40 mginj. , caffeine cirate 20mg / ml inj. , caffiene citrate oral solution oraldrop , calamine lotion 100 ml bottel , calcium + vit. d3 syp 100 ml , calcium + vit. d3 syp 200 ml , calcium acetate 667 tab. , calcium carbonatetab. i.p. 500 , colistimethane inj. , calcium chloride 5ml vial inj. , calcium dobesilate 500mg cap. , calcium gluconate inj. i.p. , calcium gluconateinj. , calcium phosphate 200 ml syrup , capmatinib 200 mg ( monopoly ) tab. , carbamazepinetablet 200 mg , carbetocin 1ml / 100micro. inj. , carbimazole 10 mg tab. , carbimazole 10mg tab. , carbimazole 20mg tab. , carbimazole tablet 5 mg , carboprost tromethamine inj. ( preservative free ) each ml contains carboprost 125mg / ml , carboxymethylcellulose + glycerin eye drop , carfilzomib 20 mg inj. , carfilzomib 60 mg inj. , caripil tab , carmustine 100 mg inj. , carnitor 500 mg tab , carvedilol 12.5 mg tab , carvedilol 3.128 mg tab , carvedilol 6.5 mg tab , caspofungin 50 mginj. , caspofungin 70 mginj. , cefaclor each 5 ml contain cefaclor 125 mg syp. , cefepime inj. ip 500 mg { 510 } , cefexime + pottasium clavunate 375 mg tab , cefexime 50 mg tab , cefexime syp 30 ml , cefixime + potassium clavulanate 200+125mg tab. , cefixime oral suspension50mg syrup , cefixime oral suspension 100mg syrup , cefixime tab 100 mg , cefixime tab 200 mg , cefoperazone 1gm+tazobactum 125mg inj. , cefoperazone 1mg inj. inj. , cefoperazone 500mg inj. , cefotaxim + salbactum 1.5 gm inj , cefotaxim 125 mg inj , cefotaxim 500 mg inj , cefotaxime sodium injection 1gm , cefotaxime sodium injection 250 mg , cefpodoxime 100 mg tab , cefpodoxime 200 mgtab , cefpodoxime 50 mg tab , cefpodoxime 500 mg tab , cefpodoxime cv 375 tab. , cefpodoxime oral suspension 20mg / ml drops , cefpodoxime proxetil oral suspension 100mg syrup , cefpodoxime proxetil oral suspension 50mg syrup , ceftazidime 1gm+sulbactam500 mg inj. , ceftazidime 250 mg inj , ceftazidime inj1 g , ceftriaxoneip 125 mginj. , ceftriaxone +salbactum+ disodium edta inj. , ceftriaxone1000mg+ tazobactom125mg inj. , ceftrioxone 1 gm inj , ceftrioxone inj.125mg / vial , ceftrioxone inj.1gm / vial , ceftrioxone inj.250mg / vial , ceftrioxone inj.500mg / vial , ceftrioxone+tazobactam 562.5 gm inj , ceftrixone with salbactum 375 mg inj , ceftrixone with salbactum 750 mg inj , cefuroxime 1gm inj. , cefuroxime 250 mg tab , cefuroxime axetil500 mg. tab. , cefuroxime syp 125 ml , cephalexin 250 mg cap , cephalexin 500 mg cap , ceritinib 100 mg cap. , ceritinib 200 mg cap. , ceritinib 250mg cap. , ceritinib 50 mg cap. , cetirizine & phenylephrine tab 5 mg + 10 mg +paracetamol 325 mg , cetrizine syp , cetrizine tab. 10mg , cetrorelix acetate 0.25 mg inj. , cetuximab 100 mg inj. , cetuximab 500mg inj. , chlorambucil tab. 5 mg , cisplatin inj 50 mg / 50 ml , cisplatin inj 10 mg / 10 ml , cyclophosphamide tab. 50 mg ( each sugar coated tab. conatain ) , cyclophosphamide inj. 200 mg , cyclophosphamide inj. 500 mg , cytarabine 500 mg inj. , chloramphenicol0.5% eye ointment , chloramphenicol +polymycineye ointment , chloramphenicol +polymycine + dexamethasone eye ointment , chloramphenicol 1gm / vial inj. , chloramphenicol eye drops 0.5% , chlordiazepoxide 25 mg tab. , chlordiazsepoxide 10 mg + clidinium 25 mg tab. , chloroquine 250 mg tab , chloroquine phosphute inj. 40 mg , chloroquine syrup 50mg / 5 ml , chlorpheniramine maleate tablet 4 mg , chlorthalidone 6.25 mg tab. , chlorzoxazone 500 mg+diclo 50 mg +pcm 500 mg tab , cholchicine 0.5mg tab. , cholichalciferol sachets 1gm , cilnidipine 20 mgtab. , cilnidipine 5 mgtab. , cilnidipine10 mgtab. , cilostazol 100mgtab. , cilostazol 50mgtab. , cinnarizine 25 mg tab , cinnarizine 75 mg , ciprofloxacin & dexamethasone ear drops5 ml , ciprofloxacin eye drops0.3% w / v 5 ml , ciprofloxacin eye ointment0.3% , ciprofloxacin inj.200mg / 100ml , ciprofloxacin tab250 mg , ciprofloxacin tab500 mg , citicoline 250 mg , citicoline 500 mg , cladrabine 10 mg inj. , clarithromycin 250 mgtab. , clarithromycin 500mginj. , clarithromycin 500mg tab. , clarithromycin for oral suspension 125mg / 5mlsyrup , clindamycin600mg / 4ml inj. , clindamycin 150 mg tab , clindamycin 300 mg tab , clindamycin gel15 gm , colistimethate injection ip 1m iu powder for soulution , clobetasol+salicylic acid 0.5%+6% ointment , clobetasole 0.05 % creame / oint / lotion , clomiphene tablets 25 mg , clomiphene tablets 50 mg , clomipramineip 25 mgtab. , clonazepam tab .25mg , clonazepam tab .5 mg , clonazepam tab 1 mg , clonidine 150mcg / ml inj. , clonidine hydrochloride tab. ip 0.1 mg ( each tab. contain clonidine hydrochlorie ip 0.1 mg ) { 751 } , clopidogrel75+ asprin 150tab , clopidogrel tab 75 mg , closed suction system , clotrimazole 1 % with beclomethasone ear drops5 ml , clotrimazole 1 % with lignocaine ear drops 5 ml , clotrimazole 1%+beclomethasone 0.25% lotion , clotrimazole vaginal tab.500mg , clozapine 100 mg tab. , clozapine 25 mg tab. , clozapine 50 mg tab. , coal tar solution + salicylic acid solution , codien lincatus syp , coloplast60 gm paste , compound sodium lactate ( 1000 ml ) rl , compund sodium lactate inj. i.p.i 500 ml , compund sodium lactate inj. i.p.i 500 ml glass bottle , conjugated estrogen 0.625mg tab , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) tab. , cotrimoxazole suspension40 mg + 200 mg / 5 ml , cotrimoxazole ds tab 160+800 mg , co trimoxazole tab 80 mg + 400 mg , cough syrup 50ml each 5ml contains chloropheniramine maleate ip 3mg ammonium chloride 130mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cpm+cmc+nephazolineeye drop , cream clotimazole +neomycine + beclo , cathterher mount , cyclopentolate 1% eye drop , cyclosporine 100 mg cap. , cyclosporine oral solution 100mg / ml syrup , cyproheptadine200ml syrup , cyproheptadine 4mg tab. , cyproterone acetate 2 mg +ethynil estradiol. 035mg tab. , cytarabine 1000 mg inj. , cyclosporine cap. usp / ip 50 mg , ceftrione + tazobactum 1.125 gm inj. , complamina 300 mginj. , danazol 50 mg cap , daunorubicin 20 mg inj. , dacarbazine 500 mg usp / bp inj. , deferasirox 100 mg tab. , deferasirox 500 mg tab. , deferiprone cap 250mg , deferiprone cap 500mg , d penicillamine 250mg cap. , dabigatran 110 mg tab. , dabigatran 150 mg tab. , dabrafenib 50 mg tab. , dacarbazine 200 mginj. , dacomitinib 15 mg ( monopoly ) tab. , dacomitinib 30 mg ( monopoly ) tab. , danazol 100mg cap. , dapagliflozin 10 mg tab. , dapoxetine 30 mg tab. , dapsone 100 mg tab. , daratumumab 100 mg ( monopoly ) inj. , daratumumab400 mg ( monopoly ) inj. , darbepoietin alfa 100mcg inj. , darbepoietin alfa 200 mcg inj. , darbepoietin alfa 500mcg inj. , decitabine 100 mg inj. , decitabine 50 mg inj. , deflazacort 12 mg tab. , deflazacort tab 6 mg , degarelix 120 mg inj. , degarelix 80 mginj. , degludec insulin 300iu / 3ml inj. , denosumab 120 mg inj. , desfluraneusp 240 ml bottle solution , desonide0.05% cream , desvenlafaxine 50mg tab. , detemir insulineinj. , dexamethasoneinj8 mg / 2ml , dexmedetomidine 100mcg / ml inj. , dextran 40 inj. , dextromethorphan hcl + chlorpheniraminesyrup , dextrose 5% 500 mlglass bottle inj. , dextrose inj. 5% isotonic ( 1000 ml ) d 5 , dextrose injection 10% , dextrose injection 25% i.p. , dextrose injection 5% isotonic , dextrose with sod.chloride polypack 5% 500ml inj. , diastasepepsin with simethicone 15 ml drop , diazepam inj.10mg / 2ml ( im / iv use ) , diazepam ip 5 mg tab , diazoxide 300 mg / 20ml inj. , diclo + dicylomine 2 ml inj , diclo+pcm+serratiopeptidasetab , diclofenac + thiocolchicoside 4 mgtab. , diclofenac 1 ml , diclofenac each transdermal patch contain 200 mg diclofenac patch , diclofenac gel30 gm , diclofenac sodium 50 mg + paracetamol 500 mg , diclofenac sodium inj 25 mg / ml , diclofenac sodium sr100tab , diclofenac sodium sr75tab , diclofenac sodium tablet 50 mg , dicyclomine+ pcm tab , dicyclomine hcl inj 10 mg / ml , dicyclomine hcl tab. 10 mg , dicyclomine syrup 10 mg / 5ml , dienogest 2mg tab. , digoxin 2mg inj. , digoxin 0.25% elixir , digoxin tablet 0.25 mg , diltiazemprolonged released90mgtab. , diltiazem 2%p / r gel , diltiazem 25 mg / 5 mlinj. , diltiazem tablet 30 mg , dimethyl fumarate 240mg tab. , dimethyl fumarate120 mg tab. , dinoprostol cream , dipper rash cream 25gm , distilled water 10ml inj. , disulfiram 125 mg tab. , disulfiram 250mg tab. , doxorubicin 50 mg / 25 ml inj. , dasatinib tab 100 mg , dobutamine hcl inj. 250 mg / 5 ml , docetaxel 120 mg inj. , docetaxel 20mg inj. , docetaxel 80 mg inj. , docosahexaenoic 30ml drops , domperidone drop , domperidone suspension5 mg / 5ml , domperidone tab. 10 mg , donepezil 5 mg tab. , dopamine hcl inj. 200 mg / 5 ml , douline respules , doxycycline inj. 100 mg , doxycycline tab 100 mg , drop enjymie , drotavarine syrup , drotaverine & mefenamic acid 80+ 250 mg tab , drotaverine 40 mg tab , drotaverine 80 mg tab , drotaverine inj40 mg / 2 ml , duloxetine gastro resistant 20 mg tab. , duloxitine gastro resistant30 mg tab. , durvalumab 120 mg ( monopoly ) inj. , durvalumab 500mg ( monopoly ) inj. , dydrogesterone 10mg tab. , dexmedetomidine 80mcg / 20ml inj. , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml syrup , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml syrup , ecoshild 1 lt. , electrolyte g ( p.b. ) 500 ml , electrolyte p inj. , electroylte m inj. iv bfs bottle , eltrombopag 25mg tab. , eltrombopag 50mg tab. , empagliflazone 10mg tab. , empagliflazone 25mg tab. , enalapril maleate tablet 2.5mg , enalepril malate inj , enjymesyp , enoxaparin 60 mg injectionlmwh 0.6 ml , entacapone 200 mg tab. , enterogermina 2billion spores 5ml resp. , enzalupamide 40mg tab. , enzymedrop , enzyme 100 ml syrup , ephedrine 30 mg / ml inj. , epirubicin 150mg / ml inj. , epirubicin 50mg / ml inj. , eribulin 0.5mg inj. , eribulin 1 mg inj. , erithroproitine 2000 inj 1 vial , erithroproitine 4000 inj 1 vial , erlotinib 100mg tab. , erlotinib 150 mg tab. , ertapenem sodium 1gm = ertapenem 1.046 gm inj. , erythromycin 250 mg tab , escitalopram 10mg tab. , esmolol 100 mg. inj , esmoprazole 10mg granules , esomeprazole 40 mg tab. , estradiolvalerate 2 mg tab. , etoposide inj. 100 mg , etanercept 25mg / 0.5ml inj. , ethamcylate 500 mg tab , ethamsylate inj 250 mg / 2ml , ethinyl estradiol 0.03 mg+ levonorgestrel 0.15 mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg tab. , etizolam 0.5 mg tab. , etomidate 20 mg inj. , etoposide inj. , entecavir tab. ip 0.5 mg , empiglitazone 25 mg tab , etophylline + theophylline150 tab , etophylline + theophylline 300 tab , etophylline + theophylline 450 mg tab , etoricoxib+thiocolchicoside ( 60+8 mg ) tab. , eveningprimosa 1000 mg cap. , everolimus 10mg tab. / cap. , everolimus 5mg tab. / cap. , exemestane 25 mg tab. , febuxostat 40 mg tab. , febuxostat 80 mgtab. , fenticonazole 2% cream 30 gm , feric carboxymaltose 50 mg / 1 mlinj. , ferrous sulphate and folic acid tab. each film coated tab. containing dried ferrous sulphate ip equivalent to 100mg elemental iron and folic acid ip 0.5mg , fexofenadine120 mg tab. , fexofenadine180 mg tab. , ferric carboxymaltose50 mg / 10 ml , finasteride tablet ip 5 mg { 575 } , fingolimod 0.5 mg tab. , filgrastim inj. ip ( granulocyte colony stimulating factor sc / iv use ) 300 mcg , flurosil 5 mlinj. , flurouracil 250 mg / 5 ml inj. , flavoxate 200 mg tab , flucanzole tab 150mg , fluconazole 100mg inj. , fluconazole 200 mginj. , fluconazole oral suspension syrup , fludarabine phosphate injection 100mg inj. , fludarabine phosphate injection 50mg inj. , fludrocortisone 100mcg tab. , flunarizine 10mg tab. , fluoxetine cap 20mg , fluphenazine deconate injection ( long acting ) 25mg / ml ampule inj. , fluromethalone 0.1% eye drop , fluticasone ftnasal spray , fluticasone ointment , fluvoxamine 100 mg tab. , fluvoxamine 50 mg tab. , folic acidtablet 5 mg , folic acid +methylcobalamine 10 ml pack inj. , folinic acid 15mg tab. , folinic acid 200mg / vial inj. , fondaparinux 2.5mg inj. , formaldihyde solution 500 ml , formaline tab. , formeterol 20mcg +budesonide 0.5mg resp. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation mdi , formetirol budesonide 200 r / c ( foracort ) , formetirol budesonide 400 r / c ( foracort ) , formoterol 6 mcg. + budesonide 200 mcg. mdi , formoterol 6 mcg. + budesonide 400 mcg. mdi , fosfomycin3gm sachet , fosphenytoin sodium 150mg / ml inj. , frusemide inj. 10mg / ml , frusemide tab. 40 mg. , fsh 150 iu inj. , fsh 75 iu inj. , fulvestrant 250mg inj. , furosemide 10mg / ml drop , furosemide 20mg + spironolactone 50mg tab. , fusidic acid ointment 2% , gbhc lotion 60 ml , gdw 5% glass bottle / 500mlinj. , gentamycinear drop , gentamycin drop ( 5 ml ) , gentamycin inj80mg / 2ml , glibenclamide tab5mg , gliclazide + metformin 500 tab , gliclazide tab 40 mg , glimepiride tab1mg , glimepiride tab2mg , glipizide tab.5mg , glucosamine + hydrochloride +methylsulfonylmethane cap. , glucosamine hydrocloride + diacerin 50 mg tab. , gluteldehyde solutions 5 lt. , glycerin2 gm / ml suppsitory , glyceryl trinitrate injection, diluted 5mg / ml inj. , glycine irrigation solution 1.5% 3ltr solution , glycolic acid 6% cream , glycopyrolate 10 ml inj , gefitinib tab. ip 250 mg film coated tab. conatain gefitinib ip 250 mg q , ganaciclovir sodium inj. 500 mg. , gemcitabine for inj. 200 mg , gemcitabine for inj. 1 gm , hydrogen peroxide mouthwash1.5% , human rabbies immunoglobine inj. , hepatites b immunoglobine 100 mg , hepatites b immunoglobine 200 mg , h2o2 solution , haemocoagulase1 ml inj. , haloperidol ( long acting ) 50mg / ml ampoule inj. , haloperidol 0.25 mg , haloperidol 0.5 mg , halothane 250 ml , hemaccealinj 1 * iv ( hydroxylethyl starch ) , hematinic syp , heperin inj25000 i.u. , homotropine eye drops 2 % 5 ml , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg tab. , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu inj. , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu inj. , hpmc 0.3%eye drop 10 ml , human albumin 20% in 50 ml vial inj. , human anti d. immunoglobulin ( polyclonal ) inj. 300mcg , hydrochlorothiazide tablet 12.5 mg , hydrocortisone sod. succinate inj.100 mg , hydroxy chloroquien200 mg tab , hydroxyprogestrone inj 500 mg / 2 ml , hyoscine butyl bromide 500 mg tab , hyoscine butylbromide 1 ml inj , hypo chlorid solution 5 lit. , hyalaronidase 1 ml 1500 i v inj. , ivermectine 12 mgtab , ibu+parasyp , ibuprofen 400 mg + paracetamol 325mg , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , imferon f 12 inj2 ml , imipramine tablet 25 mg , ifosfamide inj. ip / bp / usp 1 gm , imatinib tab ip 400 mg , inositol + myoinositol 1000mg tab. , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges inj. , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen inj. , insulin 30 / 70 inj40 iu / ml , insulin glargine10 ml , insulin hum mixtard ( 50 / 50 ) in surgen inj , insuline 50 / 50 inj. , invert sugar 10% ( fructodex 10% ) 500 cc inj. , ipratopium + salbutamol r / c , irinotecan 100 mg / 5ml inj. , irinotecan 40mg / 5ml inj. , iron ( ferrous ascorbate ) drop , iron 111 hydroxide polymaltoseoral drops 15 ml , iron and folic acid syp , iron dextran inj , iron sorbitaxinj , iron sucrose 5 ml inj , isolyte ginj. 500 ml , isolyte p 10% 500 ml inj. , isophane insulin inj. 40 iu / ml ( insulin n ) , isoprenaline inj. ip 2 mg / ml { 551 } , isosorbide dinitrate 5 mgtab , isosorbide mononitrate tablet 20 mgismo 20 , isotretinoin 10mg cap. , isotretinoin 20 mg cap. , isoxsuprine tab20mg , itraconazole 1% eye drop , itraconazole 1% eye ointment 3 gm , itraconazole capsules 100 mg , ivabradine 5mg tab. , ivermectin 12mg tab. , ivermectin 6 mg + albendazole 400 mg tab. , ivermectin 6mg tab. , ketaconazole 2% lotion 75 ml , ketamine 50mg / ml inj. , ketoconazole 200 mgtab. , ketoconazole creame 1 %15 gm , knee cap all size , kojic acid 2%, arbutin, niacinamidecream 30 gm , linizolid 600 mg tab , l ornilhave l aspartale 10 ml inj. , l asparaginase 1000 iu inj. , letrazole tab. 2.5 mg , labetalol 100 mg tab , lacosamide 50 mg tab. , lacosamide infusioninj. ( 200 mg / 10 mg / ml ) , lactulose 20% enema 275 ml , lactulose syp , leucovorin calcium inj. ip / calcium folinate inj.ip 10 mg / ml , leflunomide phosphate 10 mgtab , leflunomide phosphate 20mgtab , leflunomide tab. ip 10 mg ( film coated ) { 600 } , lenalidomide25mgtab. , lenalidomide 10 mgtab. , lenvatinib 10 mgtab. , lenvatinib 4 mgtab. , leosalbutamol 50mcg.+ ipratopium 40mcg. mdi , levetiracetamip 250 mg tab. , levobupivacaine 0.5% ( 20mg / 4ml ) ampule inj. , levocetrazine tab , levocetrizen 5mg+ phenylpropanolamine25 mg , levodopa+carbidopa 125 tab. , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg tab. , levofloxacin 750 mg tab. , levofloxacin 250 mg tab , levofloxacin 500 mg tab , levofloxacin oral solution syrup 125 mg 60 ml , levofloxacine 500mg / 100 ml inj. , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml resp. , levosalbutamol inhalation solution 50ml / gm mdi , levosalbutamol repsules 2.5 ml , levosalbutamol+ ipratopium + salbutamol , levosulpride 12.5 mg / ml inj. , levosulpride 75mg tab. , levothyroxine sodium25 mcg tab. , levothyroxine sodium75 mcg tab. , lidocaine10%20ml spray , lidocaine ( xylocard ) sustemic 50 ml inj , lidocaine 25 mg + prilocaine25mg cream 30 gm , lidocaine1% 50 mg / 5 ml inj. , lignocaine ( preservative free ) 2% inj. 30 ml , lignocaine + adrenaline ( 1:10000, 2:10000 ) inj. 30 ml , lignocaine 1% mouth paint15 ml , lignocaine 2% ( 30 ml ) inj , lignocaine 4 % 30 ml inj , lignocaine 5% 2 ml , lignocaine hcl gel2% , lignocaine hcl gel 5% 10 gm tube , lignocaine hydrochloride 2% 50ml vial inj. iv inj. , lignocaine viscous200 ml solution , linaglipitin 5mg tab. , linezolid 100mg / 5ml in 30ml syrup , linezolid 200 mg / 100 ml { 516 } , linezolid 600 mgtab , liposomal doxorubicin 20mginj. , liposomal doxorubicin 50 mg inj. , liq. antacideach 5ml contains, aluminium hydroxide gel 250 mg, magnesium trisilicate250mg, methyl polysiloxane 50mg , lisinopril 10 mg tab , lisinopril tab 5mg , liver onic syp , lomustine 40 mg cap. , loperamide tab 2 mg , lopinavir 200mg+ritonavir 50 mg tab. , loratadine 10 mg tab. , lorazepam5 mg inj. , lorazepam 1.0 mginj. , l orinithine l aspartate 10 mlinj. , lorlatinib 100 mgtab. , lorlatinib 25 mg tab. , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) cap. , losartan tab 50 mg , losarten h tab , loteprednol 0.25% eye drop , low molecular wt. heparin 0.4mg inj. , luliconazole 1% cream , lysole ( cresol 50%+soap50% ) , lithium carbonate 300 mg tab. , lithium carbonate 450 mg tab. , magnesium sulphate inj50mg / ml , magnesium sulphate, sulphacetamide, urea 75 gm ointment , mannitol 100 ml ( p.b. ) , mannitol inj. 20% w / v , mercaptopurine 20 mg tab. , methyl prednisolon sodium succ. 125 mg inj. , methyl prednisolon sodium succ. 40 mg inj. , methyl prednisolon sodium succ. 500 mg inj. , methyl prednisolon sodium succ. 80 mg inj. , mesalamine 1.2 mg tab. , melphalan 5mg tab. , mercaptopurine tab ip 50 mg , methotrexate inj. ip 50 mg / 2ml , methotrexate tab. ip 2.5 mg , methotrexate tab. ip 10mg , mycophenolate mofetil cap. / tab ip 250 mg each cap. , mycophenolate mofetil cap. / tab ip 360mg each cap. , mecobalamin tab , medazelom inj.10ml vial , medroxy progesterone acetate inj. ip150 mg with sterlie disposable syringe & water for inj. , medroxyprogesterone acetate 10 mg tab , medroxyprogesterone acetate 5 mg tab , mefenamic acid 500 mg tab , mefenamice acid 100mg / 5ml syrup , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml syrup , mefloquiene 250 mg tab , megestrol acetate 160 mg tab. , melatonin 3 mg tab. , melatonin 60 ml syrup , melphalan 2mg tab. , menadione ( vit k ) inj. menadione usp 10mg / ml , mephentermine 50mg / ml inj. , mephentine 30 mg / ml inj. , meropenem 2gm inj. , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) inj. , metformin sr 1 gm tab , metformin tab500mg , methimazole10mg tab. , methimazole5 mg tab. , methimez 10 mg tab , methimez 5 mg tab , methotrexate 15mg tab. , methotrexate 250 mg inj. , methotrexate 7.5mgtab. , methotrexate 15mg tab. , methotrexate 2.5 mg tab. , methotrexate 5 mg tab. , methotrixela10 mg tab. , methy prednisolone sodium acetate inj.40mg , methy prednisolone sodium acetate inj.80mg , methyl dopa 250 mg tab , methyl ergometrine tab i.p0.125mg , methylene blue inj. , methylphenidate 10 mg tab. , methylprednisolon acetate 125mg inj. , methylprednisolone4mgtab. , methylprednisolone 16mg tab. , methylprednisolone 8mg tab. , metoclopramide inj. 10mg / 2ml ( 1m use ) iv+im reqired , metoclopramide tab 10 mg , metolazone 5mg tab. , metoprololxl 25 tab , metoprolol 50 mg tab , metoprolol 5ml vial inj , metotrexate 15mg ( preservative free ) inj. , metronidazoleinj i.p 500 mg / 100ml , metronidazole & norfloxacin suspension 100+100 mg / ml , metronidazole syp , metronidazole tablet 200 mg , metronidazole tablet 400 mg , meverberine 135 mg + chlordiazepoxide 10 mg tab. , miconazole nitrate cream 2% , midazolam 0.5mg / 5ml nasal spray , midazolam 5mg / ml 1 ml inj. , midodrine 5mg tab. , midostaurin 25 mg ( monopoly ) tab. , mifepristone25mg tab. , milrinone 10 mg inj. , minocycline 100mg. cap. , minoxidil 10 % lotion , minoxidil 2%lotion , minoxidil 5% lotion , mirabegeron50 mg tab. , mirabegeron 25 mgtab. , mirtazapine 15mg tab. , mirtazapine 7.5mg tab. , misoprostol 200 mg tab , mitomycin 2 mg inj. , mitomycin 40 mginj. , mmr vaccine 10 ml , moxyflocxacine+dexamethasone dm eye , mometasone 2%cream 20 gm , montelucast+levocetrizine syrup , montelucast + levocetrizine 10 mg tab. , moxifloxacine 5% eye ointment 3 gm , moxifloxacine and dexamethasone eye drop5 ml , moxifloxacin and pednisolone eye drop 5 ml , multivitamine 10 ml inj. , multivitamine 100 ml syp , multivitamin drops each mlcontains vit a 3000 iu, vit, d3 300 i.u. vit d3 300 i.u. vit b1 ip 1mg, riboflavine phosphate sodium 2mg d panthenol 2.5mg, niacianamide 10mg, pyridoxine hcl 1mg, cyanocobalamin1mcg, lysine hcl10mg , multivitamin tab. nfi formula suger coated vit a 2500 iu, vit b1 2mg, vit b6 0.5mg, vit c 50mg, calcium pantothenate 1mg, vit d3 200iu, vit b2 2 mg, niacinamide 25mg, folic acid 0.2 mg , n acelylcysine 600 mgtab , nifidipine cd 30 mg tab , normal human intravenous immunuglobuin 5 mg / 100 ml { 633 } , n acetylectine effervescent form, orange flavor 600 mg tab. , n acetyl cystine 200 mginj , naloxone 1 ml inj , nandrolone 25 mg inj , nandrolone 50 mg inj , nandrolone decanoate 100mg inj. , nandrolone decanoate 50 mginj. , nasal drop saline 15 ml , natural micronised progesterone100 mg / ml inj. , natural progestron cap 200 mg , neomycin , hydrocortisone & polymixin b ear drops , neomycin + bacitracin oint 5mg + 500 iu / gm , neurobion forte 2 ml inj , nicomulone 1 mgtab ( acitorm ) , nicomulone 2 mgtab ( acitorm ) , nicomulone 3 mgtab ( acitorm ) , nicomulone 4 mgtab ( acitorm ) , nicotinamide 50 mg tab , nifedipine10 mg cap. ( soffgel ) , nifedipinetab. 20 mg sr , nifedipine + lidocaine p / rgel 30 gm , nifidipine 20mg sr tab. , nifidipine 20mg tab. , nilotinib200 mg ( monopoly ) tab. , nilotinib 150 mg ( monopoly ) tab. , nilotinib 300mg ( monopoly ) tab. , nimesulide + pcm tab , nimodipine infusion 10mg / 50 ml inj. , nimotuzumab 50 mg inj. , nimusulide 100 mg tab , nintedanib 150mg tab. / cap. , nitazoxanide 500mg tab. , nitrazepam 10 mg tab. , nitrazepam 5mg tab. , nitrofurantoin ip 100 mg tab , nitrofurantoin oral suspension 25mg / 5ml in 100syrup , nitroglycerine inj. 25mg / 5ml , nivolumab 100 mg ( monopoly ) inj. , nivolumab 40 mg ( monopoly ) inj. , nebivolol 10 mg tab , nebivolol 5 mg tab , noradrenaline 2mg / ml inj , norethistrone tab5mg , norfloxacintablet400mg , normal human intravenous immunuglobuin 5 mg / 100 ml { 633 } , normal saline 100 ml inj , normal saline 1000 mlglass bottle inj. , normal saline 500 mlglass bottle inj. , neomycin sulphate and bacitracine zinc ointment usp 5 mg + 500 iu / gm ointment 20 gm , neomycine sulphate cream 20 gm , neostigmine + glycopyrrolate 2.5 mg / 0.5 mg inj. , nicorandil 5 mg tab. , naproxin 500 mg tab , ntg 2.6 mg tab , oxaliplatin inj. usp 50 mg , oseltamivir 60 ml syp , oseltamivir 75 mg cap , octreotide 100mg inj. , octreotide lar ( long acting release ) 20 mginj. , octreotide lar ( long acting release ) 30 mg inj. , ofloxacin & ornidazole tab 200 mg + 500 mg , ofloxacin + tinidozole tab ( 200+600 mg ) , ofloxacin 400 tab , ofloxacin tab 200 mg , oint s.s. creame 20 gm , ointment ( modified linoline oint 20 gm , olaparib 150 mg ( monopoly ) tab. , olaparib 50 mg ( monopoly ) tab. , olaptadine & ketorolaceye drop 5 ml , olmisartan 20 tab. , olmisartan 40 tab. , olnazepam 5mg tab. , oloptadine opthalmic solution0.1% eye drop 5 ml , omalizumab 150 mg vial inj. , omeprazole cap. i.p. 20 mg , omeprazole inj 20 mg , ondansetron 4 mg / 2 ml ) inj , ondansetron inj 8 mg / 4 ml , ondansetron oral solution 30 ml drop , ondansetron oral suspension syrup 30 ml , ondansetron tab 4 mg md , orciprenaline 10 mg tab. , ornidazole 500mg inj. , ors powder i.p. 20.5 gm , osimertinib 80 mg ( monopoly ) tab. , oxazepam 15mg tab. , oxcarbazepine 300mg tab. , oxcarbazepine 450mg tab. , oxybutynin oral suspension5 ml syrup 125 ml , oxytocin inj. i.p. 5units / ml , polybion inj. , polybion 2 ml inj. , povidone iodine 5% eye drop , palonosetron 0.25mg inj. , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) tab. , pantoprazole & domperidone 40+30 mg sr cap , pantoprazole 20mg tab. , pantoprazole inj 40 mg , paracetamoldrops , paracetamolinj150 mg / ml , paracetamolsyp.125 mg / 5ml , paracetamoltablet 500 mg , paracetamoltablet 650 mg , paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory , paracetamol infusion 1000inj. , paracetomol 650 mg tab. , paroxetine 12.5mg tab. , paroxetine 25mg tab. , pazopanib 200mg tab. , pazopanib 400mg tab. , paclitaxel inj. ip 260 mg , paclitaxel inj. ip 100 mg , peg asparaginase 3750 iu 5 ml inj. , peg filgrastim injection 6mginj. , pembrolizumab 50 mg ( monopoly ) inj. , pembrolizumab100 mg ( monopoly ) inj. , pemetrexed 100mginj. , pemetrexed 500 mg inj. , penicillin v 400mg tab. , pentaprozole 20 mg+ dom 10 mg tab , pentazocineinjection 30mg / ml , pentoxifylline extended release / sr 400mg tab. , perampanel 2 mg tab. , perampanel 4mg tab. , permethrin creame 1% 30 gm , permethrin creame 5 % 30 gm , permethrin lotion 1 % 60 ml , permethrin lotion 5 % 60 ml , pertuzumab 100 mg inj. , pheniramine maleate inj. 22.75 mg , pheniramine mealate25 mg tab , phenobarbitone 20mg / 5ml in 100ml syrup , phenobarbitone ip inj.100 mg / ml , phenobarbitone syp , phenobarbitone tablet 30 mg , phenozopyridine 200mg tab. , phenyl ephrine drops 5 % , phenylephrine hydrochloride10 mg / ml inj. , phenytoin bpsodium ip inj. 50 mg / ml , phenytoin sodium tab100mg , pilocarpineeye drop 5 ml , pilocarpine 0.5% w / v inj. 5 ml , pilocarpine eye drops4% , pilocarpine eye drops 2% , pioglitazone 30 tab. , pioglitazone tab 15 mg , piperacillin 1 gm + tazobactum 125 mg inj. , piracetam 200mg inj. , piracetam 500mg / 5ml in 100ml syrup , piracetam tab. 800 mg , pirfenidone 200 mg tab. , pirfenidone 400 mg tab. , piroxicam 2 cc inj , piroxicam dt 20mg tab. , placental extract 2ml inj. , plerixafor 24 mg inj. 1.2 ml , phenobarbione 60 ml syp , podophyliin toxin lotion 10 ml , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride sachet , polyethyene glycol with elctrolyte approx 130gm solution , polymyxin b 10000iu / gm + neomycin 3400iu / gm eye drop 5 ml , polymyxin b for injection 1 millioninj. 5 lac units , pomalidomide 2 mg tab. , pomalidomide 4 mg tab. , posacozazole 100mg tab. , posacozazole 40mg / ml syp. 0.05 ml , potassium magnesium citrate syrup , potassum chloride inj 150 mg / ml , pottasium chloride syp , povidone iodinegargle 50 ml , povidone iodinepessary , povidone iodine ointment 5% , povidone iodine solution 5% , pralidoxime 1gm inj , prasugrel 10mg tab tab. , prazosin 2.5 mg extended release tab , prazosin 5 mg extended release tab , predinisolone syp , prednisoloneip 40mg tab. , prednisolone acetate opthalmic suspension 10 ml eye drop , prednisolone sodium phosphate1% eye / ear drop 5 ml , prednisolone tablet 10 mg , prednisolone tablet 20mg , prednisolone tablet 5 mg , pregabalin75 mg tab , pregabalin75mg+methylcobalamin 750cap , pri and probiotic sachets , primaquinds tab 15 mg , primaquine tab 2.5 mg , primaquine tab 7.5 mg , primidone 250 mg tab. , primidone 50 mg tab. , procaine penicillin fortified 2 lack inj. , prochlorperazine 5 mg tab. , prochlorperazme ( stemilil ) inj , profol 1%inj , progesterone injection 50 inj. , progesterone only pills tab. , promethazinehcl inj.25 mg / ml , promethazinesyrup ip5 mg / 5ml , promethazine tab 25 mg , propanolol 10 tab , propanolol 20 tab , proparacaine 0.5% w / v eye drop , propranolol 10mgtab. , propranolol 40 mg sr tab. , propranolol tab. 40mg , paracetamolinj. , phenobibrate 60mg tab , perfinidone 200 mg tab , propylthiouracil 100 mg tab. , prostaglandin 500mcg / ml inj. , protamine sulphate 5ml inj. , protien powder , pyridoxine100 mg tab. , pyridoxine 10 mg tab , pyridoxine 25 mg tab , pyrimethamine 25 mg tab , pipracetum 1200 tab , quinine dihydrochloride 300mginj , quetipine 25 mg tab. , quetipine 50 mg tab. , quetipine 100 mg tab. , rabeprazole +levosulpiridecap. , rabies anti serum , rifaximine 100mgtab , rabies vaccine ip human ( cell culture ) 2.5 iu / dose ( intra muscular ) , racecadotril 100mg cap. , racecadotril cap 100 mg , racecadotril sachet 30 mg sachet 1 gm 10 mg , ramiprilip 5 mg cap. , ramipriltab2.5 mg , ramucirumab 100 mg ( monopoly ) inj. , ramucirumab 500 mg ( monopoly ) inj. , ranitidinetab. i.p 300mg , ranitidine hcl inj. i.p 50mg / 2ml , ranitidine hcl tab. i.p 150mg , ranitidine oral suspension syrup , ranizumab 10mg / ml inj. , ranolazine 500mg tab. , rantec+ domperidonetab , rasagiline1mg tab. , rasburicase 1.5 mg inj. , recombinant fsh 150 iu inj. , recombinant fsh 300iu inj. , recombinant hcg 250 iu inj. , recombinant human growth hormone 4iu vial with syringeinj. , recombinant lh 75iu inj. , regorafenib 40 mg tab. , repaglinamide 0.5mg tab. , repaglinamide 1mg tab. , resperidone 1 mg tab , resperidone 2 mg tab , reteplase 18 mg inj. , revolizer / rotahaler device , rh erythropoetin inj. 10000 iu , rh erythropoetin inj.2000 iu , rh erythropoetin inj. 3000 iu , rh erythropoetin inj. 4000 iu , ribociclib 200 mg ( monopoly ) tab. , riboflavin 5 mg tab , rifampicin 150 mg tab. , rifampicin 450 mg tab. , rifampicin 600 mg tab. , rifaximin 200tab. , rifaximinsyrup 60 ml , rifaximin 550mg tab. , risperidone prolonged releaseddepot 25 mg inj. , risperidone prolonged releaseddepot 50mg inj. , rituximab500 mg inj. , rituximab 100 mginj. , rivaroxaban 10mgtab. , rivaroxaban 15mgtab. , rivaroxaban 20mgtab. , rizatriptan 10mg tab. , rocuronium 100mg / 10ml inj. , romiplostim 125 mcg inj. , romiplostim 250 mcg inj. , romiplostim 500 mcg inj. , root canal sealer ( calcium carbonate ) 21 gm powder, +7.5 ml liquid , ropinirole 0.25mg tab. , ropivacaine 0.75% 20ml vial inj. , ropivacaine 0.75% 3 ml ampule ( heavy ) inj. , rosuvastatin 10mg + fenofibrate 160mg tab. , rosuvastatin tab. 10 mg { 757 } , rosuvastatin tab. 20 mg { 756 } , rothaler machine , rucaparib300 mg cap. , rucaparib 200 mg cap. , ruxolitinib 10 mg tab. , ruxolitinib 15 mg tab. , ruxolitinib 20 mg tab. , ruxolitinib 5 mg tab. , sacubitril 24 mg and valsartan 26 mg tablet { 758 } , salbutamolr / c , salbutamol + beclomethasone r / c , sodium chloride solutin 3% inj. , sumag ointment 75 mg , salbutamol inhalation , salbutamol nebuliser solution , salbutamol rotocop , salbutamol sulphate tablet 4 mg , salbutamol tab 2 mg , salicylic acid 16.7% + lactic acid 16.7% paint15 ml , salmeterol+ fluticasone100 r / c , salmeterol+fluticasone 250 r / c , salmetrol 50mcg+fluticasone 500 mcg dpi , secnidazole tab 500 mg , secukinumab 150 mg inj. , selegiline 5mg tab. , sensor rebefacient 10 gm ointment , seranac tab 0.25 mg , serratiopeptidase 20 mg tab. , serratiopeptidase tab 10mg , sertraline tab 50 mg , sevelamer carbonate 800 mgtab. , shoulder emobilizer , sidenafil cirate 25 mgtab. , sidenafil cirate 50 mgtab. , sildenafil25 mg tab , sildenafil50 mg tab , sildenafil 0.8mg inj. , sildenafil 20 mg tab. , sildosin + dutasteride tab. , silodosin 4 mg cap. , silodosin 8 mg cap. , silver sulphadiazine 25 gm , silver sulphadiazine 250 gm , silymarin 70mg. tab. , sodium valporate 100 ml syp , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml drop , sitagliptine + metformin ( 50 / 500 ) tab. , snake venum anti serum i.p. ( liquid form ) polyvalent anti snake venum , sodium bicarbonate injection inj. 10 ml , sodium bicarbonate injection solution b.p. 7.5% w / v , sodium bicarbonate oral suspension syrup 200 ml , sodium chloride & dextrose ( 1000 ml ) dns pfs , sodium chloride 0.9% 3000ml ( n.s ) inj. pfs , sodium chloride 3 % respules 4 ml , sodium chloride 3% 100ml inj. , sodium chloride 5 %eye drop , sodium chloride 6% eye ointment , sodium chloride and dextrose0.45% infusion 500ml inj. , sodium chloride and dextrose inj. i.p dns , sodium chloride bottel 100ml inj. , sodium chloride injection i.p , sodium fluroresceinedye 20% inj. 5 ml , sodium hyaluronate 1.4mg inj. , sodium picosulphate oral suspension syrup 100 ml , sodium valporate 500 er tab , sodium valproatetablet 200 mg , sofosbuvir 400 mg+ velpatasvir 100 mg tab. , framycetin cream 30 gm , solifenacin succinate10 mg tab. , soluble insulin inj.40 iu / ml ( insulin r ) , sorafenib 200 mgtab. , sorbitol + tricholine citratesyrup 200 ml , spiranolactone tab. i.p. 25mg , spironolactone 50 mg tab , standard pama intra ocular lensno 11 to 28 , streptokinase 15 lacs iv inj , streptomycin1gm inj. , streptomycin500mg inj. , streptomycin.75 gm inj. , succinyl choline chloride ( 50mg / ml ) inj. , sucralphate syrup 100 ml , sugar free cough syp , sulfacetamide eye drops 20% 10 ml , sulfasalazine delayed release tab. usp / gastroresistant sulfasalazine tab. bp500 mg tab { 602 } , sulphur + calaminelotion 70 ml , sultamicin 375 mg tab. , sunitinib 12.5 mg tab. , sunitinib 25 mg tab. , sunitinib 50 mg tab. , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 lotion , surgical spirit 500 ml , symal mct oil 100 ml , salphadoxine + pyrimethamine 500+25 mg tab , trifluparazine 5 mg tab , trihexiphendyl tab , thiocolchicoside 2 ml inj. , tenigliptine 20 mg tab , temozolomide cap. ip 100 mg , tamoxifine tab ip 10 mg , thiouguanin tab. ups 40 mg , toivaptan 15 gm tab , trimetazidine 35 mgxetend reliese tab , tamsulosin+dusasteride tab. , telmisartan 80 mgtab , terbinafine hydrochloride250 mgtablet , thalidomide cap. usp 100 mg ( each hard gelatin cap. contains thalidomide usp 100 mg ) , tacrolimus cap. ip 0.5 mg , tocilizumab 200 mg inj. , telmisartan tab 40 mg , temsulosin 0.4 cap , terburtaline sulphate 2.5 mg tab , terbutal+ambroxole +guphensin cough syp100 ml , terbutaline + abmbroxol tab , testosterone 25mg / 1 ml inj , tetanus toxoid 0.5 ml inj , tetglob 250 mg inj , theophylline and etofylline inj. ( anhydrous theophylline 50.6mg etofylline 169.4 mg ) , thiamine 100 mg tab , thiopentone 500 mg inj. , thrombophob ointment , thyroxine sodium tab. i.p. 0.1mg of thryoxine sodium equivalent to 0.091 mg of anhydrous thyroxine sodium , timolol eye drops0.25% , tiotropium r / c ( tiova ) 18 mg , tobramycin + dexamethasoneeye drops 0.3% , tobramycin eye drops 0.3% , tobramycin eye oint. , torsamide tab 10 mg , tramadol cap 50 mg , tramadol hyd + pcm tab , tramadol inj 50 mg / ml inj. , tretenoin creame 0.025 % 20 gm cream , triamcinolone acetonide 10 mg per ml inj. , triamcinolone acetonide 40 mg per ml inj. , triclofos oral suspension500 mg / 5mlin 30ml syrup , trimetazidine 35mg tab. , trimetazidine 60mg tab. , triolmezest tab 20 mg , triolmezest tab 40 mg , triotropium + formoterolcap. ( duova ) , triptorelin 0.1 mg inj. , triptorelin 11.25 mg inj. , triptorelin 3.75 mg inj. , tropicamide+phenylepherine eye drop 5ml , trypan blue 0.6% inj. 1 ml , trypen blue dye 100 ml , trypsin + rutoside+bromelaintab. , trypsin chymotripsin tab. , ursodeoxycholic oral suspension 125mg / 5ml in 100ml syrup , udca 300 mg tab , vorisconazole injection 200 mg / vial , valganciclouir 450 mg tab. , vinblastine inj. ip 10 mg / 10 ml , vincristine inj. ip 1mg ( vial ) vincristin inj. usp 1mg / ml ( amp ) , valethamate bromide inj 8mg / ml , varicella immunoglobulin for iv use inj. 125 iv , vasopressin 3ml inj. , vencomycin 500mg inj. , verapamial 120 srtab , verapamil2.5 mg / ml inj. 2 ml , verapamil hydrochloride sustained release 120 tab. , verapamil hydrochloride sustained release 40 tab. , verapamil tablet 40 mg , verapamil tablet 80 mg , vildagliptin 50mg tab. , vinorelbine 50mg inj. 5 ml , vit d ( ergocalciferol ) 0.25 mg cap , vit d ( ergocalciferol ) 1 mg cap , vit e 400 cap , vit. k 1 ml inj , vitamin – e50mg / ml, 400 iu drop15 ml , vitamin a 25000 iu cap. , vitamin b complex inj. nfi , vitamin d ( 600000 iu ) inj. 1 ml , vitamin d3 400iu / ml drop 30 ml , vitamin d3 800iu / ml drop15 ml , vit b complex tab nfi ( prophylactic ) b1 2mg, b2 2mg, b6 0.5mg niacinamide 25mg calciumpantothenate 1mg ( with appropriate overages ) , voglibose 0.1mg tab , voglibose 0.2 mg tab , voglibose 0.3 mg tab , voglibose 0.4 mg tab , voriconazole 200 mgtab. , voriconazole eye drop 30 mg , vaso presseninj. , vasopresine 20 unitinj. , vit k1 inj. , warfarin 2m tab. , warfarin 3mg tab. , warfarin sod. 5 mg tab , water for injection i.p. , wex dissolving ear drop 10 ml , xylocaine spray 10% , xylometazoline0.1 % drops 10 ml , xantinol nicotriateinj. , xantinol nicotriate tab. 150 mg , zoledronic acid 5 ml / 100 mlinj. , zinc 50mg tab. , zinc oral suspension 20 mg / 100 ml syrup , zink sulphate 50 ml syp , zolpidem 10mg tab. , zonisamide 100 mg tab. , zonisamide 50mg tab....

Department Of Medical Education - Rajasthan

34173859 supply of rate contract for medicine for mndy supply of rate contract for medicine for mndy , laying and jointing pvc pipe. heading , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , halothane bp , isoflurane usp , ketamine inj ip 50 mg / ml , lignocaine ointment 5 o / o , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , propofol inj ip 10 mg / ml , thiopentone inj ip 0.5 g , sevoflurane , atropine sulphate injection 0.6mg / ml , liquid medical oxygen ( lmo ) , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , fentanyl citrate injection ip 2 ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , morphine sulphate inj ip 10mg / ml , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , paracetamol inj. 150 mg / ml , pentazocine inj ip 30mg / ml ( im / iv use ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , indomethacin cap ip 25 mg , diclofence prolonged release tablet ip 100 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , etoricoxib tab ip 120mg , mefenamic acid tablets bp 500 mg , fentanyl citrate injection 50mcg / ml , naproxen tablet ip 500mg , naproxen tablet ip 250mg , etoricoxib tablet ip 90 mg , aspirin tablet ip ( gastro resistant ) 150 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , paracetamol infusion ip 1% w / v 100ml size , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , adrenaline injection ip 1mg / ml im / iv use , betamethasone tab ip 0.5mg , chlorpheniramine maleate tab ip 4mg , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydroxyzine tab ip 25 mg , methyl prednisolone sodium succinate for injection usp 500 mg , pheniramine inj ip 22.75mg / ml , prednisolone tab ip 5 mg , promethazine syrup ip 5 mg / 5ml , promethazine inj ip 25mg / ml , promethazine tab ip 25 mg , betamethasone sod phos inj ip 4mg / ml , prednisolone tablet ip 10 mg , prednisolone tab ip 20 mg , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetirizine syrup ip 5mg / 5 ml , levoceitrizine tablet 5mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , naloxone inj ip 0.4mg / ml , pralidoxime chloride injection ip 25 mg / ml / 500 mg , acetylcystine solution usp ( injection ) 200 mg / ml , carbamazepine tab ip 200 mg , carbamazepine tab ip 100 mg , phenobarbitone tab ip 30 mg , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , sodium valproate gastro resistant tablets ip 200 mg , phenobarbitone inj ip 200mg / ml , carbamazepine oral suspension usp 100 mg / 5ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , clobazam tablet / capsule 5 mg , clobazam tablet / capsule 10 mg , levetiracetam tablet ip 500 mg , levetiracetam oral solution / suspension 100mg / ml , levetiracetam injection 500mg / 5ml , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , amikacin inj ip 100 mg , amikacin inj ip 500 mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amphotericin b inj ip 50 mg , ampicillin injection ip 500 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tablets ip 250mg , azithromycin tab ip 500 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , cefixime tab ip 100 mg / cefixime dispersible tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime injection ip 1 g , cefotaxime inj ip 250 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chloroquine phosphate suspension ip 50 mg / 5ml , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin tablets ip 250 mg film coated , ciprofloxacin tablet ip 500 mg film coated , clotrimazole cream ip 2% w / w , clotrimazole vaginal tab ip 500mg , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , diethylcarbamazine tab ip 100 mg , doxycycline cap ip 100 mg , fluconazole tablets ip 150mg , gentamycin injection ip 80mg / 2ml ( im / iv use ) , griseofulvin tab ip 125 mg , itraconazole cap 100 mg , meropenem inj ip 500 mg , metronidazole inj ip 500 mg / 100ml , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , norfloxacin tab ip 400mg film coated , ofloxacin tab ip 200 mg , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , ampicillin cap ip 500mg , nitrofurantoin tab ip 100mg , cloxacillin sodium inj ip 500mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , ofloxacin oral suspension ip 50mg / 5ml , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , piperacillin + tazobactum for injection ip 4gm+500mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , cefpodoxime dispersible tab 50 mg , cephalexin tablets 125 mg ( dispersible tablets ) , meropenem inj. ip 1gm , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , amikacin inj ip 250 mg , amoxicillin and potassium clavulanic ip inj 600mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , aztreonam injection usp 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefuroxime axetil tab ip 250 mg , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , levofloxacin tablets ip 250 mg , linezolid tablets ip 600 mg , linezolid inj 200mg / 100ml , mefloquine tablets ip 250 mg , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , vancomycin for intravenous infusion ip 500 mg , vancomycin for intravenous infusion ip 1 gm , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , aztreonam injection 1gm , framycetin sulphate cream 1 o / o 30gm pack , framycetin sulphate cream 1 o / o 100 gm pack , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , piperacillin injection 2 gm + tazobactom 250mg ip , ceftriaxone 1 gm + tazobactum 125 mg injection , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , clindamycin phosphate injection ip 300 mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , polymixin sulphate b injection usp 5 lac i.u. , meropenem injection ip 250 mg , colistimethate injection ip 1m iu powder for solution , voriconazole injection 200mg / vial , terbinafine hydrochloride tablet 250 mg , valganciclovir tablet 450 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , azathioprine tab ip 50 mg , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , chlorambucil tab ip 5 mg , cisplatin inj ip 50 mg / 50 ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cytarabine injection bp 500mg , danazol cap ip 50 mg , daunorubicin inj ip 20 mg , doxorubicin inj ip 50 mg / 25 ml , etoposide inj ip 100 mg , fluorouracil inj ip 250 mg / 5ml , l asparaginase inj 10000 iu , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , paclitaxel inj ip 260 mg , paclitaxel inj ip 100 mg , tamoxifen tab ip 10 mg , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , cisplatin inj ip 10 mg / 10 ml , dacarbazine injection 500 mg usp / bp , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , methotrexate tablets ip 10 mg , oxaliplatin injection usp 50 mg , cyclosporin capsule usp / ip 50 mg , bendamustine injection 100 mg , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , bortezomib injection 2mg , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , bevacizumab injection 400 mg , bevacizumab injection 100 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , zoledronic acid injection ip 4mg vial , dasatinib tab 100 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levodopa and carbidopa tab 250 mg+ 25 mg , trihexyphenidyl hcl tab ip 2 mg , bromocriptine tablets ip 2.5 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , enoxaparin sodium inj ip 60 mg , ethamsylate inj 250 mg / 2ml ( im / iv ) , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , human albumin solution ip 20% , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , rh erythropoetin inj 4000 iu , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , polygeline 3.5% solution with electrolytes for i.v. infusion , factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , tranexamic acid tablets ip 500 mg , warfarin sodium. tab ip 5mg , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried factor viii fraction ip ( iv use ) 1000 iu / vial , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , feracrylum 1% w / v sterile solution 100 ml , tranexamic acid injection ip 100mg / ml 5ml size , recombinant f ix 500 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amiodarone hydrochloride inj 50 mg / ml , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , clopidogrel tab ip 75 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , dopamine hydrochloride inj ip 40 mg / ml , enalapril maleate tab ip 5mg , enalapril maleate tab ip 2.5mg , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , lisinopril tab ip 5 mg , losartan tab ip 50 mg , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , methyldopa tab ip 250mg film coated , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitroglycerin inj 5 mg / ml , propranolol tab ip 40 mg , streptokinase injection 15 lac units ip , verapamil tab ip 40 mg film coated , labetalol tab ip 100mg , labetalol hcl inj ip 20mg / 4ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , atenolol tab ip 25 mg , enalapril maleate tablets ip 10 mg , lisinopril tablets ip 10 mg , lisinopril tab ip 2.5 mg , losartan tab ip 25 mg , adenosine injection ip 6 mg / 2ml , atorvastatin tablets ip 40 mg , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , fenofibrate capsules / tab ip 200 mg , isoprenaline injection ip 2mg / ml , metoprolol tablets ip 25 mg , metoprolol succinate extended release tablets ip 50 mg , noradrenaline injection ip 2 mg / ml , prazosin tablets ( extended release ) 2.5 mg , telmisartan tablets ip 40 mg , urokinase injection 5 lac unit ( lyophilized ) , ramipril tablets ip 2.5 mg , glyceryl trinitrate tablets 2.6 mg controlled release tablets , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , esmolol hydrochloride injection 10mg / ml 10ml size , sodium nitroprusside injection 25mg / ml 2ml size , carvedilol tablet 3.125 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rosuvastatin tablet 10 mg , sacubitril 24 mg and valsartan 26 mg tablet , chlorhexidine mouthwash ip 0.2 o / o , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , metronidazole 1% and chlorhexidine gluconade 0.25% gel , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , acyclovir cream 5% , cetrimide cream ip 15 gm , fusidic acid cream ip 2% , glycerin ip 400 gm , liquid paraffin ip 400 ml , miconazole nitrate cream ip 2% , povidone iodine ointment 5% 15 gm , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , silver sulphadiazine cream ip 1% 50gm tube , gentian violet topical solution usp 1o / o , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , clindamycin phosphate gel usp 1 o / o , clobetasol propionate cream ip 0.05 o / o , glycerin ip 100 ml , ketoconazole cream 2% , permethrin lotion 5% , permethrin cream 5% , tretenoin cream usp 0.025% , coal tar 6% & salicylic acid 3% ointment , calamine lotion ip 100ml , powder clotrimazole 1% w / w 30 gm , terbinafine cream 1%w / w ( 10 gm tube ) , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , oitment mupirocin ip 2% , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , gadodiamide inj. 0.5mml / ml vial , vdrl antigen ( with + ve and ve control ) / rpr slide kit , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , multistix test strip , povidone iodine solution ip 5 % 500 ml , compound benzoin tincture ip , formaldehyde solution ( 34.5 per. 38 per. ) , gluteraldehyde solution 2% , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , surgical spirit ip ( 500 ml ) , chlorhexidine gluconate solution 5% 250 ml , surgical spirit ip ( 100 ml ) , povidone iodine solution ip 5% 100ml bottle , povidone iodine ointment usp 250 gm , povidone iodine solution ip 10 % , silver sulphadiazine cream ip 1% 500 gm jar , acetazolamide tab ip 250mg , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , hydrochlorthiazide tab ip 12.5 mg , mannitol inj ip 20% w / v , spironolactone tab ip 25mg , torsemide tab 10 ip mg , hydrochlorthiazide tab ip 25mg , spironolactone tablets ip 50 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp / ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o eye drops / ear drops , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , drotaverine hydrochloride inj 40 mg / 2 ml , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , bisacodyl tab ip 5 mg , dicyclomine tab ip 10 mg , dicyclomine inj ip 10 mg / ml , dicyclomine hydrochloride oral solution ip 10mg / 5ml , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , hyoscine butylbromide inj ip 20 mg / ml , loperamide tab ip 2 mg , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ors powder ip , pentoprazole inj 40 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , hyoscine butyl bromide tablets ip 10mg , drotaverine tab ip 40 mg , ranitidine tab ip 300mg film coated , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , metoclopramide hydrochloride syrup ip 5 mg / 5ml , domperidone oral drops 10mg / ml ( 10ml ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , liquid paraffin ip 100 ml , ondansetron orally disintegrating tablets ip 4mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , ursodeoxycholic acid tablets ip 300 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , allopurinol tablets ip 100 mg , hydroxychloroquine sulphate tablets 200mg , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , sulfasalazine gastroresistant tablets ip 500 mg ip , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , carbimazole tabs ip 5 mg ( film coated ) , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , conjugated estrogen tabs usp 0.625 mg. , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , ethinyloestradiol tabs ip 50 mcg , glibenclamide tab ip 5 mg , gliclazide tab ip 40 mg , glimepiride tab ip 2 mg , glimepiride tab ip 1mg , glipizide tab ip 5mg , hydroxyprogesterone inj ip 250mg / ml , isophane insulin inj ip 40 iu / ml , metformin tab ip 500 mg , norethisterone tab ip 5 mg , pioglitazone tab ip 15 mg , progesterone inj 200 mg / 2ml , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , thyroxine sodium tablets ip 100mcg , metformin hydrochloride ( sustained release tablets ip 1000 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , glucagon for injection usp 1 mg / ml , medroxyprogesterone acetate tablets ip 10 mg , thyroxine tablets ip 50 mcg , octreotide injection 50 mcg / ml , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , tenaligliptin tablet ip 20mg , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , human anti d immunoglobulin injection 300mcg ( im use ) , human anti d immunoglobulin 150 mcg , human rabies immunoglobulin inj 150 iu / ml , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , diphtheria antitoxin 10000 iu , hepatitis b immunologlobin injection ip 200 i.u , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , atracurium inj 10 mg / ml , glycopyrrolate inj ip 0.2 mg / ml , midazolam inj ip 1 mg / ml , neostigmine inj ip 0.5 mg / ml , succinylcholine inj. ip 50 mg / ml ( iv use ) , valethamate bromide inj 8mg / ml , vecuronium bromide for injection 4mg ( freeze dried ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , neostigmine injection ip 2.5mg / 5ml , cis atracurium besylate injection 2 mg / ml in 5 ml vial , tropicamide eye drop ip 1o / o , atropine eye ointment ip 1% , atropine sulphate ophthalmic solution usp 1% , chloramphenicol eye drops ip 0.5 0 / 0 , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin ophthalmic ointment usp 0.3% , hydroxypropylmethyl cellulose solution 20 mg / ml , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , lidocaine hcl topical solution usp 4% , fluconazole eye drops 0.3% , timolol eye drops ip 0.5 o / o w / v , homatropine eye drops ip 2% , travoprost eye drops ip 0.004 o / o , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , betaxolol eye drops 0.5 o / o , carboxymethylcellulose eye drops ip 0.5% , acyclovir eye ointment ip 3% w / w 5gm size , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , chloramphenicol 1% w / w eye ointment ip, 3gm size , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , misoprostol tab ip 200 mcg , oxytocin inj ip 5 iu / ml , mifepristone tab ip 200mg , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , human chorionic gonadotropin injection ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amitriptyline tab ip 25mg film coated , chlordiazepoxide tablets ip 10mg , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , escitalopram tab ip 10 mg , fluoxetine cap ip 20 mg , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , lithium carbonate tab ip 300 mg , lorazepam inj ip 2 mg / ml , olanzapine tab ip 5 mg , risperidone tab 2mg , risperidone tab 1 mg , sertraline tab ip 50 mg , trifluperazine tab ip 5 mg coated , quetiapine tablet ip 50mg , quetiapine tablet ip 25mg , clonazepam tablet 0.5 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , zolpidem tablet 5 mg , aminophylline inj ip 25 mg / ml , beclomethasone inhalation ip 200 mcg / dose , budesonide nebulizer suspension 0.25mg / ml , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , ipratropium bromide nebulizer solution 250 mcg / ml , salbutamol tablet ip 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol tab ip 2 mg , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , salbutamol syrup ip 2mg / 5ml , dextromethorphan hbr syrup ip 13.5mg / 5ml , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , budesonide powder for inhalation 200 mcg , ipratropium powder for inhalation ip 40 mcg , terbutaline tablets ip 2.5 mg , xylometazoline nasal drops ip 0.1% , cough syrup / expectorant ( 50 ) ml , acebrophylline tablet / capsule 100 mg , compound sodium lactate inj. ip , dextrose inj ip 25% w / v , dextrose inj ip 10% , dextrose inj ip 5% , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , ringer acetate infusion 500 ml , sodium chloride 0.45% w / v polypack 500 ml , finasteride tablets ip 5 mg , tamsulosin hcl tablets / capsule 0.4 mg , flavoxate tablets ip 200 mg ( coated tablet ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , dutasteride tablet 0.5 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , betahistine tab ip 8 mg , betahistine tab ip 16 mg , cinnarizine tablets ip 25 mg , cinnarizine tablet ip 75 mg , ascorbic acid tab ip 500 mg , calcium gluconate inj ip 10% ( iv use ) , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , folic acid tab ip 5 mg , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , zinc sulphate dispersible tablets ip elemental zinc 10 mg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , cholecalciferol granules 60, 000 iu / gm , mecobalamin inj 500 mcg / ml , pyridoxine tablet ip 40mg , thiamine tablets ip 100 mg , calcitriol capsules ip 0.25 mcg , methyl cobalmine tablet 500mcg , methyl cobalmine tablet 1500mcg , vitamin d3 oral solution 60000 iu , ferric carboxymaltose injection 50 mg / ml 10 ml size , multi vitamin syrup , flunarizine tab 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , conc haemodialysis fluid b.p acetate concentrate 10 litre can , peritonial dialysis solution ip , sodium bicarbonate inj ip 7.5% w / v , water for inj ip , alendronate sodium tablets usp / bp 35 mg , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , normal human intravenous immunoglobulin 5g / 100ml , pregabalin cap ip 75 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , intravenous fat emulsion 20% w / v 250ml , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , amino acid 10% injection 100ml size , vitamin e capsule 400 mg , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , liposomol amphotericine injection b 50mg , amphotericin b ip gel 1.0 mg each gm contain amphotericin b 1.0mggel , crotamiton 10% + hydrocortisone 0.25% cream , methotrexate gel 1% , eflornithine hydrochloride cream 139 mg, each gm contain eflornithine hydrochloride139 mg , beclomethasone dipropionate0.064%+ salycylic acid 3% lotion , methoxsalen 1% lotion. each ml contain methoxsalen 1% , deca peptide 6 mg lotion. each ml contain deca peptide 6 mg , minocycline 50mg , trioxsalen 5mg tab. each film coated tablet contain trioxsalen 5mg , trioxsalen 25mg tab. each film coated tablet contain trioxsalen 25mg , trichloroacetic acid ( tca ) 50% w / v lotion , inj.hylan g f 20 , hepato protective tablet each film coated tablet to contain: matadoxine 500mg, silymarin 140mg, l ornithine l aspartate 150mg, pyridoxine hydrochloride 3mg, folic acid 1.5mg , spores of polyantibiotic resistant bacillus clausii 2 billion capsules , iron as ferric saccharate and phospholipid chewable tablets each chewable tablet contains:ferric saccharate ( in micro encapsulated form ) 75 mg eq. to elemental iron 30 mg phospholipid 167 mg eq. to phosphatidylserine100 mg , cojugated estrogen 0.3 mg tab.each tablet contain 0.3 mg cojugated estrogen , telmisartan40mg + hydroclorothiazide12.5 mg, i.p.each tablet contain telmisartan40mg + hydroclorithiazide12.5 mg, , telmisartan80mg + hydroclorothiazide25 mg, i.p.each tablet contain telmisartan80mg + hydroclorithiazide 25 mg, , mefenamic acid 250mg+ dicyclomine hydrochloride10mg each tablet contain mefenamic acid 250mg+ dicyclomine hydrochloride10mg , combikit of ( tab fluconazole150mg + azithromycin 1gm & secnidazole1gm ) each kit contain 1tab fluconazole150mg + 1 tab.azithromycin 1gm & 2 tab.secnidazole1gm . , dolutegravir 50, each film coated tablet contain dolutegravir sodium 50 mg , tenofovir 300+lamivudine300, each film coated tablet contain tenofovir disoproxil fumerate300mg& lamivudine300 mg , efavirenz 600 each film coated tablet contain efavirenz 600 mg , nevirapine 200 each tablet contain nevirapine 200mg , atazanavir300+ritonavir100, each tablet contain atazanavir sulphate ip 300mg+ritonavir ip100mg , tenofovir alafinamide25+emtricitabine200+ doultegravir 50 each tablet contain tenofovir alafinamide25 mg +emtricitabine200mg+ doultegravir 50mg , abacavir300 eachtablet contain abacavir 300mg ip , lamivudine 100 eachtablet contain lamivudine 100 mg , raltegravir 400each film coated tablet contain raltegravir 400 mg , zideovudine 60+ lamivudine 30 , ultrasound contrast agent ( sulphur hexafluoride ) sonovue , contrast for ct scan / ivp / special investigations , iopamidol ct contrast solution for injectiuon , iopamidol ct contrast solution for injectiuon , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate powder ) , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate suspension ) high density low viscosity , contrast for special investigations ( barium sulphate paste ) , oral contrast for mri ( ferric ammonium citrate / mineral oil / corn oil ) , oral contrast forct ( diatrozoate sodium & diatrozoate meglumine ) , iopromide ct contrast usfda / ce approved , iopromide ct contrast usfda / ce approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iodixanol ct contrast 320 mgi / 100ml in polypropylene bottle usfda approved , iotrolon ct contrastusfda / ce approved , iotrolon ct contrast usfda / ce approved , venlafaxime tab. , olanzapineinj. , flupentixol inj. , memantine tab. , glycopyrrolate tab. , pramipexole tab. , pramipexole tab. , pramipexole tab. , inj. propofol mct / lct with oleic acid inj.iv , inj.paracetamol infusion 1000 mg in double sterilised closed system 100% biodegradable eco friendly polyolefin 100 ml bag , nalbuphine inj. , chlorprocaine inj , desflurane, 100ml , gelofusion infusion , albumin 5% infusion , inj.0.9% normal saline500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 1000 ml in100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. ringers lactate1000 ml in 100% biodegradablenon dehp double sterilized polyolefin closed system bag , inj. 5% dextrose 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 5% dns 500 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , inj. 0.9% normal saline 100 ml in 100% biodegradable non dehp double sterilized polyolefin closed system bag , balance salt solution with ph. of 7.2 to 7.4 osmolarity 292 to 294 in 100% biodegradable double sterilised closed systempolyolefin 500 ml bag , inj. balance hydroxy ethyl 6% tetra starch 130 / 0.4 in plasma adapted solution 500 ml 100% biodegradable bag with polyolefin , inj.hydroxy ethyl 6% tetra starch 130 / 0.4 in nacl 500 ml 100% biodegradable bag , nifedipine sublingual , nifedipine sublingual , papaverine inj. , nicardipine tab. , topical heparin solution 1000iu / ml , anti gasgangrene sera 25000 iu / 10ml each vial contains clostridium perferingens anti toxin 10000 iu + clostridium oedematiens anti toxin 10000 iu + clostridium septicumanti toxin 5000 iu ) , basiliximab 20 mg inj , betamethasone and neomycin cream ( 0.10%+0.5% ) , solution silver nitrate 2% , solution silver nitrate 5% , solution silver nitrate 10% , alkaline nasal douches ( sodium bicarbonate+ sodium biborate+ sodium chloride ) , ear drops hydrocortisone 1%w / v+ acetic acid 2%w / v , ear drops each ml contain chloramphenicol 4mg + dexamethasone 1mg + polymyxin b ( 5000iu ) , nasal drops haemcoagulase topical solutioneach ml contain aqueous solution of haemocoagluase 0.2 cu , triamcinolone oromucosal paste bp 0.1% w / w , ethiodized oil ( lipiodol ) inj. , htk solution1 lit ( histidine tryptophan ketoglutarate solution ) , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life nonacog beta pegol f ix , glycopegylated extended half life factor viii , glycopegylated extended half life factor viii , tenofovir alafenamidefumerate ( taf ) 25 mgtab. / cap , entecavir 1mg tab. / cap film coated , dacalatasvir 30 mgtab. / cap , dacalatasvir 60 mgtab. / cap , sofosbuvir 400 mg tab. / cap , ribavirin 200 mg tab. / cap film coated , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007 ml 30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 mg , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab 400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab 1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds 20% , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine 1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab 100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75 iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab 150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension 5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , susp. azithromycin oral suspension 100mg / 5ml , susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) , hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) , nicumalone 1 mg , nicumalone 4 mg , chymotrysin , citicoline , clarithromycin 500mg , dapagliflozin 10mg , deflazacort 6 mg , esomeprazole 40 mg , febuxastat 40 mg , febuxastat 80 mg , glucosamine + diacerein 50 mg tab , ketorolac 10 mg , levothyroxine sodium tablet 25 mcg , methylpredinisolone 16 mg , methylpredinisolone 8 mg , moxifloxacin400 mg , nitrazepam 10 mg , paracetamol 650 mg , pentoprazole 40 + levosulpiride 150 mgcap , propylthiouracial 100 mg , repaglinide and voglibose ( 0.5+0.3 ) , rifaximin 500mg , rosuvastatin 10mg + finofib 60mg , serratiopeptidase 10mg , silodocin 4 mg cap , silodocin 8 mg cap , sitagliptin 50mg , sulphasalazine 500 mg , thiocolchicosite 4 mg , vildagliptine 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , zinc 50mg , azithromycine 100 mg , azithromycine 200 mg , cefpodoxime 100 mg , cyproheptidine , mefenamice acid 100mg / 5ml , montelucast+levocetrizine , phenobarbitone 20mg / 5ml, 100 ml , levofloxacine , ondansetron , zink 20 mg, 100 ml , cream luliconazole 1% w / w , lignocain mouth paint , alpha beta arteether [ lp.26 ] [ m ] , multivitamine , azithromycin 10 ml vial equivalent to 500 mg , caffein 10 mg , citicoline 250 / 500 mg , colistine 10 lakh unit , compound sodium 500ml, glass bottel , dexmedetomidine 100mcg / ml , doxcyline100 mg , etomidate 10ml , etomidate 20 mg , ferric carbo maltose 500mg / 10 ml vial , fluconazole 200mg , gdw 5% glass bottle , levofloxacine 100 ml , l ornithine l aspartate 10 ml , mephentermine 30ml / ml , methylprednisolon injection 40mg , moxifloxacin 100ml , nandrolone decanoate 50 mg inj , nicorandil 48 mg , normal saline 500 ml glass bottle , ondansetron 8 mg , pilocarpine 0.5 %v / v , piracetam 200 mg , ravici 5 ml , reteplase 18 mg , tirofiban 0.5 mg , vitamin d ( 600000 iu ) , chloramphenicol +polymycine , chloramphenicol +polymycine + dexamethason , carboxymethylcellulose + glycerin , gatifloxacin and prednisolone , moxifloxacilline+ dyliprednate , moxifloxacilline+ prednisone , natamycin 5% , sodium chloride 5% , tropicamide + phenlyephrine , dorzolamide , moxifloxacin and prednisolone eye drop , olaptadine & ketrolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , anti cold15 ml , calcium30 ml , diastasepepsin with simethicone 15 ml , digestive enzyme 15 ml , hydroxyzine 15 ml , ondensetrone 30 ml , prednisolone 10 ml , terbutalin , vitamind3 400 iu , vitamind3 800 iu , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprebitant 125 / 80 , dulexitim 20mg , dulexitim 30mg , glucosamine + chloride +msm , racecadotril 100mg , rebeprazole +levosulpiride...

North Western Railway - Rajasthan

34077154 supply of growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) , growth hormone inj.10mg / 1.5ml ( somatotropin inj.10mgpfs ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Indian Army - Rajasthan

33653335 procurement of drugs and pharmaceuticals products drugs and consumables , inj insulin lispro 25 / 75 100 iu / ml , glucostix accucheck, pack of 100 strips , inj insulin lispro 50 / 50 , tab sitagliptin 50 mg , tab actifed , eye drop latenoprost + prednisolone ( lotepred ) , tab tricagelor 90 mg , inj erythropoietien 4000 iu , inh formetrol + budesunide 400 mcg , disp lumber belt ( small , medium , large ) , inhaler duolin ( levosalbutamol & ipratropium ) 250 mcg , inj recombinant human growth hormone 5 mg to 15 mg , tab metformin sr 1 gm , resp budecort , tab vit b1, b6 & b12 ( neurobion ) ...

All India Institute Of Medical Sciences - Rajasthan

33443744 procurement / rate contract for drugs / medicines / i.v. fluids at all india institute of medical sciences, jodhpur procurement / rate contract for drugs / medicines / i.v. fluids at all india institute of medical sciences, jodhpur , amphotericin b lipid complex , amphotericin b lipid emulsion* , amphotericin b liposomal , amphotericin b plain , anidulafungin 100 mg , atracurium , atracurium , atropine , bupivacaine hclheavy 0.5% , bupivacaine hcl 0.25% , bupivacaine hcl 0.5% , bupivacaine hcl 0.5% + dextrose , bupivacaine hydrochloride 7.5% glucose solution , butorphanol tartarate , butorphanol tartarate , caspofunginvial , caspofunginvial , centhaquine citrate , chlorprocaine 5ml , cisatracurium besylate , cisatracurium besylate , citicholine , colistimethate sodium , colistimethate sodium , colistimethate sodium , colistimethate sodium , desflurane , dexmedetomidine 100 mcg , dexmedetomidine 200 mcg , dexmedetomidine 50 mcg , emla cream ( a eutectic mixture of lidocaine 2.5% and prilocaine 2.5% ) , ephedrine hydrochloride 1 ml , etomidate , etomidate lct / mct , etomidate lct / mct , eutectic lidocaine + prilocaine cream for topical anaesthesia , fosfomycine 4 gm , fosfomycine trometamol , gel choline salicylate & lignocaine hydrochloride 12 g , glyceryl trinitrate transdermal patch , glyceryl trinitrate transdermal patch , glycopyrolate 0.5mg + neostigmine methylsulphate 2.5mg , glycopyrrolate , glycopyrrolate , glycopyrrolate , halothane , human prothrombin complex i.p / e.p. , imipenam + cilastatin 500 mg and 500 mg vial , isavuconazole , isavuconazole 200 mg / 10 ml , isoflurane , isoflurane 100 ml , isoflurane 250 ml , ketamin hydrochloride , ketamin hydrochloride , levobupivacaine5 mg / ml , levobupivacaine 10 ml ampules ( 5 mg / ml ) , levobupivacaine 25% 20 ml , levobupivacaine 5% 20 ml , levobupivacaine .5% + dextrose , lidocaine 200 mg lozenges 1. a solid , single dose preparation designed to be sucked to obtain a local effect in the oral cavity and throat.2. dissolves over 5 10 min in the mouth and releases the drugs in the saliva , lidocaine hydrochloride 5% and dextrose 7.5% , lignocaine2% , lignocaine2% , lignocaine & adrenaline 2% ( 1:200, 000 ) , lignocaine hydrochloride 10% oral spray , lignocaine hydrochloride 4% , lignocaine hydrochloride+ adrenaline bitartrate 2% ( 1:80000 ) , lignocaine hydrochloride1% , lignocaine vicous solution 4% , lignocaine without preservative 2% , magnesium sulfate, urea, and sulphacetamide sodium , sodium proflavin ( glycerine base ) , mephentermine 15mg / ml , mephentermine 30mg / ml , midazolam , midazolam , midazolam , midazolam ( 5mg / ml ) , midazolam ( 5mg / ml ) , molnupiravir , nalbuphine hydrochloride , nalbuphine hydrochloride , neostigmine , neostigmine , phenylephrine 10mg , phosphenytoin 150 mg , physostigmine 1mg / ml , polymyxine –b sulphate , posaconazol , posaconazol , prazosin 1 mg , propofol 1%us fda approved , propofol 1%us fda approved , propofol 1% us fda approved , propofol mct / lct us fda approved , propofol mct / lct us fda approved , propofol mct / lct with olic acid us fda approved , propofol mct / lct with olic acid us fda approved , remdesivir , ribavirin , ribavirin 100 mg / ml , rocuronium , ropivacaine 0.2% vial , ropivacaine 0.2% vial , ropivacaine 0.2% vial , ropivacaine 0.5% vial , ropivacaine 0.5% vial , ropivacaine 0.75% ampules , ropivacaine 0.75% vial , ropivacaine 0.75% vial , ropivacaine 0.75% + dextrose sterile packing , sevoflurane , sterile water , sterile water , succinylcholine , thiopentone sodium , thiopentone sodium , tocilizumab 400 mg , tocilizumab 80 mg , topical lidocaine aerosol 10% , ulinastatin 100000 iu , ulinastatin 200000 iu , vecuronium , vecuronium , antibiotic & antiseptics , acyclovir , acyclovir , acyclovir 5% , albendazole , albendazole , amikacin , amikacin , amikacin , amoxycillin , amoxycillin , amoxycillin , amoxycillin+ clavulanic acid , amoxycillin+ clavulanic acid , amoxycillin + clavulanic acid , amoxycillin kid tablets , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin+ clavulanic acid , amoxycillin + clavulanic acid , amoxycillin+cloxacillin , ampicillin , ampicillin , ampicillin , ampicillin , ampicillin + cloxacillin , ampicillin + cloxacillin , ampicillin + cloxacillin+lb , ampicillin 500 mg , ampicillin+ sulbactam , arbekacin sulphate 200 mg , artemether , artemether+lumefantrine , artemether+lumefantrine , artesunate , artesunate , artesunate+sulfazdoxine+pyrimethamine , artesunate+sulfazdoxine+pyrimethamine , artesunate+sulfazdoxine+pyrimethamine , azathioprine , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , aztreonam , aztreonam , aztreonam , benzylpenicillin , benzylpenicillin , benzylpenicillin , benzylpenicillin , benzylpenicillin , cefaclor , cefadroxil , cefadroxil , cefepime , cefepime , cefazolin sodium , cefepime + tazobactam , cefixime , cefixime , cefixime , cefixime15 gm , cefoperazone , cefoperazone , cefoperazone+ sulbactam , cefoperazone sulbactam , cefotaxime + sulbactam , cefotaxime , cefotaxime , cefotaxime , cefotaxime , cefotaxime + sulbactam , cefpodoxime proxetil , cefpodoxime , cefpodoxime proxetil , cefpodoxime proxetil , cefpodoxime , ceftaroline fosamil , ceftazidime , ceftalazone tazobactam , ceftazidime + avibactum , ceftazidime + tazobactum , ceftriaxone + sulbactum + disodium ethylenediaminetetraacetic acid ( edta ) , ceftriaxone + sulbactum + disodium ethylenediaminetetraacetic acid ( edta ) , ceftriaxone sodium , ceftriaxone sodium , ceftriaxone + tazobactam , ceftriaxone + salbactum , ceftriaxone sodium , ceftriaxone sodium , ceftriaxone sodium , cefuroxime , ceftaroline fosamil , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefpirome sulphate , cephalexin , cephalexin , cephalexin , cephalexin , cephalexin , chloroquine , chloroquine phosphate , chloroquine phosphate , ciproflaxacin 500mg + ornidazole 500mg , ciprofloxacin , ciprofloxacin , ciprofloxacin 200 mg , clarithromycin , clarithromycin , clarithromycin , clindamycin , clindamycin , clindamycin , clindamycin , clindamycin 1% gel , clotrimazole , clotrimazole , cloxacillin sodium , clofazamine 100mg , cotrimoxazole ( sulphamethoxazole200mg + trimethoprim 40mg ) per vial , cotrimoxazole ( sulphamethoxazole 80 mg + trimethoprim 16 mg ) per vial , cotrimoxazole ( sulphamethoxazole + trimethoprim ) , co trimoxazole ( trimethoprim +sulphamethoxazole ) , crizotinib , crizotinib , cycloserine , cyclosporine , cyclosporine , cyclosporine , daclatasvir , daclatasvir , disodium edatate pfs , daptomycin , dapsone 100mg , doripenem , doxycycline , doxycycline + lactic acid , doxycycline injection , ertapenem , erythromycin , erythromycin , ethambutol , ethambutol , ethambutol , ethambutol , ethionamide , faropenem , fluconazole , fluconazole , fluconazole , flucloxacillin , flucloxacillin , gentamicin , flucytosine , fidaxomicin , garenoxacin , hydroxychloroquine , imipenam + cilastatin , imipenam + cilastatin , isoniazid , isoniazid , isoniazid , isoniazid +rifampicin , isoniazid +rifampicin , itraconazole , itraconazole , ketoconazole , kanamycin , ledipasvir + sofosbuvir , levofloxacin , levofloxacin hemihydrate , levofloxacin hemihydrate , linezolid , linezolid , linezolid , meropenem , meropenem , meropenem+ sulbactum , micafungin , micafungin , minocycline , moxifloxacin hcl 400mg , moxifloxacin hcl , nitazoxanide , naloxone , naloxone , netilmicin , netilmicin , norfloxacin , ofloxacin , ofloxacin , ofloxacin , ofloxacin , ofloxacin 200mg , oseltamivir , oseltamivir , phosphomycine 4 mg / iv , piperacillin 1gm +tazobactum 125mg , piperacillin 2gm.+tazobactam 250mg , piperacillin 4gm.+tazobactam 500mg. , inj penicillin g 5 million units , pantoprazole , primaquine , primaquine , primaquine , praziquantel , pyrazinamide , pyrazinamide , pyrazinamide , pyrimethamine , quinine , quinine sulphate , quinine sulphate , rifampicin , rifampicin , rifabutin , roxithromycin , roxithromycin , roxithromycin , roxithromycin , saccharomyces boulardii , saccharomyces boulardii , sodium bicarbonate , sodium bicarbonate 8.4% , sodium bicarbonate 8.4% , sodium bicarbonate 7.5% , sodium bicarbonate 7.5% , sofosbuvir , streptomycin , streptomycin , sulbactum , tenofovir alafenamide , teicoplanin , teicoplanin , thiamine hydrochloride 50 mg , tigecycline , ticarcillin 3gm and clavulanic acid 100mg , tobramycin , tobramycin , tobramycin , tofacinib , topotecan , triamcinolone acetonide , triamcinolone acetonide 0.1%w / w , valgancyclovir , vancomycin hydrochloride , vancomycin hydrochloride , vancomycin hydrochloride , vancomycin hydrochloride , voriconazole , voriconazole , voriconazole , voriconazole , antidotes , activated charcoal , dimercapsulesrol , fulmazenil 1mg / ml , methylthioninium chloride ( methylene blue ) , naloxone , naloxone , pencillamine , pralidoxime chloride ( 2 pam ) , sodium nitrite , sodium thiosulphate , antiseptics and disinfactants , ( 100 gm of granules contain the following active ingredient ) 43 g sodium per carbonete, 22 g tetraacetylethylenediamine.passesen 13624, en 13727, en 14348, en 14561, en 14562en 14563 , en 13704and en 14476 standreds. , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moisturerisers. , 1, 6 dihydroxy 2, 5 dioxyhexane glutaraldehyde benzalkonium chloride alkyl urea derivative , 2 propanol 63gbenzalkonium chloride 0.025g , alcohal free liquid barrier film containing acrylate terpolymer to protect form iad for72 hours , antimicrobial skin gel with ethyl alcohol >60% , back care solution wirh dispenser 7 cap ( aqua , alcohal denat, sodium laureth sulfate, peg 7 glyceryl cocoate , dimethyl urea , disodium pecocamido mipa sulfosuccinate , dibutyl adipate , disodium cocoamphodiacetate , fgragrance , potassium hydroxide ) , benzyl c12 18 alkyl dimethyl ammonium chlorides 19.9g dodecylbispropyle tramine 5g surfactants, corrosion inhibitors , cetrimide 15%+chlorhexidine 7.5% , cetrimide 15%+chlorhexidine 7.5% , chlorhexidinegluconate 2% w / v ( 10%v / v ) with 80% ethanol coloured , sterile with single use applicater for external surgical skin prepartion , chlorhexidine & ethanol based surgical hand antiseptic with moisturizers containing ( chlorhexidine gluconate 1% w / w and ethyl alcohol 61% w / w ) water less scrub fda approval , chlorhexidine & ethanol based surgical hand antiseptic with moisturizers containing ( chlorhexidine gluconate 1% w / w and ethyl alcohol 61% w / w ) water less scrub fda approval , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moistureriser foam based solution , chlorhexidine 0.5 % ( with 70% ethanol ) sol. with or without surfactants, emollients & moisturerisers. , chlorhexidine 2%, menthol, perfume expients, recommended by cdc, usa , chlorhexidine 2%, alcohol free bed bath wipes , chlorhexidine 4% sol. with surfactants, emollients & moisturerisers. , chlorhexidine 4% sol. with surfactants, emollients & moisturerisers. , chlorhexidine 2%, menthol, perfume expients, recommended by cdc, usa , chlorhexidine gluconate 2% ethanol i.p 70 w / v , chlorhexidine gluconate 2% w / v ( 10% v / v ) & isoprophyl alcohol 70% w / v surgical skin prepartion solution with dispenser , chlorohexidine body wash , combination of sodiumlaureth sulphate +nacl+ peg 7 +peg 120 + glycerine , combination of undecylenamidopropyl trimonium methosulphate + phenoxyethanol + skin care addictives , didecyldimethyl ammonium chloride 7g corrosion inhibitors fragrance, excipients q.s , didecyldimethyl ammonium chloride 7g corrosion inhibitors fragrance, excipients q.s , diethyl ether ( solvent ether ) for synthesis , dimethanol ( ethylenedioxy ) 14.1g glutaraldehyde 5.0g specialized, hi tech, inbuilt cleansors , dodecyl bis propylene triamine didecyl dimethyl ammonium chloride 13.0g surfactants, corrosion inhbitors, foam regulators, ph regulators, fragrance , ehtanol 30% with 1% triclosan solution , enzymatic detergent solution with neutral ph , enzymatic detergent solution with neutral ph , ethanol 10gm 2 propanol 9gm 1 propanol 6gm wit corrosion inhibitors , ethyl alcohol 60% w / v based hand sanitizer with moisturiser. , glutaraldehyde :15.2g 1, 6 dihydroxy 2, 5 dioxahexane:19.7g rust inhibitors and hi tech cleansors. , at 4% solution : ph value approx. 7 , glutaraldehyde 2% , gluteraldehyde ( acidic medium 2% ) , gluteraldehyde ( alkaline medium ) 2.45% with powder rust inhibitors , glycerin for oral use , hand gel ethanol 85g, and skin protectors w / w , hydrogen peroxide 11% and 0.01% sliver nitrate with micro jet. , isopropyl alcohol ( 1, 2, propanol ) 75% + macetronium + skin emollients & moisturizers , liquid cleaner for surgical instruments including endoscopes , orthopthalaldehyde 0.55% , povidone iodine 5% , povidone iodine 5% w / w ointement 25g , pre soaked surface and equipment disinfected wipes 20×25 cm with propanol 1.propanol 2, didecyle dimethyl ethyl ammonium chloride , n alkyl dimethylbenzyle ammoniumchloride & poly hexamethylene bigunide hydrochloride with nabl, ce&iso certified , silver sulfadiazine 1%, chlorhexidine gluconate 0.2% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium hypochlorite 0.002% hypochlorous acid 0.008% electrolysed water 97.64% , sodium laureth sulphate peg 7, glycerine, peg 120 sodium benzoate sodium salicylate perfume , tincture of benzoine , tincture of iodine , ultramultiple enzymatic concentrate solution , waterless body bath solution antiseptic waterless body bath hygiene solution with deionized water , betaine , dehydroacetic acid , sodiumbenzoate propyleneglycol, citric acid , sodium hydroxide with chlorhedine & alcohol free , waterless hair shampoo , antiseptic waterless head hygiene solution with deionized water , disodium edta , benzylalcohol benzonic acid , sorbic acid propylene glycol with sodium hydroxide , wettask with surface wiping system ( pre saturated ) , cardio vascular system , abciximab , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , acetyl salicylic acid , adenosine 6 mg / 2 ml , adreneline 1 mg / ml , amiodarone , amiodarone , amiodarone , amlodipine , amlodipine , amlodipine , amlodipine + atenolol , amlodipine + lisiniopril , amrinone lactae , apixaban , apixaban , aspirin ( asa ) , aspirin ( asa ) , atenolol , atenolol , atenolol + ramipril , atenolol + ramipril , atenolol 25 mg , atorvastatin , atorvastatin , atorvastatin , atorvastatin , atorvastatin + clopidogrel + aspirin asa , atorvastatin + clopidogrel + aspirin asa , bisoprolol usp , bisoprolol usp , cardioplegia solution , carvedilol , carvedilol , carvedilol , cilostazol , cilostazol , cinnarizine + dimenhydrinate + pyridoxine , clonidine hydrochloride , clonidine hydrochloride , clopidogrel , clopidogrel + aspirin asa , clopidogrel + aspirin asa , dabigatran etexilate mesylate , dabigatran etexilate mesylate , dalteparin p f syringe , dalteparin p f syringe, , dalteparin p f syringe, , dalteparin p f syringe, , digoxin , digoxin , digoxin , diltiazem , diltiazem , diltiazem , diltiazem , diltiazem hydrochloride , diltiazem 2% w / w , dobutamine 250 mg / 5 ml , dopamine 40mg / ml , doxazosin , doxazosin , enoxaparinpf syringe , enoxaparinpf syringe , enoxaparinpf syringe , eptifibatide 2mg / ml , eptifibatide 0.75mg / ml , esmolol hydrochloride , ethamsylate , ethamsylate , ethamsylate , ethamsylate , fenofibrate , fenofibrate , fondaparinux sod. pfs , fondaparinux sod. pfs , furosemide , furosemide , furosemide , furosemide , furosemide , furosemide spironolactone , glyceryl trinitrate , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate ( nitroglycerine ) , glyceryl trinitrate transdermal patch , haemcoagulase , heparin 1000 iu / ml , heparin 1000 iu / ml , heparin 5000 iu / ml , heparin sodium and benzyl nicotinate , hydrochlorothiazide , hydrochlorothiazide , hydrochlorothiazide , hydrochlorothiazide +losartan , hydrochlorothiazide +losartan , hydrochlorothiazide +nebivolol hydrochloride , hydrochlorothiazide + metoprolol , hydrochlorothiazide + metoprolol , hydrochlorothiazide + metoprolol , isoprenaline sulphate 2mg / ml , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide 5mononitrate , isosorbide dinitrate , isosorbide dinitrate , ivabridine , labetalol , labetalol , labetalol , labetalol , levo carnitine , levo carnitine , levodopa+carbidopa , levodopa+carbidopa , levodopa+carbidopa , lignocaine hydrochloride ( cardiac use / xylocard ) , lisinopril , lisinopril , lisinopril , lisinopril , losartan potassium , losartan potassium , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , metoprolol , milrinone , milrinone , milrinone , medium chain triglycerides , nebivolol , nebivolol , nicorandil , nicorandil , nicorandil 2 mg , nicoumalone , nicoumalone , nicoumalone , nicoumalone , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nifedipine , nitroglycerin ampoules , noradrenaline , noradrenaline , olmesartan , olmesartan , olmesartan , olmesartan , papaverine hcl , perindopril + amlodipine , pheniramine maleate 22.75 mg / ml , phenylephrin , prasugrel , prasugrel , prazosin hydrochloride , prazosin hydrochloride , prochlorperazin maleate 5 mg , propranolol , propranolol , propranolol , propranolol + flunnarizine , protamine suplhate 1% , ramipril , ramipril , ramipril , ramipril , ramipril +hydrochlorothiazide , ramipril +hydrochlorothiazide , ramipril + hydrochlorothiazide , reteplase , rivaroxaban , rivaroxaban , rosuvastatin , rosuvastatin , rosuvastatin , rosuvastatin calcium , rosuvastatin calcium , rosuvastatin calcium , rosuvastatin calcium + clopidogrel + aspirin asa , sacubitri + valsartan , sevalemer carbonate , sevelamer hydrochloride , sevelamer hydrochloride , sodium nitroprusside , spironolactone , spironolactone , spironolactone , spironolactone+frusemide , spironolactone+frusemide , streptokinase , streptokinase , tamsulosin , tamsulosin hydrochlorde & dutasteride 0.9 mg , telmisartan , telmisartan , telmisartan , telmisartan + hydrochlorothiazide , tenectaplase , tenecteplase , tenecteplase , tenecteplase , terazosin , terazosin , terazosin , ticagrelor , torsemide , torsemide , torsemide , torsemide , torsemide , torsemide + spironolactone , torsemide + spironolactone , tranexamic acid , tranexamic acid , tranexamic acid , tranexamic acid , trimetazidine , trimetazidine mr , urokinase , urokinase , urokinase , urokinase , verapamil , verapamil , verapamil , verapamil , vesopresin , vitamin k , vitamin k , vitamin k1 , warfarin , warfarin , warfarin , warfarin , central nervous system , alprazolam , alprazolam , alprazolam , alteplase ( tissue plasminogen activator ) , alteplase ( tissue plasminogen activator ) , amitriptyline , amitriptyline , amitriptyline , amitriptyline + chlordiazepoxide , aripiprazole , aripiprazole , betahistine , betahistine , botulinum toxid , botulinum toxid type a , botulinum toxid type a , bupenorphine +naloxone , carbamazepine , carbamazepine , carbamazepine , carbamazepine , carbamazepine sr , carbamazepine sr , chlorpromazine hydrochloride , chlorpromazine hydrochloride , cilnidipine , cilnidipine , clobazam , clobazam , clobazam , clomipramine , clomipramine , clonazepam , clonazepam , clonazepam md , clonazepam md , clonazepam md , clozapine , clozapine , colchicine , colchicine , conivaptan , deferasirox , deferasirox , deferasirox , deferiprone , deferiprone , deferiprone , desvenlafaxine , desvenlafaxine , diazepam , diazepam , diazepam , diazepam , diazepam , diethylcarbamazine citrate , diethylcarbamazine citrate , disulfiram , disulfiram , divalproex equivalent to valproic acid 250 mg , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , divalproex sodium , donepezil , duloxetine hydrochloride , duloxetine hydrochloride , duloxetine hydrochloride , enalapril maleate , eperisone hydrochloride , eperisone hydrochloride , escitalopram , escitalopram , escitalopram , flumazenil , flunarizine , flunarizine , fluoxetine , fluoxetine , fluphenazile decanoate , flupiritine , fosphenytoin , gabapentine , gabapentine , gabapentine + mecobalamine , gabapentine + nortriptyline , glycerol , haloperidol , haloperidol , haloperidol , haloperidol , hydroxyzine , hydroxyzine , hydroxyzine , imipramine , imipramine , lacosamide , lacosamide , lacosamide , lacosamide , lacosamide , lacosamide , lamotrigin , lamotrigin , lamotrigin , lamotrigin , levetiracetam , levetiracetam , levetiracetam , levetiracetam , levetiracetam 100mg / ml , levetiracetam , lithium carbonate , lithium carbonate , lithium carbonate sr , lorazepam , lorazepam , lorazepam , lorazepam , mecobalamin, pyrodoxine hcl, nicotinamide , methylfolate methylcobalamin & pyridoxal 5 phosphate , methylcobalamin +vitamin b6+folic acid , melatonin , mefloquine , methyldopa , methyldopa , methyldopa , modafinil , naltrexone , naproxen , naproxen , naproxen , naproxen + domperidone , nicotine chewing gum , nicotine chewing gum , nimodipine , nimodipine , nitrazepam , nitrazepam , nortriptyline , nortriptyline , olanzapine , olanzapine , olanzapine , olanzapine , olanzapine , oxcarbamazepine , oxcarbamazepine , oxcarbamazepine , oxcarbamazepine 300 mg , oxcarbamazepine 300 mg / 5 ml , paracetamol , paracetamol , paracetamol10mg / ml ( plastic bot ) , paracetamol + tramadol , paracetamol 10mg / ml ( glass bot ) , phenobarbitone , phenobarbitone , phenobarbitone , phenobarbitone , phenytoin sodium , phenytoin sodium , phenytoin sodium , phenytoin sodium , piperazine , piperazine , piracetam , piracetam , pregabaline , pregabaline , pregabaline , pregabaline + amitriptyline , pregabaline + nortriptyline , pregabaline+methylcobalamine , pregabaline+methylcobalamine , pyridostigmine , quetiapine fumarate , quetiapine fumarate , risperidone , risperidone , risperidone , risperidone , sertraline hcl , sertraline hcl , sertraline hcl , sodium valproate , sodium valproate , sodium valproate , sodium valproate , sodium valproate , sodium valproate + valproic acid , sodium valproate + valproic acid , sodium valproate + valproic acid , sumatriptan + naproxen , tadalafil , tolvaptan , topiramate , topiramate , topiramate , trihexyphenidyl ( benzhexol ) , zolpidem , zolpidem , zolpidem sr , zolpidem sr , ent , absorbable hemostatic powde oxidized regenerated cellulose , budesonide 32mcg , chlorhexidine gluconate 2% mouth wash , chlorhexidine gluconate 2% mouth wash , chlorhexidine mouth wash , clotrimazole , clotrimazole1% , feracrylum ( hemolok ) 1% w / v , fibrin glue , fibrin glue , fibrin glue , floseal , fluticasone 0.05% , fluticasone furoate 50mcg , hemostatic matrix kit , hemostatic matrix kit , hyaluronidase , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors 11a, , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factorsviia, , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors ixa , inert agar polysaccharide / carbohydrate and 132 ug / ml medicinal bovine factors xa , medicated toothpaste containing potassium nitrate 50mg. , mometasone nasal spray , neomycin+bacitracin+hydrocortisone , neomycin+bacitracin+hydrocortisone , neomycin+bacitracin+polymyxin b , neomycin+polymyxin b sulfates+bacitracin zinc , neomycin+polymyxin b sulfates+bacitracin zinc , normal saline drop , paradichlorobenzene 2%+ benzocaine 2.7% + chlorbutol 5% + turpentine oil 15% + butylated hydroxyanisole 0.05% w / v , povidone iodine mouthwash / gargle 1% , sodium chloride 0.65% , wax softener , xylometazoline 0.05% , xylometazoline 1% , enzyme replacement therapy , imiglucerase , aldurazyme , fertility & infertility , betamethasone , cabergoline , cabergoline , cetrorelix acetate ( gnrh antagonist ) , clomiphene citrate , clomiphene citrate , conjugated equine estrogen , conjugated equine estrogen , dinoprostone , dinoprostone vaginal pessary , drotaverine hydrochloride , duvadilan isoxsuprine hydrochloride , estradiol valerate , ethinyl estradiol+desogestral , ethinylestradi+llevo norgestrol , human chorionic gonadotropin ( hcg ) ( uriniary ) highly purified 10000 iu , letrozole , letrozole , magnesium sulphate 50% w / v , medroxyprogesterone ( depot ) 150mg / ml ) ( 1ml / vial ) , methergin , methergin , micronised progesterone , micronised progesterone , micronised progesterone , micronised progesterone vaginal , micronized progesterone , mifepristone , misoprostol , misoprostol , misoprostol , norethisterone , norditropin nordiflex pre fiiled pen , povidone iodine vaginal pessary , recombinant fsh ( follitropin a b ) multidose vials , recombinant fsh ( follitropin a b ) multidose vials , ritodrine hydrochloride , ritodrine hydrochloride , ritodrine hydrochloride , triptorelin acetate pfs , urinary gonadotropin ( menotrophin ) , valethamate bromide , gastroenterology , acetyl cysteine , acetazolamide , antacid [ magnesiumtrisilicate+ alluminium hydroxide ] , bisacodyl , bisacodyl , calcium polystyrenesulfonate , carboprost tromethamine , cinacalcet , darifenacin , desidustat , desidustat , dicyclomine , dicyclomine , dicyclomine , dicyclomine , dicyclomine , dicyclomine , aluminium hydroxide+magnesium aluminium silicate+magnesium hydroxide+simethicone , aluminium hydroxide gel ip 6g magnesium hydroxide ip 80mg activated dimethicone ip 100mg / deglycyrrhizinated liquorice 400 mg , diloxanide furoate , domperidone , domperidone , domperidone , domperidone + omeprazole , drotaverine hcl , esomeprazole , esomeprazole , esomeprazole , finasteride , flavoxate , fluoresein 20% ampules , genito urinary system , hydrocortisone rectal , hyoscine butyl bromide , hyoscine butyl bromide , indocyanine green , isoxsuprine , isoxsuprine , ispaghula husk , itopride , itopride , l ornithine l aspartate , l ornithine l aspartate , lactulose 3.3335g , levosulpiride , levosulpiride , levosulpiride , liquid paraffin +milk of magnesia with or without phenolphthalein , mesalazine , mesalazine , methyl ergometrine , methyl ergometrine , methylene blue , metoclopramide , metoclopramide , metoclopramide , metoclopramide , metoclopramide , metronidazole , metronidazole , metronidazole , midodrine , mosapride , n acetylcysteine , n acetylcysteine , n butyl cyanoacrylate glue , nitrofurantoin , nitrofurantoin , nitrofurantoin , norfloxacin 100mg + metronidazole 100mg per 5ml , omeprazole , omeprazole , omeprazole , ondansetron , ondansetron , ondansetron , ondansetron 2 mg / ml , ondansetron 2 mg / ml , ornidazole , ornidazole + ofloxacin , ornidazole 125mg + ofloxacin 50mg , ornidazole 500mg + ofloxacin 200mg , oxethazaine + antacid gel , pantoprazole , pantoprazole , pantoprazole + domperidone , pantoprazole + levosulpride , peginterferon alfa 2b , pirfenidone 200 mg , polidocanol 3% 60 mg , polyethylene glycol , polyethylene glycol +electrolyte powder , posaconazole 100 mg , posaconazole 100 mg , povidone iodine pessary 200 mg , pro biotec , proctoclysis enema , proctoclysis enema , promethazine , promethazine , promethazine , promethazine , rabeprazole + domperidone , rabeprazole + domperidone , rabeprazole sodium , rabeprazole sodium , ranitidine , ranitidine , ranitidine , rifaximin , rifaximin , secnidazole , secnidazole , sodium nitroprusside , somatostatin , somatostatin , sucralfate , sucralfate , sucralfate , sulfasalazine , tenecteplase , tenecteplase , terlipressin , tinidazole , tinidazole , tinidazole + norfloxacin , tinidazole i.p. , tinidazole i.p. , triptorelin pamoate equivalent to triptoreline 3.75 mg , triptorelin pamoate equivalent to triptoreline 3.75 mg , ursodeoxycholic acid , ursodeoxycholic acid , ursodeoxycholic acid , ursodeoxycholic acid , vedolizumab , hormones , acarbose , acarbose & metformine hcl , acarbose & metformine hcl , acotiamide , adrenocorticotropic hormone ( acth ) 60iu / ml , bromocriptine , bromocriptine , buserelin acetate ( multidose vial 1mg / ml concn ) , calcitriol , canagliflozin , carbimazole , carbimazole , carbozatinib , danazol , danazol , dapagliflozin , dehydroepiandrosterone , dehydrotestosterone , denosumab 120 mg pfs , denosumab pfs , desmopressin , desmopressin , desmopressin nasal spray , desmopressin oral lyophilisate , desmopressin oral lyophilisate , dexamethasone , dexamethasone , diazoxide , empagliflozin , glargine , gliclazide , gliclazide , gliclazide modifiedrelease , gliclazide modified release , glimeperide , glimeperide , glimeperide , glimeperide , glimeperide + metformin , glipizide , glipizide , glucagon , goserelin , highly purified chorionic gonadotrophin , human growth hormone ( prefilled pen ) , insulin long acting glargine , human insulin rapid acting analogue , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , human insulin of recombiant dna origin , hydrocortisone , hydroxyprogesterone , hydroxyprogesterone , lenvatinib , leuprolide , leuprolide , leuprolide , leuprolide acetate , leuprolide acetate , levocarnitine , levocarnitine , levothyroxine , levothyroxine , linagliptin , liraglutide , medroxyprogesterone acetate , medroxyprogesterone acetate , metformin , metformin , metformin , metformin + gliclazide , metformin sr , metformin sr , mitotane , oxytocin , pasereotide pamoate lar , pioglitazone , pioglitazone , pioglitazone , propylthiouracil , propylthiouracil , pruclopride , saxagliptin , sitagliptin , sitagliptin , somatostatin , somatostatin , somatropin recombinant , somatropin recombinant , sorafenib , teneligliptin , teriperitide prefilled pen , testosterone propionate / enanthate , testosterone propionate / enanthate , testosterone propionate / enanthate , testosterone thiomersal 0.01% , testosterone undecanoate , testosterone undecanoate , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , thyroxine sodium , triptorelin ( 0.1 mg ) , vandetinib , vasopressin 20 iu / ml , vasopressin 40 iu / ml , vildagliptin , vildagliptine+metformin , vildagliptine+metformin , vildagliptine+metformin , voglibose , i.v. fluids ( crystalloids ) , 0.9% normal saline 100 ml dehp free double sterilized closed chamber bag. , 0.9% normal saline 500 ml dehp free double sterilized closed chamber bag. , 5% dextrose 1000 ml dehp free double sterilized closed chamber bag. , 5% dextrose 500 ml dehp free double sterilized closed chamber bag. , blanced salt solution 1000 ml lactate and calcium free ph 7.2 7.4 in closed bag systemosmolarity 292 294 non pvc dehp free self collapsible bio degradable bags , blanced salt solution 500 with calcium pvc dehp free self collapsible bottle , custodial ( htk solution ) , custodial ( htk solution ) , dextrose 10% ( plastic ) , dextrose 10% ( plastic ) , dextrose 25% ( plastic ) , dextrose 5% glass , dextrose 5% non pvc dehp free self collapsible bags , dextrose 5% non pvc dehp free self collapsible bags , dextrose 5% non pvc dehp free self collapsible large twin port bottle , dextrose 5% non pvc dehp free self collapsible large twin port bottle , dextrose 5% ( plastic ) , dextrose 5% ( plastic ) , dextrose 5% ( plastic ) , dextrose 5%, sod.choride 0.18%, n / 5 glass , dextrose 5%, sod.choride 0.18%, n / 5 glass , dextrose 5%, sod.choride 0.18%, n / 5 plastic , dextrose 5%, sod.choride 0.18%, n / 5 plastic , dextrose 5%, sod.choride 0.33%, n / 3 glass , dextrose 5%, sod.choride 0.45%, n / 2 ( plastic ) , dextrose 5%, sod.choride 0.9% ( plastic ) , dextrose 5%, sod.choride 0.9% n / 3 glass , dextrose 5%, sod.choride 0.9%. ( plastic ) , dextrose normal saline dextrose 5%, sod.chloride 0.9% ( plastic self collapsible bags ) pvc bags with dehp , dextrose normal saline dextrose 5%, sod.chloride 0.9% ( plastic self collapsible bottle ) non pvc large twin port bottle , dextrose20% ( glass ) , electrolyte e , electrolyte g , glycine 1.5% ( plastic ) , glycine 1.5% ( plastic ) , h.d.fluid low calcium , heamodialysis fluid with dextrose , irrigation solution glycine 1.5 % bottle , irrigation solution glycine 1.5 % polybag , irrigation solution normal saline bottle , irrigation solution normal saline polybag , lactate free balanced solution in non pvc packing with ph of 7.35 7.45 bio degradable bag , lactate free hemodialysis fluid , prismasol hemodialysis / hemofiltration solution bags , mannitol 10% + glycerine 10% ( plastic ) , mannitol 10% + glycerine 10% ( glass ) , mannitol 10% + glycerine 10% ( glass ) , mannitol 20% , mannitol 20% ( glass ) , mannitol 20% ( glass ) , mannitol 20% self collapsible bags pvc bags with dehp , multiple electrolytes& dextrose m , multiple electrolytes& dextrose p , normal saline ( sodium chloride 0.9% ) ( glass ) , normal saline ( sodium chloride 0.9% ) ( glass ) , normal saline ( sodium chloride 0.9% ) ( plastic ) , normal saline ( sodium chloride 0.9% ) non dehp dobule sterile polyolifen closed sysytembag with both temper evident cap , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible bags , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible bags , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible large twin port bottle , normal saline ( sodium chloride 0.9% ) non pvc dehp free self collapsible large twin port bottle , normal saline ( sodium chloride 0.9% ) ( plastic ) , normal saline ( sodium chloride collapsible bag ) , normal saline sodium chloride 0.3% ( plastic ) , normal saline sodium chloride 0.45% , normal saline sodium chloride 0.45% , normal saline sodium chloride 0.9% ( plastic ) , p.d. fluid plastic , p.d. fluid plastic , paracetamol 10 mg / ml ( dehp free non pvc, self collapsibledouble sterilised closed systembio degradablebags ) , pd fluid 1.5 % bags with drain bag setof , peritoneal dialysis fluid 1.7% , ringer lactate ( glass ) , ringer lactate ( plastic ) , ringer lactate ( plastic ) , ringer lactate non pvc dehp free self collapsible bags , ringer lactate non pvc dehp free self collapsible bags , ringer lactate non pvc dehp free self collapsible large twin port bottle , ringer lactate non pvc dehp free self collapsible large twin port bottle , sodium chloride0.9 % repulse10 ml , sodium chloride 0.9%plastic ampule , sodium chloride 0.9% 500 ml glass bottle , sterile water for irrigation , sterile water for irrigation , immunomodulators , aflibercept , anti human t lymphocyte immunoglobulin ( rabbit ) , anti thymocyte immunoglobulin ( rabbit ) , basiliximab , betamethasone , betamethasone , cyclosporine , cyclosporine , cyclosporine , deflazacort , deflazacort , deflazacort , evolocumab pfs , infliximab , methyl prednisolone 40mg , methyl prednisolone 80mg , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , methyl prednisolone sodium succinate , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , mycophenolate mofetil , pegfilgrastim prefilled syringe , prednisolone , prednisolone , prednisolone , rituximab , rituximab , tenofovir, lamivudine, and , dolutegravir , tacrolimus , tacrolimus , tacrolimus , tacrolimus , musculoskeletal system , abatacept , aceclofenac , aceclofenac , aceclofenac + paracetamol , aceclofenac + thiocolchicoside , aceclofenac +thiocolchicoside , aceclofenac+chlorzoxazone+paracetamol , ademetionine butanedisulfonate , allopurinol , baclofen , baclofen , baclofen , baclofen , dextromethorphan+ chlorpheniramine+phenylephrine h , diacerein , diclofenac +chlorzoxazone + paracetamol + , diclofenac patch , diclofenac patch , diclofenac sodium 25 mg / ml , diclofenac sodium75mg / ml , diclofenac sodium , diclofenac sodium , diclofenac sodium , diclofenac sodium+ paracetamol , diclofenac sodium+ paracetamol , diclofenac suppository , diclofenac suppository , diclofenac suppository , diclofenadiethylamine linseed methyl salicylate & menthol , diclofenac diethylamine 4% w / v qps based meter dosages , dothiepin hydrochloride + methylcobalamin , etoricoxib , etoricoxib , etoricoxib , etoricoxib , febuxostat , glucosamine sulphate +chondrotin sulphate , glucosamine sulphate+diacerein , hyaluronic acid injectable implant 20mg / ml , hyaluronic acid injectable implant 20mg / ml , ibuprofen , ibuprofen , ibuprofen 100mg. / 5ml , ibuprofen + paracetamol , ibuprofen + paracetamol , ibuprofen + paracetamol , ibuprofen + tizanidine , indomethacin , indomethacin , indomethacin , indomethacin , indomethacin , ketorolac , ketorolac , ketorolac , lactulose 20 % w / v ( lactulose 200 mg sodium benzoate 3 mg , l arginin +l lysine , leflunomide , leflunomide , mefenamic acid , mefenamic acid + dicyclomine , mefenamic acid+ tranexamic acid , mesalamine , mesalamine , mesalamine , mesalamine enema 1 gm , nimesulide +paracetamol , pancreatin minimicrospheres , pancreatin minimicrospheres , pancuronium4mg / 2ml , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol , paracetamol 125mg / 5ml , paracetamol 250 mg / 5ml , paracetamol , paracetamol + aceclofenac , paracetamol 10mg / ml ( plastic bot. ) , paracetamol+ caffiene , paracetamol+tramadol , pentazocin , pinaverium bromide , piroxicam , piroxicam , rivastigmine , rivastigmine , rivastigmine , rivastigmine , serratiopeptidase , serratiopeptidase , thiocolchicoside , thiocolchicoside , thiocolchicoside , thiocolchicoside , tolterodine , tolterodine , tramadol , tramadol , tramadol hcl 100 mg / ml , tramadol hcl 50 mg / ml , trypsin / chymotrypsin , trypsin / chymotrypsin , narcotic drugs , morphine sulphate 10mg / ml , morphine sulphate 15mg / ml ( preservative free , morphine sulphate , morphine sulphate sr , morphine sulphate sr , morphine sulphate ( sr ) , morphine sulphate ( sr ) , morphine sulphate , morphine sulphate , morphine sulphate , fentanyl citrate 50mcg / ml , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal patch , fentanyl transdermal oral transmucosal , pethidine , buprenorphine , buprenorphine , buprenorphine sublingual , buprenorphine sublingual , buprenorphine sublingual , transdermal buprenorphine patch , transdermal buprenorphine patch , transdermal buprenorphine patch , methadone , methadone , neoplastic disorder , 5 flurouracil , 5 flurouracil , 5 fluorouracil , 5 fluorouracil , aberaterone , aberaterone , actinomycin d 0.5 mg , adriamycin , adriamycin , alpha interferon , amifostine , amifostine , anastrzole , aprepetant , axitinib , axitinib , azacytidine , bendamustin , bendamustin , bendamustine , bevacizumab 100 mg , bevacizumab 400 mg , bicalutamide , bleomycin , bortezomib , bortezomib , bortezomib , busulphan , capecitabine , capecitabine , carfilzomib , celecoxib , chlorhexidine gargles , cisplatin , cisplatin , cladribine , clotrimoxazole lozendges , cyclophsophamide , cyclophsophamide , cyclosporine , cytarabine , cytarabine , cytosine arabinoside , cytosine arabinoside , cytosinetarabinoside , cytosinetarabinoside , cytosinetarabinoside , cytranine , cytranine , dacarbazine , dacarbazine , dactinomycin , danazol , danazol , dasatanib , dasatanib , dasatanib , daunorubicin hydrochloride , degarelix room temperature stable , degarelix room temperature stable , docetaxel , docetaxel , docetaxel , docetaxel , docetaxel lipid suspension , docetaxel lipid suspension , doxorubicin liposomal , entecavir , entecavir , enzalutamide , enzalutamide liqid soft capsules , epirubicin , epirubicin , epirubicin , eribulin mesylate , erlotinib , erlotinib , etanercept , etanercept , erlotininb , etanercept prefilled pens , etanercept prefilled pens , etanercept prefilled pens , etoposide , etoposide , everolimus , everolimus , exemestane , filgrastim ( gcsf ) , filgrastim peg , fludarbine 50 mg , flutamide , folinic acid , fosaprepitant , fulvestrant , geftinib , gemcitabine hcl , gemcitabine hcl , gemcitabine hcl , goserelin , granisterone , granisterone , gentian violet paint , hafooz ointment , hydroxyurea ( hydroxycarbamide ) , ibrutnib , idraphos , ifosfamide 1gm.vial + mesna. combipack , ifosphamide , imatinib , imatinib , ipilimumab , irinotecan , irinotecan , itolizumab , ixabepilone , ixabepilone , lapatinib ditosylate , lapatinib ditosylate , lenalidomide , lenalidomide , lenalidomide , lenvatinib , lenvatinib , letrozole , leucovorin calcium , leucovorin calcium , leucovorin calcium , liposomal doxorubicin , melphalan , melphalan , mercaptopurine , mercaptopurine , mesna 1 gm , methotrecate tablets , methotrecate tablets , methotrexate , methotrexate , methotrexate , methotrexate , methotrexate injection for intrathecal , methotrexate injection for iv , methotrexate injection for iv , mistabron , mitomycin c , mitomycin c , mitomycin c , mitomycin c , mitoxantrone , nanoparticle paclitaxel , nanoparticle paclitaxel , nilotinib , nilotinib , nimotuzumab , pirfenidone , non pegaylated liposomal doxorubicin , non pegaylated liposomal doxorubicin , nintedanib 100 mg , nintedanib 150 mg , nivolumab , nivolumab , octreotide , octreotide , octreotide lar , octreotide lar , octreotide lar , omalizumab , osteophos , osteophos , osteophos , oxaliplatin , oxaliplatin , oxaliplatin , paclitaxel , paclitaxel , paclitaxel , paclitaxel , paclitaxellipid suspension , paclitaxellipid suspension , paclitaxel nab , palonosetron , palbociclib , palbociclib , palbociclib , pazopanib , pazopanib , pegylated asparaginase 750 iu / ml , pemetrexed disodium , pemetrexed disodium , pomalidomide , pomalidomide , pomalidomide , procarbazine , ranibizumab , ranibizumab , ranibizumab , rucaparib , rucaparib , ruxolitinib , sargramostim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulfamethoxazole and trimethoprim , sulbactum , sunitinib , sunitinib , sunitinib , tamoxifen , tamoxifen , temozolomide , temozolomide , temozolomide , tolterodine , transtuzumab ( herceptin ) , transtuzumab ( herceptin ) , trastuzumab emtansine , trastuzumab emtansine , trastuzumab lyophilized , vincristine 2mg / 2 mg , vincristine 1mg / 1ml , vinorelbine , zoledronic acid , zoledronic acid , nutrition & metabolism , 10% amino acid + 20% lipid + 15% dextrose , 10% amino acid + 20% lipid + 30% dextrose , 10% amino acids with electrolytes , 6% blanced hydroxyethyl starch130 / .04 in an isotonic electctrolyte with sodium chloride 110 112 mmol osmolarity 285 290 in non pvc dehp free bage 500 ml , 7% amino acid solution for renal patients , 7% amino acid solution for renal patients , 8% amino acids for hepatic patients , alendronic acid , alfacalcidol , alfacalcidol , alfacalcidol 1mcg , alpha ketoanalogues of essential amino acid , alpha ketoanalogues of essential amino acid , amino acid 10 % , amino acid 10 % , amino acid 10% w / v with electrolyte , aminoacids soln. ( 5%w / v ) , aminoacids soln. ( 5%w / v ) , aplrostadil , ascorbic acid , ascorbic acid , ascorbic acid 1.5 gm , b complex , balanced iso caloric powder ( polymeric diet ) for , enteral tube feeding , calciumcarbonate+vitamine d3 , calcium acetatemaleate , calcium carbonate+vitamine d3 , calcium gluconate , calcium gluconate & calcium lactobionate 10 ml , cap.live freeze dried lacatic acid bacteria and bifidobacteria , cholecalciferol ( vitamin d3 ) , cholecalciferol , cyanocobalamin , cyproheptadine ( 2mg ) + tricholine citrate ( 275mg ) , darbepoietin alfa , darbepoietin alfa , darbepoietin alfa , darbopoetin alfa , darbopoetin alfa , darbopoetin alfa , dextran 40 , dextran 70 , dipeptide of n ( 2 ) alanyl glutamin , dipeptide of n ( 2 ) alanyl glutamin , enteral nutrition powder for diabetic patients , epoetin beta , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin alpha , erythropoietin beta , erythropoietin beta , erythropoietin beta , ferric carboxymaltose 1gm , ferric carboxymaltose 500 mg , ferric carboxymaltose 100 mg , ferrous ascorbate + folic acid , ferrous sulphate / fumrate , ferrous sulphate / fumrate , folic acid , folic acid , formula milk powder for preterm / low birth weight newborns , formula milk powder for term newborns , formulated well balanced nutritional supplement for gastro intestinal , glutamine powder , hepatic protien powder , hepatic protien powder , high protein low electrolyte powder for enteral tube feeding in patients on dialysis , high protein powder for enteral tube feeding , high protein powder for pregnancy & lactation , high protein powder for pregnancy & lactation suugar free , high protien powder for renal patients on dialysis , high protienpowder for renal patients on dialysis , human albumin low salt , human albumin 20% , human albumin 20% , human albumin 25% , human albumin 25% , human albumin 5% , human albumin 5% , human milk fortifier , human milk fortifier ( bovine based ) , ibandronate , intralipid phospholipid & fat emulsion solu 20% , intralipid phospholipid & fat emulsion solu 20% , intralipid phospholipid & fat emulsion solu. 30% , intralipid phospholipids & fat emulsion solu 20% , iron , iron + folic acid , iron dextran , iron as ferric saccharate and phospholipid chewable tablets , l alanyl l glutamine , lacticacidbacillus , loperamide 2 mg , l ornithine aspartate , l ornithine aspartate , low salt human albumin solution 20% , low salt human albumin solution 20% , lyophilized erythropoietin , lyophilized erythropoietin , methoxy polyethylene glycol epoetin beta , methoxy polyethylene glycol epoetin beta , methoxy polyethylene glycol epoetin beta , methyl cobalamin , methyl cobalamin , methyl cobalamin , methyl cobalamin , methyl cobalamine +alpha liporic acid+folic , acid+choline+pyridoxine , multivitamin , multivitamin drop , multivitamin with vitamin –a , multivitamin 500 mg , multivitamine, multmineral , nicotinamide , nutritional supplements for patients in liver failure , omega 3 fatty acid , pegylated erythropoietin alfa , pegylated erythropoietin alfa , pegylated erythropoietin alfa , peptide based specialized nutrition to support gi tolerance with 100% hydrolyzed protien , phytomenadione , polygeline , polygeline ( polymer from degraded gelatin ) , potassium chloride , potassium chloride , protein powderfor renal ( low protein for non dialysis patient , renal protien powder , succinylated gelatines , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber ( central route ) bag; quote single, triple, central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes in single / triple chamber peripheral route ) bag; quote single, triple, peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combinationtriple chamber peripheral route ) bag; peripheral route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , tpn solution with amino acid, glucose & carbohydrate, electrolytes with lipids four oil combination triple chamber ( central route ) bag; quote central route bag , vitamin a , vitamin a , vitamin a , vitamin b1 ( thaimine ) , vitamin c , vitamin cwith zinc , pyridoxine , pyridoxine , pyridoxine , pyridoxine , pyridoxine , vitamin.b1, b6, b12 combination , who ors powder sachet , zinc , zinc gluconate , ophthalmic preparations , acyclovir 3% , acyclovir 5% , atropine 1% , betamethosone 0.1%+ neomycin 0.5% , betamethosone 0.1%+ neomycin 0.5% , betaxolol 0.25% , betaxolol 5% , brimonidine tartarate 0.2% , bromonidine 0.2%+timolol 0.5% , carboxymethylcellulose sodium0.5% , cefazolin 0.5% , chloramphenicol , chloramphenicol 1% , chloramphenicol 1% , ciprofloxacin 0.3% w / w , ciprofloxacin 0.3% w / w , cyclopentolate 1% , cyclosporine 0.05% , diclofenac 0.1% , dorzolamide 2% , erythromycin , fluconazole 0.3% , fluorescein 1% , fluorescein sodium 10% , fluorescein sodium 20% , fluoromethalone 0.1% , flurbiprofen 0.03% , gatifloxacin 0.3% , gentamicin 0.30% , homatropine hydrobromide 2% , hydroxy propyl methyl cellulose 0.70% , hydroxyl propyl methyl cellulose 0.3% , hydroxyl propyl methyl cellulose solution –prefilled syringe 2% pfs , hypromellose 0.3% , hypromellose 2% w / v , intravitreal implants dexamethasone 700 microgram ( slow release biodergradable implant ) , intravitreal injection triamcinolone acetonide ( 40 mg / 1ml, sterile preservative free ) , ketorolac 0.5% , latanoprost 50 mcg per ml , latanoprost 50 mcg per ml + timolol 5 mg per ml , lignocaine 4% , methyl cellulose 2% , miconazole 2% , moxifloxacin 0.5% , natamycin 5% , neomycin+polymyxinb+bacitracin zinc , neosporin eye ointment , nepafenac ophthalmic suspension , norfloxacin 0.3% , ofloxacin 0.3% , opthalmic irrigation solution 500 mlsodium chloride 7.44 mg, · sodium chloride 7.44 mg, · potassium chloride0.395 mg, calcium chloride 3.85 mg · magnesium chloride5 mg· dibasic sodium phosphate0.433mg· sodium bicarbonate 2.1 mg · dextrose 23 mg, · glutathione disulfide ( oxidized glutathione ) 4.6 mg, ph of 7.4 osmolality is approximately 305 mosm , paracaine , phenylephrine hcl5% , phenylephrine hcl 10% , pilocarpine 0.25% , pilocarpine 2% , pilocarpine 4% , pilocarpine nitrate preservative free 0.5 w / v , polyvinyl alcohol 1.4% + povidone 0.06% + chlorbutanol 0.5% , povidone iodine 0.60% , povidone iodine 5% , prednisolone acetate 0.01% , prednisolone sodium phosphate 1% , proparacain hci usp 0.5% , sodium cromoglycate 2% , sodium hyaluronate pfs , sodium hyaluronate pfs , sodium hyaluronate pfs , sodium hylauronate 14 mg , tetracaine hydrochloride 0.5% , timolol 0.25% , timolol 0.5% , tobramycin 0.3% , tropicamide 0.8%+ phenylepherine 5% , tropicamide 0.80% , tropicamide 1% , trypan blue dye 0.06% , tropicamide+phenylephrine 1%+5% , vancomycin 50mg / cc , pediatrics , aminoacid based infant formula , aminophylline , biotin , bosentan , caffine citrate , caffine citrate , calcitriol , ceftazidime+ tazobactum , cetrizine chlorpheniranine , clacium phosphate ( 10ml=300 mg ) , clobazam , cloxacillin , digene gel , domperidone , enalapril 5 , enterogermina , furosemide , gancyclovir , hepatitis b immunoglobulin , hydralazine , hydralazine , hydroxazime hcl , junior lanzol , k bind , lactulose , lactulose syrup , lasilactone , leucoverin , levosimendan , levosimendan , metoprolol , multivitamin drops , multivitamin syrup , nitroglycerine , nitroglycerine , nitroprusside , paracetamol suppository , phenergan , polyehtylene glycol , poractant alfa ( curosurf ) , poractant alfa ( curosurf ) , potassium phosphate , prazocin , prostaglandin e1 , ribofalvin , rifaximin , salbutamol , saline nasal drops ( 0.65% ) , sildenafil , sildenafil , sildenafil citrate , sildenafil citrate , surfactant , surfactant , surfactant , beractant intratracheal suspension , beractant intratracheal suspension , thiamine , thrombophobe , triclofos , ursodeoxyxholic acid , vitamin d 3 drops ( 1ml=400iu ) , zinc gluconate oral suspension , zinc oxide , radiology , barium enema disposable kit , barium enema powder , barium paste , barium powder, , barium sulphate , barium sulphate , barium sulphate high density powder , barium suspension , barium suspension , contrast agent containing sulphur hexaflouride microbubbles for intravascular use , disposablect enema kit , gadobenate acid dimglumine , gadobenate acid dimglumine , gadobenate dimeglumine334mg+195mg / ml , gadobenate dimeglumine334mg+195mg / ml , gadodiamide , gadodiamide , gadopentate , gadopentate , gadopentate dimeglumine , gadopentate dimeglumine , gadoterate meglumine , gadoterate meglumine , gadoteric acid ( ionic macro cyclic compound ) , gadoteric acid ( ionic macro cyclic compound ) , gadoteridol , gadoteridol , gastrovedeo ( diatriozoate sod 41.7% w / v ) , iodixanol 270 mg iodine / ml , iodixanol 270 mg iodine / ml , iodixanol 320 mg iodine / ml , iodixanol 320 mg iodine / ml , iohexol , iohexol 300 mg iodine / ml , iohexol 300 mg iodine / ml , iohexol 350 mg iodine / ml , iohexol 350 mg iodine / ml , iohexol 350 mg iodine / ml , iomeprol 400 mg iodine / ml , iomeprol 400 mg iodine / ml , iopamidol 300 mg iodine / ml , iopamidol 300 mg iodine / ml , iopamidol 370 mg iodine / ml , iopamidol 370 mg iodine / ml , iopromide 300 mg iodine / ml , iopromide 300 mg iodine / ml , iopromide 370 mg iodine / ml , iopromide 370 mg iodine / ml , lipiodol , n butyl 2 cyanoacrylate , n butyl 2 cyanoacrylate , n butyl 2 cyanoacrylate , one molar mri contrast agent: gadobutrol , one molar mri contrast agent: gadobutrol , one molar mri contrast agent: gadobutrol , sod. diatrizoate & meglumine diatrizoate 60% eq.to 292mg. / ml. , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sod. diatrizoate & meglumine diatrizoate 76%eq.to 370mg. / ml , sodium megluminediatrizoate , sulphar hexafluoridemicrobubbles 25 mg , respiratory system , aminophylline , aminophylline , beclomethasone , beclomethasone dipropionate , beclomethasone dipropionate , budesonide , budesonide , budesonide , budesonide , budesonide , budesonide , codeine phosphate , codeine phosphate + chlorpheniramine maleate , dextromethorphan , dextromethorphan hydrochloride , 5 mg chlorpheniramine maleate 2.5 mg, guaifenesin 50mg, ammonium chloride 60 mg / 5ml , doxophylline , doxophylline , favipiravir , fluticasone + salmeterol , fluticasone + salmeterol , fluticasone + salmetrol , fluticasone + salmetrol , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + budesonide , formoterol + triotropium , formoterol + triotropium , guaiphenesin+dextromethorphan +chlorpheniramine maleate ( sugar free ) , hydrocortisone sodium succinate , hydrocortisone sodium succinate , indacaterol maleate+indacaterol+glycopyrrronium bromide , ipratropium br + levosalbutamol , ipratropium br + salbutamol , ipratropium bromide , ipratropium respirator solu. for nebulisers , ipratropium respirator solu. for nebulisers , levosalbutamol 1.25mg , montelukast , montelukast , montelukast + levocetrizine , montelukast +fexofenadine , phenyephrine + chlorpheniramine maleate , promethazine hydrochloride 1.5mg + pholcodine 1.5mg , salbutamol , salbutamol , salbutamol+ipratropium bromide , salbutamol + theophylline , salbutamol + theophylline , salbutamol +ipratropium bromide , salbutamol 2 mg / 5 ml , salbutamol 5mg / ml , salbutamol sulphate , salbutamol sulphate , salmetrol + fluticasone , salmetrol + fluticasone with accuhaler device , salmetrol + fluticasone with accuhaler device , salmetrol+fluticasone , terbutaline , terbutaline , terbutaline , terbutaline + bromhexine hcr , terbutaline 1.5mg / 5ml , terbutaline nebulising solution 0.5mg / ml , terbutaline sulphate + brohexine hydrochloride + guaiphenesin + menthol , theophylline + etophylline , theophylline + etophylline , theophylline 35 mg + etophylline 115mg , theophylline 70 mg + etophylline 231mg , tiotropium , tiotropium , sera & vaccines , anti d immunoglobulin , anti d immunoglobulin , anti rabies immunoglobulin ( human ) , anti rabies immunoglobulin ( human ) , anti rabies immunoglobulin ( human ) , anti snake venom ( polyvalent ) vial , buvalent poliomyelits vaccine type 1&3 , live oral , diphtheria and tetanus vaccine ( adsorbed ) for adults and adolescents ) , diphtheria, tetanus, pertussis ( acellular component ) ) , diptheria antitoxin , dpt & hepatitis b combination , diphtheria toxoid & tetanus vaccine ( adsorbed ) , diphtheria toxoid, acellular pertussis & tetanus toxoid vaccine , docaravimab and miromavimab 1500 iu , haemophilus influenzae b conjugate vaccine , hepatitis a vaccine 720 elisa unit / ml. , hepatitis b vaccine ( rdna ) adult , hepatitis b vaccine multi dose 20 ?g / ml , hepatitis b vaccine single dose 20 ?g / ml , hepatitis b vaccine single dose paed. , human papilloma virus vaccine ( hpv ) , inactivated hepatitis a vaccine , influenza vaccine , influnza vaccine ( flu quadry ) , influnza vaccine ( flu quadry ) , inactivated influenza vaccine ( split virion ) i.p. tetravalent ( pfs ) , measles vaccine , meningococal vaccine , meningococcal ( groups a, c, y and w 135 ) polysaccharide diphtheria toxoid conjugate vaccine , mmr ( measles, mumps & rubella vaccine ) , oral polio vaccine , pneumococcal conjugated vaccine 10 valent , pneumococcal conjugated vaccine 13 valent , pneumococcal conjugated vaccine 23 valent , polysaccharide typhoid , rabies human monoclonal antibodies ( rdna ) 100iu , rabies human monoclonal antibodies ( rdna ) 50 iu , rabies vaccine ( human diploid cell ) , rabies vaccine, human i. p. vero cell cultured freeze dried vaccine , rubella vaccine ( monovatent ) , scorpion venom anti serum , tetnus immunoglobulin ( human ) vial. , tetnus immunoglobulin ( human ) vial , tetnus toxoid ( human ) , typhoid vaccine. , typhoid vaccine. , vericella vaccine 1vial + 1ml. of diluent , yellow fever vaccine ( live freeze dried , skin preparations , betamethasone dipropionate , betamethasone dipropionate 0.1% + salicyclic acid 3% , betamethasone valerate 0.01% , betamethasone valerate 0.12% + neomycin 0.5% , cetrizine , cetrizine , clobetasol 0.05% , clobetasol 0.05% + fusidic acid 2% , clobetasol 0.05% + gentamicin 0.1% , clobetasol 0.05% + gentamicin 0.1% , clotrimazole cream , clotrimazole cream , clotrimazole lotion 1% , clotrimazole1% + allantoin 0.2 % w / w , fluocinolone + neomycin , fluocinolone 0.025% , fluocinolone acetonide 0.1% , fluticasone 0.05% + mupirocin 2% , fluticasone propionate 0.05% , heparin , hydroquinone , hydroxizine , hydroxyl propyl methyl cellulose2 % , levocetrizine , liposomal dithranol 0.5% w / w , luliconazole cream 1% , methylrosanilinium chloride ( gentianviolet ) , miconazole 2% , minoxidil 2% , mometasone 0.1% , mometasone 0.1% , mometasone 0.1% + fusidic acid 2% , mometasone 1 mg + salicylic acid 50mg , mometasone furoate , mupirocin + betamethasone , mupirocin 2% , neomycin +bacitracin , permethrin 5% , povidone iodine 5% , povidone iodine5% + metronidazole 1% , salicylic acid 5% , sertaconazole 2% , silver sulfadiazine 1% , silver sulfadiazine+chlorhexidine , tacrolimus 0.1% , terbinafine...

Medical College - Rajasthan

33408069 rate contract of drugs medicines and injectables items rate contract of drugs medicines and injectables items , rate contract of drug and medicine , artificial saliva , balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg (monopoly) , all trans retinoic acid 10 mg , anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110/50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , ointment(modified lanolin) , aloe vera moisturizing , (six hundred twenty five) 625 , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin,niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene (0.1% w/w) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg/ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec (vitamin c+ essential amino acid) , enzyme , iron (ferrous ascorbate) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg/ml, 400 iu , vitamin d3 400iu/ml , vitamin d3 800iu/ml , cefpodoxime oral suspension 20mg/ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu/gm + neomycin 3400iu/gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w/v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p/r , nifedipine + lidocaine p/r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit(pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg/vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg/ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg(monopoly) , avelumab 200 mg (monopoly) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25,000 iu , bortezomib 2.5 , botulinum toxin type a for injection/botulinum toxin type b for injection100 iu , botulinum toxin type a for injection/botulinum toxin type b for injection50 iu , busulfan 60mg/1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg/ml , calcium chloride 5ml vial , calcium gluconate/folinate , carbetocin 1ml/100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm/vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg/4ml , clonidine 150mcg/ml , compound sodium lactate (ringer lactate) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg (monopoly) , daratumumab400 mg(monopoly) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu/3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg/ml , dextran 40 , diazoxide 300 mg/20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg (monopoly) , durvalumab 500mg (monopoly) , enalapril1.25 mg 1 ml , ephedrine 30 mg/ml , epirubicin 50mg/ml , epirubicin 150mg/ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct/lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection (long acting) 25mg/ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg/ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle/500ml , glyceryl trinitrate injection, diluted 5mg/ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol (long acting) 50mg/ml ampoule , horse atg(anti thymocyte globulin) 250 mg , hp hmg (highly human menopausal parodiedgonadotropin) 150 iu , hp hmg (highly human menopausal parodiedgonadotropin) 75 iu , hydralazine 20mg/ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg(monopoly) , insulinaspart , insulinglulisine(monocomponent insulin glulisine) 100 iu/ml/3 ml cartridges , insulinglulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% (fructodex 10%) 500 cc , iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg/5ml , irinotecan 100 mg/5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% (20mg/4ml) ampule , levofloxacine 500mg/100 ml , levosulpride 12.5 mg/ml , lignocaine (preservative free) 2% , lignocaine + adrenaline (1:10000, 2:10000) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg/ml , meropenem 2gm , mesna 200 mg/2ml (sod. mercaptoethane sulphate) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg (preservative free) , midazolam 5mg/ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg/100ml , multivitamin 10 ml , nabpaclitaxel (paclitaxel nano particle)100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg (monopoly) , neostigmine+ glycopyrrolate2.5 mg/ 0.5 mg , netilmycin 300mg/3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg/50 ml , nimotuzumab 50 mg , nivolumab 40 mg (monopoly) , nivolumab 100 mg (monopoly) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar (long acting release) 20 mg , octreotide lar (long acting release) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg (monopoly) , pembrolizumab100 mg (monopoly) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg/ml , pilocarpine 0.5% w/v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg (anti thymocyte globulin)100 mg , ramucirumab 100 mg(monopoly) , ramucirumab 500 mg (monopoly) , ranizumab 10mg/ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg/10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule (heavy) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg/5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg/ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d (600000 iu) , insulin glargine300 iu per ml/prefilled pen , insuline 50/50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd eob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) , l ornithine l aspartate (150mg) + pancreatin (100mg) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 , clotrimazole 10mg , (medium chain triglyceride) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml/gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg/5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu/gm , sodium chloride 0.9% 3000ml(n.s) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine (nac) 200mg/ml , budesonide 0.5mg/ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30/pack , revolizer/ rotahaler device , root canal sealer (calcium carbonate) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg/0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm/ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg/ ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg /ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg/5ml , clarithromycin for oral suspension 125mg/5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg/ml , rabbit atg (anti thymocyte globulin) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg/30ml , l carnitine 500mg/5ml in 30 ml , l carnosine 100mg/5ml in 200ml , levofloxacin oral solution , linezolid 100mg/5ml in 30ml , mefenamice acid 100mg/5ml , mefenemic acid 50 mg + paracetamol 250 mg /60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg/5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg/5ml in 100ml , prednisoloneip 50mg , piracetam 500mg/5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg/ 5mlin 30ml , ursodeoxycholic oral suspension 125mg/5ml in 100ml , zinc oral suspension 20 mg/100 ml , /susp. azithromycin oral suspension 100mg/5ml , /susp. azithromycin oral suspension 200mg/5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg(capsule of co enzyme q10 with lycopene,selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase (100+325+15 mg) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg (monopoly) , alpelisib 200 mg (monopoly) , alpelisib 250 mg (monopoly) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg (trientine hcl) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg (monopoly) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg (monopoly) , dacomitinib 30 mg (monopoly) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside(60+8 mg) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg/25mg/200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg (monopoly) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg (monopoly) , nilotinib200 mg (monopoly) , nilotinib 300mg (monopoly) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg (monopoly) , olaparib 150 mg (monopoly) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg (monopoly) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10,000mg(with proteiase & amylase) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release/sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg/ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg (monopoly) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin (50/500) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg (monopoly) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine (adsorbed) ip in 0.5 ml , noradranaline 2 mg , heparin sodium 5 ml vial , ethamsylate 250 , vitamin k 10 mg , esmolol hydrochloride 10 mg , amikacin 500 mg , amikacin 500 mg , amoxyclave 1.2 gm , adrenalin , ceftriaxone 1 gm , ceftazidime 1 gm , deriphylline 2cc , diazepam 10 mg/2ml , dopamine , dexamethasone , diclomine , diclofane sodium 3 ml , frusemide 2 cc , gedodemide , hydrocortisone , metrogyl 100 cc , mannitol 100 ml , midazolam 5 ml , meropenam 5 ml , meropenam 1 gm , methyl prednisolone 500 mg , pipracilline+ tezobactum 4 5 gm , phenytain 100 mg , pheniramine malate , inj. paracetamol 1% 100 ml , ranitidine 2 cc , sodium bicarbonate , tramadol 2 cc , vancomycine 1 gm , sodium valproate 5 ml , pantaparazole , nor adrenaline , 5.1 gdw 500 ml , gns 500 ml , r l 500 ml , paracetamol , ibuprofen , lactulose , antacid , cefixime , amoxyclave , cough syrup , phenytain , cefixime 200 mg , ranitidine , mvbc , iron+fa , omeprazole 20 mg , pantaparazole+domperidom 40 mg+30mg , gabapantine 300 mg , diclofanic + pcm , ibu+ pcm , etoricoxib 90 mg , amoxyclave 625 mg , phenytoin 100 mg , naproxen 500mg , levofloxacin 500 mg , ciprofloxacin 500 mg , vitamin c , betanistine , carbamazepine , acetazolamide , levetiracetam 500 mg , mephentermine 50mg/ml , ropivaine 2% , ntg spray , eye ointment neosporine , flexometablic tube 6.5 mm , paracetamol suppositiery 80 mg , inj vasopnessin , inj clonidine , inj dexmeditomidine , vasline , isoflurine 100 ml , injection ketamine , lignocaine gel 2% , inj. lignocaine & adrenaline , inj. bupivacaine , atropine sulphate 0.6 mg/ml , inj. midazolam , tab. paracetamol 500 mg , inj. adrinaline 1mg/ml , propofol injection 10 mg/ml , inj. propofol 1% 50 ml , inj. propofol 1% 10 ml , thiopentone injection 0.5 g , inj. sevoflurane , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , fentanyl citrate injection50 mcg/ml , inj. diclofenacsodium 75 mg/ml aquousprepration 1 ml , diclofenac sodium 50 mg + paracetamol 500 mg , diclofenac sodium tablet 50 mg , diclofenac sodium tablet 50 mg , diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , betamethasone sodiumphosphate injection 4 mg/ml , dexamethasoneinjection 8 mg/2ml , pheniramine injection 22.75 mg/ml , promethazine injection 25 mg/ml , povidine iodine solution 5% , povidine iodine solution 5% , povidine iodine solution 10% , povidine iodinescrub solution , furosemimde 10 mg /ml , furosemide 40 mg , omiprazole 2mg , ranitidine 50mg/ml 2 ml , pantoprazole 40 mg , diclomone , diclomine , metochloromide 10 mg , ondansetron 2 ml , atracurium 10mg/ml , glycopyrolate 0.2mg/ml , neostigmine 0.5mg/ml , neostigmine 2.5mg/5ml , vecuronium bromide 4 mg , succinylcholine 50 mg , amitriphyline 25 mg , salbutamol 100 mg , theophylline+etophylline 50.6mg+169.4mg , finasteride 5 mg , flavoxate 200 , phenazopyridine 5mg , dutasteride 0.5 mg , alkylizer 100 ml , ferrous sulphate+ folic acid 100+0.5mg , amino acid 10% , black disinfectant fluid , phenytoin 50 mg , neloxone 0.4 mg , surgical spirit bp , terlipresin 1mg/10 ml , rivaroxaban 10mg , rivaroxaban 15mg , ketamine injection 50 mg/ml , propofol injection 10 mg/ml , thiopentone injection 0.5 g , lignocaine gelip 2% , lignocaine injection 2% , atropine sulphate injection0.6 mg/ml , midazolam injection ip 1 mg/ml , tramadol capsule 50 mg , tramadol injection 50 mg/ml , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , naproxen tablet ip 500 mg , aceclofenac and paracetamol tablet 100 mg + 325 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg/ml , diclofenac tablet (sr) 100 mg , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , paracetamoltablet 500 mg , paracetamol injection 150 mg/ml , inj diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , paracetamol infusion ip 1% w/v 100ml size , chlorzoxazone,diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , allopurinol tablet 100 mg , dexamethasoneinjection 8 mg/2ml , dexamethasone tablet 0.5 mg , hydrocortisone sodium succinate injection 100 mg base / vial , methyl prednisolone sodium succinate for injection 500 mg , prednisolone tablet 5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , tab dexamethasone ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) , adrenaline injection 1 mg/ml , chlorpheniramine maleate tablet 4 mg , hydroxyzine tablet 25 mg , pheniramine injection 22.75 mg/ml , promethazine injection 25 mg/ml , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml , cetirizine,phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , levoceitrizine tablet 5mg , montelukast 10 mg + levocetrizine 5mg tablet , phenytoin injection 50 mg/ml , phenytoin tablet 100 mg , pregabalin capsule ip 75 mg , sodium valproate oral solution ip 200 mg/ 5 ml , clobazam tablet/capsule 10 mg , gabapentine tablet/capsule 300 mg , amikacin injection250 mg , amikacininjection 500 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxicillin and potassium clavulanate injection1.2 gm , piperacillin and tazobactum for injection 4 gm + 500 mg , inj piperacillin 2 gm + tazobactom 250mg usp , cefepime injection500 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , ceftazidime injection 1 g , ceftriaxone injection ip 1 g/vial , azithromycin tablet 500 mg , ciprofloxacin injection 200 mg/ 100 ml , ciprofloxacin tablet 500 mg , norfloxacintablet 400 mg , ofloxacinand ornidazole tablet 200 mg + 500 mg , aztreonam injection 500 mg , co trimoxazole tablet160 mg + 800 mg , doxycycline capsule 100 mg , linezolid injection 200 mg/100 ml , meropenem injection 500 mg , vancomycin injection 500 mg , aztreonam 1gm injection , metronidazoleinjection 500 mg/ 100 ml , metronidazole tablet 400 mg , fluconazole tablet 150 mg , acyclovir tablet200 mg , bleomycin injection15 units , chlorambucil tablet 5 mg , cisplatin injection 50 mg/ 50 ml , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cytarabineinjection100 mg/5 ml , doxorubicin injection50 mg/ 25 ml , etoposide injection 100 mg/ 5 ml , fluorouracil injection 250 mg/ 5 ml , leucovorin calcium injection 10 mg/ml , methotrexate injection 50 mg/2 ml , paclitaxel injection 260 mg , paclitaxel injection 100 mg , tamoxifen tablet 10 mg , vinblastineinjection 10 mg/10 ml , vincristineinjection 1 mg/ml , carboplatin injection 150mg , carboplatin injection 450mg , cisplatin injection 10 mg/10 ml , dacarbazine injection 500 mg , filgrastim injection 300mcg/ml , gemcitabine injection 200 mg , gemcitabine injection 1gm , ifosfamide injection 1gm , imatinib tablet 400 mg , methotrexate tablet ip 10 mg , mitomycin c injection 10 mg , oxaliplatin injection 50 mg , bendamustine 100 mg , capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) , letrozole usp2.5 mg (each film coated tablet containsletrozole usp2.5 mg) , capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) , inj. bortezomib 2mg , tab abiraterone acetate ip 250 mg(each uncoated tablet contains abiraterone acetate ip 250 mg) , cap thalidomide usp 100 mg(each hard gelatin capsule contains thalidomide usp 100 mg) , inj. bevacizumab 400 mg , inj. bevacizumab 100 mg , tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) , tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) , tab. bicalutamide usp 50 mg(each film tablet contains bicalutamide usp 50 mg) , inj zoledronic acid ip 4mg/100ml 100ml size , tab dasatinib 100 mg , heparin sodium injection 5000 iu/ml , warfarin sod. tablet 5 mg , ethamsylate injection 250 mg/ 2ml , tranexamic acid tablet 500 mg , tab ethamsylate bp 500 mg (each uncoated coated tablet contains ethamsylate bp 500 mg) , inj tranexamic acid ip 100mg/ml 5ml size , rh erythropoetininjection10000 iu , rh erythropoetininjection 4000 iu , humanalbumin solution 20% , dopamine hydrochloride injection40 mg/ml , noradrenaline injection 2 mg/ml , magnesium sulphate injection(50% ) 500 mg/ml , chlorhexidine mouthwash bp 0.20% , clotrimazole mouth paint (clotrimazole 1% w/v) 1% , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , glycerin ip 400 gm , gadodiamide injection0.5 mmol/ml , iohexol usp (solution for injection) non ionic contrastmedium in sterile aqueous solution 350 mg iodine/ml. , compoundbenzoin tinctureip , formaldehyde solution (34.5% 38%) , gentian violet topical solution usp 1% , glutaraldehyde solution 2% , hydrogen peroxide solution 6% , lysol(cresol with soap solution) (cresol 50% + soap 50%) , povidone iodine solution5% , povidone iodine scrub solution / cleansing solution 7.5%w/v povidone iodine 7.5% , povidone iodine ointment 5% , silver sulphadiazine cream 1% , surgical spirit bp , furosemide tablet 40 mg , furosemide injection 10 mg/ml , mannitol injection 20% , spironolactone tablet 25 mg , torsemide tablet 10 mg , antacidliquid , omeprazole capsule 20 mg , pantoprazole injection 40 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , ranitidine hcl injection 50 mg/2ml , ranitidine tablet 150 mg , dicyclominetablet 10 mg , dicyclomineinjection 10 mg/ml , dicyclomine and paracetamol tablet 20mg + 325mg , drotaverine tablet 40 mg , drotaverine hydrochloride injection 40 mg/2ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , metoclopramide injection 10 mg/2ml , metoclopramide tablet 10 mg , domperidone tablet 10 mg , ondansetron orally disintegrating md tablet4 mg , ondansetron injection 2 mg/ml , inj prochlorperazine mesylate 12.5mg/ml 5ml size , bisacodyl tablet 5 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm/15ml , loperamide tablet ip 2 mg , ors powder , sodium phosphates enema bp , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) , ursodeoxycholic acid tablet 300 mg , tab. mesalamine usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) , soluble insulin injection 40 iu / ml , glibenclamide tablet 5 mg , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , olanzapine tablet5 mg , amitriptyline tablets ip 25 mg , alprazolam tablet 0.5 mg , diazepam injection10 mg/ 2ml , lorazepam injection2 mg/ml , tab. zolpidem 5 mg , salbutamol tablet 2 mg , salbutamol syrup ip 2 mg/5ml , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , tab. acebrophylline 100 mg , cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] , cough syrup/ expectorant(ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , compound sodium lactate injection , dextrose injection25% , dextrose injection 5% , potassium chloride injection0.15 gm/ml , potassium chloride oral solution usp500 mg/ 5ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , ringer acetate infusion 500 ml , tamsulosinhcltablet 0.4 mg , flavoxate tablet 200 mg , tab sodium bicarbonate usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) , syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate) , calcium gluconate injection 10% , calcium& vitamin d3 tablet 500 mg + 250 iu , cholecalciferol granules 60,000 iu /1gm , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , folic acidtablet ip 5 mg , iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , pyridoxine tablet40 mg , vitamin b complex tablet nfi (prophylactic) , vitamin b complex injectionnfi , zinc sulphate dispersible ip elemental tablet 10 mg , methylcobalmin tablet 1500 mcg , black disinfectant fluid (phenyl) (as per schedule o grade iii , sodium bicarbonate injection ip 7.5% , water for injection ip , mannitolwith glycerin injection 10% + 10% , tab.morphine , tab.morphine , tab.sunitinib , tab.sunitinib , inj.docetaxel , inj.docetaxel , normal saline(glass bottle) , normal saline(glass bottle) , codon filter , d 5 %(glass bottle) , inj.mitomycin , inj.fludrabine , inj.vinorelbine , inj. mesna , inj ifosphamide with mesna , lenalidamide , codon filter (in line iv filter) , capacity less then 0.22 micrometer , tab.anastrazole , inj.bendamustine , tab.nilotinib , tab.enzalutamide , tab.sunitinib , inj.cytarabine , tab.fludrabine , inj.leuprolide , inj.albumin bound paclitaxel , tab.pilocarpine , cap.nilotinib , tab.enzalutamide , saliva stimulating tablets , inj.degaralix , inj.degaralix , tab.afatinib , inj.transtuzumab , inj.irinotecan , tab.lenolidomide , tab.lenolidomide , inj.liposomal doxorubicin , tab.sorafenib , inj.pemetrexet , inj.pemetrexet , inj.romiplostine , normal saline(glass bottle) , normal saline(glass bottle) , inj.mesna , d 5 %(glass bottle) , tab. granisetron , tab.aprepitanat , tab.aprepitanat , tab.ceritinib , inj.cabazitaxel , inj.epirubicin , tab.etoposide , tab.cyclophosphamide , in. fulvastrant , syp.lignocaine viscus , tab.methotrexate , inj.nandrolone , tab.everolimus , tab.febuxostate , ribociclib , tab.lapatinib , pemetrexed , cytarabine , bone marrow aspiration needle 18g , true cut needle biopsy gun with needle , xylocane 2 % (i.v. use)50 ml vial , xylocard 50 ml 2% , midorine 2.5 mg , chlordiazepoxide 10 mg , drotaverine tablet 40 mg , butrum , buscopan , paraffin , peglec powder , bisacodyl tablet 5 mg , thiamine , isphagulla husk , obleticholic acid 10mg , levofloxacin 500 mg , isphagulla , clonidine 150mg , alpha ketoanalouge , taurine + acetylcysteine 1mg , nefedipine 10 mg , tab teneligliptin 20mg , glimepride 5 mg , itraconazole200 mg , amino acid , methyl prednisolon 1gm , methyl prednisolon 500 mg , losartan 50 mg , telmisartan 40 mg , telmisartan 20 mg , telmisartan 80 mg , digoxin 0.25 , clopidogrel 75 mg , vymada 50 mg , vymada 100 mg (sacubitril+valsartan) , thrombophob ointment , faropenem 200 mg , nicorandil 48 mg , nicorandil 5 mg , ivabradine 5 mg , parasugrel 10 mg , ticagrelor 90 mg , multiple electrolyte isotonic crystaloid, calcium free and lactate free with high balance base excess sloution with ph. of 7.2 to 7.4, osmolarity 292 to 294 in double sterilized closed system polyolefin 1000 ml freeflex bag with both temper evident cap. , paracetamol infusion in double sterilized closed system polyolefin 50 ml freeflex bag with both temper evident cap. , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 38 gm of amino acid with taurine advantage npe ratio 113:1 peripheral line 1000 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 46 gm of amino acid with taurine advantage npe ratio 108:1 peripheral line 1500 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 50 gm of amino acid with taurine advantage npe ratio 113:1 central line 1000 ml , triple chamber bag with 4 oil combination lipid containing (fish,soya,coconut,olive oil) with 75 gm of amino acid with taurine advantage npe ratio 108:1 central line 1500 ml , amino acid 8% 500 ml , multiple electrolyte isotonic crystaloid, calcium free and lactate free with high balance base excess sloution with ph. of 7.2 to 7.4, osmolarity 292 to 294 in double sterilized closed system polyolefin 500 ml freeflex bag with both temper evident cap. , omega 3 fatty acid 50 ml , paracetamol infusion in double sterilized closed system polyolefin 100 ml freeflex bag with both temper evident cap. , tegadrem (10x12 cm) 8526in...

Medical Health And Family Welfare - Rajasthan

33338962 supply of medicine items in govt hospital nathdwara supply of medicine items in govt hospital nathdwara , category : drug , budesonide 1ml respule , budesonide 200 mcg. , diltiazem 2%p / r gel , enterogermina 2billion spores 5mlrespule , esmoprazole 10mg granules , estradiolvalerate cream , fluticasone , formeterol 20mcg +budesonide 0.5mg respule , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , glycopyrronium 25mcg. inhalation 2ml. respule , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml respule , minoxidil 2%lotion , multi vitamin syrup , nifedipine + lidocaine p / r gel , povidone iodine gargle , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride 3 % respule , sodium chloride bottel 100ml , syrup l carnitine 500mg / 5ml in 30 ml , tiotropium + glycopyrolate 25mg , tiotropium bromide dry powder30 / pack respule , ( medium chain triglyceride ) oil , / susp. azithromycin oral suspension 100mg / 5ml , / susp. azithromycin oral suspension 200mg / 5ml , 1.5% hydrogen peroxide mouthwash , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , aceclofenac and paracetamol tablet 100 mg + 325 mg , acenocoumarol tablet 2 mg , acetazolamide tablet 250 mg , act kit containing 3 tablet of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg , act kit containing 3 tablet of artesunate ( 50mg each ) and 1tablet of sulphadoxine pyremethamine ( 500+25 ) mg , act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyremethamine ( 500+25 ) mg each , act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and 1 tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir injection250 mg , acyclovir injection500 mg , acyclovir suspension400 mg / 5ml , acyclovir tablet200 mg , acyclovir tablet 800 mg , adenosine injection6 mg / 2ml , adrenaline injection 1 mg / ml , albendazole oral suspension 400 mg / 10 ml , albendazole tablet ip 400 mg , alendronate sodium tablets usp / bp 35 mg , allopurinol tablet 100 mg , alpha interferon injection 3 million unit , alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , amikacininjection100 mg , amikacininjection 500 mg , amikacin injection250 mg , aminophylline injection25 mg / ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg / ml , amitriptyline tablets ip 25 mg , amlodipine and atenolol tablet 5 mg +50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin oral suspension ( dry syrup ) 125 mg / 5ml , amoxycillin trihydrate dispersible tablet 125 mg , amphotericin b injection 50 mg , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , antacidliquid , antacid tablet , anti a blood grouping serum ( anti a monoclonal serum ip ) , anti b blood grouping serum , anti drh blood grouping serum , anti inhibitor coagulation complex [ human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu ] , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg / 5ml , artemether + leumefantrine tablet ( 40 mg and 240 mg ) , artemether + leumefantrine tablet ( 80 mg and 480 mg ) , artificial saliva solution , artisunate injection 60 mg ( combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17%lotion , ascorbic acid tablet 500 mg , aspirintablet ip ( gastro resistant ) 150 mg , aspirin delayed release tablet ( enteric coated ) 75 mg , atenolol tablet 25 mg , atenolol tablet 50 mg , atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , atracurium injection 10 mg / ml , atropine eye ointment 1% , atropine sulphate injection0.6 mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tablet ip 50 mg , azithromycin 1% eye ointment , azithromycin tablet ( dt ) 100 mg , azithromycin tablet 500 mg , azithromycin tablet ip 250 mg , aztreonam 1gm injection , aztreonam injection 500 mg , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , beclomethasone inhalation 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , benzathine benzylpenicillin injection 6 lac units , benzathine benzylpenicillin injection ip12 lac units , betahistine tabletip 8 mg , betahistine tablet ip 16 mg , betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , betamethasone sodiumphosphate injection 4 mg / ml , betamethasone tablet 0.5 mg , betaxolol eye drops 0.50% , biphasic isophane insulin injection30 / 70 ( 30% soluble insulin &70% isophane insulin ) 40 iu / ml , bisacodyl tablet 5 mg , black disinfectant fluid ( phenyl ) ( as per schedule o grade iii , bleomycin injection15 units , brimonidine tartrate and timolol eye drops0.15% + 0.5% , bromocriptine mesylate tablet2.5 mg , budesonide 0.5mg / ml respule , budesonide 400 mcg , budesonide nebulizer suspension0.25 mg / ml , budesonide rotacap 200 mcg , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , caffiene citrate oral solution , calamine lotion ip , calcitriol capsule0.25 mcg , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu ) , calcium gluconate injection 10% , cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , cap. acitretin 10 mg , cap. acitretin 25 mg , cap. alectinib 150 mg ( monopoly ) , cap. all trans retinoic acid 10 mg , cap. alpha+lipoic acid + leycopen +multivitamin and miltiminerals , cap. anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , cap. aprepitant 125 mg , cap. budesonide 9 mg , cap. calcium dobesilate 500mg , cap. ceritinib 100 mg , cap. ceritinib 200 mg , cap. ceritinib 250mg , cap. ceritinib 50 mg , cap. clomipramineip 25 mg , cap. cyclosporine 100 mg , cap. d penicillamine 250mg , cap. danazol 100mg , cap. eveningprimosa 1000 mg , cap. glucosamine + hydrochloride +methylsulfonylmethane , cap. indacaterol andglycopyronium inhalation powder110 / 50 mcg , cap. isotretinoin 10mg , cap. isotretinoin 20 mg , cap. lomustine 40 mg , cap. l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , cap. minocycline 100mg. , cap. mycophenolate mofetil 500mg , cap. netupitant + palonosetron 300 mg + 0.5 mg , cap. rabeprazole +levosulpiride , cap. racecadotril 100mg , cap. ramiprilip 5 mg , cap. rucaparib300 mg , cap. rucaparib 200 mg , cap. silodosin 4 mg , cap. silodosin 8 mg , cap. temozolamide 250 mg , cap. trametinib 0.5mg + davarafenide 150mg ( monopoly ) , cap. vitamin a 25000 iu , cap. vitamin e 400 mg , capsuleprocarbazine hydrochloride usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , capsule lomustine ip 40 mg ( each capsule contains lomustine ip 40 mg ) , capsule mycophenolate mofetil usp 250 mg ( each capsule conatin mycophenolate mofetil usp 250 mg ) , capsule tacrolimus ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg / 5 ml , carbimazole tablet 5 mg , carboplatin injection 150mg , carboplatin injection 450mg , carboprosttromethamine injection0.25 mg / ml , carboxymethylcellulose sodium lubricant eyedrops 0.50% , cefepime injection500 mg , cefixime oral susp ( drops ) 25 mg / ml , cefixime tablet 100 mg , cefixime tablet 200 mg , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection 250 mg , ceftriaxone injection ip 1 g / vial , ceftriaxone injection ip 500 mg / vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5ml , cephalexin tablet ( dt ) 125 mg , cetirizine syrup 5 mg / ml , cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetrimide cream ip 0.50% , chlorambucil tablet 5 mg , chloramphenicol0.5% eye ointment , chloramphenicol +polymycin eye ointment , chloramphenicol +polymycine + dexamethasone eye ointment , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops 0.05% , chlorhexidine gluconate solution 5% , chlorhexidine mouthwash bp 0.20% , chloridazepoxide tablets ip 10 mg , chloroquine phosphate injection 40 mg / ml , chloroquine phosphate suspension 50 mg / 5ml , chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) , chlorpheniramine maleate tablet 4 mg , chlorpromazineinjection ip 25 mg / ml , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip50 mg , chlorpromazinetablets ip 25 mg , chlorzoxazone, diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , cholecalciferol granules 60, 000 iu / 1gm , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , ciprofloxacin eye drops0.30% , ciprofloxacin injection 200 mg / 100 ml , ciprofloxacin ophthalmic ointment 0.30% , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , cisplatin injection 10 mg / 10 ml , cisplatin injection 50 mg / 50 ml , clindamycincapsule 150 mg , clindamycin capsule 300 mg , clindamycin phosphate gel usp 1% , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol cream 0.05% , clobetasol+salicylic acid 0.5%+6% , clomiphene tablet 50 mg , clomiphene tablet ip 25 mg , clonazepam tablet 0.5 mg , clopidogrel and aspirin tablet 75 mg +75 mg , clopidogrel tablet ip 75 mg , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , clotrimazole 1%+beclomethasone 0.25% lotion , clotrimazole 10mg lozenses , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1% w / v ) 1% , clotrimazole vaginal tablet 500 mg , cloxacillin sodium injection 500 mg , coal tar 6% & salicylic acid 3% onitment , coloplast60 gm paste , compoundbenzoin tinctureip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , compound sodium lactate injection , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , conjugated estrogen tablet 0.625 mg , continuous ambulatory peritoneal dialysis fluid 2 ltr , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet160 mg + 800 mg , co trimoxazole tablet40 mg + 200 mg , cough syrup [ each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg ] , cough syrup / expectorant ( ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , creamlidocaine 25 mg + prilocaine25mg , cream / ointment ( modified lanolin ) , cream aloe vera moisturizing , cream amophous hydrogel with colloid silver wound dressing , cream amorolfine 0.25% , cream azelaic acid 20% , cream benzoyl peroxide 2.5 % , cream desonide0.05% , cream fenticonazole 2% , cream glycolic acid 6% , cream hydrocortisone 1% , cream hydroquinone 2% , cream kojic acid 2%, arbutin, niacinamide , cream luliconazole 1% , cream mometasone 0.1 % , cream mometasone 2% , cream mupirocin usp 2% ( each gram contains 21.5 mgmupirocin calcium usp in a mineral oil cream base ) 15 gm size , cream permethrin 1%rinse , creamneomycin sulphate cream , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg / 5 ml , dacarbazine injection 500 mg , danazol capsule ip 50 mg , daunorubicininjection 20 mg , deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) 500 mg , dexamethasoneinjection 8 mg / 2ml , dexamethasone tablet 0.5 mg , dextromethorphan hydrobromide syrup 13.5 mg / 5ml , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , diagnostic sticks for multiple use strip ( sugar, ketone, albumin ) , diagnostic stip for sugar, ketone , diagnostic stip for sugar, protein , diatrizoate meglumine and diatrizoate sodium inj usp60% ( iodine conc.292 mg / ml ) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w / v ( iodine conc.370 mg / ml ) 76% , diazepam injection10 mg / 2ml , diazepam tablet 5 mg , diclofenac each transdermal patch contain 200 mg diclofenac , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg / ml , diclofenac sodium tablet 50 mg , diclofenac tablet ( sr ) 100 mg , dicyclomineinjection 10 mg / ml , dicyclominetablet 10 mg , dicyclomine and paracetamol tablet 20mg + 325mg , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine hydrochloride oral solution ip10 mg / 5ml , diethylcarbamazine tablets ip 100 mg , digoxin 0.25% elixir , digoxin injection 0.25 mg / ml , digoxin tablet 0.25 mg , diltiazem tablet 30 mg , dinoprostone cream0.5 mg , diphtheria antitoxin 10, 000 iu , dobutamineinjection 50 mg / ml , domperidone oral drops 10 mg / ml , domperidone suspension 5 mg / 5ml , domperidone tablet 10 mg , dopamine hydrochloride injection40 mg / ml , doxorubicin injection50 mg / 25 ml , doxycycline capsule 100 mg , dried factor viii fraction ( iv use ) 1000 iu , dried factor viii fraction ( iv use ) 250 iu , dried factor viii fraction ( iv use ) 500 iu , dropdiastasepepsin with simethicone 15 ml , drop ambroxol , drop anticold , drop astyminec ( vitamin c+ essential amino acid ) , drop cefpodoxime oral suspension 20mg / ml , drop docosahexaenoic 30ml , drop enzyme , drop furosemide 10mg / ml , drop hydroxyzine oral solution 15 ml , drop iron ( ferrous ascorbate ) , drop ondansetron oral solution 30 ml , drop simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , drop terbutalin , drop vitamin – e50mg / ml, 400 iu , drop vitamin d3 400iu / ml , drop vitamin d3 800iu / ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , drotaverine hydrochloride injection 40 mg / 2ml , drotaverine tablet 40 mg , ear dropacetic acid otic solution 2% , ear dropgentamycin , eeg 400gm paste , enalapril maleate tablet 10 mg , enalapril maleate tablet 2.5 mg , enalapril maleate tablet 5 mg , enema lactulose , enoxaparin sodium injection 60 mg , escitalopram tablets ip10 mg , ethamsylate injection 250 mg / 2ml , ethinyloestradiol tablet ip 50 mcg , etoposide injection 100 mg / 5 ml , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , eye drop carboxymethylcellulose + glycerin , eye drop moxifloxacin+ difluoprednate , eye drop natamycin opthalmic suspension 5% , eye drop olaptadine & ketorolac , eye drop polymyxin b 10000iu / gm + neomycin 3400iu / gm , eye dropbetadin 5% , eye dropbrinozolamide+brimonidine , eye dropcpm+cmc+nephazoline , eye dropcyclopentolate 1% , eye dropdorzolamide 2% , eye dropfluromethalone 0.1% , eye dropgatifloxacin+prednisolone , eye drophpmc 0.3% , eye dropitraconazole 1% , eye droploteprednol 0.25% , eye dropmoxifloxacin 0.5%+ketorolac tromethamine 0.5% , eye dropmoxifloxacin and dexamethasone , eye dropmoxifloxacin and prednisolone , eye dropnepafenac 0.1% , eye dropoloptadine opthalmic solution0.1% , eye droppilocarpine , eye dropprednisolone acetate opthalmic suspension 10 ml , eye dropproparacaine 0.5% w / v , eye dropsodium chloride 5 % , eye dropsulfacetamide 20% , eye droptravapost+timolol , eye droptropicamide+phenylepherine , eye dropvoriconazole , eye drop gatifloxacin 0.3% , eye drop moxifloxacin0.5% w / v ophthalmic solutionip 5ml size , factor – ix concentrate 600 iu , fenofibrate capsule 200 mg , fentanyl 25iu patch , fentanyl 50iu patch , fentanyl citrate injection50 mcg / ml , fentanyl citrate injection50 mcg / ml , feracrylum 1% w / w sterile solution 100 ml , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab. ( paediatric ) 20 mg + 0.1 mg , filgrastim injection 300mcg / ml , finasteride tablet 5 mg , flavoxate tablet 200 mg , fluconazole eye drops0.3% , fluconazole tablet 150 mg , flunarizine tablet 5 mg , fluorouracil injection 250 mg / 5 ml , fluoxetine capsule ip 20 mg , flurbiprofen sodium ophthalmic solution 0.03% , fluticasone ft nasal spray , folic acidtablet ip 5 mg , formaldehyde solution ( 34.5% 38% ) , formetrol 12mcg + budesonide 400 mcg. , formoterol & budesoniderotacap 6 mcg+ 200 mcg , fosfomycin3gm , framycetin sulphate cream 1% , framycetin sulphate cream 1% , furosemide injection 10 mg / ml , furosemide tablet 40 mg , fusidic acid cream2% , gabapentine tablet / capsule 100 mg , gabapentine tablet / capsule 300 mg , gadodiamide injection0.5 mmol / ml , gamma benzene hexachloride lotion ( lindane lotion usp ) 1% , ganciclovir 0.15% eye ointment , gel adaplene ( 0.1% w / w ) , gemcitabine injection 1gm , gemcitabine injection 200 mg , gentamycin injection 80 mg / 2ml , gentian violet topical solution usp 1% , glibenclamide and metformin hydrochloride ( sr ) tablet 5 mg + 500 mg , glibenclamide tablet 5 mg , gliclazideand metformin tablet 80 mg + 500 mg , gliclazide tablets ip 40 mg , glimepiride tablet 1 mg , glimepiride tablet 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sr ) tablet2mg + 15mg + 500mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glipizide tablet ip 5 mg , glucagon injection usp 1 mg / ml , glutaraldehyde solution 2% , glycerin2 gm / ml , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablet 2.6 mg , glycopyrrolate injection 0.2 mg / ml , glycopyrronium 25 , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 50 , griseofulvin tablets 125 mg , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , haloperidol injection 5 mg / ml , haloperidol tablet5 mg , haloperidol tablet 1.5 mg , halothane , hameodialysis bicarbonate solution , heparin 50 iu benzyl nicotinate 2 mg , heparin sodium injection 5000 iu / ml , hmffor pretem , homatropine eye drops 2% , hormonalintra uterine device , humanalbumin solution 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection ( im use ) 300 mcg , human rabies immunoglobulin injection 150 iu / ml , hyaluronidase injection 1500 iu , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , hydrocortisone sodium succinate injection 100 mg base / vial , hydrogen peroxide solution 6% , hydroxychloroquine sulphatetablet 200 mg , hydroxyethyl starch ( 130 / 4 ) 6% w / vwith sodium chloride 0.9% w / v intravenous infusion , hydroxyprogesterone injection 250 mg / ml , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg / ml , hydroxyzine tablet 25 mg , hyoscine butylbromide injection ip 20 mg / ml , hyoscine butylbromide tablet 10 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen oral suspension 100 mg / 5ml , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ifosfamide injection 1gm , imatinib tablet 400 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , indomethacin capsule 25 mg , injbendamustine 100 mg , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg / 500mg ip powder for solution , inj colistimethate ip 1m iu powder for solution , inj diclofenac sodium aqueous 75mg / ml1ml size, iv & im use , inj human chorionic gonadotropin ip 5000 i.u. , inj meropenem ip 250 mg , inj piperacillin 2 gm + tazobactom 250mg usp , inj poractant alpha 80 mg / ml in pack of 1.5 ml , inj prochlorperazine mesylate 12.5mg / ml 5ml size , inj tranexamic acid ip 100mg / ml 5ml size , inj zoledronic acid ip 4mg / 100ml 100ml size , inj.docetaxel 20mg , inj.docetaxel 80 mg , inj.etanercept 25mg / 0.5ml , inj.folinic acid 200mg / vial , inj.sodium chloride 3% 100ml , inj. acth synacthen 250 mcg , inj. adalimumab 40 mg , inj. ado trastuzumab 100 mg , inj. ado trastuzumab 160 mg , inj. alpha beta arteether 2 ml , inj. amino acid 10% 100ml size , inj. aminocaproicacid 20ml , inj. amoxycillin & clavulanic acid 300 mg , inj. ampicillin + salbactum 1.5g , inj. artesunate 120 mg , inj. atezolizumab 1200 mg ( monopoly ) , inj. avelumab 200 mg ( monopoly ) , inj. azacitidine 100mg , inj. azacitidine 50mg , inj. azithromycin 10 ml vial equaivelent to 500 mg , inj. bacitracin for injection 25, 000 iu , inj. bevacizumab 100 mg , inj. bevacizumab 400 mg , inj. bortezomib 2.5 , inj. bortezomib 2mg , inj. botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , inj. botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , inj. busulfan 60mg / 1ml , inj. butorphanol tartrate usp 1mg / ml 1ml size , inj. cabazitaxel 20 mg , inj. cabazitaxel 40 mg , inj. caffeine cirate 20mg / ml , inj. caffeine citrate usp 20mg / ml ( equivalent to 10 mgcaffeine base / ml ) 3ml size , inj. calcium chloride 5ml vial , inj. calcium gluconate / folinate , inj. carbetocin 1ml / 100micro. , inj. carfilzomib 20 mg , inj. carfilzomib 60 mg , inj. carmustine 100 mg , inj. caspofungin 50 mg , inj. caspofungin 70 mg , inj. cefipime 1000mg + tazobactum 125mg , inj. cefoperazone 1gm+tazobactum 125mg , inj. cefoperazone 1mg inj. , inj. cefoperazone 500mg , inj. ceftazidime 1gm+sulbactam500 mg , inj. ceftazidime+ avibactum 2gm+500mg , inj. ceftizoxime 1 gm , inj. ceftriaxoneip 125 mg , inj. ceftriaxone +salbactum+ disodium edta , inj. ceftriaxone 1 gm + tazobactum 1.25 gm , inj. ceftriaxone and sulbactam 1.5g , inj. ceftriaxone1000mg+ tazobactom125mg , inj. cefuroxime 1gm , inj. cetrorelix acetate 0.25 mg , inj. cetuximab 100 mg , inj. cetuximab 500mg , inj. chloramphenicol 1gm / vial , inj. cis atracurium besylate 2 mg / ml in 5 ml vial , inj. cladrabine 10 mg , inj. clarithromycin 500mg , inj. clindamycin600mg / 4ml , inj. clonidine 150mcg / ml , inj. compound sodium lactate ( ringer lactate ) in glass bottle 500ml , inj. crystilline penicillin 2 lakh , inj. cytarabine 1000 mg , inj. dacarbazine 200 mg , inj. daratumumab 100 mg ( monopoly ) , inj. daratumumab400 mg ( monopoly ) , inj. darbepoietin alfa 100mcg , inj. darbepoietin alfa 200 mcg , inj. darbepoietin alfa 500mcg , inj. decitabine 100 mg , inj. decitabine 50 mg , inj. degarelix 120 mg , inj. degarelix 80 mg , inj. degludec insulin 300iu / 3ml , inj. denosumab 120 mg , inj. deriphylline 1 ampul , inj. detemir insuline , inj. dexmedetomidine 100mcg / ml , inj. dextran 40 , inj. dextrose 5% 500 mlglass bottle , inj. diazoxide 300 mg / 20ml , inj. digoxin 2mg , inj. diltiazem 25 mg , inj. distilled water 10ml , inj. docetaxel 120 mg , inj. doxycycline for injection 100 mg , inj. durvalumab 120 mg ( monopoly ) , inj. durvalumab 500mg ( monopoly ) , inj. enalapril1.25 mg 1 ml , inj. ephedrine 30 mg / ml , inj. epirubicin 150mg / ml , inj. epirubicin 50mg / ml , inj. eribulin 0.5mg , inj. eribulin 1 mg , inj. ertapenem sodium 1gm = ertapenem 1.046 gm , inj. esmolol hydrochloride 10mg / ml 10ml size , inj. etomidate 20 mg , inj. etomidate mct / lct 10ml vial , inj. ferric carboxymaltose 50 mg / ml 10 ml size , inj. fluconazole 100mg , inj. fluconazole 200 mg , inj. fludarabine phosphate injection 50mg , inj. fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , inj. fluphenazine deconate injection ( long acting ) 25mg / ml ampule , inj. folic acid +methylcobalamine 10 ml pack , inj. fondaparinux 2.5mg , inj. fosphenytoin sodium 150mg / ml , inj. fsh 150 iu , inj. fsh 75 iu , inj. fulvestrant 250mg , inj. ganciclovir sodium 500mg ( lyophilized powder forreconstitution ) , inj. gdw 5% glass bottle / 500ml , inj. glyceryl trinitrate injection, diluted 5mg / ml , inj. goserelin acetate implant 3.6 mg , inj. haemocoagulase1 ml , inj. haloperidol ( long acting ) 50mg / ml ampoule , inj. hepatitis b immunologlobin ip 100 i.u , inj. horse atg ( anti thymocyte globulin ) 250 mg , inj. hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , inj. hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , inj. human albumin 20% in 50 ml vial , inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml ( 0.5 gm ) 100 mg , inj. hydralazine 20mg / ml , inj. indomethacin lyophilized powder 1mg , inj. inotuzumab1 mg ( monopoly ) , inj. insulinaspart , inj. insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , inj. insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , inj. insulin glargine300 iu per ml / prefilled pen , inj. insulin lispro , inj. insuline 50 / 50 , inj. interferon beta 1 a 30mg , inj. intralipds , inj. invert sugar 10% ( fructodex 10% ) 500 cc , inj. iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , inj. ipilimumab 50 mg , inj. irinotecan 100 mg / 5ml , inj. irinotecan 40mg / 5ml , inj. isolyte g , inj. isolyte p 10% 500 ml , inj. lacosamide infusion , inj. levobupivacaine 0.5% ( 20mg / 4ml ) ampule , inj. levofloxacine 500mg / 100 ml , inj. levosulpride 12.5 mg / ml , inj. lidocaine1% intra cameral , inj. lignocaine ( preservative free ) 2% , inj. lignocaine + adrenaline ( 1:10000, 2:10000 ) , inj. lignocaine 10% spray , inj. lignocaine hydrochloride 2% 50ml vial , inj. liposomal doxorubicin 20mg , inj. liposomol amphotericine b 10 mg , inj. liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , inj. lorazepam5 mg , inj. lorazepam 1.0 mg , inj. l orinithine l aspartate 10 ml , inj. low molecular wt. heparin 0.4mg , inj. mephentermine 50mg / ml , inj. meropenem 2gm , inj. mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , inj. methotrexate 1000 mg , inj. methotrexate 250 mg , inj. methylene blue , inj. methylprednisolon acetate40mg , inj. methylprednisolon acetate 125mg , inj. metoprolol 5ml vial , inj. metotrexate 15mg ( preservative free ) , inj. midazolam 5mg / ml 1 ml , inj. milrinone 10 mg , inj. mitomycin 2 mg , inj. mitomycin 40 mg , inj. mitoxanthrone infusion 10 mg , inj. mitoxanthrone infusion 20mg , inj. moxifloxacin intra cameral 0.5% , inj. moxifloxin 400mg / 100ml , inj. multivitamin 10 ml , inj. n butyl alcohol 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , inj. nabpaclitaxel ( paclitaxel nano particle ) 100 mg , inj. nandrolone decanoate 100mg , inj. nandrolone decanoate 50 mg , inj. natalizumab 300 mg ( monopoly ) , inj. neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , inj. netilmycin 300mg / 3ml , inj. nicardipin 10mg , inj. nicorandil 48 mg , inj. nimodipine infusion 10mg / 50 ml , inj. nimotuzumab 50 mg , inj. nivolumab 100 mg ( monopoly ) , inj. nivolumab 40 mg ( monopoly ) , inj. normal saline 1000 mlglass bottle , inj. normal saline 500 mlglass bottle , inj. octreotide 100mg , inj. octreotide lar ( long acting release ) 20 mg , inj. octreotide lar ( long acting release ) 30 mg , inj. omalizumab 150 mg vial , inj. ornidazole 500mg , inj. palonosetron 0.25mg , inj. paracetamol infusion 1000 mg with both temper evident caps spray 10% , inj. paracetamol infusion 500 mg with both temper evident caps spray 10% , inj. peg asparaginase 3750 iu 5 ml , inj. peg filgrastim injection 6mg , inj. pembrolizumab 50 mg ( monopoly ) , inj. pembrolizumab100 mg ( monopoly ) , inj. pemetrexed 100mg , inj. pemetrexed 500 mg , inj. pertuzumab 100 mg , inj. phenylephrine hydrochloride10 mg / ml , inj. pilocarpine 0.5% w / v , inj. piperacillin 1 gm + tazobactum 125 mg , inj. piracetam 200mg , inj. placental extract 2ml , inj. plerixafor 24 mg , inj. polymixin sulphate b usp 5 lac i.u. , inj. potassium chloride for injection , inj. progesterone injection 50 , inj. prostaglandin 500mcg / ml , inj. protamine sulphate 5ml , inj. rabbit atg ( anti thymocyte globulin ) 250 mg , inj. rabbit atg ( anti thymocyte globulin ) 100 mg , inj. ramucirumab 100 mg ( monopoly ) , inj. ramucirumab 500 mg ( monopoly ) , inj. ranizumab 10mg / ml , inj. rasburicase 1.5 mg , inj. recombinant fsh 150 iu , inj. recombinant fsh 300iu , inj. recombinant hcg 250 iu , inj. recombinant human growth hormone 4iu vial with syringe , inj. recombinant lh 75iu , inj. reteplase 18 mg , inj. risperidone prolonged releaseddepot 25 mg , inj. risperidone prolonged releaseddepot 50mg , inj. rituximab500 mg , inj. rituximab 100 mg , inj. rocuronium 100mg / 10ml , inj. romiplostim 125 mcg , inj. romiplostim 250 mcg , inj. romiplostim 500 mcg , inj. ropivacaine 0.75% 20ml vial , inj. ropivacaine 0.75% 3 ml ampule ( heavy ) , inj. secukinumab 150 mg , inj. sildenafil 0.8mg , inj. sodium bicarbonate injection , inj. sodium chloride and dextrose0.45% infusion 500ml , inj. sodium fluroresceinedye 20% , inj. sodium hyaluronate 1.4mg , inj. sodium nitroprusside25mg / ml2ml size , inj. streptomycin1gm , inj. streptomycin500mg , inj. sugmadex , inj. teicoplanin 200 mg , inj. teicoplanin 400 mg , inj. tenecteplase 20mg , inj. tenecteplase 40 mg , inj. tetanus vaccine ( adsorbed ) ip in 0.5 ml , inj. thiamine 100ml , inj. ticarcillinand clavulanic acid , inj. tigecycline for injection 100mg , inj. tigecycline for injection 50mg , inj. tobaramycin 80mg , inj. topotecan 2.5 mg , inj. topotecan 4 mg , inj. topotecan1 mg , inj. t pa 20mg alteplase for injection , inj. t pa 50mg alteplase for injection , inj. trabectedin 1 mg , inj. tranexamic acid 500mg / 5ml , inj. trastuzumab 440 mg , inj. trastuzumab150mg , inj. triamcinolone acetonide 10 mg per ml , inj. triamcinolone acetonide 40 mg per ml , inj. triptorelin 0.1 mg , inj. triptorelin 11.25 mg , inj. triptorelin 3.75 mg , inj. trypan blue 0.6% , inj. varicella immunoglobulin for iv use , inj. vasopressin 3ml , inj. verapamil2.5 mg / ml , inj. vinorelbine 10mg , inj. vinorelbine 50mg , inj. vitamin d ( 600000 iu ) , inj. voriconazole200mg / vial , inj.dextrose with sod.chloride polypack 5% 500ml , inj.fludarabine phosphate injection 100mg , inj.inj. liposomal doxorubicin 50 mg , inj.polymyxin b for injection 1 million , inj.procaine penicillin fortified 2 lack , inj.testosteron propionate 250mg , inj.testosteron propionate 50mg , insulin glargine100 iu / mlwith 30 insulin syringes with needle , insulin glargine 100 iu / ml with 15 insulin syringes and needles / cartridge 100 iu / ml with 15 needles and 1 pen per 20 cartridges , intravenous fat emulsion 20% w / v ( pl / tg ratio 0.06 ) 250ml , iohexol ( non ionic contrastmedium in sterile aqueous solution ) 300 mg iodine / ml. , iohexol usp ( solution for injection ) non ionic contrastmedium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium rotacap40 mcg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg / ml usp / bp 20 mg / ml ( for iv use ) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , isoflurane , isophane insulin injection40 iu / ml , isoprenaline injection 2mg / ml , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , isoxsuprine injection 5 mg / ml , isoxsuprine tablet 20 mg , itraconazole 1% eye ointment , itraconazole capsule 100 mg , ketaconazole 2% lotion , ketamine injection 50 mg / ml , ketoconazole cream 2% , labetalol hydrochloride injection 20 mg / 4ml , labetalol tablet 100 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm / 15ml , l arginine+proanthocynadine granules 3mg , l asparaginase injection 10000 iu , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , leucovorin calcium injection 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levetiracetam injection 500 mg / 5ml , levetiracetam oral solution suspension 100 mg / ml , levetiracetam tablet 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , levofloxacin tablet250 mg , levosalbutamol 100mcg+ ipratropium bromide 40mcg , levosalbutamol inhalation solution 50ml / gm , lidocaine10%20ml spray , lidocaine hydrochloride topical solution usp 4% , lignocaineointment 5% , lignocaine 1% mouth paint , lignocaine 4%30ml , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , lignocaine gelip 2% , lignocaine injection 2% , lignocaine viscous , linezolid injection 200 mg / 100 ml , linezolid tablet ip 600 mg , liquid paraffin ip , liquid paraffin ip , lisinopril tablet 10 mg , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lithium carbonate tablet 300 mg , loperamide tablet ip 2 mg , lorazepam injection2 mg / ml , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , losartan tablet 25 mg , losartan tablet 50 mg , lysol ( cresol with soap solution ) ( cresol 50% + soap 50% ) , magnesium sulphate injection ( 50% ) 500 mg / ml , magnesium sulphate, sulphacetamide, urea 75 gm , mannitolwith glycerin injection 10% + 10% , mannitol injection 20% , mecobalamin injection 500 mcg / ml , medroxyprogesterone acetate tablet ip 10 mg , mefenamic acid tablet 500 mg , mefloquine tablet250 mg , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , mercunium chloride paint , meropenem injection 1 g , meropenem injection 500 mg , mesalazine , metformin hydrochloride ( sr ) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride ( sustained release ) and glimepiride tablet500 mg + 2 mg , metformin hydrochloride sr tablet 1000 mg , metformin tablet 500 mg , methotrexate injection 50 mg / 2 ml , methotrexate tablet 2.5 mg , methotrexate tablet ip 10 mg , methyl prednisolone sodium succinate for injection 500 mg , methylcobalmin tablet 1500 mcg , methylcobalmin tablet 500 mcg , methyldopa tablet 250 mg , methylergometrine injection 0.2 mg / ml , methylergometrine tablet ip 0.125 mg , metoclopramide injection 10 mg / 2ml , metoclopramide syrup 5 mg / 5ml , metoclopramide tablet 10 mg , metoprolol suscinate tablet ( extended release ) usp 50 mg , metoprolol tablet ip 25 mg , metronidazoleinjection 500 mg / 100 ml , metronidazole and chlorhexidine gel 1%+ 0.25% , metronidazole benzoate oral suspension 100 mg / 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , miconazole nitrate cream2% , midazolam 0.5mg / 5ml nasal spray , midazolam injection ip 1 mg / ml , midodrine 5mg , mifepristone tablet200 mg , milk low birth formula powder , minoxidil 10 % lotion , minoxidil 5% lotion , misoprostol tablet 200 mcg , mitomycin c injection 10 mg , montelukast 10 mg + levocetrizine 5mg tablet , morphine sulphate injection ip 10 mg / ml , moxifloxacin0.5% eye ointment , multiple electrolytes & dextrose injection type iip ( electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip ( electrolyte m injection ) , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , n acetylcystine injection 200 mg / ml , n acetylcysteine ( nac ) 200mg / ml respule , naloxone injection ip 0.4 mg / ml , naproxen tablet ip 250 mg , naproxen tablet ip 500 mg , natural micronisedprogesteron soft gelatin capsule 200 mg ( each soft gelatin capsule containsprogesteron ip 200 mg ) , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , neomycin, polymixin b & hydrocortisone ear drops / otic solution usp ( neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml ) , neostigmine injection 2.5 mg / 5ml , neostigmine injection ip 0.5 mg / ml , neostigmine tablets ip 15 mg , nifedipine capsule 5 mg , nifedipine tablet ( sustained release ) 10 mg , nitrofurantoin tablet 100 mg , nitroglycerininjection 5 mg / ml , noradrenaline injection 2 mg / ml , norethisterone tablet 5 mg , norfloxacintablet 400 mg , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin injection 200mg / 100 ml , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin suspension 50 mg / 5 ml , ofloxacin tablet 200 mg , oint. terbinafine 1%w / w ( 10 gm tube ) , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , olanzapine tablet5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v usp ( e / d ) 5ml size , omega 3fatty acid 50ml , omeprazole capsule 20 mg , ondansetron injection 2 mg / ml , ondansetron orally disintegrating md tablet4 mg , ors powder , oseltamivir 30 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate oral suspension ip 12 mg / ml ( each ml contains : 12 mg oseltamivir after reconstitution , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg / ml. ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection 50 mg , oxytocin injection 5 iu / ml , paclitaxel injection 100 mg , paclitaxel injection 260 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , pantoprazole injection 40 mg , paracetamoldrops 150 mg / ml , paracetamolsyrup ip 125 mg / 5ml , paracetamoltablet 500 mg , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , paracetamol infusion ip 1% w / v 100ml size , paracetamol injection 150 mg / ml , pentazocine injection 30 mg / ml , peritonial dialysis solution ip , permethrinlotion 5% , permethrin cream 5% , pheniramine injection 22.75 mg / ml , phenobarbitone injection ip 200 mg / ml , phenobarbitone tablet 30 mg , phenylephrine hydrochloride ophthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection 50 mg / ml , phenytoin oral suspension 25 mg / ml , phenytoin tablet 100 mg , pioglitazone tablet ip 15 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , podophyliin toxin lotion , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride injection0.15 gm / ml , potassium chloride oral solution usp500 mg / 5ml , povidone iodine ointment 5% , povidone iodine ointment 5% , povidone iodine pessary , povidone iodine scrub solution / cleansing solution 7.5%w / v povidone iodine 7.5% , povidone iodine solution10% , povidone iodine solution5% , povidone iodine solution5% , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection 25 mg / ml , prazosin tablet ( extended release ) 2.5 mg , prednisoloneip 50mg , prednisolone sodium phosphate1% eye / ear drop , prednisolone tablet 10 mg , prednisolone tablet 20 mg , prednisolone tablet 5 mg , pregabalin capsule ip 75 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , progesteroneinjection 200 mg / 2ml , promethazinesyrup ip 5 mg / 5ml , promethazine injection 25 mg / ml , promethazine tablet 25 mg , propofol injection 10 mg / ml , propranolol tablet 40 mg , pyridoxine tablet40 mg , pyridoxine tablet 10 mg , quetiapine tablet ip 25 mg , quetiapine tablet ip 50 mg , quinine dihydrochlorideinjection 300 mg / ml , quinine sulphate tablet 300 mg , rabies antiserum ip ( equine ) ( i.m. / sc use ) 300 units / ml , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose , racecadotril sachet 30 mg , ramipril tablet / capsule 2.5 mg , ranitidine hcl injection 50 mg / 2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , revolizer / rotahaler device , rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , ringer acetate infusion 500 ml , risperidone tablet2 mg , risperidone tablet 1 mg , root canal sealer ( calcium carbonate ) , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution 5 mg / ml , salbutamol syrup ip 2 mg / 5ml , salbutamol tablet 2 mg , salicylic acid 16.7% + lactic acid 16.7% paint , saline nasal solution ( drops ) 0.65% , salmetrol 50mcg+fluticasone 500 mcg , sertraline tablet 50 mg , sevoflurane , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , snake venom anti serum ( polyvalent anti snake venom ) lyophillized , sodium bicarbonate injection ip 7.5% , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride 6% eye ointment , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , sodium phosphates enema bp , sodium valproatetablet 200 mg , sodium valproate ipinjection 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate ( gastro resistant ) ip tablet 500 mg , soluble insulin injection 40 iu / ml , solution carbolic acid 100% in 500 ml , solution carbolic acid 50% in 500 ml , solution desfluraneusp 240 ml bottle , solution glycine irrigation solution 1.5% 3ltr , solution hydrogen 11% + silver nitrate .01% , solution polyethyene glycol with elctrolyte approx 130gm , spironolactone tablet 25 mg , spironolactone tablet 50 mg , streptokinase injection 15 lac units , succinylcholine injection 50 mg / ml , sulfasalazine delayed release tablet 500 mg , sulphur + calamine lotion , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 lotion , superoxidized spray , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical spirit bp , surgical spirit bp , syp. alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , syp. posacozazole 40mg / ml , syrup amlodipine oral solution 1 mg / ml , syrup artemether 40mg + lumefantrine 240 mg 30ml , syrup b. complex , syrup baclofen oral solution 5 mg / ml , syrup calcium phosphate 200 ml , syrup cefaclor each 5 ml contain cefaclor 125 mg , syrup cefixime oral suspension50mg , syrup cefixime oral suspension 100mg , syrup cefpodoxime proxetil oral suspension 100mg , syrup cefpodoxime proxetil oral suspension 50mg , syrup cefuroxime axetil oral suspension 125mg / 5ml , syrup clarithromycin for oral suspension 125mg / 5ml , syrup codienephosphate , syrup cyclosporine oral solution 100mg / ml , syrup cyproheptadine200ml , syrup dextromethorphan hcl + chlorpheniramine , syrup diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , syrup drotavarine , syrup each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , syrup each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , syrup enzyme 100 ml , syrup esomperazole , syrup fluconazole oral suspension , syrup furosemide oral solution 10mg / 30ml , syrup l carnosine 100mg / 5ml in 200ml , syrup levofloxacin oral solution , syrup linezolid 100mg / 5ml in 30ml , syrup mefenamice acid 100mg / 5ml , syrup mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , syrup melatonin 60 ml , syrup montelucast+levocetrizine , syrup nitrofurantoin oral suspension 25mg / 5ml in 100 , syrup ondansetron oral suspension , syrup oxybutynin oral suspension5 ml , syrup phenobarbitone 20mg / 5ml in 100ml , syrup piracetam 500mg / 5ml in 100ml , syrup potassium magnesium citrate , syrup ranitidine oral suspension , syrup rifaximin , syrup sodium bicarbonate oral suspension , syrup sodium picosulphate oral suspension , syrup sorbitol + tricholine citrate , syrup sucralphate , syrup triclofos oral suspension500 mg / 5mlin 30ml , syrup ursodeoxycholic oral suspension 125mg / 5ml in 100ml , syrup zinc oral suspension 20 mg / 100 ml , tab abiraterone acetate ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , tab baclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , tab cabergoline ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , tab cyclophosphamide ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , tab dasatinib 100 mg , tab dexamethasone ip 4 mg ( each uncoated tablet containsdexamethasone ip 4 mg ) , tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg ) , tab ethamsylate bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , tab gefitinib ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , tab lacosamide 100 mg ( each film coated tablet contains lacosamide 100 mg ) , tab lamotrigine ip50 mg ( eachsustained releasetablet contains lamotrigineip 50 mg ) , tab letrozole usp2.5 mg ( each film coated tablet containsletrozole usp2.5 mg ) , tab levamisol hydrochloride ip 50 mg ( each uncoated tablet conatinlevamisol hydrochloride ip 50 mg ) , tab oxcarbazepine ip150 mg ( each film coated tablet contains oxcarbazepine ip150 mg ) , tab pyridostigmine usp 60 mg ( each tabletcontains pyridostigmine usp 60 mg ) , tab rosuvastatin 10 mg , tab rosuvastatin ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , tab savelamer carbonate 400 mg ( each film coated tablet containssavelamer carbonate 400 mg ) , tab sodium bicarbonate usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , tab tizanidine hydrochloride ip 2 mg ( each uncoated tabletcontainstizanidine hydrochloride ip 2 mg ) , tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , tab.nicoumalone 3 mg , tab.nicoumalone 4 mg , tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , tab. 6 mercaptopurine 20 mg , tab. acebrophylline 100 mg , tab. acebrophylline sr 200 mg , tab. aceclofenac + thiocolchicoside , tab. aceclofenac sr 200 mg , tab. aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , tab. afatinib 20 mg , tab. afatinib 30 mg , tab. afatinib 40 mg , tab. alendronate sodium 70 mg , tab. alfuzosin 10 mg , tab. alpelisib 150 mg ( monopoly ) , tab. alpelisib 200 mg ( monopoly ) , tab. alpelisib 250 mg ( monopoly ) , tab. amantidine 100mg , tab. amisulpride 50 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , tab. apixaban 2.5 mg , tab. apixaban 5mg , tab. aripiprazole 10 mg , tab. aripiprazole 5 mg , tab. aspirinip 300 mg , tab. aspirin dispresible 325mg , tab. atomoxetin 10 mg , tab. atomoxetin 18 mg , tab. atomoxetin 25 mg , tab. atroxentine 250mg ( trientine hcl ) , tab. axitinib 5 mg , tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) , tab. bilastin 20 mg , tab. biotin 5 mg , tab. bosentan62.5 mg , tab. bosutinib 500 mg , tab. brivaracetam 50mg , tab. buprinorphine 2 mg , tab. calcium acetate 667 , tab. calcium folinate 15 mg , tab. capmatinib 200 mg ( monopoly ) , tab. carbimazole 10 mg , tab. carvedilol 3.125 mg , tab. cefixime + potassium clavulanate 200+125mg , tab. cefpodoxime 200mg , tab. cefpodoxime cv 375 , tab. cefpodoxime proxetil 100mg , tab. cefuroxime axetil500 mg. , tab. chlordiazepoxide 25 mg , tab. chlordiazsepoxide 10 mg + clidinium 25 mg , tab. chlorthalidone 6.25 mg , tab. cholchicine 0.5mg , tab. cilnidipine 20 mg , tab. cilnidipine 5 mg , tab. cilnidipine10 mg , tab. cilostazol 100mg , tab. cilostazol 50mg , tab. clarithromycin 250 mg , tab. clarithromycin 500mg , tab. clonazepam 0.25 , tab. clonazepam 1mg , tab. clonidine hydrochloride usp 0.1 mg ( each tablet contains clonidine hydrochloride usp 0.1 mg ) , tab. clozapine 100 mg , tab. clozapine 25 mg , tab. clozapine 50 mg , tab. coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , tab. cotriamazole 480mgs , tab. cyproheptadine 4mg , tab. cyproterone acetate 2 mg +ethynil estradiol. 035mg , tab. dabigatran 110 mg , tab. dabigatran 150 mg , tab. dabrafenib 50 mg , tab. dacomitinib 15 mg ( monopoly ) , tab. dacomitinib 30 mg ( monopoly ) , tab. dapagliflozin 10 mg , tab. dapoxetine 30 mg , tab. dapsone 100 mg , tab. deflazacort 12 mg , tab. deflazacort 6mg , tab. desvenlafaxine 50mg , tab. diclo & sera& para. , tab. diclofenac + thiocolchicoside , tab. dienogest 2mg , tab. diltiazemprolonged released90mg , tab. dimethyl fumarate 240mg , tab. dimethyl fumarate120 mg , tab. disulfiram 125 mg , tab. disulfiram 250mg , tab. donepezil 5 mg , tab. duloxetine gastro resistant 20 mg , tab. duloxitine gastro resistant30 mg , tab. dutasteride 0.5 mg , tab. dydrogesterone 10mg , tab. eltrombopag 25mg , tab. eltrombopag 50mg , tab. empagliflazone 10mg , tab. empagliflazone 25mg , tab. entacapone 200 mg , tab. entecavir ip 0.5 mg ( each film coated tablet conatinsentecavir ip 0.5 mg ) , tab. enzalupamide 40mg , tab. erlotinib 100mg , tab. erlotinib 150 mg , tab. esomeprazole 40 mg , tab. estradiolvalerate 2 mg , tab. ethynil estradiol 0.02mg+ tab desogestral 0.15mg , tab. etizolam 0.5 mg , tab. etoricoxib+thiocolchicoside ( 60+8 mg ) , tab. exemestane 25 mg , tab. faropenem sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , tab. febuxostat 40 mg , tab. febuxostat 80 mg , tab. fexofenadine120 mg , tab. fexofenadine180 mg , tab. fingolimod 0.5 mg , tab. fludrocortisone 100mcg , tab. flunarizine 10mg , tab. fluvoxamine 100 mg , tab. fluvoxamine 50 mg , tab. folinic acid 15mg , tab. formaline , tab. furosemide 20mg + spironolactone 50mg , tab. glucosamine hydrocloride + diacerin 50 mg , tab. hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , tab. hydrocortisone oromucosal 20 mg , tab. hydrocortisone oromucosal 5 mg , tab. hydrocortisone oromucosal10 mg , tab. ibrutinib 140mg , tab. indomethacin 75 mg sr , tab. inositol + myoinositol 1000mg , tab. ivabradine 5mg , tab. ivermectin 12mg , tab. ivermectin 6 mg + albendazole 400 mg , tab. ivermectin 6mg , tab. ketoconazole 200 mg , tab. ketorolac 10 mg , tab. lacosamide 50 mg , tab. lamotrigine dispersible 100mg , tab. lapatinib 500mg , tab. lenalidomide25mg , tab. lenalidomide 10 mg , tab. lenvatinib 10 mg , tab. lenvatinib 4 mg , tab. levetiracetamip 250 mg , tab. levodopa+carbidopa 125 , tab. levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , tab. levofloxacin 750 mg , tab. levofloxacin ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , tab. levosulpiride 25 mg ( each uncoated tablet containslevosulpiride 25 mg ) , tab. levosulpride 75mg , tab. levothyroxine sodium25 mcg , tab. levothyroxine sodium75 mcg , tab. linaglipitin 2.5mg , tab. linaglipitin 5mg , tab. lopinavir 200mg+ritonavir 50 mg , tab. loratadine 10 mg , tab. lorazepam ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , tab. lorlatinib 100 mg , tab. lorlatinib 25 mg , tab. megestrol acetate 160 mg , tab. melatonin 3 mg , tab. melphalan 2mg , tab. mesalamine usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , tab. methimazole10mg , tab. methimazole5 mg , tab. methotrexate 15mg , tab. methotrexate 7.5mg , tab. methylphenidate 10 mg , tab. methylprednisolone4mg , tab. methylprednisolone 16mg , tab. methylprednisolone 8mg , tab. metolazone 5mg , tab. meverberine 135 mg + chlordiazepoxide 10 mg , tab. midostaurin 25 mg ( monopoly ) , tab. mifepristone25mg , tab. mirabegeron50 mg , tab. mirabegeron 25 mg , tab. mirtazapine 15mg , tab. mirtazapine 7.5mg , tab. montelukast 10 mg , tab. montelukast 4mg , tab. montelukast 5 mg , tab. morphine10mg , tab. morphine30mg , tab. moxifloxacin400 mg , tab. moxonidine 0.2 mg , tab. mycophenolate sodium 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , tab. n acetylecystine effervescent form, orange flavour, 600 mg , tab. naltrexone50 mg , tab. nebivolol 10mg , tab. nebivolol 5mg , tab. nicorandil 5mg , tab. nicoumalone 1 mg , tab. nifidipine 20mg , tab. nifidipine 20mg sr , tab. nilotinib200 mg ( monopoly ) , tab. nilotinib 150 mg ( monopoly ) , tab. nilotinib 300mg ( monopoly ) , tab. nitazoxanide 500mg , tab. nitrazepam 10 mg , tab. nitrazepam 5mg , tab. olaparib 150 mg ( monopoly ) , tab. olaparib 50 mg ( monopoly ) , tab. olmesartan medoxomil 20 mg , tab. orciprenaline 10 mg , tab. osimertinib 80 mg ( monopoly ) , tab. oxazepam 15mg , tab. oxcarbazepine 300mg , tab. oxcarbazepine 450mg , tab. pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , tab. pantoprazole 20mg , tab. paracetomol 650 mg , tab. paroxetine 12.5mg , tab. paroxetine 25mg , tab. pazopanib 200mg , tab. pazopanib 400mg , tab. penicillin v 400mg , tab. pentoxifylline extended release / sr 400mg , tab. perampanel 2 mg , tab. perampanel 4mg , tab. pheniramine 25 mg , tab. phenozopyridine 200mg , tab. pirfenidone 200 mg , tab. pirfenidone 400 mg , tab. piroxicam dt 20mg , tab. pomalidomide 2 mg , tab. pomalidomide 4 mg , tab. posacozazole 100mg , tab. prasugrel 10mg tab , tab. prazosin 5mg , tab. prednisoloneip 40mg , tab. primidone 250 mg , tab. primidone 50 mg , tab. prochlorperazine 5mg , tab. progesterone only pills , tab. propranolol 10mg , tab. propranolol 40 mg sr , tab. propylthiouracil 100 mg , tab. pyridoxine100 mg , tab. ranolazine 500mg , tab. rasagiline1mg , tab. regorafenib 40 mg , tab. repaglinamide 0.5mg , tab. repaglinamide 1mg , tab. ribociclib 200 mg ( monopoly ) , tab. rifampicin 150 mg , tab. rifampicin 450 mg , tab. rifampicin 600 mg , tab. rifaximin 200 , tab. rifaximin 550mg , tab. rivaroxaban 10mg , tab. rivaroxaban 15mg , tab. rivaroxaban 20mg , tab. rizatriptan 10mg , tab. ropinirole 0.25mg , tab. rosuvastatin 10mg + fenofibrate 160mg , tab. ruxolitinib 10 mg , tab. ruxolitinib 15 mg , tab. ruxolitinib 20 mg , tab. ruxolitinib 5 mg , tab. sacubitril 24 mg and valsartan 26 mg , tab. selegiline 5mg , tab. serratiopeptidase 10mg , tab. serratiopeptidase 20 mg , tab. sevelamer carbonate 800 mg , tab. sildenafil 20 mg , tab. sildosin + dutasteride , tab. silymarin 70mg. , tab. sitagliptine + metformin ( 50 / 500 ) , tab. sofosbuvir 400 mg+ velpatasvir 100 mg , tab. solifenacin succinate10 mg , tab. sorafenib 200 mg , tab. sotalol hydrochloride usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , tab. sultamicin 375 mg , tab. sunitinib 12.5 mg , tab. sunitinib 25 mg , tab. sunitinib 50 mg , tab. tacrolimus 1mg , tab. tamsulosin + dutasteride , tab. tapentadol50mg , tab. tegafur + uracil 100 mg , tab. tenofovir 300mg , tab. terbinafine hydrochloride 250 mg , tab. tetrabenazine 25mg , tab. ticagrelor 90mg , tab. tofacitinib 5 mg , tab. tolvapatan 15mg , tab. topiramate50mg , tab. torsemide20mg , tab. tramadol 37.5mg + paracetamol 325mg , tab. trimetazidine 35mg , tab. trimetazidine 60mg , tab. trypsin + rutoside+bromelain , tab. trypsin chymotripsin , tab. ulipristal 5mg , tab. valganciclovir 450 mg , tab. verapamil hydrochloride sustained release 120 , tab. verapamil hydrochloride sustained release 40 , tab. vildagliptin 50mg , tab. voglibose 0.2 mg tab , tab. voglibose 0.3 mg tab , tab. voriconazole 200 mg , tab. warfarin 1mg , tab. warfarin 2mg , tab. warfarin 3mg , tab. zinc 50mg , tab. zolpidem 10mg , tab. zolpidem 5 mg , tab. zonisamide 100 mg , tab. zonisamide 50mg , tab. / cap everolimus 10mg , tab. / cap everolimus 5mg , tab. / cap hydroxyurea 500mg , tab. / cap tacrolimus 0.25 , tab. / capnintedanib 150mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , tab.phenazopyridine 5 mg , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , tamoxifen tablet 10 mg , tamsulosinhcltablet 0.4 mg , telmisartan tablet ip 40 mg , tenaligliptin tablet 20 mg , terbutaline sulphate tablet ip 2.5 mg , tetanus immunoglobulin 250iu , tetanus vaccine ( adsorbed ) ip , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet ( sr ) 400 mg , thiamine tablet 100 mg , thiopentone injection 0.5 g , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , timolol eye drops 0.50% , tinidazole tablet ip 300 mg ( film coated ) , tinidazole tablet ip 500 mg ( film coated ) , tiotropium 9mcg inhaler , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , torsemide injection10 mg / ml , torsemide tablet 10 mg , tramadol capsule 50 mg , tramadol injection 50 mg / ml , tranexamic acid tablet 500 mg , travoprost ophthalmic solution 0.004% , tretenoin cream 0.03% , trifluperazine tablets ip5 mg , trihexyphenidyl hydrochloride tablet 2 mg , tropicamide eye drops 1% , urokinase injection 5 lac unit , ursodeoxycholic acid tablet 300 mg , v moxonidine 0.3 mg , valethamate bromide injection 8 mg / ml , vancomycin for intravenous infusion ip 1 gm , vancomycin injection 500 mg , vdrl antigen ( with +ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4 mg ( freeze dried ) , verapamil tablets ip 40 mg , vinblastineinjection 10 mg / 10 ml , vincristineinjection 1 mg / ml , vitamin a solution 1 lac iu / ml , vitamin b complex injectionnfi , vitamin b complex tablet nfi ( prophylactic ) , vitamin d3 oral solution 60000 iu , vitamin k injection10 mg / ml , vitamin k 1 ( phytomenadione ) 1 mg / 0.5ml injection , warfarin sod. tablet 5 mg , water for injection ip , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , xylocaine lubricating30gm , xylometazolinenasal drops 0.1% , zinc oxide +alo vera +semethicone , zinc sulphate dispersible ip elemental tablet 10 mg , category : surgicals , absorbable gelatin sponge ip 66, size 80 ( + 10 ) mm x 50 mm x 10 mm should be sterlized. , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824 ( part 3 ) :1996 , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered, , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic •shouldconform to is 13422 •isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards , suction catheter, sterile. size: fg 5 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 6 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 8 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 10 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 12 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 14 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 16 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 18 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 20 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 22 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size 8 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is 11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size10 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size16 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size18 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size20 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size22 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 •color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage ( foley balloon catheter ) , 2 way, size 24 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b, c, d, e, f, g should be mentioned as per is11497 for particular size , infant feeding tube size:10fg length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:8fg, length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:5fg length 50 cm ( min. ) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , sterile disposable perfusion set with airway and needle ( adult use ) • for gravity feed only • sharp and easy piercing spike with air vent • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • self sealing latex bulb which will also act as an port for extra medication • efficient roller clamp to control and adjust the fluid rate • 21 g needle • should conform to is 12655 4 standard , sterile disposable perfusion set ( infusion set ) with airway and needle ( paediatric use ) • burette type measured volume chamber of 100 ml • drop size of approx 60 drops per ml • injection port, latexfree, for intermittent medication. • floating auto shut off valve ( latex free ) in burette. • soft and kink resistant pvc tubing. • roller controller for flow control • tube length 150 cm • 23g needle • should conform to iso 8536 5 , sterile disposable infusion set with microdrip ( i.v. ) • microdrip infusion set with drop size reduced to approx 60 drops per ml • sharp and easy piercing spike • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the fluid rate • should conform to is 12655 4 standard , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conform to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 16g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable ( single use teflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port.size 24g • suitable for paediatric & neonatal use • should be packed in transparent, single blister pack. • should conform to is 10555 standard , mucus extractor sterile • clear transparent container • antibacterial filter • soft, kink resistant pvc tubing • tube size 10 fg; length 40 cm ( min. ) • capacity 25 ml , nasal oxygen cannula ( set ) , twin bore ( accessory for compressed air breathing ) all sizes ( adult ) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , nasal oxygen cannula ( set ) , twin bore ( accessory for compressed air breathing ) all sizes ( pediatrics ) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , paper adhesive plaster 1 x 9.0 mts ( with cutter ) non woven adhesive tape, hypoallergic, should have some stretch bonding , paper adhesive plaster 2 x 9.0 mts ( with cutter ) non woven adhesive tape hypoallergic, should have some stretch bonding , paper adhesive plaster 3 x 9.0 mts ( with cutter ) non woven adhesive tape hypoallergic, should have some stretch bonding , plaster of paris bandages15cm x 2.7mts / roll should conform to schedulef ( ii ) of drug and cosmetic act 1940 , plaster of paris bandages 10cm x 2.7mts / roll should conform to schedulef ( ii ) of drug and cosmetic act 1940 , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:10 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:12 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:14 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:16 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube ( p.v.c. ) with radio opaque lining. size:18 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , scalp vein set ( disposable ) :size 18g •butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritanttube • sterile , scalp vein set ( disposable ) :size 20g • butterfly shaped wings for easy handling and attachment with skin. colour coded •needle should be bevelled, siliconised and should ensure atraumatic cannulation •female luer fitting at one end •soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set ( disposable ) :size 22g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set ( disposable ) :size 24g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , sterile hypodermic syringe with needle attached, 24g, single use 2 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container , sterile hypodermic syringe with needle attached, 24g, single use 5 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 10 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 20 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , surgical blade sterile, size 11 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 15 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 22 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , suture needles curved 1 / 2 circle round body assorted size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1 / 2 circle round body assorted size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle cutting size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1 / 2 circle size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , sterile disposable spinal needle for single use 22g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , sterile disposable spinal needle for single use 25g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , urine collecting bag, disposable 2000 ml • transparent sheet • kink resistant flexible tubing not less than 90 cm in length • should have non return valve • top drainage outlet • graduated bag • moulded handle for easy handling , double j stent, sterile, both ends open size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, both ends open, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , endotracheal tube, plain size 2.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain with radio opaque line, sterile, single use size 6mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 6.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, cuffed size 4mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 4.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 9 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , tracheostomy tube ( pvc ) , plain, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line , tracheostomy tube ( pvc ) , cuffed, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line • balloon with non return valve , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 24 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 28 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 32 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , corrugateddrainage sheet, sterile, multichannel, with radio opaque line, single use all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.5 cmx 15 cm soft to feel fast edges, slightly stretchbonding. , polypropylene nonabsorbable synthetic surgical mesh 15 cmx 15 cm soft to feel fast edges, slightly stretchbonding. , sterilised umbilical cotton tape width 3 mm, length 75 cm should conform to schedulef ( iii ) of drug and cosmetic act 1940 , bone wax sterilised , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; straightcutting60 mm , breakaway , skin graft knife blade ( sterile ) ( disposable ) skin grafting knife blade ( sterile ) made of carbon steel or stainless steel material 158 mm long individually wrapped in wrapper corrosion inhibitor paper in single packet, .in packs of 10. the edge must be sharp enough to cut the skin in a single shave and should snugly fit in the handle should conform to is 3759. 2. skin grafting knife handle ( watson modification of humby’s knife ) stainless steel, ce certified, in which the blade specified in ( a ) above should fit snugly. should conform to 7980 1976. , k wire, length 375 mm; 1mm length of wire should be mentioned with specification. should conformto is 8261 , k wire, length 375 mm;1.6mm • length of wire should be mentioned with specification. • should conformto is 8261 , k wire, length 375 mm; size 1.8mm • length of wire should be mentioned with specification. •should conformto is 8261 , face mask, disposable • should be manufactured from non woven poly prop fabric • should be 3 ply construction • should have high bacterial filtration efficiency • should be heat sealed to keep 3 layers together • standard size 17.5 x9 cm • color green / blue • there should be a string each at all four corners, length of string should be 40cm • nose clip should be there •no elastic band. , surgical cap, disposable ( for surgeons ) • should be manufactured from non woven fabric. • strip for tying the cap stitched on the back for proper grip on the forhead. • green colour • ultrasonically stitched • air permeable / breathable • should retain skin and hair particle. • strip for tying the cap , surgical cap, disposable ( for nurses ) • should be manufactured from non wovenfabric • blue / green colour • round upon wearing, with elastic •air permeable / breathable •should retain skin and hair particles , foldable intra ocular lense with injector ( size + 11 d to +17.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics ( 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 18 d to + 24 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , foldable intra ocular lense with injector ( size + 24.5 d to + 28.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic ( hydrophobic ) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic / plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 24.5 d to + 28.5 d at 0.5 d step. 9.supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 11 d to +17.5 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 18 d to + 24 d ) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , standard pmma intra ocular lenses ( size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce / us fda certified. , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowdered, without tear, properly folded in a paper • should conform to is 13422 • isi marked / ce certified / fda approved • colour code marking to designate size , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowder free, without tear, properly folded in a paper • should conform to is 13422 • isi marked / ce certified / fda approved • colour code marking to designate size , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small. should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large should conform to is 15354 , pressure monitoring line / high pressure extension line • suitable for high pressure monitoring and for connection between syringe infusion pump and patient • male luer lock at one end and female luer lock at other end ; should fit all standard equipment. luer lock connectors should provide secure fitting. • pressure upto 800 psi • length 200 cm • sterile , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml • should have suitability for both male and female patients • should be provided withadhesive for fixation and good grip with minimal risk of allergy and injury • capacity 100 ml • sterile , umbilical catheter ( for new born ) all sizes • radio opaque line • with female flexible mount • colour coded connector • open tip should be soft, rounded, atraumatic • length 40 cm , umbilical cord clamp • suitable for clamping umbilical cord of new born • security lock to prevent accidental opening after clamping • grooved clamping area , absorbable oxidizedregenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure ( closed wound suction unit ) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 16 fg , close wound drainage device under negative pressure ( closed wound suction unit ) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter18 fg , t – tube for common bile duct drainage • kehr’s t tube made from medical grade pvc, and siliconized • smooth, kink resistant • radio opaque line throughout the length • sterile • length 20 x 60 cm • size 10 to 18 fg , bone cement with antibiotics, fast and slow setting , sanitary napkin, beltless 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp / wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc. 3. back strip – a back strip for sticking the sanitary napkin onto the underwear should be there using good quality adhesive material. 4. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm ) absorbent section total pad length 210 +_ 10 230 +_ 10 width60 to 75 70 to 85 thickness8 +_ 2 5. weight : not more than 10 gm . . instructionfor usage should be mentioned on every packet , sanitary napkin, belttype 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp / wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc 3. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm ) absorbent section pad length220 +_ 10 width 70 +_ 5 thickness17 +_ 3 4.weight : 12 +_ 3 gm 5.pack – six napkins in a pack. 6.elastic belt with loops shall be provided in each pack. 7.absorbency: the napkin should be able to absorb not less than 30 ml of normal saline or coloured water or test fluid when poured on to the centre of the napkin at the rate of 15 ml per minute. .instruction for usage should be mentioned on every packet. , belt less sanitary napkin with wings 1. covering ( absorbing top sheet corrector ) –good quality knitted sleeve or non woven fabric of rash free, non irritant and soft to touch material which has sufficient porosity to permit the assembled napkin to meet absorbency requirements.the napkins shall have a non absorbent barrier on one side with adhesive covered by a differently identifiablepaper 2.overall length ( mm ) 230 ± 5 3.core length 220 mm± 10 4.fluff core / padlength220 mm± 10 5. over all width with wings160mm+_5 6.fluff core / padlength70 mm± 5 7.thickness of a single pad9 10mm 8.weight of a single pad : 8 10 gm 9.packsix napkins in a pack. 10type. belt less sanitary napkin withwings 11.minimum absorbency:50ml 12.ph value of absorbent material6 8.5 b. disposable individual pouch or wrapper for each sanitary napkin ( as per ministry of environment, forest and climate change dated 08.04.2016 ) pouch / wrapper specifications : 1. pouch / wrapper should be of the size of sanitary napkin being supplied. 2. it should have adhesive to seal the sanitary napkins within. 3. pouch / wrapper should not be transparent. note : instructions for use of disposable pouch / wrapper mst be written in hindi on disposable pouch / wrapper. blrseky fd;s gq;s lsusvjh usifdu dks eksm dj disposable pouch / wrapper esa mkys , oa disposable pouch / wrapper dks xksan yxh iv~vh ls cun dj lqjf { kr rjhds ls dwmsnku esa mkysaa , oxygen mask ( adult ) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. , oxygen mask ( paediatric ) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc materialwith comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. • mask connector 4m , sterile catheter, single use, for urinary drainage ( foley baloon catheter ) , 2 way, size 14 • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for a traumatic intubation • symmetrical foley balloon • balloon capacity 30+ 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and ballon capacity should be mentioned as per is 11497 • specification for b, c, d, e, f, g should be mentioned as per is 11497 , nelaton catheter size 14 fg distal end is close and proximal end has female colour code connector • soft, kink resistant medical grade pvc tube • length:40 cm • individually packed in poly and sterile , ecg electrode •reliable trace, •high conductivity, • easy to handle , surgical blade sterile, size 23 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction duringmovement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , urethral catheter90 ( fg 14 ) , made up of medical grade pvc , urethral catheter91 ( fg 10 ) , made up of medical grade pvc , vaccum suction set, 2.5 meter length, •suction handle with suctiontube •sterile, • pyrogenic free, •latex free, • single use , epidural minipack 18g, 90 mm, metal stylet for single use only, •sterile, •epidural catheter 20g, l 90 cm, •6 lateral holes closedend, •borst adapter •epidural catheter flat filter 0.2 micro meter •thread assist guide•lor ( loss of resistance ) plastic syringe 6 ml , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no.22double lumen size 30 cm ( longline iv. ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv. ) , vascular catheter with metal guide no.18 double lumen size 45 cm ( longline iv. ) , vascular catheter with metal guide no.20 double lumen size45 cm ( longline iv. ) , vascular catheter with metal guide no. 22 double lumen size 45cm ( longline iv. ) , 3 waystop cock , non pyrogenic & single use, should be leak proof, with smooth movements , 3 waystop cock with extension tube ( vein o line ) size 10cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 50cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 100cm ( non pyrogenic & single use ) , 3 waystop cock with extension tube ( vein o line ) size 150 cm ( non pyrogenic & single use ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) • graduated bag, • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp1m x 10cm adhesive material should have good quality sticking property, non allergic , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g · should be packed in transparent single blister pack · should confirm to is 10555 standard · ( neonatal iv cannula size 26 ) , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained , niv mask ( noninvasive ventilation mask ) paediatric · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads in small size. · should be with ergonomically designed clips / straps for easy disengagement of the head gear · should be single use with bronchoscopy and co2 &o2 port with chin support · non allergic, leak proof, contour should be maintained , nebulization mask adult , nebulization mask paediatric , chemotherapy port &non coring needles ( adult ) · valved catheter need only saline flush, catheter with intermediate size port with small septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 8fr with silicon material with peel apart percutaneous introducer system. · chemo port huber needle 20g and 22g. , chemotherapy port &non coring needles ( pediatric ) · valved catheter need only saline flush, catheter with intermediate size power port with large septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 6fr with silicon material with peel apart percutaneous introducer system · .chemo port huber needle 20g and 22g. , category : suture , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 3 / 8 cir rb needle 40mm length 76 cm ) 1 / 0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet ( 1 / 2 circle rb 30mm needle, length70cm ) 1 / 0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet ( 1 / 2 circle rb 31mm needle, length70cm ) 2 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 30mm, suture length 90 cm / 2 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 3 / 8circle r cutting, ps 1, 24mm, suture length 70 cm 3 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 1 / 2circle ctroundbodied40mm, gsneedle, suture length 90 cm 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acidviolet ) 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm / , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoatedpolyglactin / polyglycolic acidviolet ) 1 / 2 circle ctroundbodied40mm, gsneedle, suture length 90 cm / 1 / 0 , absorbablesurgicalsuture ( synthetic ) antibacterial coatedsterilisedneedledsuture ( braidedcoated polyglactin / polyglycolic acid violet ) 1 / 2 circle round bodied 20mm, suture length 70 cm 3 / 0 , absorbablesurgical suturespolyglecaprone / polyglyconate, monofilament sutures ( 3 / 8 circle cutting24 26mm needle, suture length of 70 90cm ) 3 / 0 , absorbable surgicalsuturesmonofilament sutures polyglecaprone / polyglyconate ( l / 2 circle cutting 16mm needle, suture length 70cm ) 4 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 3 / 8 rb needle 30mm length 76 cm ) 2 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) 1 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 40mm length 76 cm ) 1 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir cutting needle 8mm, length 35 cm ) 6 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 16mm, length 76 cm ) 5 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 19mm length 76 cm ) , absorbable surgical suture ( sterile catgut ) , needled suture chromic ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 4 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) 1 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 20mm length 76 cm ) 3 / 0 , absorbable surgical suture ( sterile catgut ) , bp / usp needled suture chromic ( l / 2 cir rb needle 30mm length 76 cm ) 2 / 0 , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanoneviolet ( 1 / 2 circle reverse cutting 40 50 mm length 70 90cm ) 1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm 2 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 20mm length 70 cm ) 4 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle 30mm length 90 cm 2 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir conventional 25mm length 90 cm ) undyed3 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ( 1 / 2 cir rb needle 40mm length 90 cm ) 1 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle 20mm length 70 cm 3 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) ½ cir rb needle40mm length 90 cm1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle 30mm length75 90 cm1 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir tapercut needle ( heavy ) 35 40mm length 75 90 cm 1 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 3 / 8 circle cutting 16mm needle, suture length70cm 4 / 0 , absorbable surgical suture ( synthetic ) sterilised surgical needled suture ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 3 / 8 circle cutting needle 22mm length 45 cm3 / 0 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures ( 1 / 2 circle oval rbneedle 26mm needle, suture length of 70cm ) 2 / 0 , absorbable surgical suturespolyglecaprone / polyglyconate, monofilament sutures ( l / 2 circle oval rbcontrast needle 26mm, suture length 70cm ) 3 / 0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided ( green / blue ) *with 1 / 2 circle taper cut , 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 2 / 0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided ( green / blue ) 1 / 2 circle taper cut , 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm2 / 0 , non absorbable surgical suture, , sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 8 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitecoated polyster braided ( green / blue ) with 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided green / blue ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided white ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 1 / 2 cir rb needle 20mm, length 76 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturebraided coated polyster, green / white or blue / whitepolybutylate / silicon coated polyster braided green / blue ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 30mm length 90 cm ) 1 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut double needle 17mm length 70 90 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb13 mm needle, length 75cm ) double arm 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb heavy needle 40 45mm length 75 90 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 16 mm length 70 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir rb needle 30mm, length 90 cm ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut double needle cutting size 16 17mm length 70 90 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle tapercut 13mm double needle 70cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir cutting needle 25mm length 45 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 70 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( 3 / 8cir rb 16mm needle, length 90 cm ) 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue ( l / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue usp ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 6 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cirr cutting needle 40 45mm length 60 70 cm. ) 2 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 conventional cutting needle 16 mm length 70 cm ) 3 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 10 / 0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk ( 3 / 8 cir rb needle 16mm, length 76 cm ) 5 / 0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk ( 3 / 8 cir rb needle 20mm, length 76 cm ) 4 / 0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black ( nylon ) ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 8 / 0 , non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue ( 3 / 8cir rb double 8mm needle, length 60 cm ) 7 / 0...

Jhalawar Medical College and SRG Hospital - Rajasthan

33337326 rate contract for drug medicine items at srg hospital jhalawar rate contract for drug medicine 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 3 bupivacaine inj ip 0.5% 4 drotaverine hydrochloride inj 40 mg/2 ml 5 halothane bp 6 isoflurane usp 7 ketamine inj ip 50 mg/ml 8 lignocaine ointment 5% 9 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 10 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 11 lignocaine gel ip 2% 12 lignocaine inj ip 2 % 13 propofol inj ip 10 mg/ml 14 thiopentone inj ip 0.5 g 15 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 16 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 17 fentanyl citrate injection ip 2 ml 18 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 19 ibuprofen tab ip 200 mg (coated) 20 ibuprofen tab ip 400 mg (coated) 21 morphine sulphate inj ip 10mg/ml 22 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg 23 paracetamol syrup ip 125 mg/5ml (detail in rc) 24 paracetamol tab ip 500 mg 25 paracetamol inj. 150 mg/ml 26 pentazocine inj ip 30mg/ml (im/iv use) 27 tramadol cap ip 50 mg 28 tramadol inj 50 mg/ml 29 adrenaline injectiori ip img/ml im/iv use 30 betamethasone tab ip 0.5mg 31 chlorpheniramine maleate tab ip 4mg 32 dexamethasone inj ip 8mg/2ml 33 dexamethasone tab ip 0.5 mg 34 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 35 hydroxyzine tab ip 25 mg 36 methyl prednisolone sodium succinate for injection usp 500 mg 37 pheniramine inj ip 22.75mg /ml 38 prednisolone tab ip 5 mg 39 promethazine syrup ip 5 mg/5ml 40 promethazine inj ip 25mg/ml 41 promethazine tab ip 25 mg 42 naloxone inj ip 0.4mg/ ml 43 pralidoxime chloride injection ip 25 mg/ml / 500 mg 44 carbamazepine tab ip 200 mg 45 carbamazepine tab ip 100 mg 46 phenobarbitone tab ip 30 mg 47 phenytoin injection bp 50mg/ml 48 phenytoin oral suspension ip 25mg/ml 49 phenytoin tab ip 100 mg (film coated) 50 sodium valproate inj 100 mg/ ml 51 sodium valproate gastro resistant tablets ip 200 mg 52 acyclovir oral suspension ip 400mg/5ml 53 acyclovir tab ip 200 mg 54 acyclovir tab ip 800 mg 55 albendazole oral suspension ip 400 mg/10ml 56 amikacin inj ip 100 mg 57 amikacin inj ip 500 mg 58 amoxycillin and cloxaciiiin cap 250 + 250 mg 59 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 60 amoxycillin cap ip 250mg 61 amoxycillin cap ip 500mg 62 amoxycillin dispersible tablets ip 125 mg 63 amphotericin b inj ip 50 mg 64 ampicillin injection ip 500 mg 65 benzathine benzytpenicillin inj ip 12 lac units 66 benzathine benzylpenicillin inj ip 6 lac units 67 cefixime tab ip 100 mg 68 cefixime tab ip 200 mg 69 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone lgm and sulbactum sodium eq. to sulbactum 0.5gm)(lm/lv use) 70 cefotaxime injection ip 1g. 71 cefotaxime inj ip 250 mg. 72 ceftazidime inj ip 1g. 73 ceftazidime inj ip 250 mg 74 ceftazidime inj ip 500 mg 75 ceftriaxone inj ip lg /vial 76 ceftriaxone inj ip 250 mg/vial 77 ceftriaxone inj ip 500mg/vial 78 cephalexin cap ip 250 mg 79 cephalexin cap ip 500 mg 80 chloroquine phosphate inj ip 40 mg/ ml 81 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 82 ciprofloxacin injection ip 200mg/100ml 83 ciprofloxacin tablets ip 250 mg film coated 84 ciprofloxacin tablet ip 500 mg film coated 85 clotrimazole cream ip 2% w/w 86 clotrimazole vaginal tab ip 500mg 87 compound benzoic acid ointment ip benzoic acid 6% + salicylic acid 3% 88 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 89 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 90 diethyicarbamazine tab ip 100 mg 91 doxycyciine cap ip 100 mg 92 gentamycin injection ip 80mg/2ml (1m/ iv use) 93 griseofuivin tab ip 125 mg 94 ltraconazole cap 100 mg 95 meropenem inj ip 500 mg 96 metronidazole inj ip 500 mg/100ml 97 metronidazole benzoate oral suspension ip 100 mg of base/ 5ml 98 metronidazole tablet ip 200 mg (film coated) 99 metronidazole tablets p 400 mg (film coated) 100 norfloxacin tab ip 400mg film coated 101 ofloxacin tab ip 200 mg 102 primaquine tab ip 2.5 mg 103 primaquine tab ip 7.5 mg 104 quinine dihydrochloride inj ip 300 mg/ml 105 quinine sulphate tablets ip 300 mg (film coated) 106 azathioprine tab ip 50 mg 107 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 108 chlorambucil tab ip 5 mg 109 cisplatin inj ip 50 mg/ 50 ml 110 cyclophosphamide inj ip 200 mg 111 cyclophosphamide inj ip 500 mg 112 cytarabine injection bp 500mg 113 danazol cap ip 5.0 mg 114 daunorubicin inj ip 20mg. 115 doxorubicin inj ip 50 mg/ 25ml . 116 etoposide inj ep 100 mg 117 flunarizine tab 5mg 118 fluorouracil inj ip 250 mg/ 5ml 119 l asparaginase inj 10000 iu 120 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 121 melphalan tab ip 5 mg 122 mercaptopurine tab ip 50 mg 123 methotrexate inj ip 50 mg/ 2 ml 124 methotrexate tab ip 2.5 mg 125 paclitaxel inj ip 260 mg 126 paclitaxel inj ip 100 mg 127 tamoxifen täb ip 10 mg 128 vinblastine inj ip 10mg/ 10ml 129 vincristine inj ip img(vial)/vincristin injection usp img/ml (amp) 130 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 131 levodopa and carbidopa tab 250 mg+ 25 mg 132 trihexyphenidyl hci tab ip 2 mg 133 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 134 deferasirox tab 100 mg 135 deferasirox tab 500 mg 136 deferiprone cap 250 mg 137 deferiprone cap 500 mg 138 desferrioxamine injection ip 500 mg / vial (for t.m. inj and i.v s.c. infusion) 139 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 lu/ vial (iv use) 140 enoxaparin sodium inj ip 60 mg 141 ethamsylate inj 250 mg/ 2ml (im/iv) 142 heparin sodium inj ip 5000 iu/ml (im/iv use) 143 human albumin solution ip 20% 144 rh erythropoetin inj ip 10000 iu 145 rh erythropoetin inj ip 2000 iu 146 rh erythropoetin inj 4000 iu 147 vitamin k injection each ml contains menadione sodium bisulphite equivalent to 5.2 mg of menadione. (aqueous solution) 148 amiodarone tab ip 100 mg 149 amiodarone tab ip 200 mg 150 amiodarone hydrochloride inj 50 mg/ml 151 amlodipine tab ip 2.5 mg 152 amlodipine tablets ip 5 mg 153 atenolol tab ip 50 mg 154 atorvastatin tab ip 10mg 155 clopidogrel tab ip 75 mg 156 digoxin inj ip 0.25 mg/ml 157 digoxin tab ip 0.25 mg. 158 diltiazem tabs ip 30 mg film coated 159 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 160 dopamine hydrochloride inj ip 40 mg/ml 161 enalapril maleate tab ip 5mg 162 enalapril maleate tab ip 2.5mg 163 isosorbide dinitrate tab ip 5 mg 164 isosorbide mononitrate tabs ip 20 mg 165 lisinoprii tab ip 5 mg 166 losartan tab ip 50 mg 167 magnesium sulphate inj. ip 500mg/ml (50%w/v) 168 methyldopa tab ip 250mg film coated 169 nifedipine cap ip 5mg 170 nifedipine tablets ip 10 mg (sustained release) 171 nitroglycerin inj 5 mg/ ml 172 propranolol tab ip 40 mg 173 streptokinase injection 15 lac units ip 174 verapamil tab ip 40 mg film coated 175 acyclovir cream 5% 176 glycerin ip 400 gm 177 liquid paraffin ip 400 ml 178 ointment containing lidocaine ip 3% zinc oxide ip 5 % , hydrocortisone ip 0.25%, allantoin ip 0.5% 179 miconazole nitrate cream ip 2% 180 povidone iodine ointment 5% 15 gm 181 povidone iodine solution ip 5% 500 ml 182 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 183 silver sulphadiazine cream ip 1% 50gm tube 184 anti a blood grouping serum ip(anti a monoclonal serum) 185 anti b blood grouping serum ip(anti b mono clonal serum) 186 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 187 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 188 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 189 gadodiamide inj. 0.5mrnl/ml vial 190 tropicamide eye drop ip 1% 191 vdrl antigen (with + ve and ve control) / rpr slide kit 192 compound benzoin tincture ip 193 formaldehyde solution (34.5 per. 38 per.) 194 gentian violet topical solution usp 1% 195 gluteraldehyde solution 2% 196 hydrogen peroxide solution ip 6% (20 vol) 197 lysol (cresol with soap solution) ip (cresol 50 %+ soap 50 %) 198 povidone iodine scrub solution / cleansing solution 7.5 0/0 w/v povidone iodine (suitable for hand wash) 199 surgical spirit ip (500 ml) 200 acetazolamide tab ip 250mg 201 frusemide tab ip 40 mg 202 furosemide injection ip 10mg/ml (1m and iv use) 203 hydrochlorthiazide tab (p 12.5 mg 204 spironofactone tab ip 25mg 205 torsemide tab 10 ip mg 206 bisacodyl tab ip 5 mg 207 dicyclomine tab ip 10 mg 208 dicyclomine inj ip 10 mg/ml 209 dicyclomine hydrochloride oral solution ip 10mg /5m) 210 domperidone suspension ip 5mg/5ml 211 domperidone tab ip 10 mg 212 hyoscine butylbromide inj ip 20 mg/ml 213 loperamide tab ip 2mg 214 metoclopramide inj ip 10mg/2ml 215 metoclopramide tab ip 10 mg 216 omeprazole cap ip 20 mg 217 oddansetron inj ip 2mg/ml 218 ors powder 219 pentoprazole inj 40 mg 220 ranitidine hcl injection ip 50mg/2ml 221 ranitidine tab ip 150mg film coated 222 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 % disodium hydrogen phosphate dodecahydrate 8% 223 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 224 carbimazole tab. ip 5 mg (film coated) [280] 225 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml [2811 226 clomifene tab ip 25 mg [282] 227 clomiphene tab ip 50 mg [283) 228 conjugated estrogen tab. usp 0.625 mg. 229 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 230 ethinyloestradiol tabs ip 50 mcg 231 glibenclamide tab ip 5 mg 232 gliclazide tab ip 40 mg 233 glimepiride tab ip 2 mg 234 glimepiride tab ip 1mg 235 glipizide tab ip 5mg 236 hydroxyprogesterone inj ip 250mg /ml 237 isophane insulin inj ip 40 iu /ml 238 metformin tab ip 500 mg(fiim coated) 239 norethisterone tab ip 5mg 240 pioglitazone tab ip 15mg 241 progesterone inj 200 mg/2ml 242 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 243 thyroxine sodium tablets ip 100mcg 244 human anti d immunoglobulin injection 300mcg (1m use) 245 human anti d immunoglobulin 150 mcg 246 human rabies immunoglobulin inj 150 iu/ ml 247 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 248 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 249 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.l ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 250 tetanus immunoglobulin ip 250 iu/ vial 251 tetanus vaccine (adsorbed) ip 5 ml vial 252 atracurium inj 10 mg/ml 253 glycopyrrolate inj ip 0.2 mg/ml 254 midazolam inj ip 1 mg/ml 255 neostigmine inj ip 0.5 mg/ml 256 neostigmine tab p 15 mg 257 succinylcholine inj. ip 50 mg/ml (iv use) 258 valethamate bromide inj 8mg / ml 259 atropine eye ointment ip 1% 260 atropine sulphate ophthalmic solution usp 1% 261 chloramphenicol eye drops ip 0.5% 262 ciprofloxacin eye drops ip 0.3% w/v 263 ciprofloxacin ophthalmic ointment usp 0.3% 264 hydroxypropylmethyl cellulose solution 20 mg/ml 265 tobramycin and dexamethasone ophthalmic suspension usp 0.3% + 0.1% 266 tobramycin eye drops 0.3% 267 tobramycin ophthalmic ointment usp 0.3% 268 isoxsuprine inj ip 5 mg/ml 269 isoxsuprine tab ip 20 mg 270 methylergometrine inj ip 0.2 mg/ml 271 methylergometrine tab ip 0.125 mg 272 misoprostol tab ip 200 mcg 273 oxytocin inj ip 5 iu/ml 274 alprazolam tab p 0.25 mg 275 alprazolam tab ip 0.5mg 276 amitriptyline tab ip 25mg film coated 277 chlordiazepoxide tablets ip 10mg 278 chlorpromazine tablets ip 100 mg (coated tablet) 279 chlorpromazine tablets ip 25 mg (sugar coated) 280 chlorpromazine tablets ip 50 mg (coated tablets) 281 chlorpromazine inj. (p 25mg/ml 282 diazepam inj ip 10mg/2ml (1m/lv use) 283 diazepam tab ip 5 mg 284 escitalopram tab ip 10 mg 285 fluoxetine cap ip 20 mg 286 haloperidol inj ip 5 mg/ml 287 haloperidol tab ip 1.5 mg 288 haloperidol tab ip 5 mg 289 imipramine tab ip 25 mg (coated tab) 290 imipramine tab ip 75 mg (coated) 291 lithium carbonate tab ip 300 mg 292 lorazepam inj ip 2 mg/ml 293 olanzapine tab ip 5 mg 294 risperidone tab 2mg 295 risperidone tab 1mg 296 sertraline tab 50 mg 297 trifluperazine tab ip 5 mg coated 298 aminophylline inj ip 25 mg/ml 299 beclomethasone inhalation ip 200 mcg/dose 300 budesonide nebulizer suspension 0.25mg/ml 301 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 302 ipratropium bromide nebulizer solution 250 mcg/ ml 303 salbutamol tablet ip 4 mg 304 salbutamol inhalation 100 mcg /dose 305 salbutamol nebuliser solution bp 5 mg/ml 306 salbutamol tab ip 2 mg 307 theophyltine and etofyuine injection (anhydrous theophylline 50,6mg + etofyiiine 169.4 mg) 308 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 309 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 310 compound sodium lactate inj. ip 311 dextrose inj 25% w/v 312 dextrose inj 10% 313 dextrose inj ip 5% 314 multiple electrolytes and dextrose injection type ip (electro)yte p injection ) 315 multiple electrolytes and dextrose injection type ill ip electroylte m injection (i.v.) 316 potassium chloride inj. 0.15 gm/ml 317 potassium chloride oral solution u.s.p 500mg/ 5m) 318 sodium chloride and dextrose injection ip 0.9 % + 5 % 319 sodium chloride inj ip 500 ml 320 ascorbic acid tab ip 500 mg 321 calcium gluconate inj ip 10% (iv use) 322 ferrous sulphate with folic acid tab ip each film coated tab. containing dried 323 ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 324 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. 325 containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip ioo mcg 326 folic acid tab ip 5 mg 327 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit bl img, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl img, cyanocobalamin imcg, lysine hcl 10mg 328 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit bi 2mg vit b6 0.5mg vit c 50mg calcium pantothenate lmg vit d3 2001u vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 329 vitamin b complex inj nfi 330 vitamin b complex tablet nfi (prophylactic) bl 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate img (with appropriate overages) 331 black disinfectant fluid (phenyl) as per schedule o grade iii 332 conc haemodialysis fluid b.p acetate concentrate 10 litre can 333 peritonial dialysis solution ip 334 sodium bicarbonate inj ip 7.5% w/v 335 water for inj ip 336 polygeline 3.5% solution with electrolytes for i.v. infusion 337 factor ix concentrate (purified) ip 500 600 1.u.(human coagulation factor ix) 338 anti inhibitorcoagulation complex (human plasma protein with a factor vlll inhibitor bypassing activity of 500 1.u. per vial) 339 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 340 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 341 labetalol tab ip 100mg 342 labetalol hci inj. ip 20mg/4ml 343 ampicillin cap ip 500mg 344 nitrofurantoin tab ip 100mg 345 hyoscine butyl bromide tablets ip 10mg 346 drotaverine tab ip 40 mg 347 hydroxyethyl starch (130/0.4) 6 % w/v with sodium chloride 0.9 % w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 348 cloxacillin sodium inj. ip 500mg 349 betamethasone sod phos inj. jp 4mg/ml 350 vccuronium bromide for injection 4mg (freeze dried) 351 phenobarbitone inj ip 200mg/ml 352 flurbiprofen sodium ophthalmic solution ip 0.03% w/v 353 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 l.u. 354 lidocaine hci topical solution usp 4% 355 fluconazole eye drops 0.3% 356 cephalexin oral suspension ip (cephalexin dry syrup [p) 125mg/ 5 ml 357 ofloxacin oral suspension ip 50mg/ 5ml 358 tinidazole tab ip 300 mg (film coated) 359 tinidazole tab ip 500 mg (film coated) 360 salbutamol syrup ip 2mg/ 5ml 361 ranitidine tab ip 300mg film coated 362 indomethacin cap ip 25 mg 363 diclofence prolonged release tablet ip 100 mg 364 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 365 dextromethorphan hbr syrup ip 13.5mg/5ml 366 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 367 saline nasal solution (drops) (sodium chloride 0.65%) 368 clotrimazofe mouth paint (clotrimazoie 1% w/v) 369 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 370 beclomethasone, neomycin and clotrimazo)e cream (beclomethasone dipropionate 0.025%, neomycin sulphate 0.5% arid clotrimazote 1%) 371 gamma benzene hexachloride lotion 1%(lindane lotion usp). 372 chlorhexidine gluconate solution 5% 250 ml. 373 iron and folic acid suspension. each 5m] contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 374 surgical spirit ip(100 ml) 375 povidone iodine solution ip 5% 100m) bottle 376 metformin hydrochloride(sustained release tablets ip 1000 mg 377 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 378 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 379 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 380 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 381 glimepiride, pioglitazone and metformin hydrochloride (sustained re(ease) tablets each tablet contains glimepiride 2mg, piogiitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 382 amtodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 383 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 384 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 385 amlodipine and lisinopril tablets amlodipine besiiate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 386 amtodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 387 atenolol tab ip 25 mg 388 enalapril maleate tablets ip 10 mg 389 hydrochiorthiazide tab ip 25mg 390 lisinopril tablets ip 10 mg 391 lisinopril tab 2.5 mg 392 losartan tab ip 25 mg 393 piperacillin + tazobactum for injection ip 4gm+500mg 394 prednisolone tablet ip 10 mg 395 prednisofone tab ip 20 mg 396 torsemide inj 10 mg/ml 397 zinc sulphate dispersible tablets ip elemental zinc 10 mg 398 amoxycin oral suspension ip (dry syrup) 125 mg/5ml 399 carbamazepine oral suspension usp 100 mg/5ml 400 cefpodoxime dispersible tab 50 mg 401 cephalexin tablets 125 mg (dispersible tablets) 402 lbuprofen oral suspension bp /usp 100 mg/ 5 ml 403 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 404 sodium valproate oral solution ip 200 mg/5 ml 405 diphtheria antitoxin 10000 iu 406 meropenem inj. ip 1gm 407 lohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 408 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 409 timolol eye drops ip 0.5 0% w/v 410 homatropine eye drops ip 2% 411 travoprost eye drops ip 0.004% 412 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 413 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 414 sevoflurane 415 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 416 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 417 etoricoxib tab ip 120mg 418 mefenamic âcid tablets bp 500 mg 419 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg chlorpheniramine maleate 1 mg, and paracetamol 125 mg 420 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamot 325 mg tab 421 cetirizine syrup ip 5mg/5 ml 422 acetylcystine solution usp (injection) 200 mg/ml 423 acyclovir intravenous infusion ip 250mg 424 acyclovir intravenous infusion ip 500mg 425 amikacin inj ip 250 mg 426 amoxicillin and potassium clavulanic ip inj 600mg 427 amoxicillin and potassium clavulanate inj ip 1.2gm 428 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottie) 429 aztreonam injection usp 500 mg 430 cefepime injection ip 500 mg 431 cefixime oral suspension ip 25mg/ml (paediatric drops) 432 cefuroxime axetil tab ip 250 mg 433 clindamycin capsule ip 150mg 434 clindamycin capsule ip 300 mg 435 levofloxacin tablets ip 250 mg 436 linezolid tablets ip 600 mg 437 linezolid inj 200mg/100ml 438 mefloquine tablets ip 250 mg 439 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 440 ofloxacin infusion ip 200mg/100 ml(in nacl inj) 441 vancomycin for intravenous infusion ip 500 mg 442 vancomycin for intravenous infusion ip 1gm 443 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 444 carboplatin injection ip 150 mg 445 carboplatin injection ip 450mg 446 cisplatin inj ip 10 mg/10 ml 447 dacarbazine injection 500 mg usp/ bp 448 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 449 gemcitabine for injection 200 mg 450 gemcitabine for injection ip lgm 451 ifosfamide injection ip/bp/usp l gm 452 imatinib tab ip 400mg 453 methotrexate tablets ip 10 mg 454 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 455 oxaliplatin injection usp 50 mg 456 bromocriptine tablets ip 2.5 mg 457 betahistine tab ip 8 mg 458 betahistine tab ip 16 mg 459 cinnarizine tablets ip 25 mg 460 cinnarizine tablet ip 75 mg 461 tranexamic acid tablets ip 500 mg 462 warfarin sodium. tab ip 5mg 463 adenosine injection ip 6 mg/ 2m) 464 atorvastatin tablets ip 40 mg 465 clopidogrel and aspirin tables, clopidogrei 75 mg and aspirin 75 mg 466 fenofibrate capsules/ tab ip 200 mg 467 isoprenaline injection ip 2mg / ml 468 metoprolol tablets ip 25 mg 469 metoprolol succinate extended release tablets ip 50 mg 470 noradrenaline injection ip 2 mg/ml 471 prazosin tablets (extended release) 2.5 mg 472 telmisartan tablets ip 40 mg 473 urokinase injection s lac unit (lyophilized) 474 betamethasone dipropionate cream ip 0.05% 475 betamethasone lotion ip 0.05% 476 clindamycin phosphate gel usp 1% 477 clobetasol propionate cream ip 0.05 % 478 glycerin ip 100 ml 479 ketoconazole cream 2% 480 permethrin lotion 5% 481 permethrin cream 5% 482 tretenoin cream usp 0.025% 483 povidone iodine ointment usp 250 gm 484 povidone iodine solution ip 10 % 485 silver sulphadiazine cream ip 1% 500 gm jar 486 spironolactone tablets ip 50 mg 487 finasteride tablets ip 5 mg 488 tamsulosin hci tablets/capsute 0.4 mg 489 flavoxate tablets ip 200 mg (coated tablet) 490 chlorhexidine mouthwash ip 0.2% 491 dental gel choline salicylate 8.7%, benzalkonium chloride 0.01%, lignocaine hci 2% (flavoured gel base) 492 tooth gel sodium monofluorophosphate 0.7% and potassium nitrate 5% (in flavoured base) 493 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 494 metronidazole 1% and chlorhexidine gluconade 0.25% gel 495 ciprofloxacin 0.3% and dexamethasone 0.1% ear drops ciprofloxacin and dexamethasone otic suspension usp 496 clotrimazole 1% with bectomethasone dipropionate 0.025% ear drops 497 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 498 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2% , benzocaine 2.7% , chlorbuto) 5%, turpentine oil 15% 499 dohperidone oral drops 10mg/ ml (10ml) 500 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 501 lactic acid bacillus tab 60 million spores 502 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 503 liquid paraffin ip 100 ml 504 ondansetron orally disintegrating tablets ip 4mg 505 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 506 ursodeoxycholic acid tablets ip 300 mg 507 allopurinol tablets ip 100 mg 508 hydroxychloroquine sulphate tablets 200mg 509 leflunomide tablets ip 10mg(film coated) 510 leflunomide tablets ip/usp 20mg (film coated) 511 sulfasalazine gastroresistant tablets ip 500 mg ip 512 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500mg) 513 glucagon for injection usp 1mg/ml 514 medroxyprogesterone acetate tablets ip 10 mg 515 thyroxine tablets ip 50 mcg 516 octreotide injection 50 mcg/ml 517 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazoné 250mg , diclofenac sodium 50mg paracetamol 325 mg) 518 betaxolol eye drops 0.5% 519 carboxymethylcellulose eye drops ip 0.5% 520 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 521 mifepristone tab ip 200mg 522 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 523 budesonide powder for inhalation 200 mcg 524 ipratropium powder for inhalation ip 40 mcg 525 terbutaline tablets ip 2.5 mg 526 xylometazoline nasal drops ip 0.1% 527 sodium chloride injection ip 100 ml 528 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (nonchewable) 529 cholecalciferol granules 60,000 iu /gm 530 mecobalamin inj 500 mcg/ml 531 pyridoxine tablet ip 10 mg 532 pyridoxine tablet ip 40mg 533 thiamine tablets ip 100 mg 534 calcitriol capsules ip 0.25 mcg 535 alendronate sodium tablets usp / bp 35 mg 536 mannitol with glycerin injection 10% + 10% w/v (for intravenous infusion) 537 normal human intravenous immunoglobulin 5g/100ml 538 pregabalin cap ip 75 mg 539 surfactant for intratrecheal instillation (natural bovine lung surfactant) 540 ramipril tablets ip 2.5 mg 541 neostigmine injection ip 2.5mg/5ml 542 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 543 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivirphosphate equivalent to oseltamivir 45 mg) 544 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 545 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 546 vitamin k 1 (phytomenadione) ip 1mg/o.5ml injection (detail in rc) 547 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 548 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 549 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 550 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 551 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(50q+25)mg 552 giyceryl trinitrate tablets 2.6 mg controlled release tablets 553 artemether and leumefantrine tablet (80 mg and 480 mg) 554 methyl cobalmine tablet 500mcg 555 methyl cobalmine tablet 1500mcg 556 atropine sulphate injection 0.6mg/ml 557 fentanyl citrate injection 50mcg/ml 558 naproxen tablet ip 500mg 559 naproxen tablet ip 250mg 560 etoricoxib tablet ip 90 mg 561 levoceitrizine tablet 5mg 562 montelucast(10mg) + levocetrizine tablet (5mg) 563 sodium valproate tablet(gastro resistant) ip 500mg 564 clobazam tablet/capsule 5 mg 565 clobazam tablet/capsute 10 mg 566 levetiracetam tablet ip 500 mg 567 levetiracetam oral solution/suspension 100mg/ml 568 levetiracetam injection 500mg/5ml 569 gabapentine tablet/capsuie 100mg 570 gabapentine tablet/capsule 300mg 571 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 572 coal tar 6% & salicylic acid 3% ointment 573 calamine lotion ip 100ml 574 lohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 575 quetiapine tablet ip 50mg 576 quetiapine tablet ip 25mg 577 vitamin d3 oral solution 60000 iu 578 cyclosporin capsule usp/ip 50 mg 579 clonazepam tablet 0.5 mg 580 aspirin tablet (p (gastro resistant) 150 mg 581 insulin glargine 3ml (100 lu/ml) with 15 insulin syringes and needles/cartridge 3ml (100 lu/mt) with 15 needles and 1 pen per 20 cartridges 582 tenaligliptin tablet ip 20mg 583 aztreonam injection lgm 584 framycetin sulphate cream 1% 30gm pack 585 framycetin sulphate cream 1% 100 gm pack 586 artemether and leumefantrine tablet (40 mg and 240 mg) 587 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 588 dried factor vjii fraction ip (iv use) 500 iu/vial 589 dried factor vili fraction ip (iv use) 1000 iu/vial 590 recombinant coagulation factor vila 1mg 591 redombinant coagulation factor vila 2mg 592 cough syrup/expectorant(50) ml 593 insulin glargine 10 ml vial (100 lu/ml) with 30 insuline syringes with needle 594 butorphanol tartrate injection usp lmg/ml lml size 595 diclofenac sodium aqueous injection 75mg/ml lml size, iv & im use 596 paracetamol infusion ip 1% w/v 100ml size 597 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 598 baclofen tablet fp 10 mg (each uncoated tablet contains baclofen ip 10 mg) 599 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 600 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 601 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 602 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 603 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 604 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100mg) 605 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25mg) 606 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 607 piperacillin injection 2 gm + tazobactom 250mg ip 608 ceftriaxone 1 gm + tazobactum 125 mg injection 609 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 610 cefadroxil tablet 500 mg 611 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 612 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 613 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 614 clindamycin phosphate injection ip 300 mg 615 imipenem + cilastatin injection 500mg/500mg ip powder for solution 616 polymixin sulphate b injection usp 5 lac i.u. 617 meropenem injection ip 250 mg 618 colistimethate injection ip im 1u powder for solution 619 voriconazole injection 200mg/vial 620 terbinafine hydrochloride tablet 250 mg 621 valganciclovir tablet 450 mg 622 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 623 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 624 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 625 bendamustine injection 100 mg 626 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 627 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 628 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 629 bortezomib injection 2mg 630 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 631 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 632 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 633 bevacizumab injection 400 mg 634 bevacizumab injection 100 mg 635 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50mg) 636 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250mg) 637 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 638 tacrolimus capsule ip 0.5 mg (each hard gealtin capsüle tacrolimus ip 0.5 mg) 639 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 640 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip so mg) 641 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 642 zoledronic acid injection ip 4mg vial 643 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5m) and sod. chloride solution 5 ml size 644 ethamsy!ate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 645 feracrylum 1% w/v steriie solution 100 ml 646 tranexamic acid injection ip 100mg/ml 5ml size 647 recombinant f ix 500 iu with diluent 648 3rd generation recombinant f viii 250 iu with diluent 649 3rd generation recombinant f viii 1000 iu with diluent 650 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 651 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotatol hydrochloride usp/bp 40mg) 652 esmolol hydrochloride injection 10mg/ml 10ml size 653 sodium nitroprusside injection 25mg/ml 2ml size 654 carvedilol tablet 3.125 mg 655 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 656 rosuvastatin tablet 10 mg 657 sacubitril 24 mg and valsartan 26 mg tablet 658 powder clotrimazole 1% w/w 30 gm 659 terbinafine cream 1%w/w (10 gm tube) 660 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 661 oitment mupirocin ip 2% 662 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 663 prochlorperazine mesyiate injection 12.5mg/ml 5ml size 664 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 665 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 666 hepatitis b immunologlobin injection ip 200 1.u 667 cis atracurium besylate injection 2 mg/ml in 5 ml vial 668 acyclovir eye ointment ip 3% w/w 5gm size 669 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 670 chloramphenicol 1% w/w eye ointment ip, 3gm size 671 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 672 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 673 human chorionic gonadotropin injection ip 5000 1.u. 674 leurprolide acetate depot 3.75 mg 675 leurprolide acetate depot 11.25 mg 676 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 677 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 678 zolpidem tablet 5 mg 679 acebrophylline tablet/capsule 100 mg 680 ringer acetate infusion 500 ml 681 sodium chloride 0.45% w/v polypack 500 ml 682 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 683 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 684 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 685 phenazopyridine tablet 5 mg 686 dutasteride tablet 0.5 mg 687 alkylizer syrup 1.4 gm/5100 ml )(disodium hydrogen citrate) 688 ferric carboxymaltose injection 50 mg/ml 10 ml size 689 multi vitamin syrup 690 intravenous fat emulsion 20% w/v 250ml 691 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 692 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 693 amino acid 10% injection 100ml size 694 vitamin e capsule 400 mg 695 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 696 dasatinib tab 100 mg 697 human immunoglobulin inj with 12% lgm, 12% iga, 76% lgg in pack of 10ml (o.5gm) 698 liquid medical oxygen (lmo) 699 liposomol amphotericine injection b 50mg 700 multistix test strip 701 chloroquine phosphate suspension ip 50 mg/5ml 702 fluconazole tablets ip 150mg 703 cetrimide cream ip 15 gm 704 fusidic acid cream ip 2% 705 mannitol inj ipw/v 706 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 707 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyt siloxane 50mg 708 dicyclomine and paracetamol tablets dicyctomine hydrochloride 20 mg + paracetamol 325 mg tablets 709 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5% w/v (iml ampoule),sodium chloride injection ip 0.9% w/v (5m! ampoule) 710 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 711 albendazole tablets ip 400 mg(detaii in rc) 712 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 713 azithromycin tablets ip 250mg 714 azithromycin tab ip 500 mg 715 artificial saliva solution 716 all trans retinoic acid capsule 10mg 717 cyclopentolate 1% eye drop 718 dorzolamide 2% eye drop 719 fluromethalone 0.1% eye drop 720 gatifloxacin and prednisolone eye drop 721 hpmc 0.3% eye drop 722 ltraconazote 1% eye drop 723 loteprednol 0.25% eye drop 724 moxifloxacin 0.5% and ketorolac tromethamine 0.5% eye drop 725 moxifloxacin and dexamethasone eye drop 726 moxifloxacin and prednisolone eye drop 727 anti oxidants capsule (beta carotene 10 mg,vit e 25mg,vit c 100 mg, copper 1.5 mg, managanese 1.5 mg,z 728 nepafenac 0.1% eye drop 729 oloptadine opthalmic solution 0.1% eye drop 730 pilocarpine eye drop 731 prednisolone sodium phosphate 1% eye/ear drop 732 proparacaine 0.5% w/v eye drop 733 sodium chloride 5 % eye drop 734 sulfacetamide 20% eye drop 735 travapost and timolol eye drop 736 tropicamide and phenylepherine eye drop 737 voriconazole eye drop 738 aprepitant capsule 125mg 739 azithromycin 1% eye ointment 740 chloramphenicol 0.5% eye ointment 741 chloramphenicol and polymycin eye ointment 742 chloramphenicol and polymycine and dexamethasone eye ointment 743 ganciclovir 0.15% eye ointment 744 traconazole ointment 745 moxifloxacin 0.5% eye ointment 746 sodium chloride 6% eye ointment 747 povidone iodine gargle 748 gatifloxacin 0.3% eye drop 749 budesonide capsule 9mg 750 diltiazem 2% p/r gel 751 nifedipine and lidocaine p/r gel 752 glycine irrigation solution 1.5% 3ltr solution 753 esmoprazole 10mg granules 754 hormonal intra uterine device 755 hp kit (pantoprazole 40 mg and metronidazole 400 mg and clarithromycin tablet 500 mg 756 hydrocortisone oromucosal tablet 5mg 757 hydrocortisone oromucosal tablet 10mg 758 hydrocortisone oromucosal tablet 20mg 759 hydrogen 11% and silver nitrate .01% solution 760 calcium dobesilate capsule 500mg 761 tiotropium and glycopyrolate 25mg inhaler 762 metoprolol 5ml vial injection 763 docetaxel 20mg injection 764 docetaxel 80 mg injection 765 folinic acid 200mg/vial injection 766 sodium chloride 3% ioomi injection 767 acth synacthen 250 mcg injection 768 adalimumab 40 mg injection 769 ado trastuzumab 100 mg injection 770 ado tras!uzumab 160 mg injection 771 ceritinib capsule 50mg 772 alpha beta arteether 2 ml injection 773 prostaglandin 500mcg/ml injection 774 aminocaproic acid 20ml injection 775 amoxycillin & clavulanic acid 300 mg injection 776 ampicillin and salbactum 1.5g injection 777 progesterone injection 50 tnjection 778 artesunate 120 mg injection 779 atezolizumab 1200 mg injection 780 avelumab 200 mg injection 781 azacitidine 50mg injection 782 ceritinib capsule 100mg 783 azacitidine 100mg injection 784 azithromycin 10 ml vial equaivelent to 500 mg injection 785 bacitracin for injection 25,000 lu injection 786 bortezomib 2.5 injection 787 botulinum toxin type a for injection/botulinum toxin type b for injection 100 lu injection 788 botulinum toxin type a for injection/botulinum toxin type b for injection. 50 lu injection 789 busulfan 60mg/1ml injection 790 cabazitaxel 20 mg injection 791 cabazitaxel 40 mg injection 792 caffeine cirate 20mg/ml injection 793 ceritinib capsule 200mg 794 calcium chloride 5ml vial injection 795 calcium gluconate/folinate injection 796 carbetocin imi/100micro. injection 797 carfilzomib 20 mg injection 798 carfilzomib 60 mg injection 799 carmustine 100 mg injection 800 caspofungin 50 mg injection 801 caspofungin 70 mg injection 802 cefipime 1000mg and tazobactum 125mg injection 803 cefoperazone igm and tazobactum 125mg injection 804 ceritinib capsule 250mg 805 cefoperazone 500mg injection 806 ceftazidime igm and sulbactam500 mg injection 807 ceftazidime and avibactum 2gm and 500mg injection 808 ceftizoxime 1gm injection 809 ceftriaxone ip 125 mg injection 810 ceftriaxone and salbactum and disodium edta injection 811 ceftriaxone and sulbactam 1.5g injection 812 ceftriaxone1000mg and tazobactom125mg injection 813 cefuroxime 1gm injection 814 cetrorelix acetate 0.25 mg injection 815 clomipramine capsule ip 25mg 816 cetuximab 100 mg injection 817 cetuximab 500mg injection 818 chloramphenicol 1gm/viaf injection 819 cladrabine 10 mg injection 820 clarithromycin 500mg injection 821 clindamycin 600mg/4ml injection 822 clonidine 150mcg/ml injection 823 compound sodium lactate (ringer lactate) in glass bottle 500ml injection 824 crystilline penicillin 2 lakh injection 825 cytarabine 1000 mg injection 826 balanced satt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag solution 827 cyclosporine capsule 100mg 828 d penicillamine 250mg capsule 829 dextrose 5% 500 ml glass bottle injection 830 daratumumab 100 mg injection 831 daratumumab 400 mg injection 832 darbepoietin alfa 100mcg injection 833 darbepoietin alfa 200 mcg injection 834 darbepoietin alfa 500mcg injection 835 decitabine 50 mg injection 836 decitabine 100 mg injection 837 degarelix 80 mg injection 838 dacarbazine 200mg injection 839 degarelix 120 mg injection 840 degludec insulin 300lu/3ml injection 841 denosumab 120 mg injection 842 deriphylline 1 ampul injection 843 detemir insuline injection 844 dexmedetomidine 100mcg/ml 845 dextran 40 injection 846 diazoxide 300 mg/20ml injection 847 digoxin 2mg injection 848 diitiazem 25 mg injection 849 danazol capsule 100mg 850 docetaxel 120 mg injection 851 doxycyciine for injection 100 mg injection 852 durvalumab 120 mg injection 853 durvalumab 500mg injection 854 enalapril 1.25 mg 1 ml injection 855 ephedrine 30 mg/ml injection 856 epirubicin 50mg/ml injection 857 epirubicin 150mg/ml injection 858 eribulin 0.5mg injection 859 eribulin 1 mg injection 860 evening primosa capsule 1000mg 861 ertapenem sodium igm = ertapenem 1.046 gm injection 862 etomidate 20 mg injection 863 etomidate mct/lct 10ml vial injection 864 fentanyl 25 lu patch 865 fentanyl 50 lu patch 866 fluconazole 100mg injection 867 fluconazo!e 200 mg injection 868 fludarabine phosphate injection 100mg injection 869 fludarabine phosphate injection 50mg tnjection 870 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography injection 871 formetrol 12mcg and budesonide 400 mcg respule 872 fluphenazine deconate injection (long acting) 25mg/ml ampule injection 873 folic acid and methylcobalamine 10 ml pack injection 874 fondaparinux 2.5mg injection 875 fosphenytoin sodium 150mg/ml injection 876 fsh 75 lu injection 877 fsh 150 lu injection 878 fulvestrant 250mg injection 879 gdw 5% glass bottle/500ml injection 880 glyceryl trinitrate injection, diluted 5mg/ml injection 881 goserelin acetate implant 3.6 mg injection 882 indacaterol and glycopyronium inhalation powder capsule 110/50 mcg 883 haemocoagulase 1 ml injection 884 haloperidol (long acting) 50mg/ml ampoule injection 885 horse atg(anti thymocyte globulin) 250 mg injection 886 hp hmg (highly human menopausal parodied gonadotropin) 150 lu injection 887 hp hmg (highly human menopausal parodied gonadotropin) 75 lu injection 888 hydralazine 20mg/ml injection 889 indomethacin lyophilized powder 1mg injection 890 inotuzumabl mg injection 891 insulin aspart injection 892 insulin glulisine (monocomponent insulin glulisine) 100 lu/ml/3 ml cartridges injection 893 isotretinoin capsule 10mg 894 insulin glulisine (monocomponent insulin glulisine) 100 lu/ml/3 ml prefilled pen injection 895 insulin lispro injection 896 interferon beta 1 a 30mg injection 897 intralipds injection 898 invert sugar 10% (fructodex 10%) 500 cc injection 899 lohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml injection 900 ipilimumab 50 mg injection 901 irinotecan 40mg/5ml injection 902 irinotecan 100 mg/5ml injection 903 isolyte g injection 904 isotretinoin capsule 20mg 905 isolyte p 10%500 ml injection 906 lacosamide infusion injection 907 levobupivacaine 0.5% (20mg/4ml) ampute injection 908 levofloxacine 500mg/100 ml injection 909 levosulpride 12.5 mg/ml injection 910 lignocaine (preservative free) 2% injection 911 lignocaine and adrenaline (1: 10000, 2: 10000) injection 912 lignocajne 10% spray injection 913 lignocaine hydrochloride 2% 50ml vial injection 914 liposomal doxorubicin 20mg injection 915 lomustine capsule 40mg 916 liposomal doxorubicin 50 mg injection 917 lorazepam 1.0 mg injection 918 lorazepam 5 mg injection 919 l orinithine l aspartate 10 ml injection 920 low molecular wt. heparin 0.4mg injection 921 mephentermine 50mg/ml injection 922 meropenem 2gm injection 923 mesna 200 mg/2ml (sod. mercaptoethane sulphate) injection 924 methotrexate 250 mg injection 925 methotrexate 1000 mg injection 926 minocycline capsule 100mg. 927 methylene blue injection 928 methylprednisolon acetate 40mg injection 929 methylprednisolon acetate 125mg injection 930 metotrexate 15mg (preservative free) injection 931 midazolam 5mg/ml 1 ml injection 932 milrinone 10 mg injection 933 mitomycin 2 mg injection 934 mitomycin 40 mg injection 935 mitoxanthrone infusion 10 mg injection 936 mitoxanthrone infusion 20mg injection 937 alpha and lipoic acid and leycopen and multivitamin and miltiminerals capsule 938 mycophenoiate mofetii capsule 500mg 939 moxiftoxacin intra cameral 0.5% injection 940 moxifloxin 400mg/100ml injection 941 multivitamin 10 ml injection 942 nabpaclitaxel (paclitaxel nano particle)100 mg injection 943 nandrojone decanoate 100mg injection 944 nandroione decanoate 50 mg injection 945 natalizumab 300 mg injection 946 neostigmine and glycopyrrolate 2.5 mg/ 0.5 mg injection 947 netiimycin 300mg/3ml injection 948 nicardipin 10mg injection 949 netupitant and palonosetron capsule 300mg and 0.5mg 950 nicorandil 48 mg injection 951 nimodipine infusion 10mg/50 ml injection 952 nimotuzumab 50 mg injection 953 nivolumab 40 mg injection 954 nivolumab 100 mg injection 955 normal saline 500 ml glass bottle injection 956 normal saline 1000 ml glass bottle injection 957 octreotide 100mg injection 958 octreotide lar (long acting release) 20 mg injection 959 octreotide lar (long acting release) 30 mg injection 960 ramipril capsule ip 5mg 961 lidocaine l% intra cameral injection 962 omalizumab 150 mg vial injection 963 ornidazdle 500mg injection 964 palonosetron 0.25mg injection 965 paracetamol infusion 500 mg with both temper evident caps spray 10% injection 966 paracetamol infusion 1000 mg with both temper evident caps spray 10% injection 967 peg asparaginase 3750 fu 5 mi injection 968 peg filgrastim injection 6mg injection 969 pembrolizumab 50 mg injection 970 pembrolizumab100 mg injection 971 rucaparib capsule 200mg 972 pemetrexed 100mg injection 973 pemetrexed 500 mg injection 974 pertuzumab 100 mg injection 975 phenylephrine hydrochloride 10 mg/ml injection 976 pilocarpine 0.5% w/v injection 977 piperacillin 1 gm and tazobactum 125 mg injection 978 piracetam 200mg injection 979 placental extract 2ml injection 980 pierixafor 24 mg injection 981 polymyxin b for injection 1 million injection 982 rucaparib capsule 300mg 983 potassium chloride for injection injection 984 procaine penicillin fortified 2 lack injection 985 protamine sulphate 5ml injection 986 rabbit atg (anti thymocyte globulin)100 mg injection 987 ramucirumab 100 mg injection 988 ramucirumab 500 mg injection 989 ranizumab 10mg/ml injection 990 rasburicase 1.5 mg injection 991 recombinant fsh 150 lu injection 992 recombinant fsh 3001u injection 993 silodosin capsule 4mg 994 recombinant hcg 250 lu injection 995 recombinant lh 751u injection 996 reteplase 18 mg injection 997 risperidone prolonged released depot 25 mg injection 998 risperidone prolonged released depot 50mg injection 999 rituximab 100 mg injection 1000 rituximab 500 mg injection 1001 rocuronium ioomg/10ml injection 1002 romiplostim 125 mcg injection 1003 romiplostim 250 mcg injection 1004 silodosin capsule 8mg 1005 romiplostim 500 mcg injection 1006 ropjvacaine 0.75% 20m] vial injection 1007 ropivacaine 0.75% 3 ml ampule (heavy) injection 1008 secukinumab 150 mg injection 1009 sildenafil 0.8mg injection 1010 sodium bicarbonate injection 1011 sodium fluroresceine dye 20% injection 1012 sodium hyaluronate 1.4mg injection 1013 streptomycin igm injection 1014 streptomycin 500mg injection 1015 temozolamide capsule 250mg 1016 sugmadex injection 1017 teicoplanin 200 mg injection 1018 teicoplanin 400 mg injection 1019 tenecteplase 20mg injection 1020 tenecteplase 40 mg injection 1021 testosteron propionate 50mg injection 1022 testosteron propionate 250mg injection 1023 thiamine 100ml injection 1024 ticarcillin and clavulanic acid injection 1025 tigecycline for injection 50mg injection 1026 vitamin a capsule 25000 lu 1027 tigecycline for injection 100mg injection 1028 tobaramycin 80mg injection 1029 topotecan 1 mg injection 1030 topotecan 2.5 mg injection 1031 topotecan 4 mg injection 1032 t pa 20mg alteplase for injection 1033 t pa 50mg alteplase for injection 1034 trabectedin 1 mg injection 1035 tranexamic acid 500mg/5ml injection 1036 trastuzumab 440 mg injection 1037 carbolic acid solution 50% in 500 ml solution 1038 trastuzumab 15()mg injection 1039 triamcinolone acetonide 10 mg per mt injection 1040 triamcinolone acetonide 40 mg per ml injection 1041 trypan blue 0.6% injection 1042 triptoretin 0.1 mg injection 1043 triptorelin 3.75 mg injection 1044 triptorelin 11.25 mg injection 1045 varicella immunoglobulin for iv use injection 1046 vasopressin 3ml injection 1047 verapamil 2.5 mg/ml injection 1048 glucosamine and hydrochloride and methylsulfonylmethane capsule 1049 carbolic acid solution 100% in 500 ml solution 1050 vinorelbine 10mg injection 1051 vinorelbine 50mg injection 1052 vitamin d (600000 lu) injection 1053 insulin glargine 300 lu per mt/prefitled pen injection 1054 insuiine 50/50 injection 1055 xylocaine lubricating 30gm jelly 1056 lignocaine 4% 30ml 1057 lignocaine viscous 1058 liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd ob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) injection 1059 l ornithiné l aspartate (150mg) and pancreatin capsule 100mg 1060 continuous ambulatory peritonedialysis fluid 2 ltr 1061 asceptic chlorhexadine gluconate 7.5% and =15% cetrimide solu and isopropyl 17% lotion 1062 clotrimazole 1% and bectomethasone 0.25% lotion 1063 ketaconazole 2% lotion 1064 minoxidil 2% lotion 1065 minoxidil 5% 1066 minoxidit 10 % lotion 1067 podophyliin toxin lotion 1068 sulphur and calamine lotion 1069 sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 lotion 1070 clotrimazole 10mg lozenses 1071 lidocaine 25mg and prilocaine 25mg cream 1072 medium chain triglyceride oil 1073 budesonide 200 mcg. mdi 1074 formeterol 6mcg, and fluticasone 250 mcg. inhalation mdi 1075 formoterol 6 mcg. and budesonide 200 mcg. mdi 1076 formoterol 6 mcg. and budesonide 400 mcg. mdi 1077 leosalbutamol 50mcg. and ipratopium 40mcg. mdi 1078 levosalbutamol inhalation solution 50ml/gm mdi 1079 lignocaine 1% mouth paint 1080 hydrogen peroxide 1.5% mouthwash 1081 fluticasone ft nasal spray 1082 ointment (modified lanolin) cream 1083 midazolam 0.5mg/5ml nasal spray 1084 neomycin sulphate and bacitracin zinc ointment usp 5 mg and 500 lu/gm ointment 1085 sodium chloride 0.9% 3000ml(n.s) injection 1086 sodium chloride bottel 100ml injection 1087 magnesium sulphate, sulphacetamide, urea 75 gm ointment 1088 clobetasol and salicylic acid 0.5% and 6% ointment 1089 heparin 50 lu benzyl nicotinate 2 mg ointment 1090 fluticasone ointment 1091 neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip ointment 1092 tacrolimus o .03% 15 gm ointment 1093 aloe vera moisturizing cream 1094 tacrolimus o .1% 15 gm ointment 1095 zinc oxide and alo vera and semethicone ointment 1096 omega 3fatty acid 50ml 1097 caffiene citrate oral solution oral drop 1098 mercunium chloride paint 1099 salicylic acid 16.7% and lactic acid 16.7% paint 1100 coloplast 60 gm paste 1101 eeg 400gm paste 1102 diclofenac each transdermal patch contain 200 mg diclofenac patch 1103 povidone iodine pessary 1104 amophous hydrogel with colloid silver wound dressing cream 1105 milk low birth formula powder 1106 recombinant human growth hormone 41u vial with syringe injection 1107 enterogermina 2billion spores 5ml respules 1108 formeterol 20mcg and budesonide 0.5mg respules 1109 levosalbutamol 2.5 mg and ipratropium 500 mcg 2.5 ml respules 1110 n acetylcysteine (nac) 200mg/ml respule 1111 budesonide 0.5mg/ml respules 1112 budesonide imi respules 1113 glycopyrronium 25mcg. inhalation 2ml. respules 1114 sodium chloride 3 % respules 1115 amorolfine 0.25% cream 1116 tiotropium bromide dry powder 30/pack respules 1117 revolizer/ rotahaler device 1118 root canal sealer (calcium carbonate) 1119 fosfomycin 3gm sachet 1120 hmf for pretem sachet 1121 l arginine and proanthocynadine granules 3mg sachet 1122 polyethyene glycol and sodium chloride and sodium bi carbonate and potassium chloride sachet 1123 racecadotril sachet 30 mg sachet 1124 etanercept 25mg/o.5ml injection 1125 polyethyene glycol with elctrolyte approx 130gm solution 1126 azelaic acid 20% cream 1127 lidocaine20ml spray 1128 super 1129 mesa 1130 glycerin 2 gm/ml suppsitory 1131 paracetamol 170 mg each suppsitory contain paracetamol 170 mg suppsitory 1132 cefaclor each 5 ml contain cefaclor 125 mg syrup 1133 codiene phosphate syrup 1134 amlodipine oral solution 1 mg/ ml syrup 1135 artemether 40mg and lumefantrine 240 mg 30m! syrup 1136 b. complex syrup 1137 benzoyl peroxide 2.5 % cream 1138 badöfen oral solution 5 mg /mi syrup 1139 calcium phosphate 200 ml syrup 1140 cefixime oral suspension 5()mg syrup 1141 cefixime oral suspension 100mg syrup 1142 cefpodoxime proxetil oral suspension 50mg syrup 1143 cefpodoxime proxetil oral suspension 100mg syrup 1144 cefuroxime axetil oral suspension 125mg/5ml syrup 1145 clarithromycin for ora! suspension 125mg/5ml syrup 1146 cefoperazone 1mg inj. injection 1147 cyclosporine oral solution 100mg/mi syrup 1148 desonide 0.05% cream 1149 rabbit atg (anti thymocyte globulin) 250 mg injection 1150 cyproheptadine 200ml syrup 1151 dextromethorphan hci and chiorpheniramine syrup 1152 diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml syrup 1153 drotavarine syrup 1154 each 15 ml contains: milk of magnesia 11.25 ml and liquid paraffin 3.75 mt 170 mt syrup 1155 each 5 ml containing : paracetamol 125 mg and ibuprofen 100 mg 60 ml syrup 1156 enzyme 100 ml syrup 1157 esomperazole syrup 1158 fluconazole ora) suspension syrup 1159 racecadotril capsule 100mg 1160 fenticonazole 2% cream 1161 furosemide oral solution 10mg/30ml syrup 1162 l carnitine 500mg/5ml in 30 ml syrup 1163 l carnosine ioomg/5mi in 200m) syrup 1164 levofloxacin oral solution syrup 1165 linezolid ioomg/5m! in 30ml syrup 1166 mefenamice acid 100mg/5mi syrup 1167 mefenemic acid 50 mg and paracetamol 250 mg /60 ml syrup 1168 melatonin 60 ml syrup 1169 montelucast and levocetrizine syrup 1170 nitrofurantoin oral suspension 25mg/5ml in 100 syrup 1171 glycolic acid 6% cream 1172 ondansetron oral suspension syrup 1173 oxybutynin oral suspension5 ml syrup 1174 phenobarbitone 20mg/5mi in 100ml syrup 1175 prednisolone tablet ip 50mg 1176 piracetam 500mg/5ml in 100mt syrup 1177 potassium magnesium citrate syrup 1178 ranitidine oral suspension syrup 1179 rifaximin syrup 1180 sodium bicarbonate oral suspension syrup 1181 sodium picosulphate oral suspension syrup 1182 hydrocortisone 1% cream 1183 sorbitol and trichotine citrate syrup 1184 sucralphate syrup 1185 triclofos ora! suspension500 mg/ smi in 30m} syrup 1186 ursodeoxycholic oral suspension 125mg/5ml in 100ml syrup 1187 zinc oral suspension 20 mg/loo ml syrup 1188 azithromycin oral suspension 100mg/5ml syrup 1189 azithromycin oral suspension 200mg/5ml syrup 1190 midodrine tablet 5mg 1191 hydroxyurea tablet/capsuie 500mg 1192 coq tablet/capsule 300mg(capsule of co enzyme qio with lycopene, selenium & omega 3 fatty acid ) 1193 hydroquinone 2% cream 1194 everolimus tablet/capsule 5mg 1195 everolimus tablet/capsute 10mg 1196 tacrolimus tablet/capsule 0.25 1197 nintedanib tablet/capsule 150mg 1198 6 mercaptopurine tablet 20mg 1199 acebrophylline sr tablet 200mg 1200 aceclofenac and thiocofchicoside tablet 1201 aceclofenac sr tablet 200mg 1202 aceclofenac and paracetamol and serratiopeptidase tablet (100 and 325 and 15 mg) 1203 afatinib tablet 20mg 1204 kojic acid 2%, arbutin,niacinamide cream 1205 afatinib tablet 30mg 1206 afatinib tablet 40mg 1207 alendronate sodium tablet 70mg 1208 alfuzosin tablet 10mg 1209 alpelisib tablet 150mg 1210 alpelisib tablet 200mg 1211 ajpejjsjb tablet 250mg 1212 amantidine tablet 100mg 1213 amisulpride tablet 50mg 1214 apixaban tablet 2.5mg 1215 luliconazole 1% cream 1216 apixaban tablet 5mg 1217 aripiprazole tablet 10mg 1218 aripiprazole tablet 5mg 1219 aspirin tablet ip 300mg 1220 aspirin dispresible tablet 325mg 1221 atomoxetin tablet 10mg 1222 atomoxetin tablet 18mg 1223 atomoxetin tablet 25mg 1224 atroxentine tablet 250mg (trientine hcl) 1225 axitinib tablet 5mg 1226 mometasone 0.1 % cream 1227 bilastin tablet 20mg 1228 biotin tablet 5mg 1229 bosentan tablet 62.5mg 1230 bosutinib tablet 500mg 1231 brivaracetam tablet 50mg 1232 buprinorphine tablet 2mg 1233 calcium acetate tablet 667 1234 calcium folinate tablet 15mg 1235 capmatinib tablet 200mg 1236 carbimazole tablet 10mg 1237 mometasone 2% cream 1238 cefixime and potassium clavulanate tablet 200 and 125mg 1239 cefpodoxime proxetil tablet 100mg 1240 cefpodoxime tablet 200mg 1241 cefpodoxime tablet 375 1242 chlordiazepoxide tablet 25mg 1243 chlordiazsepoxide tablet 10 mg and clidinium 25 mg 1244 chlorthalidone tablet 6.25mg 1245 choichicine tablet 0.5mg 1246 cilostazol tablet 50mg 1247 cilostazol tablet 100mg 1248 neomycin sulphate cream 1249 clarithromycin tablet 250mg 1250 clarithromycin tablet 500mg 1251 cilnidipine tablet 5mg 1252 cilnidipine tablet 10mg 1253 cilnidipine tablet 20mg 1254 clonazepam tablet 0.25 1255 clonazepam tablet 1mg 1256 clozapine tablet 25mg 1257 clozapine tablet 50mg 1258 clozapine tablet ioomg 1259 permethrin 1% rinse cream 1260 cotriamazole tablet 480mg 1261 cefuroxime axetil tablet 500mg. 1262 cyproheptadine tablet 4mg 1263 cyproterone acetate 2 mg and ethynil estradiol. tablet 035mg 1264 dabigatran tablet 150mg 1265 dabigatran tablet 110mg 1266 dabrafenib tablet 50mg 1267 dacomitinib tablet 15mg 1268 dacomitinib tablet 30mg 1269 dapagliflozin tablet 10mg 1270 rabeprazole and levosulpiride capsule 1271 adaplene (0.1% w/w) gel 1272 dapoxetine tablet 30mg 1273 dapsone tablet 100mg 1274 deflazacort tablet 6mg 1275 deflazacort tablet 12mg 1276 desvenlafaxine tablet 50mg 1277 diclo & sera & para. 1278 diclofenac and thiocolchicoside tablet 1279 dienogest tablet 2mg 1280 diltiazem prolonged released tablet 90mg 1281 dimethyl fumarate tablet 120mg 1282 desflurane usp 240 ml bottle solution 1283 dimethyl fumarate tablet 240mg 1284 disulfiram tablet 125mg 1285 disulfiram tablet 250mg 1286 donepezil tablet 5mg 1287 duloxetine gastro resistant tabiet 20mg 1288 duloxitine gastro resistant tablet 30mg 1289 dydrogesterone tablet 10mg 1290 eltrombopag tablet 25mg 1291 eltrombopag tablet 50mg 1292 empagliflazone tablet 10mg 1293 dextrose with sod.chloride polypack 5% 500ml injection 1294 empag!iflazone tablet 25mg 1295 entacapone tablet 200mg 1296 eriotinib tablet 150mg 1297 eriotinib tablet ioomg 1298 esomeprazole tablet 40mg 1299 estradioi valerate tablet 2mg 1300 estradiol valerate cream 1301 enzalupamide tablet 40mg 1302 ethynil estradiol tablet 0.02mg and desogestrat tablet 0.15mg 1303 etizolam tablet 0.5mg 1304 distilled water 10ml injection 1305 etoricoxib and thiocolchicoside tablet (60mg and 8mg) 1306 exemestane tabiet 25mg 1307 febuxostat tablet 40mg 1308 febuxostat tablet 80mg 1309 fexofenadine tablet 120mg 1310 fexofenadine tablet 180mg 1311 fingolimod tablet 0.5mg 1312 fludrocortisone tablet 100mcg 1313 flunarizine tablet 10mg 1314 fluvoxamine tablet 100mg 1315 sodium chloride and dextrose 0.45% infusion 500ml injection 1316 ftuvoxamine tablet 50mg 1317 folinic acid tablet 15mg 1318 formaline tablet 1319 furosemide tablet 20mg and spironoåactone tablet 50mg 1320 glucosamine hydrocloride tablet and diacerin 50 tablet mg 1321 brutinib tablet 140mg 1322 indomethacin tablet 75mg 1323 inositol and myoinositol tablet 1000mg 1324 ivabradine tablet 5mg 1325 ivermectin tablet 6mg and albendazole tablet 400mg 1326 salrhetrol 50mg and fluticasone 500 mcg dpi 1327 ivermectin tablet 6mg 1328 ivermectin tablet 12mg 1329 ketoconazole tablet 200mg 1330 lacosamide tablet 50mg 1331 lamotrjgine dispersible tablet 100mg 1332 lapatinib tablet 500mg 1333 lenalidomide tablet 25mg 1334 lenalidomjde tablet 10mg 1335 lenvatinib tablet 4mg 1336 lenvatinib tablet 10mg 1337 budesonide 400 mcg dpi 1338 levetiracetam tablet ip 250mg 1339 levodopa and carbidopa tablet 125 1340 levodopa and carbidopa and entacapone tablet 100mg/25mg/200mg 1341 levofloxacin tablet 750mg 1342 levosulpride tablet 75mg 1343 levothyroxine sodium tablet 25mcg 1344 levothyroxine sodium tablet 75mcg 1345 linaglipitin tablet 2.5mg 1346 linaglipitin tablet 5mg 1347 lopinavirtablet 200mg and ritonavir tablet 50mg 1348 glycopyrronium 25 and formoterol 6 mcg dpi 1349 loratadine tablet 10mg 1350 loriatinib tablet 25mg 1351 loriatinib tablet 100mg 1352 megestrol acetate tablet 160mg 1353 melatonin tablet 3mg 1354 melphalan tablet 2mg 1355 metolazone tablet 5mg 1356 methimazole tablet 5mg 1357 methimazole tablet 10mg 1358 methotrexate tablet 7.5mg 1359 glycopyrronium 25 dpi 1360 methotrexate tablet 15mg 1361 methylphenidate tablet 10mg 1362 methylprednisolone tablet 4mg 1363 methylprednisolone tablet 16mg 1364 methylprednisolone tablet 8mg 1365 meverberine tablet 135mg and chlordiazepoxide tablet 10mg 1366 midostaurin tablet 25mg 1367 mirabegeron tablet 25mg 1368 mirabegeron tablet 50mg 1369 mirtazapine tablet 7.5mg 1370 glycopyrronium 50 dpi 1371 mirtazapine tablet 15mg 1372 mifepristone tablet 25mg 1373 montelukast tablet 4mg 1374 montelukast tablet 5mg 1375 montelukast tablet 10mg 1376 morphine tablet 10mg 1377 morphine tablet 30mg 1378 moxifloxacin tablet 400mg 1379 moxonidine tablet 0.2mg 1380 moxonidine tablet 0.3mg 1381 acitretin cap ip 10 mg 1382 levosalbutamol 100mcg and ipratropium bromide 40mcg dpi 1383 n acetylecystine effervescent form, orange flavour tablet 600 mg 1384 naitrexone tablet 50mg 1385 nebiv.olol tablet 5mg 1386 nebivolol tablet 10mg 1387 nicorandil tablet 5mg 1388 nicoumalone tablet 1mg 1389 nicoumalone tablet 3mg 1390 nicoumalone tablet 4mg 1391 nifidipine tablet 20mg 1392 nifidipine tablet 20mgsr 1393 diastase pepsin with simethicone 15 ml drop 1394 nilotinib tablet 150mg 1395 nilotinib tablet 200mg 1396 nilotinib tablet 300mg 1397 nitazoxanide tablet 500mg 1398 nitrazepam tablet 5mg 1399 nitrazepam tablet 10mg 1400 olaparib tablet 50mg 1401 olaparib tablet 150mg 1402 olmesartan medoxomil tablet 20mg 1403 orciprenaline tablet 10mg 1404 furosemide 10mg/ml drop 1405 osimertinib tablet 80mg 1406 oxcarbazepine tablet 300mg 1407 oxcarbazepine tablet 450mg 1408 oxazepam tablet 15mg 1409 pancreatin gastroresistant tablet 10,000mg (with proteiase & amylase) 1410 pantoprazole tablet 20mg 1411 paracetomol tablet 650mg 1412 paroxetine tablet 12.5mg 1413 paroxetine tablet 25mg 1414 pazopanib. tablet 200mg 1415 ondansetron oral solution 30 ml drop 1416 pazopanib tablet 400mg 1417 penicillin tablet v400mg 1418 pentoxifyiline extended release/sr tablet 400mg 1419 perampanel tablet 2mg 1420 perampanel tablet 4mg 1421 pheniramine tablet 25mg 1422 phenozopyridine tablet 200mg 1423 pirfenidone tablet 200mg 1424 pirfenidone tablet 400mg 1425 piroxicam tablet dt20mg 1426 prednisoione acetate opthalmic suspension 10 mt eye drop 1427 pomalidomide tablet 2mg 1428 pomalidomide tablet 4mg 1429 posacozazole tablet 100mg 1430 posacozazole tablet 40mg/ml 1431 prasugrel tablet iomgtab 1432 prazosin tablet 5mg 1433 prednisolone tablet ip 40mg 1434 primidone tablet 50mg 1435 primidone tablet 250mg 1436 prochlorperazine tablet 5mg 1437 terbutalin drop 1438 progesterone tablet onlypills 1439 propranofol tablet 10mg 1440 propranoloi tablet 40mg sr 1441 propylthiouracil tablet 100mg 1442 pyridoxine tablet 100mg 1443 ranolazine tablet 500mg 1444 rasagiline1mg tablet 1445 regorafenib tablet 40mg 1446 repaglinamjde tablet 0.5mg 1447 repagiinamide tablet 1mg 1448 hydroxyzine oral solution 15 ml drop 1449 ribociclib tablet 200mg 1450 rifampicin tablet 150mg 1451 rifampicin tablet 450mg 1452 rifampicin tablet 600mg 1453 rifaximin tablet 200 1454 rifaximin tablet 550mg 1455 rivaroxaban tablet 10mg 1456 rivaroxaban tablet 15mg 1457 rivaroxaban tablet 20mg 1458 rizatriptan tablet 10mg 1459 ambroxol drop 1460 ropinirole tablet 0.25mg [nrd.770] 1461 rosuvastatin tablet 10mg and fenofibrate tablet 160mg 1462 ruxolitinib tablet 5mg 1463 ruxolitinib tablet 10mg 1464 ruxolitinib tablet 15mg 1465 ruxolitinib tablet 20mg 1466 selegiline tablet 5mg 1467 serratiopeptidase tablet 10mg 1468 serratiopeptidase tablet 20mg 1469 seveiamer carbonate tablet 800mg 1470 anticoid drop 1471 sildosin and tablet dutasteride 1472 silymarin tablet 70mg. 1473 sitagliptine and metformin tablet (50/500) 1474 sifdenafi tablet 20mg 1475 sofosbuvir tablet 400mg and velpatasvir tablet 100mg 1476 solifenacin succinate tablet 10mg 1477 sorafenib tablet 200mg 1478 sultamicin tablet 375mg 1479 sunitinib tablet 12.5mg 1480 sunitinib tablet 25mg 1481 astymine c (vitamin c and essential amino acid) drop 1482 sunitinib tablet 50mg 1483 tacrolimus tablet 1mg 1484 tamsulosin and dutasteride tablet 1485 tapentadol tablet 50mg 1486 tegafur and uracil tablet 100mg 1487 tenofovir tablet 300mg 1488 tetrabenazine tablet 25mg 1489 ticagrelor tablet 90mg 1490 tofacitinib tablet 5mg 1491 tolvapatan tablet 15mg 1492 acitretin capsule 25mg 1493 enzyme drop 1494 topiramate tablet 50mg 1495 torsemide tablet 20mg 1496 tramadol tablet 37.5mg and paracetamol tablet 325mg 1497 trametinib tablet 0.5mg and davarafenide tablet 150mg 1498 trimetazidine tablet 35mg 1499 trimetazidine tablet 60mg 1500 trypsin and rutoside and bromelain tablet 1501 trypsin chymotripsin tablet 1502 ulipristal tablet 5mg 1503 voriconazole tablet 200mg 1504 iron (ferrous ascorbate) drop 1505 verapamil hydrochloride tablet sustained release 40mg 1506 verapamil hydrochloride tablet sustained release 120mg 1507 vildagliptin tablet 50mg 1508 voglibose tablet 0.2mg 1509 voglibose tablet 0.3mg 1510 warfarin tablet 1mg 1511 warfarin tablet 2mg 1512 warfarin tablet 3mg 1513 zinc tablet 50mg 1514 zolpidem tablet 10mg 1515 simethicon 40mg and dili oil 0.005ml and fennel oil 0.0007m130 ml drop 1516 zonisamide tablet 50mg 1517 zonisamide tablet 100mg 1518 tiotropium 9mcg inhaler 1519 human albumin 20% injection 50 ml vial 1520 tetanus vaccine (adsorbed) injection ip in 0.5 ml 1521 vitamin e 50mg/ml, 400 drop 1522 vitamin d3 4001u/ml drop 1523 vitamin 03 8001u/ml drop 1524 cefpodoxime oral suspension 20mg/ml drop 1525 lactulose enema 1526 docosahexaenoic 30ml drop 1527 acetic acid otic solution 2% ear drop 1528 alectinib capsule 150mg 1529 gentamycin ear drop 1530 digoxin 0.25% elixir 1531 carboxymethylceellulose and glycerin eye drop 1532 moxifloxacin and difluoprednate eye drop 1533 natamycin opthalmic suspension 5% eye drop 1534 olaptadine & ketoroiac eye drop 1535 polymyxin b 100001u/gm and neomycin 34001u/gm eye drop 1536 betadin 5% eye drop 1537 brinozolamide and brimonidine eye drop 1538 cpm and cmc and nephazoline eye drop 1539 potassium permanganate powder 1540 potassium permanganate powder 1541 formula feedlbw powder 1542 nitroglycerin 2.6 tablet 1543 activated charcol tab. 500 mg 1544 sodium hyaluronate 1.4 % opthamalic solution 1545 proparacaine 0.5% w/v eye drop ...

Indian Army - Rajasthan

33283758 supply of consumables and expendable medical stores , abdominal binder xl size , abipyllin 100 mg tab , aceclofenac 100 mg tab , aceclofenac 100mg+paracetamol 325mg+serratiopeptidase 10mg tab , acitrom 2 mg tab ( nicoumalone ) , acotinamide 100 mg tab , adhesive micropore , adsan ( sadonein, methonine ) 400mg tab , albendazole 400 mg tab , albumin kit , aldectone 50 tab ( spironolactone ) , alfuzocin 10 mg tab , alpha ketoanalogue tab , alphacalcidol 0.25 mcg cap , amiodarone hcl 100 mg tab , amlodipine 10 mg tab , amlodipine 2.5 mg tab , amloride 5mg+frusemide 40mg tab , ampicillin 220mg + sulbactum 148mg tab , anti haemorrhoidal oint tube of 20 gm , apixaban 2.5 mg tab , aspirin 75 mg + atorvastatin 10 mg , aspirin 75 mg + clopidogrel 75 mg tab , atarax 25 mg tab , atenolol 50 mg + amlodipine 5 mg tab , atorvastatine 10mg +fenofibrate 160 mg tab , atorvastatine 40mg tab , b complex forte with zinc & vit c tab , baclofen 10mg tab , baclofen 20 mg tab , bandage crepe: 10 cm , bandage crepe:15 cm , bandage roller 2.5 cm pkt of 10 , bandage roller 9 cm pkt of 10 , beclomethasone & salicylic acid oint tube of 20 gm , bethanechol 25 mg tab , bisacodyle 5 mg tab ( vegilex ) , bisoprolo 5 mg , bisoprolol 2. 5 mg tab , blood grouping kit , blood sugar kit , bosentan 62.5 mg tab , brivaracetam ( briviact ) 50 mg tab , calcitonin nasal spray , calcium + vit d3 syp 200ml bott , calcium aspartate 500 mg + calcium orotate 500 mg + cholecalciferol 0.25 mg + em 50 mg + fa 1.5 mg + hydroxycobalamin tab , cap vit e 400 mg ( evion ) , carbamazepine 400 cr tab , carbamazepine 400mg sr tab , carbidopa 25mg + levodopa 100 mg tab , carbidopa 50 mg + levodopa 200 mg tab , carbimazole 10 mg tab ( neomercazole ) , carvedilol 25 mg tab , carvedilol 6.25 mg tab , catheter k 91 , catheter male med size , cerevate 90 mg + vit d3 tab , cervical collar soft , cetrizine 5mg+paracetamol 325mg+phenylephrine hcl 5mg ( cold plus ) , chlordiazepoxide 10 mg tab , chloroxylenol sol jar of 5 ltr , chlorthalidone 6.25 mg + cilinidipine 10 mg tab , chlorthalidone 6.25 mg tab , chlorzoxazone 500 mg+diclofenec sodium 50 mg +paracetamol 500 mg tab , cholecalciferol 60000 iu tab , cilastozole 50 mg tab , cilinidipine 10 mg tab , citicoline 500 mg + piracetam 400 mg tab , citicoline 500 mg tab , clarithromycin 500 mg tab , clindamycin 100+clotrimazole 100 mg vaginal pessary ( clingen ) , clindamycin 300 mg tab , clindamycin gel , clobetasole propionate 0.05% cream , clonazepam 0.5 mg tab , clopidogrel 75 mg + aspirin 75 mg + atorvastatin 10 mg cap , clopidogrel 75 mg + aspirin 75 mg tab , common cold ( antihistaminics + paracetamol 325 mg without pseudoephedrine ) tab , cotton absorbant packet of 500 gm , cough syp ambroxol+ terbutalin + guphapensin bott of 100 ml , cream betamethasone dipropionate usp 0.5 mg and gentamycin sulphate 1 mg per gm tube of 5 gm. , cream miconazole nitrate 2% skin tube of 15 g , cremaffin white each 15 ml containing milk of magnesia 11.25 ml liquid paraffin 3.75 ml bottle of 170 ml , dapagliflozin 10 mg tab , decadurabolin 50 mg / ml inj , deflazacort 6 mg tab , desensitising pastetube of 50 gm. , desvenlafexine 50 mg tab , diazepam 5mg tab , diclofenac 50mg+paracetamol 325mg tab , diclofenac gel linseed oil, menthol, methyl salisylate tube of 20 gm , diclofenac sodium 100 mg sr ( voveran sr ) tab , diclofenac sodium 50 mg + paracetamol 500 mg tab , diclofenac+pcm+serratiopeptidase tab , dicyclomine 20 mg + mefenamic acid 250 mg tab , dicylomine 10 mg + mefanimic acid 250 mg tab , digoxin 0.25 mg tab , disposable face mask , disposable insulin pen needles 4mm , divalporex sodium 500mg tab , dologel mouth ulcer gel , doxofylline 400 mg + ambroxol 30 mg tab , doxophyllin 400 mg tab , doxycycline cap , drotavarin 40 mg tab , duloxetine 20 mg tab , dutasteride 0.5 mg+ tamsulosin 0.4 mg , ear drop clear wax , ear drop clotrimazole , ebastin 20mg tab , ecg paper roll 80 mm x 20 20 mtr pack of 3 rolls , ecosprin 150 mg tab , edta vacutainer tube , enalapril 5 mg ( envas ) tab , enalapril maleate2.5mg ( envas ) tab , entecavir 0.5 mg cap , eosinophil diluting fluid , epeleron 25 mg tab , ethamsylate 500 mg tab , etiozolam 1 mg tab , etophyllin + theophyllin retard 150 mg tab , etoricoxib 90 mg + thiocolchicoside 8 mg tab , eye drop aquagic , eye drop brimonidine + timolol , eye drop bromfenac , eye drop carboxy methyl cellulose 0.5% bott of 5 ml ( cmc e / d ) , eye drop carboxymethylcellulose 0.5% bott of 10 ml , eye drop ciprofloxacin , eye drop ciprofloxacin + dexamethasone , eye drop ciprofloxacin 0.3% w / v bott of 5ml , eye drop dorzolamide , eye drop dorzolamide + timolol , eye drop fluorometholone , eye drop flurbiprofen sodium 0.3% bott of 5 ml , eye drop gatifloxacin + dexamethasone bott of 5 ml , eye drop gatifloxacin 0.3% bott of 5 ml , eye drop ketorlec , eye drop latanoprost 50mcg bott of 2.5 ml , eye drop moxifloxacin 5ml , eye drop moxifloxacin+dexamethasone bott of 5 ml , eye drop nephafenac , eye drop ocupol d , eye drop oflox , eye drop olapat kt , eye drop olapetadine , eye drop olopatodine 0.1% w / v bott of 5 ml , eye drop phenylephrine hydrochloride naphazoline hydrochloride chlorpheniramine maleate menthol camphor , eye drop prednisolone acetate , eye drop sodium hyaluronate , eye drop sulphacetamide , eye dropchlorphenarmine 0.1% nephazoline 0.05%+phenylphrine hcl 0.12%+menthol0.005%+camphor0.01% , eye dropofloxacin 0.3% bott of 5 ml , febuxosat 40 mg tab , fenofibrate 135 mg cap , fexofenadine 120mgtab , fexofenadine hydrochloride 120 mg tab , flohale 0.5mg / 2ml respules , fluconazole 150 mg cap , flunarizine 10mg tab , flupentixol 0.5 mg + melitracen 10 mg tab ( placida ) , flurbiprofen 5% w / wgel tube of 20 gm , flurbiprofen gel tube of 30 gm , foleys catheter 2 way size 16 fr , folic acid 5 mg tab , foracort 200 rotacap bott of 30 , foracort 400 rotacap bott of 30 , formetrol + budesonide 200 mcg synchrobreath mdi , fouchet reagent , framycetin sulphate cream bp 1% cream 15 / 20 gm , frusemide 20mg + spironolactone 50mg ( lasilactone ) tab , fusidic acid 2% w / wcream , fusidic acid oint tube of 10 gm , gabapentin 100 mg tab , galantamine 4 mg tab , gauze surgical pkt of 18 mtr , gliclazide 60 mg tab , glimipride 1 mg + metformin 1 gm sr tab , glimipride 1 mg + metformin 500 mg tab , glipizide 5 mg tab , glucometer strip , glucosamine 250mg+chondroitin sulphate 200 mg cap , glucosamine 500 mg + chondroitin sulphate 400 mg + akba tab , glucose strip one touch ultra bott of 50 with meter , glycopyrronium powder for inhalation 50 mcg bott of 30 cap , haematinic containnnig ferrous fumarate, vit b 12, folic acid vit c cap , hand gloves, size 7.5 pair of , hb a1c kit , heamatinic tab / cap containing ferrous fumarate vit b 12 folic acid and vit c, strength: 300mg, 1.5mg, 75mg min , hydrochlorothiazide 12.5mg tab , hydrocortisone 20 mg tab , hydrocortisone oint tube of 10 gm , hydroxychloroquin 200 mg tab , hyoscine 10 mg tab , indapamide 2.5 mg tab , indomethacin 25 mg cap , inh ipratropium bromide 20mcg + levosalbutamol 50 mcg mdi , inh salmeterol 25mcg + fluticasone 125mcg 120 mdi , inj decaduraboline 25mg / ml , inj dicyclomine 10 mg per amp , inj etophyllin 84.7+ theophyllin 25.3 mg / amp , inj insulin isophane / nph ( 70% ) + human insulin / soluble insulin ( 30% ) ( insulin wosulin 30 / 70 vial of 10 ml ) , inj methylcobalamine1500 mg , insulin actrapid inj , insulin aspart cartridge 100 iu / ml ( cart 0f 3 ml ) , insulin glargin 300 iu / cart ( cart of 3 ml ) , insulin glargine monocomponent 100 iu / ml 3ml cartridge , insulin glulisine ( apidra ) , insulin humolog 100iu / ml , insulin mixtard 30 / 70 inj vial of 15 ml , insulin mixtard 30 / 70 pen , ipratropium bromide 500 mcg + levosalbutamol 1.25mg / 2.5ml respules , iron syp bott of 200 ml , isabgol sachet 3.5gm , isapgol husk pkt of 100 gm , isosorbide dinitrate 5 mg tab , itopride 150 mg + rabeprazole 20 mg tab , ketoconazole 2% cream 20 gm , ketoconazole lotion , ketoconazole shampo bott of 100 ml , ketorol dt tab , ketorolac 10 mg tab , ketostaril cap , kit for estimationof bilirubin erba , kit for estimation ofuric acid erba , kit for estimation of glucose erba , knee cap size large , knee cap size medium , lacosamide 100mg tab , lacosamide 200 mg tab , lactobacilus 120 mil spores tab , lactulose 10gm / 15 ml syp bott of100 ml , lamino nephro inj 250 ml / bott , lamivudine 150mg + stavudine 30 mg + nevirapine 200mg tab , lamotrigine50 mg tab , leflunomide 10 mg tab , leviteracetam 500 mg dt tab , levocarnitine 500mg tab , levo cetrizine 5 mg tab , levocetrizine 5mg + montelukast 10mg tab , levosulpride 75 mg + rabeprazole tab , lignocaine jelly2% 30 gm withplastic nozzle , liquid paraffin + milk of magnesia bott of 170 ml , lorazepam 1 mg tab , luliconazole cream , lumbar belt size 44 , lycopene with vit & minerals cap , magesterol acetate 40 mg tab , mecobalamine inj 1500 mcg , mecobalamine1500 mcg +alphalipoic acid 200 mg+bentothiamine 150 mg +fa+chromium myo inositol 200 mg +pyridoxin hcl tab , memantine 5 mg tab , mesalamine dr 800mg tab , metformin 0.5 g sr tab , methotrexate 5 mg tab , methyl prednisolone 4mg tab , methylated spirit bott 500 ml , methylperdinosolone 8 mg tab , metolazone 0.5 mg tab , metoprolol sr 50 mg tab , metoprolol xl 12.5 mg tab , micro tips 100 1000 , mirabegron 50 mg tab , mometasone lotion , montair+levocetrizine+ambroxol , monteleukast 10 mg tab , moxifloxacin 0.5% w / veye dropbott of 5 ml , moxinidine 0.3 mg tab , multivitamin syp , multivitamin tab , multivitamin with zinc syp bott of 200ml , multi vitamine mineral cap , n acetylcystine 600mg effervecent tab , naproxen 500 mg + domperidome 10 mg tab , nasal drops oxymetazoline 0.025% , natrilix sr 1.5 mg tab , nebivilol 5 mg tab , needle disposable pkt of 100 , neomercazole 5 mgtab , nicorandil 5mg tab , nicoumalone 2 mg tab , nifedipine retard 20 mg cap , nimesulide tab , nintadanib 150 mg , nitrocontine 2.6 mg tab ( bott of 30 tab ) , nitrofurantoin 100 mg tab , normaxin tab , oin beclomethasone .025%w / w+ salisylic acid 3%w / w tube of 20 gm , oin beclomethasone0.025%w / w+lignocaine 2.5%w / w +phenylephrine 0.1%w / w ( no pile ) tube of 20gm , oin miconazole 2% w / w , oint alovera+ vit e cream tube of 50 gm , oint betamethasone 0.05 %w / w + gentamycin 1 %w / w , oint clobetasole cream 0.05% of 10 15gm , oint diclofenac gel 1% tube of 30 gm ( voveran ) , oint hydrocortisone 1% , oint sertaconazole 2% , oint terbinafine 1% w / w , olanzapine 10 mg tab , olanzapine 5 mg tab , olmesartan 20 mg tab , omega d3 fatty acid tab , ondansetron 4 mg tab , ornidazole 500 mg tab , oxcarbazepine 300 mg tab , pamoralin 11.25 mg inj , pancreoflate 300 mg tab , pantoprazole 40 mg + domperidone 10 mg tab , pantoprazole 40 mg + levosulpiride 75 mg cap , paracetamol 325mg + tramadol hcl 37.5mg tab , paroxetin cr 12.5 mg tab , phophatidyl serine 200 mg cap ( liposerin ) , pioglitazone 15 mg tab , piracetam 800 mg tab , pirfenidone 200 mg tab , piroxicam 20mg tab , plastic bott ( urine container ) , polyantibiotic resistant spores bacillus clausiicap ( enzispor ) , pramipexolol 0.125mg tab , pramipexolol 0.5mg tab , prasugrel10 mg tab , prazocin xl 5mg tab , predinisolone 5 mg tab , printerpaperrollerbachem 5+ , prochlorpromezine 5 mg tab ( stemetil ) , propranolol 40 mg tab , propranolol hcl 10 mg tab , prucalopride 2 mg tab , pyrazinamide 750 mg tab , ra kit , rabeprazole 20 mg +domperidone 10 mg tab , ramipril 2.5 mgtab , ranitidine 150 mg + domperidone 10 mg tab , ranolazine 500mg tab , recombinant human growth hormone 15 iu ( hgh ) , residronate 35mg tab , resperidone 0.5mg tab , respules fluticasone 0.5 mg , rifaximine 200 mg tab , rivaroxabin 2.5 mg tab , ropark 0.5mg tab , rosehip extract, boswellia serrata, vit c& piprine , rosuvastatin 15 mg tab , rotacap budesonide 200mcg + formeterol 6 mcgpkt of 30 cap , rotacap formeterol 6 mcg + budesonide 400mcg , pkt of 30 cap , rotacap indacaterol 110 mg + glycopyrronium 60 mcg , rotahaler device for inhalation cap , s metoprolol 12.5 mg tab , s metoprolol 25 mg tab , s metoprolol 50 mg tab , salbutamol + ipratropium bromide rotacaps bott of 30 cap , salbutamol 100 mcg + ipratropium 40 mcg inhaler , salbutamol 200 mdi ( each metered dose supplies 100mcg of salbutamol ) mdi , salbutamol aerosol inhalation pack of200 metered doses ( each metered dose supplies 100 mcg of salbutamol ) . ( asthaline ) , salmetrol + fluticasone ( 50+ 250mcg ) synchrobreath mdi , salmetrol 25mcg + fluticasone 250mcgmdi , scabiol lotion bott of 100 ml , serratiopeptidase 10mg tab , sertaconazole cream , sertaline 50 mg tab , serum albuminerba kit for testing , serum vacutainer tube , sevelamer 800mg tab , shalcal 500 mg ( calcium carbonate + vit d3 ) tab , silodosin 8 mg + dutasteride 0.5 mg tab , silodosin 8mg tab , sitagliptin 50mg tab , sobisis 500 mg tab , sodium valporate 333 mg + valporic acid 145 mg tab , sodium valproate 500 mg tab , sofosbuvir 400 + velpatasvir 100 mg tab , soframycin oint tube of 30 gm , solifenacin 10mg tab , sr bilirubin total & direct kit , sr cholestrol kit , stocking dvt below knee size med , syp antacid gel bott of 170 ml ) , syp cough expectorant 100 ml , syp cyprohepatadine 2 mg / 5ml , bott of 200 ml , syp ironcontaining cyanocobalamin 7.5 mcg + ferric ammonium citrate 160 mg + folic acid 0.5 mg / ml bott of 200 ml , syp tricholine citrate 0.55 gm + sorbitol 7.15 gm / 10 ml , syringe disposable 2 ml , tamsulosin 0.4+dutasteroide 0.5 tab , telmisartan 20mg tab , teneligliptin 20 mg tab , teriparatide 750 mcg / 3ml inj , test tube borosil 10 x 75 mm ( box of 100 ) , test tube borosil 12 x 100 mm ( box of 100 ) , theophylline 400 mg tab , thiocolchicoside 4 mgtab , thyroxine 12.5 mcg tab , ticagrelol 90 mg tab , tofacitinib 5 mg tab , tolvaptan 15 mg tab , topiramate 50 mg tab , torsemide 20mg tab , torsemide 40 mg tab , tramadol 37.5 + paracetamol 325 mg tab , trihexyphenidyl hcl 2 mg ( pacitane ) tab , trimetazidine 35mg mr tab , trypsin & chymotrypsin tab ( chymoral forte ) , ubidecarenone 180 mg tab ( renoque ) , urea kit erba , vildagliptin 50 mg + metformin 500 mg tab , vildagliptin 50 mg tab , vitamin b complex with a minimum concentration of vit b1 5 mg, vit b6 3 mg vit b12 5 mcg therapeutic tab / cap , vitamin e200 mg cap , vitamin e400 mg cap , voglibose 0.3 mg tab , widal test kit , zokon as kit , zolendronic acid 5 mg inj , zolpidem 10 mg tab...

North Western Railway - Rajasthan

32981569 supply of growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs)growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs),growth hormone inj.10mg/1.5ml(somatotropin inj.10mgpfs)...

Medical College - Rajasthan

32913744 rate contract of drug and medicine rate contract of drug and medicine , rate contract of drug and medicine , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder 110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , susp. azithromycin oral suspension 100mg / 5ml , susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , sugammadex 100 mg / ml 2ml , sugammadex 100 mg / ml 5ml , iodixanol 320mg / 100 ml polypropylene vial , iodixanol 320mg / 50 ml polypropylene vial , inj. cis atracurium besylate 2 mg / ml in 10 ml vial , ketoprofen ip 30 mg , micronized flavonoids 500mg ( 90% diosmin + 10% hesperidin ) , nitroglycerine 5mg / ml , trenxaemic acid 500mg , glycopyorolate 0.2mg / ml , n.acetyl cysteine 600mg , benzathine penicilline 1.2 million unit , methyl prednisolone 500mg , methyl prednisolone 1gm , dobutamine 12.5mg / ml , linezolid 600mg , terlipresin 1mg / 10 ml , co trimaxazole 800+160 , mesalamine 1200mg , levitiracetam 500mg , beta histine 16mg , chloramphenicol 500mg , activated charcol , milk of magnisia , trimetazidine 35mg , levocarnitine 500mg , piracetam 500mg , feropenem 200mg , clobazam 10mg , sacubitril + valsartan 49mg + 51mg , mangnisium sulphate , serratiopeptidase 10mg , urodeoxycholic acid 300mg , hydroxy chloroquine 200mg , leflunamide 10mg , gadoteric acid 10ml...

Dr. S.N.Medical College - Rajasthan

32913288 drug and medicine drug and medicine as per enclosed list , drug and medicine , artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab100 mg ( monopoly ) , pemetrexed 100mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , ticarcillinand clavulanic acid , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , / susp. azithromycin oral suspension 100mg / 5ml , / susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml , inj. piperacillin 400mg & tazobactam 500mg , inj. meropenam 1gm , inj. ceftriaxone 1gm , usg guided nerve stimilation needle ( 360 ultra ) , 811 item no. ( detailed description as per technical specification and compliance sheet ) , 812 item no. ( detailed description as per technical specification and compliance sheet ) , 813 item no. ( detailed description as per technical specification and compliance sheet ) , 814 item no. ( detailed description as per technical specification and compliance sheet ) , 815 item no. ( detailed description as per technical specification and compliance sheet ) , 816 item no. ( detailed description as per technical specification and compliance sheet ) , 817 item no. ( detailed description as per technical specification and compliance sheet ) , 818 item no. ( detailed description as per technical specification and compliance sheet ) , 819 item no. ( detailed description as per technical specification and compliance sheet ) , 820 item no. ( detailed description as per technical specification and compliance sheet ) , 821 item no. ( detailed description as per technical specification and compliance sheet ) , 822 item no. ( detailed description as per technical specification and compliance sheet ) , 823 item no. ( detailed description as per technical specification and compliance sheet ) , 824 item no. ( detailed description as per technical specification and compliance sheet ) , 825 item no. ( detailed description as per technical specification and compliance sheet ) , 826 item no. ( detailed description as per technical specification and compliance sheet ) , 827 item no. ( detailed description as per technical specification and compliance sheet ) , 828 item no. ( detailed description as per technical specification and compliance sheet ) , 829 item no. ( detailed description as per technical specification and compliance sheet ) , 830 item no. ( detailed description as per technical specification and compliance sheet ) , 831 item no. ( detailed description as per technical specification and compliance sheet ) , 832 item no. ( detailed description as per technical specification and compliance sheet ) , 833 item no. ( detailed description as per technical specification and compliance sheet ) , 834 item no. ( detailed description as per technical specification and compliance sheet ) , 835 item no. ( detailed description as per technical specification and compliance sheet ) , 836 item no. ( detailed description as per technical specification and compliance sheet ) , 837 item no. ( detailed description as per technical specification and compliance sheet ) , 838 item no. ( detailed description as per technical specification and compliance sheet ) , 839 item no. ( detailed description as per technical specification and compliance sheet ) , 840 item no. ( detailed description as per technical specification and compliance sheet ) , 841 item no. ( detailed description as per technical specification and compliance sheet ) , 842 item no. ( detailed description as per technical specification and compliance sheet ) , 843 item no. ( detailed description as per technical specification and compliance sheet ) , 844 item no. ( detailed description as per technical specification and compliance sheet ) , 845 item no. ( detailed description as per technical specification and compliance sheet ) , 846 item no. ( detailed description as per technical specification and compliance sheet ) , 847 item no. ( detailed description as per technical specification and compliance sheet ) , 848 item no. ( detailed description as per technical specification and compliance sheet ) , 849 item no. ( detailed description as per technical specification and compliance sheet ) , 850 item no. ( detailed description as per technical specification and compliance sheet ) , 851 item no. ( detailed description as per technical specification and compliance sheet ) , 852 item no. ( detailed description as per technical specification and compliance sheet ) , 853 item no. ( detailed description as per technical specification and compliance sheet ) , 854 item no. ( detailed description as per technical specification and compliance sheet ) , 855 item no. ( detailed description as per technical specification and compliance sheet ) , 856 item no. ( detailed description as per technical specification and compliance sheet ) , 857 item no. ( detailed description as per technical specification and compliance sheet ) , 858 item no. ( detailed description as per technical specification and compliance sheet ) , 859 item no. ( detailed description as per technical specification and compliance sheet ) , 860 item no. ( detailed description as per technical specification and compliance sheet ) , 861 item no. ( detailed description as per technical specification and compliance sheet ) , 862 item no. ( detailed description as per technical specification and compliance sheet ) , 863 item no. ( detailed description as per technical specification and compliance sheet ) , 864 item no. ( detailed description as per technical specification and compliance sheet ) , 865 item no. ( detailed description as per technical specification and compliance sheet ) , 866 item no. ( detailed description as per technical specification and compliance sheet ) , 867 item no. ( detailed description as per technical specification and compliance sheet ) , 868 item no. ( detailed description as per technical specification and compliance sheet ) , 869 item no. ( detailed description as per technical specification and compliance sheet ) , 870 item no. ( detailed description as per technical specification and compliance sheet ) , 871 item no. ( detailed description as per technical specification and compliance sheet ) , 872 item no. ( detailed description as per technical specification and compliance sheet ) , 873 item no. ( detailed description as per technical specification and compliance sheet ) , 874 item no. ( detailed description as per technical specification and compliance sheet ) , 875 item no. ( detailed description as per technical specification and compliance sheet ) , 876 item no. ( detailed description as per technical specification and compliance sheet ) , 877 item no. ( detailed description as per technical specification and compliance sheet ) , 878 item no. ( detailed description as per technical specification and compliance sheet ) , 879 item no. ( detailed description as per technical specification and compliance sheet ) , 880 item no. ( detailed description as per technical specification and compliance sheet ) , 881 item no. ( detailed description as per technical specification and compliance sheet ) , 882 item no. ( detailed description as per technical specification and compliance sheet ) , 883 item no. ( detailed description as per technical specification and compliance sheet ) , 884 item no. ( detailed description as per technical specification and compliance sheet ) , 885 item no. ( detailed description as per technical specification and compliance sheet ) , 886 item no. ( detailed description as per technical specification and compliance sheet ) , 887 item no. ( detailed description as per technical specification and compliance sheet ) , 888 item no. ( detailed description as per technical specification and compliance sheet ) , 889 item no. ( detailed description as per technical specification and compliance sheet ) , 890 item no. ( detailed description as per technical specification and compliance sheet ) , 891 item no. ( detailed description as per technical specification and compliance sheet ) , 892 item no. ( detailed description as per technical specification and compliance sheet ) , 893 item no. ( detailed description as per technical specification and compliance sheet ) , 894 item no. ( detailed description as per technical specification and compliance sheet ) , 895 item no. ( detailed description as per technical specification and compliance sheet ) , 896 item no. ( detailed description as per technical specification and compliance sheet ) , 897 item no. ( detailed description as per technical specification and compliance sheet ) , 898 item no. ( detailed description as per technical specification and compliance sheet ) , 899 item no. ( detailed description as per technical specification and compliance sheet ) , 900 item no. ( detailed description as per technical specification and compliance sheet ) , 901 item no. ( detailed description as per technical specification and compliance sheet ) , 902 item no. ( detailed description as per technical specification and compliance sheet ) , 903 item no. ( detailed description as per technical specification and compliance sheet ) , 904 item no. ( detailed description as per technical specification and compliance sheet ) , 905 item no. ( detailed description as per technical specification and compliance sheet ) , 906 item no. ( detailed description as per technical specification and compliance sheet ) , 907 item no. ( detailed description as per technical specification and compliance sheet ) , 908 item no. ( detailed description as per technical specification and compliance sheet ) , 909 item no. ( detailed description as per technical specification and compliance sheet ) , 910 item no. ( detailed description as per technical specification and compliance sheet ) , 911 item no. ( detailed description as per technical specification and compliance sheet ) , 912 item no. ( detailed description as per technical specification and compliance sheet ) , 913 item no. ( detailed description as per technical specification and compliance sheet ) , 914 item no. ( detailed description as per technical specification and compliance sheet ) , 915 item no. ( detailed description as per technical specification and compliance sheet ) , 916 item no. ( detailed description as per technical specification and compliance sheet ) , 917 item no. ( detailed description as per technical specification and compliance sheet ) , 918 item no. ( detailed description as per technical specification and compliance sheet ) , 919 item no. ( detailed description as per technical specification and compliance sheet ) , 920 item no. ( detailed description as per technical specification and compliance sheet ) , 921 item no. ( detailed description as per technical specification and compliance sheet ) , 922 item no. ( detailed description as per technical specification and compliance sheet ) , 923 item no. ( detailed description as per technical specification and compliance sheet ) , 924 item no. ( detailed description as per technical specification and compliance sheet ) , 925 item no. ( detailed description as per technical specification and compliance sheet ) , 926 item no. ( detailed description as per technical specification and compliance sheet ) , 927 item no. ( detailed description as per technical specification and compliance sheet ) , 928 item no. ( detailed description as per technical specification and compliance sheet ) , 929 item no. ( detailed description as per technical specification and compliance sheet ) , 930 item no. ( detailed description as per technical specification and compliance sheet ) , 931 item no. ( detailed description as per technical specification and compliance sheet ) , 932 item no. ( detailed description as per technical specification and compliance sheet ) , 933 item no. ( detailed description as per technical specification and compliance sheet ) ...

Medical College - Rajasthan

32909627 supply of drug and medicine injection tablet syrup capsule syringe ear and eye drops , capsule , drug , tablets , cream ointment , etc artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20 ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , / susp. azithromycin oral suspension 100mg / 5ml , / susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml angnisium sulphate , gadoterci acid activatyed charcol powder , syrup , milk of magnisia ketoprofen ruxolitinib inhaler , syrup lidocaine spray superoxideized mesaiazine , glycerin , sachet , polyethyene gluycol with elctrolyte solution nrd soxoumcnonde3%? 459 nrd toropwum brtmmde ry powde 30!pad 460 [ 41? — nrd r.voiizadruwaerdrnce? 461 __ root can seaer ( caici0m carbonate ) ir io lis __.._ respe’a s i 456 nrd4 46 nrd4 57 8udesonde 0 5mohs gtycopyrroraurm 25rncg i nh&ation 2n nrd4 48 respdeo 457 458 459 460 462 nrd4 62 respue s 463 464 nrd. 463 nad4 44 foefcm 3gm hw ospretemr sad glycd+ 455 catbonate.pota$s#$ c?iorde • r • c zinc oxide alo vera semethicone tacrolimus , cafflene citrate oral solution mercunium chloride , salicylic acid , coloplast eed , dicofenac each trasnsdermal patch contain povidone iodine milk low birth formula powder formoterol , leosafbutamol , mdi lignocaine hydrogen peroxide mouth wash , nasal spray asceptic lotion clotrimazole , ketaconazole minoxideil lotion podophyline toxin eye drop dpi ointment cream respule , etc gadoteric acid 10 ml vial 748 749 750 751 rifampicin 450 mg rifampiein 600 mg ritatiminn 200 rifaximin 550mg each tab. each tab. each tab. 747 rifampicin is0 mg each tab. — 752 rivaroxahan 10mg each tab. 753 754 rivaroxaban lsmg rivaroxaban 20mg each tab. each tab. 755 756 riatriptan 10mg — ropinirole 0.25mg each tab. each tab. 757 rosunastatin 10mg + fenofibrate 160mg each tab. 758 ruxolitinib 5 mg each tab. 759 ruxoliginib 10 mg each tab. 7640 ruxolitinib is mg each tab. 761 ruxolitinib 20 mg each tab. 762 selegiline 5mg each tab. 763 serratiopcptidase 10mg each ‘[ab. 764 serratiopcptidase 20 mg each tab 765 sevelamer carbonate 800 mg each tab. 766 )67 sildosin + dutasteride silymarin 70mg. each tab. each tab. 768 sitagliptine + metformin (50/500) each tab. 769 sildcnafil 2o mg each ‘lab. 770 sofosbuv ir 400 mg+ velpatas ir 100 each l’ab. 771 mg solifenacin succinate 10 mg each tab. 772 sorafenib 200 mg ________ each tab. 773 sultamicin 375 mg ehach tab, 774 sunitinib 12.5 mg each tab. 775 sun itinib 25 mg each tab. 776 sunitinib 50 mg each tab. “ tacrolimus 1mg each tab. each tab. ‘78. lamsulosin + dutasteride 779 tapentadol 50mg each tab. tegafur + uracil 100 mg efach tab. 781 tctrabenaiine 25mg i icagrelor 9omg each tab. each tab. ‘82 783 tofacitinib5mg each tab. 7s4. tokapatan 15mg each lab. 85 lopiramate 5omg leach tab. 86 lorsernide 20mg each tab. — 787 trarnadol 3 7.5mg + paracetamol 325mg 1 ach tab. 88 trametinib 0.5mg + davarafenide 150mg (monopol>) fa h tab c 789 [rimnetaiidine 35mg each tab. 790 trimetazidine 60mg each tab. 791 [rypsin + rutoside+bromelain each tab. ‘92 verapamil hvdrochloride sustained release 40 each tab. 791 verapamil hvdrochloride sustained release 120 each tab. 793 verapamil hydrochloride sustained release 120 each tab. 794 vildagliptin 50mg each tab. 795 voglibose 0.2 mg tab each tab. 796 voglibose 0.3 mg tab each tab. 797 warfarin i mg each tab. 798 warfarin 2mg each tab. 799 warfarin 3mg each tab. 800 zinc 50mg each tab. 801 lolpidem 10mg each tab. 802 zonisamide 50mg each tab. 803 zonisamide 100 mg each tab. 804 tioropium 9mncg inhaler each inhaler 05 human albumin 20% in 50 ml vial each inj. 806 tetanus vaccine (adsorbed) ip in 0.5 ml each inj. 807 lni. piperacillin 400mg & tazobactan 5o0mg each lnj. 808 lnj. meropenam 1gm each inj. 809 lni. cefiriaxone 1gm each lnu. 810 usg guided nerve stimilation needle (360 ultra) each needle etc ...

Government Hospital - Rajasthan

32882272 rate contract of nrd drug and medicines injection tablet syrup capsule syringe ear and eye drops , capsule , drug , tablets , cream ointment , etc artificial saliva , balanced salt calcium free 1000 ml [ solution ] , non pvc polyolefin sterile free flex bag , alpha+lipoic acid + leycopen +multivitamin and miltiminerals , glucosamine + hydrochloride +methylsulfonylmethane , racecadotril 100mg , rabeprazole +levosulpiride , acitretin 10 mg , acitretin 25 mg , alectinib 150 mg ( monopoly ) , all trans retinoic acid 10 mg , anti oxidants ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) , aprepitant 125 mg , budesonide 9 mg , calcium dobesilate 500mg , ceritinib 50 mg , ceritinib 100 mg , ceritinib 200 mg , ceritinib 250mg , clomipramineip 25 mg , cyclosporine 100 mg , dacarbazine 200 mg , danazol 100mg , eveningprimosa 1000 mg , formetrol 12mcg + budesonide 400 mcg. , indacaterol andglycopyronium inhalation powder110 / 50 mcg , isotretinoin 10mg , isotretinoin 20 mg , lomustine 40 mg , minocycline 100mg. , mycophenolate mofetil 500mg , netupitant + palonosetron 300 mg + 0.5 mg , ramiprilip 5 mg , rucaparib 200 mg , rucaparib300 mg , silodosin 4 mg , silodosin 8 mg , temozolamide 250 mg , vitamin a 25000 iu , carbolic acid 50% in 500 ml , carbolic acid 100% in 500 ml , continuous ambulatory peritoneal dialysis fluid 2 ltr , lidocaine 25 mg + prilocaine25mg , / ointment ( modified lanolin ) , aloe vera moisturizing , amophous hydrogel with colloid silver wound dressing , amorolfine 0.25% , azelaic acid 20% , benzoyl peroxide 2.5 % , desonide0.05% , fenticonazole 2% , glycolic acid 6% , hydrocortisone 1% , hydroquinone 2% , kojic acid 2%, arbutin, niacinamide , luliconazole 1% , mometasone 0.1 % , mometasone 2% , neomycin sulphate cream , permethrin 1%rinse , adaplene ( 0.1% w / w ) , desfluraneusp 240 ml bottle , dextrose with sod.chloride polypack 5% 500ml , distilled water 10ml , sodium chloride and dextrose0.45% infusion 500ml , salmetrol 50mcg+fluticasone 500 mcg , budesonide 400 mcg , glycopyrronium 25 + formoterol 6 mcg , glycopyrronium 25 , glycopyrronium 50 , levosalbutamol 100mcg+ ipratropium bromide 40mcg , diastasepepsin with simethicone 15 ml , furosemide 10mg / ml , ondansetron oral solution 30 ml , prednisolone acetate opthalmic suspension 10 ml , terbutalin , hydroxyzine oral solution 15 ml , ambroxol , anticold , astyminec ( vitamin c+ essential amino acid ) , enzyme , iron ( ferrous ascorbate ) , simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml , vitamin – e50mg / ml, 400 iu , vitamin d3 400iu / ml , vitamin d3 800iu / ml , cefpodoxime oral suspension 20mg / ml , lactulose , docosahexaenoic 30ml , acetic acid otic solution 2% , gentamycin , digoxin 0.25% , carboxymethylcellulose + glycerin , moxifloxacin+ difluoprednate , natamycin opthalmic suspension 5% , olaptadine & ketorolac , polymyxin b 10000iu / gm + neomycin 3400iu / gm , betadin 5% , brinozolamide+brimonidine , cpm+cmc+nephazoline , cyclopentolate 1% , dorzolamide 2% , fluromethalone 0.1% , gatifloxacin+prednisolone , hpmc 0.3% , itraconazole 1% , loteprednol 0.25% , moxifloxacin 0.5%+ketorolac tromethamine 0.5% , moxifloxacin and dexamethasone , moxifloxacin and prednisolone , nepafenac 0.1% , oloptadine opthalmic solution0.1% , pilocarpine , prednisolone sodium phosphate1% , proparacaine 0.5% w / v , sodium chloride 5 % , sulfacetamide 20% , travapost+timolol , tropicamide+phenylepherine , voriconazole , azithromycin 1% , chloramphenicol0.5% , chloramphenicol +polymycin , chloramphenicol +polymycine + dexamethasone , ganciclovir 0.15% , itraconazole 1% , moxifloxacin0.5% , sodium chloride 6% , povidone iodine , gatifloxacin 0.3% , diltiazem 2%p / r , nifedipine + lidocaine p / r , glycine irrigation solution 1.5% 3ltr , esmoprazole 10mg , hormonalintra uterine device , hp kit ( pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg , hydrocortisone oromucosal 5 mg , hydrocortisone oromucosal10 mg , hydrocortisone oromucosal 20 mg , hydrogen 11% + silver nitrate .01% , tiotropium + glycopyrolate 25mg , metoprolol 5ml vial , docetaxel 20mg , docetaxel 80 mg , folinic acid 200mg / vial , sodium chloride 3% 100ml , acth synacthen 250 mcg , adalimumab 40 mg , ado trastuzumab 100 mg , ado trastuzumab 160 mg , alpha beta arteether 2 ml , prostaglandin 500mcg / ml , aminocaproicacid 20 ml , amoxycillin & clavulanic acid 300 mg , ampicillin + salbactum 1.5g , progesterone injection 50 , artesunate 120 mg , atezolizumab 1200 mg ( monopoly ) , avelumab 200 mg ( monopoly ) , azacitidine 50mg , azacitidine 100mg , azithromycin 10 ml vial equaivelent to 500 mg , bacitracin for injection 25, 000 iu , bortezomib 2.5 , botulinum toxin type a for injection / botulinum toxin type b for injection100 iu , botulinum toxin type a for injection / botulinum toxin type b for injection50 iu , busulfan 60mg / 1ml , cabazitaxel 20 mg , cabazitaxel 40 mg , caffeine cirate 20mg / ml , calcium chloride 5ml vial , calcium gluconate / folinate , carbetocin 1ml / 100micro. , carfilzomib 20 mg , carfilzomib 60 mg , carmustine 100 mg , caspofungin 50 mg , caspofungin 70 mg , cefipime 1000mg + tazobactum 125mg , cefoperazone 1gm+tazobactum 125mg , cefoperazone 500mg , ceftazidime 1gm+sulbactam500 mg , ceftazidime+ avibactum 2gm+500mg , ceftizoxime 1 gm , ceftriaxoneip 125 mg , ceftriaxone +salbactum+ disodium edta , ceftriaxone and sulbactam 1.5g , ceftriaxone1000mg+ tazobactom125mg , cefuroxime 1gm , cetrorelix acetate 0.25 mg , cetuximab 100 mg , cetuximab 500mg , chloramphenicol 1gm / vial , cladrabine 10 mg , clarithromycin 500mg , clindamycin600mg / 4ml , clonidine 150mcg / ml , compound sodium lactate ( ringer lactate ) in glass bottle 500ml , crystilline penicillin 2 lakh , cytarabine 1000 mg , d penicillamine 250mg , dextrose 5% 500 mlglass bottle , daratumumab 100 mg ( monopoly ) , daratumumab400 mg ( monopoly ) , darbepoietin alfa 100mcg , darbepoietin alfa 200 mcg , darbepoietin alfa 500mcg , decitabine 50 mg , decitabine 100 mg , degarelix 80 mg , degarelix 120 mg , degludec insulin 300iu / 3ml , denosumab 120 mg , deriphylline 1 ampul , detemir insuline , dexmedetomidine 100mcg / ml , dextran 40 , diazoxide 300 mg / 20ml , digoxin 2mg , diltiazem 25 mg , docetaxel 120 mg , doxycycline for injection 100 mg , durvalumab 120 mg ( monopoly ) , durvalumab 500mg ( monopoly ) , enalapril1.25 mg 1 ml , ephedrine 30 mg / ml , epirubicin 50mg / ml , epirubicin 150mg / ml , eribulin 0.5mg , eribulin 1 mg , ertapenem sodium 1gm = ertapenem 1.046 gm , etomidate 20 mg , etomidate mct / lct 10ml vial , fentanyl 25iu patch , fentanyl 50iu patch , fluconazole 100mg , fluconazole 200 mg , fludarabine phosphate injection 100mg , fludarabine phosphate injection 50mg , fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography , fluphenazine deconate injection ( long acting ) 25mg / ml ampule , folic acid +methylcobalamine 10 ml pack , fondaparinux 2.5mg , fosphenytoin sodium 150mg / ml , fsh 75 iu , fsh 150 iu , fulvestrant 250mg , gdw 5% glass bottle / 500ml , glyceryl trinitrate injection, diluted 5mg / ml , goserelin acetate implant 3.6 mg , haemocoagulase1 ml , haloperidol ( long acting ) 50mg / ml ampoule , horse atg ( anti thymocyte globulin ) 250 mg , hp hmg ( highly human menopausal parodiedgonadotropin ) 150 iu , hp hmg ( highly human menopausal parodiedgonadotropin ) 75 iu , hydralazine 20mg / ml , indomethacin lyophilized powder 1mg , inotuzumab1 mg ( monopoly ) , insulinaspart , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml cartridges , insulinglulisine ( monocomponent insulin glulisine ) 100 iu / ml / 3 ml prefilled pen , insulin lispro , interferon beta 1 a 30mg , intralipds , invert sugar 10% ( fructodex 10% ) 500 cc , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution, 300 mg lodine / ml non ionic 50 ml , ipilimumab 50 mg , irinotecan 40mg / 5ml , irinotecan 100 mg / 5ml , isolyte g , isolyte p 10% 500 ml , lacosamide infusion , levobupivacaine 0.5% ( 20mg / 4ml ) ampule , levofloxacine 500mg / 100 ml , levosulpride 12.5 mg / ml , lignocaine ( preservative free ) 2% , lignocaine + adrenaline ( 1:10000, 2:10000 ) , lignocaine 10% spray , lignocaine hydrochloride 2% 50ml vial , liposomal doxorubicin 20mg , liposomal doxorubicin 50 mg , lorazepam 1.0 mg , lorazepam5 mg , l orinithine l aspartate 10 ml , low molecular wt. heparin 0.4mg , mephentermine 50mg / ml , meropenem 2gm , mesna 200 mg / 2ml ( sod. mercaptoethane sulphate ) , methotrexate 250 mg , methotrexate 1000 mg , methylene blue , methylprednisolon acetate40mg , methylprednisolon acetate 125mg , metotrexate 15mg ( preservative free ) , midazolam 5mg / ml 1 ml , milrinone 10 mg , mitomycin 2 mg , mitomycin 40 mg , mitoxanthrone infusion 10 mg , mitoxanthrone infusion 20mg , moxifloxacin intra cameral 0.5% , moxifloxin 400mg / 100ml , multivitamin 10 ml , nabpaclitaxel ( paclitaxel nano particle ) 100 mg , nandrolone decanoate 100mg , nandrolone decanoate 50 mg , natalizumab 300 mg ( monopoly ) , neostigmine+ glycopyrrolate2.5 mg / 0.5 mg , netilmycin 300mg / 3ml , nicardipin 10mg , nicorandil 48 mg , nimodipine infusion 10mg / 50 ml , nimotuzumab 50 mg , nivolumab 40 mg ( monopoly ) , nivolumab 100 mg ( monopoly ) , normal saline 500 mlglass bottle , normal saline 1000 mlglass bottle , octreotide 100mg , octreotide lar ( long acting release ) 20 mg , octreotide lar ( long acting release ) 30 mg , lidocaine1% intra cameral , omalizumab 150 mg vial , ornidazole 500mg , palonosetron 0.25mg , paracetamol infusion 500 mg with both temper evident caps spray 10% , paracetamol infusion 1000 mg with both temper evident caps spray 10% , peg asparaginase 3750 iu 5 ml , peg filgrastim injection 6mg , pembrolizumab 50 mg ( monopoly ) , pembrolizumab100 mg ( monopoly ) , pemetrexed 100mg , pemetrexed 500 mg , pertuzumab 100 mg , phenylephrine hydrochloride10 mg / ml , pilocarpine 0.5% w / v , piperacillin 1 gm + tazobactum 125 mg , piracetam 200mg , placental extract 2ml , plerixafor 24 mg , polymyxin b for injection 1 million , potassium chloride for injection , procaine penicillin fortified 2 lack , protamine sulphate 5ml , rabbit atg ( anti thymocyte globulin ) 100 mg , ramucirumab 100 mg ( monopoly ) , ramucirumab 500 mg ( monopoly ) , ranizumab 10mg / ml , rasburicase 1.5 mg , recombinant fsh 150 iu , recombinant fsh 300iu , recombinant hcg 250 iu , recombinant lh 75iu , reteplase 18 mg , risperidone prolonged releaseddepot 25 mg , risperidone prolonged releaseddepot 50mg , rituximab 100 mg , rituximab500 mg , rocuronium 100mg / 10ml , romiplostim 125 mcg , romiplostim 250 mcg , romiplostim 500 mcg , ropivacaine 0.75% 20ml vial , ropivacaine 0.75% 3 ml ampule ( heavy ) , secukinumab 150 mg , sildenafil 0.8mg , sodium bicarbonate injection , sodium fluroresceinedye 20% , sodium hyaluronate 1.4mg , streptomycin1gm , streptomycin500mg , sugmadex , teicoplanin 200 mg , teicoplanin 400 mg , tenecteplase 20mg , tenecteplase 40 mg , testosteron propionate 50mg , testosteron propionate 250mg , thiamine 100ml , ticarcillinand clavulanic acid , tigecycline for injection 50mg , tigecycline for injection 100mg , tobaramycin 80mg , topotecan1 mg , topotecan 2.5 mg , topotecan 4 mg , t pa 20mg alteplase for injection , t pa 50mg alteplase for injection , trabectedin 1 mg , tranexamic acid 500mg / 5ml , trastuzumab 440 mg , trastuzumab150mg , triamcinolone acetonide 10 mg per ml , triamcinolone acetonide 40 mg per ml , trypan blue 0.6% , triptorelin 0.1 mg , triptorelin 3.75 mg , triptorelin 11.25 mg , varicella immunoglobulin for iv use , vasopressin 3ml , verapamil2.5 mg / ml , vinorelbine 10mg , vinorelbine 50mg , vitamin d ( 600000 iu ) , insulin glargine300 iu per ml / prefilled pen , insuline 50 / 50 , xylocaine lubricating30gm , lignocaine 4%30ml , lignocaine viscous , liver specific mri contrast agent ( gadobenate disodium ( gd bopta ) , gadoxetate disodium ( gd eob dtpa ) , mangafodipirtri sodium ( mn dpdp ) , ferumoxide, ferucarbotran ) , l ornithine l aspartate ( 150mg ) + pancreatin ( 100mg ) , asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% , clotrimazole 1%+beclomethasone 0.25% , ketaconazole 2% , minoxidil 2% , minoxidil 5% , minoxidil 10 % , podophyliin toxin , sulphur + calamine , sunscreen ( octinoxate, avobenzone , oxybenzone ) spf 30 , clotrimazole 10mg , ( medium chain triglyceride ) , budesonide 200 mcg. , formeterol 6mcg.+ fluticasone 250 mcg. inhalation , formoterol 6 mcg. + budesonide 200 mcg. , formoterol 6 mcg. + budesonide 400 mcg. , leosalbutamol 50mcg.+ ipratopium 40mcg. , levosalbutamol inhalation solution 50ml / gm , lignocaine 1% , 1.5% hydrogen peroxide , fluticasone ft , midazolam 0.5mg / 5ml , neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu / gm , sodium chloride 0.9% 3000ml ( n.s ) , sodium chloride bottel 100ml , magnesium sulphate, sulphacetamide, urea 75 gm , clobetasol+salicylic acid 0.5%+6% , heparin 50 iu benzyl nicotinate 2 mg , fluticasone , neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip , tacrolimus 0 .03%15 gm , tacrolimus 0 .1% 15 gm , zinc oxide +alo vera +semethicone , omega 3fatty acid 50ml , caffiene citrate oral solution , mercunium chloride , salicylic acid 16.7% + lactic acid 16.7% , coloplast60 gm , eeg 400gm , diclofenac each transdermal patch contain 200 mg diclofenac , povidone iodine , milk low birth formula , recombinant human growth hormone 4iu vial with syringe , enterogermina 2billion spores 5ml , formeterol 20mcg +budesonide 0.5mg , levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml , n acetylcysteine ( nac ) 200mg / ml , budesonide 0.5mg / ml , budesonide 1ml , glycopyrronium 25mcg. inhalation 2ml. , sodium chloride 3 % , tiotropium bromide dry powder30 / pack , revolizer / rotahaler device , root canal sealer ( calcium carbonate ) , fosfomycin3gm , hmffor pretem , l arginine+proanthocynadine granules 3mg , polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride , racecadotril sachet 30 mg , etanercept 25mg / 0.5ml , polyethyene glycol with elctrolyte approx 130gm , lidocaine10%20ml , superoxidized , mesalazine , glycerin2 gm / ml , paracetamol 170 mg each suppsitory contain paracetamol 170 mg , cefaclor each 5 ml contain cefaclor 125 mg , codienephosphate , amlodipine oral solution 1 mg / ml , artemether 40mg + lumefantrine 240 mg 30ml , b. complex , baclofen oral solution 5 mg / ml , calcium phosphate 200 ml , cefixime oral suspension50mg , cefixime oral suspension 100mg , cefpodoxime proxetil oral suspension 50mg , cefpodoxime proxetil oral suspension 100mg , cefuroxime axetil oral suspension 125mg / 5ml , clarithromycin for oral suspension 125mg / 5ml , cefoperazone 1mg inj. , cyclosporine oral solution 100mg / ml , rabbit atg ( anti thymocyte globulin ) 250 mg , cyproheptadine200ml , dextromethorphan hcl + chlorpheniramine , diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg / ml 30 ml , drotavarine , each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml , each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml , enzyme 100 ml , esomperazole , fluconazole oral suspension , furosemide oral solution 10mg / 30ml , l carnitine 500mg / 5ml in 30 ml , l carnosine 100mg / 5ml in 200ml , levofloxacin oral solution , linezolid 100mg / 5ml in 30ml , mefenamice acid 100mg / 5ml , mefenemic acid 50 mg + paracetamol 250 mg / 60 ml , melatonin 60 ml , montelucast+levocetrizine , nitrofurantoin oral suspension 25mg / 5ml in 100 , ondansetron oral suspension , oxybutynin oral suspension5 ml , phenobarbitone 20mg / 5ml in 100ml , prednisoloneip 50mg , piracetam 500mg / 5ml in 100ml , potassium magnesium citrate , ranitidine oral suspension , rifaximin , sodium bicarbonate oral suspension , sodium picosulphate oral suspension , sorbitol + tricholine citrate , sucralphate , triclofos oral suspension500 mg / 5mlin 30ml , ursodeoxycholic oral suspension 125mg / 5ml in 100ml , zinc oral suspension 20 mg / 100 ml , / susp. azithromycin oral suspension 100mg / 5ml , / susp. azithromycin oral suspension 200mg / 5ml , midodrine 5mg , hydroxyurea 500mg , coq 300mg ( capsule of co enzyme q10 with lycopene, selenium & omega 3 fatty acid ) , everolimus 5mg , everolimus 10mg , tacrolimus 0.25 , nintedanib 150mg , 6 mercaptopurine 20 mg , acebrophylline sr 200 mg , aceclofenac + thiocolchicoside , aceclofenac sr 200 mg , aceclofenac+paracetamol+ serratiopeptidase ( 100+325+15 mg ) , afatinib 20 mg , afatinib 30 mg , afatinib 40 mg , alendronate sodium 70 mg , alfuzosin 10 mg , alpelisib 150 mg ( monopoly ) , alpelisib 200 mg ( monopoly ) , alpelisib 250 mg ( monopoly ) , amantidine 100mg , amisulpride 50 mg , apixaban 2.5 mg , apixaban 5mg , aripiprazole 10 mg , aripiprazole 5 mg , aspirinip 300 mg , aspirin dispresible 325mg , atomoxetin 10 mg , atomoxetin 18 mg , atomoxetin 25 mg , atroxentine 250mg ( trientine hcl ) , axitinib 5 mg , bilastin 20 mg , biotin 5 mg , bosentan62.5 mg , bosutinib 500 mg , brivaracetam 50mg , buprinorphine 2 mg , calcium acetate 667 , calcium folinate 15 mg , capmatinib 200 mg ( monopoly ) , carbimazole 10 mg , cefixime + potassium clavulanate 200+125mg , cefpodoxime proxetil 100mg , cefpodoxime 200mg , cefpodoxime cv 375 , chlordiazepoxide 25 mg , chlordiazsepoxide 10 mg + clidinium 25 mg , chlorthalidone 6.25 mg , cholchicine 0.5mg , cilostazol 50mg , cilostazol 100mg , clarithromycin 250 mg , clarithromycin 500mg , cilnidipine 5 mg , cilnidipine10 mg , cilnidipine 20 mg , clonazepam 0.25 , clonazepam 1mg , clozapine 25 mg , clozapine 50 mg , clozapine 100 mg , cotriamazole 480mgs , cefuroxime axetil500 mg. , cyproheptadine 4mg , cyproterone acetate 2 mg +ethynil estradiol. 035mg , dabigatran 150 mg , dabigatran 110 mg , dabrafenib 50 mg , dacomitinib 15 mg ( monopoly ) , dacomitinib 30 mg ( monopoly ) , dapagliflozin 10 mg , dapoxetine 30 mg , dapsone 100 mg , deflazacort 6mg , deflazacort 12 mg , desvenlafaxine 50mg , diclo & sera& para. , diclofenac + thiocolchicoside , dienogest 2mg , diltiazemprolonged released90mg , dimethyl fumarate120 mg , dimethyl fumarate 240mg , disulfiram 125 mg , disulfiram 250mg , donepezil 5 mg , duloxetine gastro resistant 20 mg , duloxitine gastro resistant30 mg , dydrogesterone 10mg , eltrombopag 25mg , eltrombopag 50mg , empagliflazone 10mg , empagliflazone 25mg , entacapone 200 mg , erlotinib 150 mg , erlotinib 100mg , esomeprazole 40 mg , estradiolvalerate 2 mg , estradiolvalerate , enzalupamide 40mg , ethynil estradiol 0.02mg+ tab desogestral 0.15mg , etizolam 0.5 mg , etoricoxib+thiocolchicoside ( 60+8 mg ) , exemestane 25 mg , febuxostat 40 mg , febuxostat 80 mg , fexofenadine120 mg , fexofenadine180 mg , fingolimod 0.5 mg , fludrocortisone 100mcg , flunarizine 10mg , fluvoxamine 100 mg , fluvoxamine 50 mg , folinic acid 15mg , formaline , furosemide 20mg + spironolactone 50mg , glucosamine hydrocloride + diacerin 50 mg , ibrutinib 140mg , indomethacin 75 mg sr , inositol + myoinositol 1000mg , ivabradine 5mg , ivermectin 6 mg + albendazole 400 mg , ivermectin 6mg , ivermectin 12mg , ketoconazole 200 mg , lacosamide 50 mg , lamotrigine dispersible 100mg , lapatinib 500mg , lenalidomide25mg , lenalidomide 10 mg , lenvatinib 4 mg , lenvatinib 10 mg , levetiracetamip 250 mg , levodopa+carbidopa 125 , levodopa+carbidopa+entacapone 100mg / 25mg / 200mg , levofloxacin 750 mg , levosulpride 75mg , levothyroxine sodium25 mcg , levothyroxine sodium75 mcg , linaglipitin 2.5mg , linaglipitin 5mg , lopinavir 200mg+ritonavir 50 mg , loratadine 10 mg , lorlatinib 25 mg , lorlatinib 100 mg , megestrol acetate 160 mg , melatonin 3 mg , melphalan 2mg , metolazone 5mg , methimazole5 mg , methimazole10mg , methotrexate 7.5mg , methotrexate 15mg , methylphenidate 10 mg , methylprednisolone4mg , methylprednisolone 16mg , methylprednisolone 8mg , meverberine 135 mg + chlordiazepoxide 10 mg , midostaurin 25 mg ( monopoly ) , mirabegeron 25 mg , mirabegeron50 mg , mirtazapine 7.5mg , mirtazapine 15mg , mifepristone25mg , montelukast 4mg , montelukast 5 mg , montelukast 10 mg , morphine10mg , morphine30mg , moxifloxacin400 mg , moxonidine 0.2 mg , moxonidine 0.3 mg , n acetylecystine effervescent form, orange flavour, 600 mg , naltrexone50 mg , nebivolol 5mg , nebivolol 10mg , nicorandil 5mg , nicoumalone 1 mg , nicoumalone 3 mg , nicoumalone 4 mg , nifidipine 20mg , nifidipine 20mg sr , nilotinib 150 mg ( monopoly ) , nilotinib200 mg ( monopoly ) , nilotinib 300mg ( monopoly ) , nitazoxanide 500mg , nitrazepam 5mg , nitrazepam 10 mg , olaparib 50 mg ( monopoly ) , olaparib 150 mg ( monopoly ) , olmesartan medoxomil 20 mg , orciprenaline 10 mg , osimertinib 80 mg ( monopoly ) , oxcarbazepine 300mg , oxcarbazepine 450mg , oxazepam 15mg , pancreatin gastroresistant 10, 000mg ( with proteiase & amylase ) , pantoprazole 20mg , paracetomol 650 mg , paroxetine 12.5mg , paroxetine 25mg , pazopanib 200mg , pazopanib 400mg , penicillin v 400mg , pentoxifylline extended release / sr 400mg , perampanel 2 mg , perampanel 4mg , pheniramine 25 mg , phenozopyridine 200mg , pirfenidone 200 mg , pirfenidone 400 mg , piroxicam dt 20mg , pomalidomide 2 mg , pomalidomide 4 mg , posacozazole 100mg , posacozazole 40mg / ml , prasugrel 10mg tab , prazosin 5mg , prednisoloneip 40mg , primidone 50 mg , primidone 250 mg , prochlorperazine 5mg , progesterone only pills , propranolol 10mg , propranolol 40 mg sr , propylthiouracil 100 mg , pyridoxine100 mg , ranolazine 500mg , rasagiline1mg , regorafenib 40 mg , repaglinamide 0.5mg , repaglinamide 1mg , ribociclib 200 mg ( monopoly ) , rifampicin 150 mg , rifampicin 450 mg , rifampicin 600 mg , rifaximin 200 , rifaximin 550mg , rivaroxaban 10mg , rivaroxaban 15mg , rivaroxaban 20mg , rizatriptan 10mg , ropinirole 0.25mg , rosuvastatin 10mg + fenofibrate 160mg , ruxolitinib 5 mg , ruxolitinib 10 mg , ruxolitinib 15 mg , ruxolitinib 20 mg , selegiline 5mg , serratiopeptidase 10mg , serratiopeptidase 20 mg , sevelamer carbonate 800 mg , sildosin + dutasteride , silymarin 70mg. , sitagliptine + metformin ( 50 / 500 ) , sildenafil 20 mg , sofosbuvir 400 mg+ velpatasvir 100 mg , solifenacin succinate10 mg , sorafenib 200 mg , sultamicin 375 mg , sunitinib 12.5 mg , sunitinib 25 mg , sunitinib 50 mg , tacrolimus 1mg , tamsulosin + dutasteride , tapentadol50mg , tegafur + uracil 100 mg , tenofovir 300mg , tetrabenazine 25mg , ticagrelor 90mg , tofacitinib 5 mg , tolvapatan 15mg , topiramate50mg , torsemide20mg , tramadol 37.5mg + paracetamol 325mg , trametinib 0.5mg + davarafenide 150mg ( monopoly ) , trimetazidine 35mg , trimetazidine 60mg , trypsin + rutoside+bromelain , trypsin chymotripsin , ulipristal 5mg , voriconazole 200 mg , verapamil hydrochloride sustained release 40 , verapamil hydrochloride sustained release 120 , vildagliptin 50mg , voglibose 0.2 mg tab , voglibose 0.3 mg tab , warfarin 1mg , warfarin 2mg , warfarin 3mg , zinc 50mg , zolpidem 10mg , zonisamide 50mg , zonisamide 100 mg , tiotropium 9mcg inhaler , human albumin 20% in 50 ml vial , tetanus vaccine ( adsorbed ) ip in 0.5 ml angnisium sulphate , gadoterci acid activatyed charcol powder , syrup , milk of magnisia ketoprofen ruxolitinib inhaler , syrup lidocaine spray superoxideized mesaiazine , glycerin , sachet , polyethyene gluycol with elctrolyte solution nrd soxoumcnonde3%? 459 nrd toropwum brtmmde ry powde 30!pad 460 [41? — nrd r.voiizadruwaerdrnce? 461 __ root can seaer (caici0m carbonate) ir io lis __.._ respe’a s i 456 nrd4 46 nrd4 57 8udesonde 0 5mohs gtycopyrroraurm 25rncg i nh&ation 2n nrd4 48 respdeo 457 458 459 460 462 nrd4 62 respue s 463 464 nrd. 463 nad4 44 foefcm 3gm hw ospretemr sad glycd+ 455 catbonate.pota$s#$ c?iorde • r • c zinc oxide alo vera semethicone tacrolimus , cafflene citrate oral solution mercunium chloride , salicylic acid , coloplast eed , dicofenac each trasnsdermal patch contain povidone iodine milk low birth formula powder formoterol , leosafbutamol , mdi lignocaine hydrogen peroxide mouth wash , nasal spray asceptic lotion clotrimazole , ketaconazole minoxideil lotion podophyline toxin eye drop dpi ointment cream respule , etc gadoteric acid 10 ml vial etc ...

Jawaharlal Nehru Medical College - Rajasthan

32832157 tender for drug and medicine items for satellite hospital, adash nagar, ajmer drug and medicine item list of drug and medicine 2 1.5% hydrogen peroxide 3 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) 4 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) 5 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail in rc) 6 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) (detail in rc) 7 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) (detail in rc) 8 3rd generation recombinant f viii 1000 iu with diluent 9 3rd generation recombinant f viii 250 iu with diluent 10 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 11 6 mercaptopurine 20 mg 12 abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 13 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) (detail in rc) 14 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) 15 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 (details in rc) 16 abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 (details in rc) 17 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 18 absorbable gelatin sponge 80 x 50x 10mm(details in rc) 19 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(details in rc) 20 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 21 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 22 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 23 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 24 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 25 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 26 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 27 absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) 28 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm 29 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm 30 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm 31 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm 32 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm 33 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm 34 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) 35 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) 36 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) 37 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm 38 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm 39 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm 40 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) 41 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) 42 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm 43 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm 44 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm 45 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 46 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 47 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed 48 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm 49 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) 50 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) 51 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) 52 absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) 53 absorbent cotton wool ip 500 gm 54 acebrophylline sr 200 mg 55 acebrophylline tablet/capsule 100 mg 56 aceclofenac + thiocolchicoside 57 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 58 aceclofenac sr 200 mg 59 aceclofenac+paracetamol+ serratiopeptidase (100+325+15 mg) 60 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 61 acetazolamide tab ip 250mg 62 acetic acid otic solution 2% 63 acetylcystine solution usp (injection) 200 mg/ml 64 acitretin 10 mg 65 acitretin 25 mg 66 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) 67 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 68 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) 69 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) 70 acth synacthen 250 mcg 71 acyclovir cream 5% 72 acyclovir eye ointment ip 3% w/w 5gm size 73 acyclovir intravenous infusion ip 250mg 74 acyclovir intravenous infusion ip 500mg 75 acyclovir oral suspension ip 400mg/5ml 76 acyclovir tab ip 200 mg 77 acyclovir tab ip 800 mg 78 adalimumab 40 mg 79 adaplene (0.1% w/w) 80 adenosine injection ip 6 mg/2ml 81 ado trastuzumab 100 mg 82 ado trastuzumab 160 mg 83 adrenaline injection ip 1mg/ml im/iv use 84 afatinib 20 mg 85 afatinib 30 mg 86 afatinib 40 mg 87 albendazole oral suspension ip 400 mg/10ml 88 albendazole tablets ip 400 mg(detail in rc) 89 alectinib 150 mg (monopoly) 90 alendronate sodium 70 mg 91 alendronate sodium tablets usp / bp 35 mg 92 alfuzosin 10 mg 93 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) 94 all trans retinoic acid 10 mg 95 allopurinol tablets ip 100 mg 96 aloe vera moisturizing 97 alpelisib 150 mg (monopoly) 98 alpelisib 200 mg (monopoly) 99 alpelisib 250 mg (monopoly) 100 alpha beta arteether 2 ml 101 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 102 alpha+lipoic acid + leycopen +multivitamin and miltiminerals 103 alprazolam tab ip 0.25 mg 104 alprazolam tab ip 0.5mg 105 amantidine 100mg 106 ambroxol 107 amikacin inj ip 100 mg 108 amikacin inj ip 250 mg 109 amikacin inj ip 500 mg 110 amino acid 10% injection 100ml size 111 aminocaproicacid 20ml 112 aminophylline inj ip 25 mg/ml 113 amiodarone hydrochloride inj 50 mg/ml 114 amiodarone tab ip 100 mg 115 amiodarone tab ip 200 mg 116 amisulpride 50 mg 117 amitriptyline tab ip 25mg film coated 118 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 119 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 120 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 121 amlodipine oral solution 1 mg/ ml 122 amlodipine tab ip 2.5 mg 123 amlodipine tablets ip 5 mg 124 amophous hydrogel with colloid silver wound dressing 125 amorolfine 0.25% 126 amoxicillin and potassium clavulanate inj ip 1.2gm 127 amoxicillin and potassium clavulanic ip inj 600mg 128 amoxycillin & clavulanic acid 300 mg 129 amoxycillin and cloxacillin cap 250 + 250 mg 130 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 131 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottle) 132 amoxycillin cap ip 250mg 133 amoxycillin cap ip 500mg 134 amoxycillin dispersible tablets ip 125 mg 135 amoxycillin oral suspension ip (dry syrup) 125 mg/5ml 136 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 137 amphotericin b inj ip 50 mg 138 ampicillin + salbactum 1.5g 139 ampicillin cap ip 500mg 140 ampicillin injection ip 500 mg 141 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 142 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 143 anti a blood grouping serum ip(anti a monoclonal serum) 144 anti b blood grouping serum ip(anti b mono clonal serum) 145 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 146 anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) 147 anticold 148 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 149 anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) 150 apixaban 2.5 mg 151 apixaban 5mg 152 aprepitant 125 mg 153 aripiprazole 10 mg 154 aripiprazole 5 mg 155 artemether 40mg + lumefantrine 240 mg 30ml 156 artemether and leumefantrine tablet (40 mg and 240 mg) 157 artemether and leumefantrine tablet (80 mg and 480 mg) 158 artesunate 120 mg 159 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) 160 artificial saliva 161 asceptic ( chlorhexadine gluconate 7.5% +=15%cetrimide solu + isopropyl17% 162 ascorbic acid tab ip 500 mg 163 asepto syringe with transparent bulb sterile, 60 ml 164 aspirinip 300 mg 165 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 166 aspirin dispresible 325mg 167 aspirin tablet ip (gastro resistant) 150 mg 168 astyminec (vitamin c+ essential amino acid) 169 atenolol tab ip 25 mg 170 atenolol tab ip 50 mg 171 atezolizumab 1200 mg(monopoly) 172 atomoxetin 10 mg 173 atomoxetin 18 mg 174 atomoxetin 25 mg 175 atorvastatin tab ip 10mg 176 atorvastatin tablets ip 40 mg 177 atracurium inj 10 mg/ml 178 atropine eye ointment ip 1% 179 atropine sulphate injection 0.6mg/ml 180 atropine sulphate ophthalmic solution usp 1% 181 atroxentine 250mg (trientine hcl) 182 avelumab 200 mg (monopoly) 183 axitinib 5 mg 184 azacitidine 100mg 185 azacitidine 50mg 186 azathioprine tab ip 50 mg 187 azelaic acid 20% 188 azithromycin 1% 189 azithromycin 10 ml vial equaivelent to 500 mg 190 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 191 azithromycin tab ip 500 mg 192 azithromycin tablets ip 250mg 193 aztreonam injection 1gm 194 aztreonam injection usp 500 mg 195 b. complex 196 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) 197 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) 198 bacitracin for injection 25,000 iu 199 baclofen oral solution 5 mg /ml 200 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 201 balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile free flex bag 202 beclomethasone inhalation ip 200 mcg/dose 203 beclomethasone, neomycin and clotrimazole cream (beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 204 bendamustine injection 100 mg 205 benzathine benzylpenicillin inj ip 12 lac units 206 benzathine benzylpenicillin inj ip 6 lac units 207 benzoyl peroxide 2.5 % 208 betadin 5% 209 betahistine tab ip 16 mg 210 betahistine tab ip 8 mg 211 betamethasone dipropionate cream ip 0.05% 212 betamethasone lotion ip 0.05 o/o 213 betamethasone sod phos inj ip 4mg/ml 214 betamethasone tab ip 0.5mg 215 betaxolol eye drops 0.5 o/o 216 bevacizumab injection 100 mg 217 bevacizumab injection 400 mg 218 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip 50 mg) 219 bilastin 20 mg 220 biotin 5 mg 221 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 222 bisacodyl tab ip 5 mg 223 black disinfectant fluid (phenyl) as per schedule o grade iii 224 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) 225 blood administration set blood transfusion set (details in rc) 226 bone cement 227 bone wax sterilised 228 bortezomib 2.5 229 bortezomib injection 2mg 230 bosentan62.5 mg 231 bosutinib 500 mg 232 botulinum toxin type a for injection/botulinum toxin type b for injection100 iu 233 botulinum toxin type a for injection/botulinum toxin type b for injection50 iu 234 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 235 brinozolamide+brimonidine 236 brivaracetam 50mg 237 bromocriptine tablets ip 2.5 mg 238 budesonide 0.5mg/ml 239 budesonide 1ml 240 budesonide 200 mcg. 241 budesonide 400 mcg 242 budesonide 9 mg 243 budesonide nebulizer suspension 0.25mg/ml 244 budesonide powder for inhalation 200 mcg 245 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 246 bupivacaine inj ip 0.5% 247 buprinorphine 2 mg 248 busulfan 60mg/1ml 249 butorphanol tartrate injection usp 1mg/ml 1ml size 250 cabazitaxel 20 mg 251 cabazitaxel 40 mg 252 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 253 caffeine cirate 20mg/ml 254 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 255 caffiene citrate oral solution 256 calamine lotion ip 100ml 257 calcitriol capsules ip 0.25 mcg 258 calcium acetate 667 259 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 260 calcium chloride 5ml vial 261 calcium dobesilate 500mg 262 calcium folinate 15 mg 263 calcium gluconate inj ip 10% (iv use) 264 calcium gluconate/folinate 265 calcium phosphate 200 ml 266 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (non chewable) 267 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 268 capmatinib 200 mg (monopoly) 269 carbamazepine oral suspension usp 100 mg/5ml 270 carbamazepine tab ip 100 mg 271 carbamazepine tab ip 200 mg 272 carbetocin 1ml/100micro. 273 carbimazole 10 mg 274 carbimazole tabs ip 5 mg (film coated) 275 carbolic acid 100% in 500 ml 276 carbolic acid 50% in 500 ml 277 carboplatin injection ip 150 mg 278 carboplatin injection ip 450 mg 279 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml 280 carboxymethylcellulose + glycerin 281 carboxymethylcellulose eye drops ip 0.5% 282 carfilzomib 20 mg 283 carfilzomib 60 mg 284 carmustine 100 mg 285 carvedilol tablet 3.125 mg 286 caspofungin 50 mg 287 caspofungin 70 mg 288 catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 289 catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 290 catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 291 catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 292 catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 293 catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 294 catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) 295 cefaclor each 5 ml contain cefaclor 125 mg 296 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 297 cefadroxil tablet 500 mg 298 cefepime injection ip 500 mg 299 cefipime 1000mg + tazobactum 125mg 300 cefixime + potassium clavulanate 200+125mg 301 cefixime oral suspension50mg 302 cefixime oral suspension 100mg 303 cefixime oral suspension ip 25mg/ml (paediatric drops) 304 cefixime tab ip 100 mg 305 cefixime tab ip 200 mg 306 cefoperazone 1gm+tazobactum 125mg 307 cefoperazone 1mg inj. 308 cefoperazone 500mg 309 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) 310 cefotaxime inj ip 250 mg 311 cefotaxime injection ip 1 g 312 cefpodoxime 200mg 313 cefpodoxime cv 375 314 cefpodoxime dispersible tab 50 mg 315 cefpodoxime oral suspension 20mg/ml 316 cefpodoxime proxetil 100mg 317 cefpodoxime proxetil oral suspension 100mg 318 cefpodoxime proxetil oral suspension 50mg 319 ceftazidime 1gm+sulbactam500 mg 320 ceftazidime inj ip 1g 321 ceftazidime inj ip 250 mg 322 ceftazidime inj ip 500 mg 323 ceftazidime+ avibactum 2gm+500mg 324 ceftizoxime 1 gm 325 ceftriaxoneip 125 mg 326 ceftriaxone +salbactum+ disodium edta 327 ceftriaxone 1 gm + tazobactum 125 mg injection 328 ceftriaxone and sulbactam 1.5g 329 ceftriaxone inj ip 1g /vial 330 ceftriaxone inj ip 250 mg/vial 331 ceftriaxone inj ip 500mg/vial 332 ceftriaxone1000mg+ tazobactom125mg 333 cefuroxime 1gm 334 cefuroxime axetil500 mg. 335 cefuroxime axetil oral suspension 125mg/5ml 336 cefuroxime axetil tab ip 250 mg 337 cephalexin cap ip 250 mg 338 cephalexin cap ip 500 mg 339 cephalexin oral suspension ip (cephalexin dry syrup ip) 125mg/ 5 ml 340 cephalexin tablets 125 mg (dispersible tablets) 341 ceritinib 100 mg 342 ceritinib 200 mg 343 ceritinib 250mg 344 ceritinib 50 mg 345 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o 346 cetirizine syrup ip 5mg/5 ml 347 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab 348 cetrimide cream ip 15 gm 349 cetrorelix acetate 0.25 mg 350 cetuximab 100 mg 351 cetuximab 500mg 352 chemotherapy port & non coring needles(pediatric) (detail in rc) 353 chemotherapy port and non coring needles(adult) (detail in rc) 354 chlorambucil tab ip 5 mg 355 chloramphenicol0.5% 356 chloramphenicol +polymycin 357 chloramphenicol +polymycine + dexamethasone 358 chloramphenicol 1% w/w eye ointment ip, 3gm size 359 chloramphenicol 1gm/vial 360 chloramphenicol eye drops ip 0.5 0/0 361 chlordiazepoxide 25 mg 362 chlordiazepoxide tablets ip 10mg 363 chlordiazsepoxide 10 mg + clidinium 25 mg 364 chlorhexidine gluconate solution 5% 250 ml 365 chlorhexidine mouthwash ip 0.2 o/o 366 chloroquine phosphate inj ip 40 mg/ ml 367 chloroquine phosphate suspension ip 50 mg/5ml 368 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 369 chlorpheniramine maleate tab ip 4mg 370 chlorpromazine inj. ip 25mg/ml 371 chlorpromazine tablets ip 100 mg (coated tablet) 372 chlorpromazine tablets ip 25 mg (sugar coated) 373 chlorpromazine tablets ip 50 mg (coated tablets) 374 chlorthalidone 6.25 mg 375 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) 376 cholchicine 0.5mg 377 cholecalciferol granules 60,000 iu /gm 378 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) 379 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) 380 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) 381 cilnidipine 20 mg 382 cilnidipine 5 mg 383 cilnidipine10 mg 384 cilostazol 100mg 385 cilostazol 50mg 386 cinnarizine tablet ip 75 mg 387 cinnarizine tablets ip 25 mg 388 ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 389 ciprofloxacin eye drops ip 0.3 o/o w/v 390 ciprofloxacin injection ip 200mg/100ml 391 ciprofloxacin ophthalmic ointment usp 0.3% 392 ciprofloxacin tablet ip 500 mg film coated 393 ciprofloxacin tablets ip 250 mg film coated 394 cis atracurium besylate injection 2 mg/ml in 5 ml vial 395 cisplatin inj ip 10 mg/10 ml 396 cisplatin inj ip 50 mg/ 50 ml 397 cladrabine 10 mg 398 clarithromycin 250 mg 399 clarithromycin 500mg 400 clarithromycin 500mg 401 clarithromycin for oral suspension 125mg/5ml 402 clindamycin600mg/4ml 403 clindamycin capsule ip 150mg 404 clindamycin capsule ip 300 mg 405 clindamycin phosphate gel usp 1 o/o 406 clindamycin phosphate injection ip 300 mg 407 clobazam tablet/capsule 10 mg 408 clobazam tablet/capsule 5 mg 409 clobetasol propionate cream ip 0.05 o/o 410 clobetasol+salicylic acid 0.5%+6% 411 clomifene tab ip 25 mg 412 clomiphene tab ip 50 mg 413 clomipramineip 25 mg 414 clonazepam 0.25 415 clonazepam 1mg 416 clonazepam tablet 0.5 mg 417 clonidine 150mcg/ml 418 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 419 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 420 clopidogrel tab ip 75 mg 421 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) 422 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) 423 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 424 clotrimazole 1%+beclomethasone 0.25% 425 clotrimazole 10mg 426 clotrimazole cream ip 2% w/w 427 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 428 clotrimazole vaginal tab ip 500mg 429 cloxacillin sodium inj ip 500mg 430 clozapine 100 mg 431 clozapine 25 mg 432 clozapine 50 mg 433 coal tar 6% & salicylic acid 3% ointment 434 codienephosphate 435 colistimethate injection ip 1m iu powder for solution 436 coloplast60 gm 437 compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o 438 compound benzoin tincture ip 439 compound sodium lactate (ringer lactate) in glass bottle 500ml 440 compound sodium lactate inj. ip 441 conc haemodialysis fluid b.p acetate concentrate 10 litre can 442 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 443 conjugated estrogen tabs usp 0.625 mg. 444 continuous ambulatory peritoneal dialysis fluid 2 ltr 445 coq 300mg(capsule of co enzyme q10 with lycopene,selenium & omega 3 fatty acid ) 446 corrugated drainage sheet all sizes(details in rc) 447 cotriamazole 480mgs 448 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 449 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) 450 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 451 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 452 cough syrup/expectorant(50) ml 453 cpm+cmc+nephazoline 454 crystilline penicillin 2 lakh 455 cyclopentolate 1% 456 cyclophosphamide inj ip 200 mg 457 cyclophosphamide inj ip 500 mg 458 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) 459 cyclosporin capsule usp/ip 50 mg 460 cyclosporine 100 mg 461 cyclosporine oral solution 100mg/ml 462 cyproheptadine200ml 463 cyproheptadine 4mg 464 cyproterone acetate 2 mg +ethynil estradiol. 035mg 465 cytarabine 1000 mg 466 cytarabine injection bp 500mg 467 d penicillamine 250mg 468 dabigatran 110 mg 469 dabigatran 150 mg 470 dabrafenib 50 mg 471 dacarbazine 200 mg 472 dacarbazine injection 500 mg usp/ bp 473 dacomitinib 15 mg (monopoly) 474 dacomitinib 30 mg (monopoly) 475 danazol 100mg 476 danazol cap ip 50 mg 477 dapagliflozin 10 mg 478 dapoxetine 30 mg 479 dapsone 100 mg 480 daratumumab 100 mg (monopoly) 481 daratumumab400 mg(monopoly) 482 darbepoietin alfa 100mcg 483 darbepoietin alfa 200 mcg 484 darbepoietin alfa 500mcg 485 dasatinib tab 100 mg 486 daunorubicin inj ip 20 mg 487 decitabine 100 mg 488 decitabine 50 mg 489 deferasirox tab 100 mg 490 deferasirox tab 500 mg 491 deferiprone cap 250 mg 492 deferiprone cap 500 mg 493 deflazacort 12 mg 494 deflazacort 6mg 495 degarelix 120 mg 496 degarelix 80 mg 497 degludec insulin 300iu/3ml 498 denosumab 120 mg 499 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) 500 deriphylline 1 ampul 501 desferrioxamine injection ip 500 mg / vial (for i.m. inj and i.v s.c. infusion) 502 desfluraneusp 240 ml bottle 503 desonide0.05% 504 desvenlafaxine 50mg 505 detemir insuline 506 dexamethasone inj ip 8mg/2ml 507 dexamethasone tab ip 0.5 mg 508 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 509 dexmedetomidine 100mcg/ml 510 dextran 40 511 dextromethorphan hbr syrup ip 13.5mg / 5ml 512 dextromethorphan hcl + chlorpheniramine 513 dextrose 5% 500 mlglass bottle 514 dextrose inj ip 10% 515 dextrose inj ip 25% w/v 516 dextrose inj ip 5% 517 dextrose with sod.chloride polypack 5% 500ml 518 diastasepepsin with simethicone 15 ml 519 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 520 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 521 diatrizoic acid salts & meglumine 66% & sodium 10% & iodine content 370 mg/ml 30 ml 522 diazepam inj ip 10mg/2ml (1m/iv use) 523 diazepam tab ip 5 mg 524 diazoxide 300 mg/20ml 525 diclo & sera& para. 526 diclofenac + thiocolchicoside 527 diclofenac each transdermal patch contain 200 mg diclofenac 528 diclofenac gastro resistant tablet ip 50 mg(enteric coated) 529 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 530 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg 531 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use 532 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 533 diclofence prolonged release tablet ip 100 mg 534 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 535 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 536 dicyclomine hydrochloride oral solution ip 10mg /5ml 537 dicyclomine inj ip 10 mg /ml 538 dicyclomine tab ip 10 mg 539 dienogest 2mg 540 diethylcarbamazine tab ip 100 mg 541 digoxin 2mg 542 digoxin 0.25% 543 digoxin inj ip 0.25 mg/ml 544 digoxin tab ip 0.25 mg. 545 diltiazemprolonged released90mg 546 diltiazem 2%p/r 547 diltiazem 25 mg 548 diltiazem tabs ip 30 mg film coated 549 dimethyl fumarate 240mg 550 dimethyl fumarate120 mg 551 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe 552 diphtheria antitoxin 10000 iu 553 disposable sterile surgical rubber gloves size 8 inches,powder free 554 disposable sterile surgical rubber gloves size 8 inches,powdered 555 distilled water 10ml 556 disulfiram 125 mg 557 disulfiram 250mg 558 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 559 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 560 docetaxel 120 mg 561 docetaxel 20mg 562 docetaxel 80 mg 563 docosahexaenoic 30ml 564 domperidone oral drops 10mg/ ml (10ml) 565 domperidone suspension ip 5mg/5ml 566 domperidone tab ip 10 mg 567 donepezil 5 mg 568 dopamine hydrochloride inj ip 40 mg/ml 569 dorzolamide 2% 570 double j stent, sterile, both ends open size 4f, length 16 cm 571 double j stent, sterile, both ends open, size 5f, length 20 cm 572 double j stent, sterile, one end closed size 4f, length 16 cm 573 double j stent, sterile, one end closed, size 5f, length 20 cm 574 doxorubicin inj ip 50 mg/ 25 ml 575 doxycycline cap ip 100 mg 576 doxycycline for injection 100 mg 577 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 578 dried factor viii fraction ip (iv use) 1000 iu/vial 579 dried factor viii fraction ip (iv use) 500 iu/vial 580 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) 581 drotavarine 582 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 583 drotaverine hydrochloride inj 40 mg/2 ml 584 drotaverine tab ip 40 mg 585 duloxetine gastro resistant 20 mg 586 duloxitine gastro resistant30 mg 587 durvalumab 120 mg (monopoly) 588 durvalumab 500mg (monopoly) 589 dutasteride tablet 0.5 mg 590 dydrogesterone 10mg 591 each 15 ml contains: milk of magnesia 11.25 ml+liquid paraffin 3.75 ml170 ml 592 each 5 ml containing : paracetamol 125 mg + ibuprofen 100 mg 60 ml 593 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg 594 ecg electrode (detail in rc) 595 eeg 400gm 596 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property (detail in rc) 597 eltrombopag 25mg 598 eltrombopag 50mg 599 empagliflazone 10mg 600 empagliflazone 25mg 601 enalapril1.25 mg 1 ml 602 enalapril maleate tab ip 2.5mg 603 enalapril maleate tab ip 5mg 604 enalapril maleate tablets ip 10 mg 605 endotracheal tube, cuff size 4.5 (details in rc) 606 endotracheal tube, cuff size 5 details in rc 607 endotracheal tube, cuff size 6 (details in rc) 608 endotracheal tube, cuff size 7 (details in rc) 609 endotracheal tube, cuff size 7.5 (details in rc) 610 endotracheal tube, cuff size 8 (details in rc) 611 endotracheal tube, cuff size 8.5 (details in rc) 612 endotracheal tube, cuff size 9 (details in rc) 613 endotracheal tube, cuff size 6.5 (details in rc) 614 endotracheal tube, cuffed size 4 (details in rc) 615 endotracheal tube, plain size 2.5 (details in rc) 616 endotracheal tube, plain size 3 (details in rc) 617 endotracheal tube, plain size 3.5 (details in rc) 618 endotracheal tube, plain size 4 (details in rc) 619 endotracheal tube, plain size 4.5 (details in rc) 620 endotracheal tube, plain size 5 (details in rc) 621 endotracheal tube, plain size 5.5 (details in rc) 622 endotracheal tube, plain size 6 (details in rc) 623 endotracheal tube, plain size 7 (details in rc) 624 endotracheal tube, plain size 7.5 (details in rc) 625 endotracheal tube, plain size 8 (details in rc) 626 endotracheal tube, plain size 8.5 (details in rc) 627 endotracheal tube, plain size 6.5 (details in rc) 628 enoxaparin sodium inj ip 60 mg 629 entacapone 200 mg 630 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 631 enterogermina 2billion spores 5ml 632 enzalupamide 40mg 633 enzyme 634 enzyme 100 ml 635 ephedrine 30 mg/ml 636 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile (detail in rc) 637 epirubicin 150mg/ml 638 epirubicin 50mg/ml 639 eribulin 0.5mg 640 eribulin 1 mg 641 erlotinib 100mg 642 erlotinib 150 mg 643 ertapenem sodium 1gm = ertapenem 1.046 gm 644 escitalopram tab ip 10 mg 645 esmolol hydrochloride injection 10mg/ml 10ml size 646 esmoprazole 10mg 647 esomeprazole 40 mg 648 esomperazole 649 estradiolvalerate 650 estradiolvalerate 2 mg 651 etanercept 25mg/0.5ml 652 ethamsylate inj 250 mg/ 2ml (im/iv) 653 ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) 654 ethinyloestradiol tabs ip 50 mcg 655 ethynil estradiol 0.02mg+ tab desogestral 0.15mg 656 etizolam 0.5 mg 657 etomidate 20 mg 658 etomidate mct/lct 10ml vial 659 etoposide inj ip 100 mg 660 etoricoxib tab ip 120mg 661 etoricoxib tablet ip 90 mg 662 etoricoxib+thiocolchicoside(60+8 mg) 663 eveningprimosa 1000 mg 664 everolimus 10mg 665 everolimus 5mg 666 exemestane 25 mg 667 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 668 face mask, disposable(details in rc) 669 factor ix concentrate (purified) ip 500 600 i.u.(human coagulation factor ix) 670 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 671 febuxostat 40 mg 672 febuxostat 80 mg 673 fenofibrate capsules/ tab ip 200 mg 674 fentanyl 25iu patch 675 fentanyl 50iu patch 676 fentanyl citrate injection 50mcg/ml 677 fentanyl citrate injection ip 2 ml 678 fenticonazole 2% 679 feracrylum 1% w/v sterile solution 100 ml 680 ferric carboxymaltose injection 50 mg/ml 10 ml size 681 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 682 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 683 fexofenadine120 mg 684 fexofenadine180 mg 685 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg 686 finasteride tablets ip 5 mg 687 fingolimod 0.5 mg 688 flavoxate tablets ip 200 mg (coated tablet) 689 fluconazole 100mg 690 fluconazole 200 mg 691 fluconazole eye drops 0.3% 692 fluconazole oral suspension 693 fluconazole tablets ip 150mg 694 fludarabine phosphate injection 100mg 695 fludarabine phosphate injection 50mg 696 fludrocortisone 100mcg 697 flunarizine 10mg 698 flunarizine tab 5 mg 699 fluorescien sodium ip 20% vail 3 ml for diagnostic fundus fluorescien angiography 700 fluorouracil inj ip 250 mg/ 5ml 701 fluoxetine cap ip 20 mg 702 fluphenazine deconate injection (long acting) 25mg/ml ampule 703 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v 704 fluromethalone 0.1% 705 fluticasone 706 fluticasone ft 707 fluvoxamine 100 mg 708 fluvoxamine 50 mg 709 foldable intra ocular lense with injector (details in rc) 11 to 17.5 710 foldable intra ocular lense with injector (details in rc) 18 to 24 711 foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 712 foleys catheter no. 14 (detail in rc) 713 folic acid +methylcobalamine 10 ml pack 714 folic acid tab ip 5 mg 715 folinic acid 15mg 716 folinic acid 200mg/vial 717 fondaparinux 2.5mg 718 formaldehyde solution (34.5 per. 38 per.) 719 formaline 720 formeterol 20mcg +budesonide 0.5mg 721 formeterol 6mcg.+ fluticasone 250 mcg. inhalation 722 formetrol 12mcg + budesonide 400 mcg. 723 formoterol 6 mcg. + budesonide 200 mcg. 724 formoterol 6 mcg. + budesonide 400 mcg. 725 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 726 fosfomycin3gm 727 fosphenytoin sodium 150mg/ml 728 framycetin sulphate cream 1 o/o 100 gm pack 729 framycetin sulphate cream 1 o/o 30gm pack 730 frusemide tab ip 40 mg 731 fsh 150 iu 732 fsh 75 iu 733 fulvestrant 250mg 734 furosemide 10mg/ml 735 furosemide 20mg + spironolactone 50mg 736 furosemide injection ip 10mg/ml (im and iv use) 737 furosemide oral solution 10mg/30ml 738 fusidic acid cream ip 2% 739 gabapentine tablet/capsule 100mg 740 gabapentine tablet/capsule 300mg 741 gadodiamide inj. 0.5mml/ml vial 742 gamma benzene hexachloride lotion 1%(lindane lotion usp) 743 ganciclovir 0.15% 744 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) 745 gatifloxacin 0.3% 746 gatifloxacin+prednisolone 747 gdw 5% glass bottle/500ml 748 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 749 gemcitabine for injection 200 mg 750 gemcitabine for injection ip 1gm 751 gentamycin 752 gentamycin injection ip 80mg/2ml (im/ iv use) 753 gentian violet topical solution usp 1o/o 754 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) 755 glibenclamide tab ip 5 mg 756 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 757 gliclazide tab ip 40 mg 758 glimepiride tab ip 1mg 759 glimepiride tab ip 2 mg 760 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 761 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 762 glipizide tab ip 5mg 763 gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 764 gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 765 gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves)(details in rc) 766 gloves size 7 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) 767 gloves size 7 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 768 gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) 769 glucagon for injection usp 1 mg/ml 770 glucosamine + hydrochloride +methylsulfonylmethane 771 glucosamine hydrocloride + diacerin 50 mg 772 gluteraldehyde solution 2% 773 glycerin2 gm/ml 774 glycerin ip 100 ml 775 glycerin ip 400 gm 776 glyceryl trinitrate injection, diluted 5mg/ml 777 glyceryl trinitrate tablets 2.6 mg controlled release tablets 778 glycine irrigation solution 1.5% 3ltr 779 glycolic acid 6% 780 glycopyrrolate inj ip 0.2 mg/ml 781 glycopyrronium 25 782 glycopyrronium 25 + formoterol 6 mcg 783 glycopyrronium 25mcg. inhalation 2ml. 784 glycopyrronium 50 785 goserelin acetate implant 3.6 mg 786 griseofulvin tab ip 125 mg 787 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 788 haemocoagulase1 ml 789 haloperidol (long acting) 50mg/ml ampoule 790 haloperidol inj ip 5 mg/ml 791 haloperidol tab ip 1.5 mg 792 haloperidol tab ip 5 mg 793 halothane bp 794 heparin 50 iu benzyl nicotinate 2 mg 795 heparin sodium inj ip 5000 iu/ml (im/iv use) 796 hepatitis b immunologlobin injection ip 200 i.u 797 hmffor pretem 798 homatropine eye drops ip 2% 799 hormonalintra uterine device 800 horse atg(anti thymocyte globulin) 250 mg 801 hp kit(pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 mg 802 hp hmg (highly human menopausal parodiedgonadotropin) 150 iu 803 hp hmg (highly human menopausal parodiedgonadotropin) 75 iu 804 hpmc 0.3% 805 human albumin 20% in 50 ml vial 806 human albumin solution ip 20% 807 human anti d immunoglobulin 150 mcg 808 human anti d immunoglobulin injection 300mcg (im use) 809 human chorionic gonadotropin injection ip 5000 i.u. 810 human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) 811 human rabies immunoglobulin inj 150 iu/ ml 812 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. 813 hydralazine 20mg/ml 814 hydrochlorthiazide tab ip 12.5 mg 815 hydrochlorthiazide tab ip 25mg 816 hydrocortisone 1% 817 hydrocortisone oromucosal 20 mg 818 hydrocortisone oromucosal 5 mg 819 hydrocortisone oromucosal10 mg 820 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) 821 hydrogen 11% + silver nitrate .01% 822 hydrogen peroxide solution ip 6 o/o (20 vol) 823 hydroquinone 2% 824 hydroxychloroquine sulphate tablets 200mg 825 hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride 0.9 o/o w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 826 hydroxyprogesterone inj ip 250mg /ml 827 hydroxypropylmethyl cellulose solution 20 mg/ ml 828 hydroxyurea 500mg 829 hydroxyzine oral solution 15 ml 830 hydroxyzine tab ip 25 mg 831 hyoscine butyl bromide tablets ip 10mg 832 hyoscine butylbromide inj ip 20 mg/ ml 833 ibrutinib 140mg 834 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 835 ibuprofen oral suspension bp /usp 100 mg/ 5 ml 836 ibuprofen tab ip 200 mg (coated) 837 ibuprofen tab ip 400 mg (coated) 838 ifosfamide injection ip/bp/usp 1gm 839 imatinib tab ip 400mg 840 imipenem + cilastatin injection 500mg/500mg ip powder for solution 841 imipramine tab ip 25 mg (coated tab) 842 imipramine tab ip 75 mg (coated) 843 indacaterol andglycopyronium inhalation powder110/50 mcg 844 indomethacin 75 mg sr 845 indomethacin cap ip 25 mg 846 indomethacin lyophilized powder 1mg 847 infant feeding tube size 10fg(details in rc) 848 infant feeding tube size 5fg(details in rc) 849 infant feeding tube size 8fg(details in rc) 850 infusion set with microdrip,(i.v.)sterile disposable(details in rc) 851 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 852 inositol + myoinositol 1000mg 853 inotuzumab1 mg(monopoly) 854 insulinaspart 855 insulinglulisine(monocomponent insulin glulisine) 100 iu/ml/3 ml cartridges 856 insulinglulisine (monocomponent insulin glulisine) 100 iu/ml/3 ml prefilled pen 857 insulin glargine300 iu per ml/prefilled pen 858 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle 859 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges 860 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) 861 insulin lispro 862 insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 863 insuline 50/50 864 interferon beta 1 a 30mg 865 intralipds 866 intravenous fat emulsion 20% w/v 250ml 867 invert sugar 10% (fructodex 10%) 500 cc 868 iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution, 300 mg lodine/ml non ionic 50 ml 869 iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 870 iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 871 ipilimumab 50 mg 872 ipratropium bromide nebulizer solution 250 mcg/ ml 873 ipratropium powder for inhalation ip 40 mcg 874 irinotecan 100 mg/5ml 875 irinotecan 40mg/5ml 876 iron (ferrous ascorbate) 877 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 878 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 879 isoflurane usp 880 isolyte g 881 isolyte p 10% 500 ml 882 isophane insulin inj ip 40 iu /ml 883 isoprenaline injection ip 2mg / ml 884 isosorbide dinitrate tab ip 5 mg 885 isosorbide mononitrate tabs ip 20 mg 886 isotretinoin 10mg 887 isotretinoin 20 mg 888 isoxsuprine inj ip 5 mg/ml 889 isoxsuprine tab ip 20 mg 890 itraconazole 1% 891 itraconazole 1% 892 itraconazole cap 100 mg 893 ivabradine 5mg 894 ivermectin 12mg 895 ivermectin 6 mg + albendazole 400 mg 896 ivermectin 6mg 897 k wire, length 375 mm; 1.6mm(details in rc) 898 k wire, length 375 mm; 1.8mm(details in rc) 899 k wire, length 375 mm; 1mm(details in rc) 900 ketaconazole 2% 901 ketamine inj ip 50 mg/ml 902 ketoconazole 200 mg 903 ketoconazole cream 2% 904 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 905 kojic acid 2%, arbutin,niacinamide 906 labetalol hcl inj ip 20mg/4ml 907 labetalol tab ip 100mg 908 lacosamide 50 mg 909 lacosamide infusion 910 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) 911 lactic acid bacillus tab 60 million spores 912 lactulose 913 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml 914 lamotrigine dispersible 100mg 915 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 916 lapatinib 500mg 917 l arginine+proanthocynadine granules 3mg 918 l asparaginase inj 10000 iu 919 l carnitine 500mg/5ml in 30 ml 920 l carnosine 100mg/5ml in 200ml 921 leflunomide tablets ip 10mg(film coated) 922 leflunomide tablets ip/usp 20mg (film coated) 923 lenalidomide25mg 924 lenalidomide 10 mg 925 lenvatinib 10 mg 926 lenvatinib 4 mg 927 leosalbutamol 50mcg.+ ipratopium 40mcg. 928 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 929 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 930 leurprolide acetate depot 11.25 mg 931 leurprolide acetate depot 3.75 mg 932 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 933 levetiracetamip 250 mg 934 levetiracetam injection 500mg/5ml 935 levetiracetam oral solution/suspension 100mg/ml 936 levetiracetam tablet ip 500 mg 937 levobupivacaine 0.5% (20mg/4ml) ampule 938 levoceitrizine tablet 5mg 939 levodopa and carbidopa tab 250 mg+ 25 mg 940 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 941 levodopa+carbidopa 125 942 levodopa+carbidopa+entacapone 100mg/25mg/200mg 943 levofloxacin 750 mg 944 levofloxacin oral solution 945 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 946 levofloxacin tablets ip 250 mg 947 levofloxacine 500mg/100 ml 948 levosalbutamol 100mcg+ ipratropium bromide 40mcg 949 levosalbutamol 2.5 mg +ipratropium 500 mcg 2.5 ml 950 levosalbutamol inhalation solution 50ml/gm 951 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 952 levosulpride 12.5 mg/ml 953 levosulpride 75mg 954 levothyroxine sodium25 mcg 955 levothyroxine sodium75 mcg 956 lidocaine10%20ml 957 lidocaine 25 mg + prilocaine25mg 958 lidocaine hcl topical solution usp 4% 959 lidocaine1% intra cameral 960 lignocaine (preservative free) 2% 961 lignocaine + adrenaline (1:10000, 2:10000) 962 lignocaine 1% 963 lignocaine 10% spray 964 lignocaine 4%30ml 965 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 966 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg 967 lignocaine gel ip 2% 968 lignocaine hydrochloride 2% 50ml vial 969 lignocaine inj ip 2 o/o 970 lignocaine ointment 5 o/o 971 lignocaine viscous 972 linaglipitin 2.5mg 973 linaglipitin 5mg 974 linezolid 100mg/5ml in 30ml 975 linezolid inj 200mg/100ml 976 linezolid tablets ip 600 mg 977 liposomal doxorubicin 20mg 978 liposomal doxorubicin 50 mg 979 liposomol amphotericine injection b 50mg 980 liquid medical oxygen (lmo) 981 liquid paraffin ip 100 ml 982 liquid paraffin ip 400 ml 983 lisinopril tab ip 2.5 mg 984 lisinopril tab ip 5 mg 985 lisinopril tablets ip 10 mg 986 lithium carbonate tab ip 300 mg 987 liver specific mri contrast agent (gadobenate disodium (gd bopta), gadoxetate disodium (gd eob dtpa), mangafodipirtri sodium (mn dpdp), ferumoxide, ferucarbotran) 988 lomustine 40 mg 989 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) 990 loperamide tab ip 2 mg 991 lopinavir 200mg+ritonavir 50 mg 992 loratadine 10 mg 993 lorazepam5 mg 994 lorazepam 1.0 mg 995 lorazepam inj ip 2 mg/ml 996 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 997 l orinithine l aspartate 10 ml 998 lorlatinib 100 mg 999 lorlatinib 25 mg 1000 l ornithine l aspartate (150mg) + pancreatin (100mg) 1001 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 1002 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) 1003 losartan tab ip 25 mg 1004 losartan tab ip 50 mg 1005 loteprednol 0.25% 1006 low molecular wt. heparin 0.4mg 1007 luliconazole 1% 1008 lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) 1009 magnesium sulphate inj. ip 500mg/ml (50%w/v) 1010 magnesium sulphate, sulphacetamide, urea 75 gm 1011 mannitol inj ip 20% w/v 1012 mannitol with glycerin injection 10 o/o + 10 o/o w/v (for intravenous infusion) 1013 mecobalamin inj 500 mcg/ml 1014 medium chain triglyceride 1015 medroxyprogesterone acetate tablets ip 10 mg 1016 mefenamic acid tablets bp 500 mg 1017 mefenamice acid 100mg/5ml 1018 mefenemic acid 50 mg + paracetamol 250 mg /60 ml 1019 mefloquine tablets ip 250 mg 1020 megestrol acetate 160 mg 1021 melatonin 3 mg 1022 melatonin 60 ml 1023 melphalan 2mg 1024 melphalan tab ip 5 mg 1025 mephentermine 50mg/ml 1026 mercaptopurine tab ip 50 mg 1027 mercunium chloride 1028 meropenem 2gm 1029 meropenem inj ip 500 mg 1030 meropenem inj. ip 1gm 1031 meropenem injection ip 250 mg 1032 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 1033 mesalazine 1034 mesna 200 mg/2ml (sod. mercaptoethane sulphate) 1035 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg 1036 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 1037 metformin hydrochloride(sustained release tablets ip 1000 mg 1038 metformin tab ip 500 mg(film coated) 1039 methimazole10mg 1040 methimazole5 mg 1041 methotrexate 1000 mg 1042 methotrexate 15mg 1043 methotrexate 250 mg 1044 methotrexate 7.5mg 1045 methotrexate inj ip 50 mg/2 ml 1046 methotrexate tab ip 2.5 mg 1047 methotrexate tablets ip 10 mg 1048 methyl cobalmine tablet 1500mcg 1049 methyl cobalmine tablet 500mcg 1050 methyl prednisolone sodium succinate for injection usp 500 mg 1051 methyldopa tab ip 250mg film coated 1052 methylene blue 1053 methylergometrine inj ip 0.2 mg/ml 1054 methylergometrine tab ip 0.125 mg 1055 methylphenidate 10 mg 1056 methylprednisolon acetate40mg 1057 methylprednisolon acetate 125mg 1058 methylprednisolone4mg 1059 methylprednisolone 16mg 1060 methylprednisolone 8mg 1061 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 1062 metoclopramide inj ip 10mg/2ml 1063 metoclopramide tab ip 10 mg 1064 metolazone 5mg 1065 metoprolol 5ml vial 1066 metoprolol succinate extended release tablets ip 50 mg 1067 metoprolol tablets ip 25 mg 1068 metotrexate 15mg (preservative free) 1069 metronidazole 1% and chlorhexidine gluconade 0.25% gel 1070 metronidazole benzoate oral suspension ip 100 mg of base/5ml 1071 metronidazole inj ip 500 mg/100ml 1072 metronidazole tablets ip 200 mg (film coated) 1073 metronidazole tablets ip 400 mg (film coated) 1074 meverberine 135 mg + chlordiazepoxide 10 mg 1075 miconazole nitrate cream ip 2% 1076 midazolam 0.5mg/5ml 1077 midazolam 5mg/ml 1 ml 1078 midazolam inj ip 1 mg/ml 1079 midodrine 5mg 1080 midostaurin 25 mg (monopoly) 1081 mifepristone25mg 1082 mifepristone tab ip 200mg 1083 milk low birth formula 1084 milrinone 10 mg 1085 minocycline 100mg. 1086 minoxidil 10 % 1087 minoxidil 2% 1088 minoxidil 5% 1089 mirabegeron50 mg 1090 mirabegeron 25 mg 1091 mirtazapine 15mg 1092 mirtazapine 7.5mg 1093 misoprostol tab ip 200 mcg 1094 mitomycin 2 mg 1095 mitomycin 40 mg 1096 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg 1097 mitoxanthrone infusion 10 mg 1098 mitoxanthrone infusion 20mg 1099 mometasone 0.1 % 1100 mometasone 2% 1101 montelucast(10mg) + levocetrizine tablet (5mg) 1102 montelucast+levocetrizine 1103 montelukast 10 mg 1104 montelukast 4mg 1105 montelukast 5 mg 1106 morphine10mg 1107 morphine30mg 1108 morphine sulphate inj ip 10mg/ml 1109 moxifloxacin0.5% 1110 moxifloxacin400 mg 1111 moxifloxacin 0.5%+ketorolac tromethamine 0.5% 1112 moxifloxacin and dexamethasone 1113 moxifloxacin and prednisolone 1114 moxifloxacin intra cameral 0.5% 1115 moxifloxacin+ difluoprednate 1116 moxifloxin 400mg/100ml 1117 moxonidine 0.2 mg 1118 moxonidine 0.3 mg 1119 mucus extractor sterile(details in rc) 1120 multi vitamin syrup 1121 multiple electrolytes and dextrose injection type i ip (electrolyte p injection ) 1122 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 1123 multistix test strip 1124 multivitamin 10 ml 1125 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 1126 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 1127 mycophenolate mofetil 500mg 1128 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 1129 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 1130 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size 1131 nabpaclitaxel (paclitaxel nano particle)100 mg 1132 n acetylcysteine (nac) 200mg/ml 1133 n acetylecystine effervescent form, orange flavour, 600 mg 1134 naloxone inj ip 0.4mg/ ml 1135 naltrexone50 mg 1136 nandrolone decanoate 100mg 1137 nandrolone decanoate 50 mg 1138 naproxen tablet ip 250mg 1139 naproxen tablet ip 500mg 1140 nasal oxygen set, twin bore all sizes adult (details in rc) 1141 nasal oxygen set, twin bore all sizes paediatrics (details in rc) 1142 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) 1143 natalizumab 300 mg (monopoly) 1144 natamycin opthalmic suspension 5% 1145 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 1146 nebivolol 10mg 1147 nebivolol 5mg 1148 nebulization mask adult (detail in rc) 1149 nebulization mask paediatric (detail in rc) 1150 nelaton catheter size 14 fg(detail in rc) 1151 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 1152 neomycin sulphate and bacitracin zinc ointment usp 5 mg + 500 iu/gm 1153 neomycin sulphate cream 1154 neomycin, polmyxin and bacitracin zinc ophthalmic 15 gm ip 1155 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 1156 neostigmine inj ip 0.5 mg/ml 1157 neostigmine injection ip 2.5mg/5ml 1158 neostigmine tab ip 15 mg 1159 neostigmine+ glycopyrrolate2.5 mg/ 0.5 mg 1160 nepafenac 0.1% 1161 netilmycin 300mg/3ml 1162 netupitant + palonosetron 300 mg + 0.5 mg 1163 nicardipin 10mg 1164 nicorandil 48 mg 1165 nicorandil 5mg 1166 nicoumalone 1 mg 1167 nicoumalone 3 mg 1168 nicoumalone 4 mg 1169 nifedipine + lidocaine p/r 1170 nifedipine cap ip 5mg 1171 nifedipine tablets ip 10 mg (sustained release) 1172 nifidipine 20mg 1173 nifidipine 20mg sr 1174 nilotinib200 mg (monopoly) 1175 nilotinib 150 mg (monopoly) 1176 nilotinib 300mg (monopoly) 1177 nimodipine infusion 10mg/50 ml 1178 nimotuzumab 50 mg 1179 nintedanib 150mg 1180 nitazoxanide 500mg 1181 nitrazepam 10 mg 1182 nitrazepam 5mg 1183 nitrofurantoin oral suspension 25mg/5ml in 100 1184 nitrofurantoin tab ip 100mg 1185 nitroglycerin inj 5 mg/ ml 1186 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent (detail in rc) 1187 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent (detail in rc) 1188 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent (detail in rc) 1189 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent (detail in rc) 1190 niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support (detail in rc) 1191 nivolumab 100 mg (monopoly) 1192 nivolumab 40 mg (monopoly) 1193 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1194 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1195 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) 1196 non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) 1197 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 1198 non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm 1199 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) 1200 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) 1201 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) 1202 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) 1203 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) 1204 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 1205 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm 1206 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm 1207 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm 1208 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) 1209 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm)(detail in rc) 1210 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) 1211 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm 1212 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm)(detail in rc) 1213 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) 1214 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm 1215 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1216 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) 1217 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1218 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1219 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) 1220 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) 1221 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) 1222 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) 1223 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm)(detail in rc) 1224 non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 1225 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm 1226 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) 1227 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm 1228 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 1229 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) 1230 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) 1231 non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) 1232 noradrenaline injection ip 2 mg/ml 1233 norethisterone tab ip 5 mg 1234 norfloxacin tab ip 400mg film coated 1235 normal human intravenous immunoglobulin 5g/100ml 1236 normal saline 1000 mlglass bottle 1237 normal saline 500 mlglass bottle 1238 octreotide 100mg 1239 octreotide injection 50 mcg/ml 1240 octreotide lar (long acting release) 20 mg 1241 octreotide lar (long acting release) 30 mg 1242 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 1243 ofloxacin infusion ip 200mg / 100 ml(in nacl inj) 1244 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 1245 ofloxacin oral suspension ip 50mg/ 5ml 1246 ofloxacin tab ip 200 mg 1247 ointment(modified lanolin) 1248 ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o, allantoin ip 0.5 o/o 1249 oitment mupirocin ip 2% 1250 olanzapine tab ip 5 mg 1251 olaparib 150 mg (monopoly) 1252 olaparib 50 mg (monopoly) 1253 olaptadine & ketorolac 1254 olmesartan medoxomil 20 mg 1255 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 1256 oloptadine opthalmic solution0.1% 1257 omalizumab 150 mg vial 1258 omega 3fatty acid 50ml 1259 omeprazole cap ip 20 mg 1260 ondansetron inj ip 2mg/ml 1261 ondansetron oral solution 30 ml 1262 ondansetron oral suspension 1263 ondansetron orally disintegrating tablets ip 4mg 1264 orciprenaline 10 mg 1265 ornidazole 500mg 1266 ors powder ip 1267 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) 1268 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) 1269 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) 1270 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 1271 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) 1272 osimertinib 80 mg (monopoly) 1273 oxaliplatin injection usp 50 mg 1274 oxazepam 15mg 1275 oxcarbazepine 300mg 1276 oxcarbazepine 450mg 1277 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 1278 oxybutynin oral suspension5 ml 1279 oxygen mask (adult) 1280 oxygen mask (pediatric) 1281 oxytocin inj ip 5 iu/ml 1282 paclitaxel inj ip 100 mg 1283 paclitaxel inj ip 260 mg 1284 palonosetron 0.25mg 1285 pancreatin gastroresistant 10,000mg(with proteiase & amylase) 1286 pantoprazole 20mg 1287 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 1288 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape 1289 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape 1290 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape 1291 paracetamol 170 mg each suppsitory contain paracetamol 170 mg 1292 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg) 1293 paracetamol infusion 1000 mg with both temper evident caps spray 10% 1294 paracetamol infusion 500 mg with both temper evident caps spray 10% 1295 paracetamol infusion ip 1% w/v 100ml size 1296 paracetamol inj. 150 mg/ml 1297 paracetamol syrup ip 125 mg/5ml (detail in rc) 1298 paracetamol tab ip 500 mg 1299 paracetomol 650 mg 1300 paroxetine 12.5mg 1301 paroxetine 25mg 1302 pazopanib 200mg 1303 pazopanib 400mg 1304 peg asparaginase 3750 iu 5 ml 1305 peg filgrastim injection 6mg 1306 pembrolizumab 50 mg (monopoly) 1307 pembrolizumab100 mg (monopoly) 1308 pemetrexed 100mg 1309 pemetrexed 500 mg 1310 penicillin v 400mg 1311 pentazocine inj ip 30mg/ml (im/iv use) 1312 pentoprazole inj 40 mg 1313 pentoxifylline extended release/sr 400mg 1314 perampanel 2 mg 1315 perampanel 4mg 1316 perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable(details in rc) 1317 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) 1318 peritonial dialysis solution ip 1319 permethrin 1%rinse 1320 permethrin cream 5% 1321 permethrin lotion 5% 1322 pertuzumab 100 mg 1323 phenazopyridine tablet 5 mg 1324 pheniramine 25 mg 1325 pheniramine inj ip 22.75mg /ml 1326 phenobarbitone 20mg/5ml in 100ml 1327 phenobarbitone inj ip 200mg/ml 1328 phenobarbitone tab ip 30 mg 1329 phenozopyridine 200mg 1330 phenylephrine hydrochloride10 mg/ml 1331 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% 1332 phenytoin injection bp 50mg/ml 1333 phenytoin oral suspension ip 25mg/ml 1334 phenytoin tab ip 100 mg (film coated) 1335 pilocarpine 1336 pilocarpine 0.5% w/v 1337 pioglitazone tab ip 15 mg 1338 piperacillin + tazobactum for injection ip 4gm+500mg 1339 piperacillin 1 gm + tazobactum 125 mg 1340 piperacillin injection 2 gm + tazobactom 250mg ip 1341 piracetam 200mg 1342 piracetam 500mg/5ml in 100ml 1343 pirfenidone 200 mg 1344 pirfenidone 400 mg 1345 piroxicam dt 20mg 1346 placental extract 2ml 1347 plaster of paris bandage 10cm x 2.7mts 1348 plaster of paris bandage 15cm x 2.7 mts/roll 1349 plerixafor 24 mg 1350 podophyliin toxin 1351 polyethyene glycol + sodium chloride+sodium bi carbonate+potassium chloride 1352 polyethyene glycol with elctrolyte approx 130gm 1353 polygeline 3.5% solution with electrolytes for i.v. infusion 1354 polymixin sulphate b injection usp 5 lac i.u. 1355 polymyxin b 10000iu/gm + neomycin 3400iu/gm 1356 polymyxin b for injection 1 million 1357 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 1358 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm 1359 pomalidomide 2 mg 1360 pomalidomide 4 mg 1361 posacozazole 100mg 1362 posacozazole 40mg/ml 1363 potassium chloride for injection 1364 potassium chloride inj. 0.15 gm/ml 1365 potassium chloride oral solution u.s.p 500mg/ 5ml 1366 potassium magnesium citrate 1367 povidone iodine 1368 povidone iodine 1369 povidone iodine ointment 5% 15 gm 1370 povidone iodine ointment usp 250 gm 1371 povidone iodine scrub solution / cleansing solution 7.5 o/o w/v povidone iodine (suitable for hand wash) 1372 povidone iodine solution ip 10 % 1373 povidone iodine solution ip 5 % 500 ml 1374 povidone iodine solution ip 5% 100ml bottle 1375 powder clotrimazole 1% w/w 30 gm 1376 pralidoxime chloride injection ip 25 mg/ml / 500 mg 1377 prasugrel 10mg tab 1378 prazosin 5mg 1379 prazosin tablets (extended release) 2.5 mg 1380 prednisoloneip 40mg 1381 prednisoloneip 50mg 1382 prednisolone acetate opthalmic suspension 10 ml 1383 prednisolone sodium phosphate1% 1384 prednisolone tab ip 20 mg 1385 prednisolone tab ip 5 mg 1386 prednisolone tablet ip 10 mg 1387 pregabalin cap ip 75 mg 1388 pressure monitoring line / high pressure extension line (details in rc) 1389 primaquine tab ip 2.5 mg 1390 primaquine tab ip 7.5 mg 1391 primidone 250 mg 1392 primidone 50 mg 1393 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1394 procaine penicillin fortified 2 lack 1395 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 1396 prochlorperazine 5mg 1397 prochlorperazine mesylate injection 12.5mg/ml 5ml size 1398 progesterone inj 200 mg/ 2ml 1399 progesterone injection 50 1400 progesterone only pills 1401 promethazine inj ip 25mg/ml 1402 promethazine syrup ip 5 mg/5ml 1403 promethazine tab ip 25 mg 1404 proparacaine 0.5% w/v 1405 propofol inj ip 10 mg/ml 1406 propranolol 10mg 1407 propranolol 40 mg sr 1408 propranolol tab ip 40 mg 1409 propylthiouracil 100 mg 1410 prostaglandin 500mcg/ml 1411 protamine sulphate 5ml 1412 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 1413 pyridoxine100 mg 1414 pyridoxine tablet ip 10 mg 1415 pyridoxine tablet ip 40mg 1416 quetiapine tablet ip 25mg 1417 quetiapine tablet ip 50mg 1418 quinine dihydrochloride inj ip 300 mg/ml 1419 quinine sulphate tablets ip 300 mg (film coated) 1420 rabbit atg (anti thymocyte globulin) 250 mg 1421 rabbit atg (anti thymocyte globulin)100 mg 1422 rabeprazole +levosulpiride 1423 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 1424 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 1425 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose 1426 racecadotril 100mg 1427 racecadotril sachet 30 mg 1428 ramiprilip 5 mg 1429 ramipril tablets ip 2.5 mg 1430 ramucirumab 100 mg(monopoly) 1431 ramucirumab 500 mg (monopoly) 1432 ranitidine hcl injection ip 50mg/2ml 1433 ranitidine oral suspension 1434 ranitidine tab ip 150mg film coated 1435 ranitidine tab ip 300mg film coated 1436 ranizumab 10mg/ml 1437 ranolazine 500mg 1438 rasagiline1mg 1439 rasburicase 1.5 mg 1440 recombinant coagulation factor viia 1mg 1441 recombinant coagulation factor viia 2mg 1442 recombinant f ix 500 iu with diluent 1443 recombinant fsh 150 iu 1444 recombinant fsh 300iu 1445 recombinant hcg 250 iu 1446 recombinant human growth hormone 4iu vial with syringe 1447 recombinant lh 75iu 1448 regorafenib 40 mg 1449 repaglinamide 0.5mg 1450 repaglinamide 1mg 1451 reteplase 18 mg 1452 revolizer/ rotahaler device 1453 rh erythropoetin inj 4000 iu 1454 rh erythropoetin inj ip 10000 iu 1455 rh erythropoetin inj ip 2000iu 1456 ribociclib 200 mg (monopoly) 1457 rifampicin 150 mg 1458 rifampicin 450 mg 1459 rifampicin 600 mg 1460 rifaximin 1461 rifaximin 200mg 1462 rifaximin 550mg 1463 ringer acetate infusion 500 ml 1464 risperidone prolonged releaseddepot 25 mg 1465 risperidone prolonged releaseddepot 50mg 1466 risperidone tab 1 mg 1467 risperidone tab 2mg 1468 rituximab500 mg 1469 rituximab 100 mg 1470 rivaroxaban 10mg 1471 rivaroxaban 15mg 1472 rivaroxaban 20mg 1473 rizatriptan 10mg 1474 rocuronium 100mg/10ml 1475 romiplostim 125 mcg 1476 romiplostim 250 mcg 1477 romiplostim 500 mcg 1478 root canal sealer (calcium carbonate) 1479 ropinirole 0.25mg 1480 ropivacaine 0.75% 20ml vial 1481 ropivacaine 0.75% 3 ml ampule (heavy) 1482 rosuvastatin 10mg + fenofibrate 160mg 1483 rosuvastatin tablet 10 mg 1484 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 1485 rubber examination gloves made of natural rubber latex, non sterile, size large (details in rc) 1486 rubber examination gloves, non sterile, extra small(details in rc) 1487 rubber examination gloves,size medium (details in rc) 1488 rubber examination gloves,size small (details in rc) 1489 rucaparib300 mg 1490 rucaparib 200 mg 1491 ruxolitinib 10 mg 1492 ruxolitinib 15 mg 1493 ruxolitinib 20 mg 1494 ruxolitinib 5 mg 1495 ryles tube / nasogastric tube size: 10(details in rc) 1496 ryles tube / nasogastric tube size: 12(details in rc) 1497 ryles tube / nasogastric tube size: 16 (details in rc) 1498 ryles tube / nasogastric tube size: 18 (details in rc) 1499 ryles tube / nasogastric tube size:14 (details in rc) 1500 sacubitril 24 mg and valsartan 26 mg tablet 1501 salbutamol inhalation 100 mcg /dose 1502 salbutamol nebuliser solution bp 5 mg/ml 1503 salbutamol syrup ip 2mg/ 5ml 1504 salbutamol tab ip 2 mg 1505 salbutamol tablet ip 4 mg 1506 salicylic acid 16.7% + lactic acid 16.7% 1507 saline nasal solution (drops) (sodium chloride 0.65 o/o) 1508 salmetrol 50mcg+fluticasone 500 mcg 1509 sanitary napkin beltless with wings (details in rc) 1510 sanitary napkin beltless(details in rc) 1511 sanitary pads belt type(details in rc) 1512 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 1513 scalp vein set (disposable) size 18g (details in rc) 1514 scalp vein set (disposable) size 20g (details in rc) 1515 scalp vein set (disposable) size 22g (details in rc) 1516 scalp vein set (disposable) size 24 g (details in rc) 1517 secukinumab 150 mg 1518 selegiline 5mg 1519 serratiopeptidase 10mg 1520 serratiopeptidase 20 mg 1521 sertraline tab ip 50 mg 1522 sevelamer carbonate 800 mg 1523 sevoflurane 1524 sildenafil 0.8mg 1525 sildenafil 20 mg 1526 sildosin + dutasteride 1527 silodosin 4 mg 1528 silodosin 8 mg 1529 silver sulphadiazine cream ip 1% 500 gm jar 1530 silver sulphadiazine cream ip 1% 50gm tube 1531 silymarin 70mg. 1532 simethicon 40mg+dill oil 0.005ml + fennel oil 0.0007ml30 ml 1533 sitagliptine + metformin (50/500) 1534 skin graft knife blade (sterile)(details in rc) 1535 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) 1536 sodium bicarbonate inj ip 7.5% w/v 1537 sodium bicarbonate injection 1538 sodium bicarbonate oral suspension 1539 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 1540 sodium chloride 0.45% w/v polypack 500 ml 1541 sodium chloride 0.9% 3000ml(n.s) 1542 sodium chloride 3 % 1543 sodium chloride 3% 100ml 1544 sodium chloride 5 % 1545 sodium chloride 6% 1546 sodium chloride and dextrose0.45% infusion 500ml 1547 sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o 1548 sodium chloride bottel 100ml 1549 sodium chloride inj ip 500 ml 1550 sodium chloride injection ip 100 ml 1551 sodium fluroresceinedye 20% 1552 sodium hyaluronate 1.4mg 1553 sodium nitroprusside injection 25mg/ml 2ml size 1554 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o/o disodium hydrogen phosphate dodecahydrate 8 o/o 1555 sodium picosulphate oral suspension 1556 sodium valproate gastro resistant tablets ip 200 mg 1557 sodium valproate inj 100 mg/ ml 1558 sodium valproate oral solution ip 200 mg / 5 ml 1559 sodium valproate tablet(gastro resistant) ip 500mg 1560 sofosbuvir 400 mg+ velpatasvir 100 mg 1561 solifenacin succinate10 mg 1562 sorafenib 200 mg 1563 sorbitol + tricholine citrate 1564 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 1565 spironolactone tab ip 25mg 1566 spironolactone tablets ip 50 mg 1567 standard pama intra ocular lenses (details in rc) 11 to 17.5 1568 standard pama intra ocular lenses (details in rc) 18 to 24 1569 standard pama intra ocular lenses (details in rc) 24.5 to 28.5 1570 sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g (detail in rc) 1571 sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g (details in rc) 1572 sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g (details in rc) 1573 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) 1574 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g (details in rc) 1575 sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g (details in rc) 1576 sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) 1577 sterile disposable spinal needle for single use. 25g x 3 1/2 inch (details in rc) 1578 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) 1579 sterilized umbilical cotton tape width 3 mm, length 75 cm(details in rc) 1580 streptokinase injection 15 lac units ip 1581 streptomycin1gm 1582 streptomycin500mg 1583 succinylcholine inj. ip 50 mg/ml (iv use) 1584 sucralphate 1585 suction catheter, sterile. size: f g 10 (details in rc) 1586 suction catheter, sterile. size: f g 12 (details in rc) 1587 suction catheter, sterile. size: f g 14 (details in rc) 1588 suction catheter, sterile. size: f g 16 (details in rc) 1589 suction catheter, sterile. size: f g 18 (details in rc) 1590 suction catheter, sterile. size: f g 20 (details in rc) 1591 suction catheter, sterile. size: f g 22 (details in rc) 1592 suction catheter, sterile. size: f g 6 (details in rc) 1593 suction catheter, sterile. size: f g 8 (details in rc) 1594 suction catheter, sterile.size: fg 5 (details in rc) 1595 sugmadex 1596 sulfacetamide 20% 1597 sulfasalazine gastroresistant tablets ip 500 mg ip 1598 sulphur + calamine 1599 sultamicin 375 mg 1600 sunitinib 12.5 mg 1601 sunitinib 25 mg 1602 sunitinib 50 mg 1603 sunscreen (octinoxate,avobenzone , oxybenzone) spf 30 1604 superoxidized 1605 surfactant for intratrecheal instillation (natural bovine lung surfactant) 1606 surgical blade sterile, size 11(details in rc) 1607 surgical blade sterile, size 15(details in rc) 1608 surgical blade sterile, size 22(details in rc) 1609 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) 1610 surgical cap disposable (for surgeons)(details in rc) 1611 surgical cap, disposable (for nurses) (details in rc)(details in rc) 1612 surgical spirit ip (100 ml) 1613 surgical spirit ip (500 ml) 1614 susp. azithromycin oral suspension 100mg/5ml 1615 susp. azithromycin oral suspension 200mg/5ml 1616 suture needles curved 1/2 circle round body assorted size 11 15(details in rc) 1617 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) 1618 suture needles curved 1/2 circle round body assorted size 16 20(details in rc) 1619 suture needles curved 1/2 circle round body assorted size 6 10(details in rc) 1620 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) 1621 suture needles curved and cutting 1/2 circle size 11 15(details in rc) 1622 suture needles curved and cutting 1/2 circle size 16 20(details in rc) 1623 suture needles curved and cutting size 1 5(details in rc) 1624 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 1625 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 1626 syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) 1627 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) 1628 tacrolimus 0 .03%15 gm 1629 tacrolimus 0 .1% 15 gm 1630 tacrolimus 0.25 1631 tacrolimus 1mg 1632 tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 1633 tamoxifen tab ip 10 mg 1634 tamsulosin + dutasteride 1635 tamsulosin hcl tablets/capsule 0.4 mg 1636 tapentadol50mg 1637 tegafur + uracil 100 mg 1638 teicoplanin 200 mg 1639 teicoplanin 400 mg 1640 telmisartan tablets ip 40 mg 1641 temozolamide 250 mg 1642 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 1643 temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm 1644 tenaligliptin tablet ip 20mg 1645 tenecteplase 20mg 1646 tenecteplase 40 mg 1647 tenofovir 300mg 1648 terbinafine cream 1%w/w (10 gm tube) 1649 terbinafine hydrochloride tablet 250 mg 1650 terbutalin 1651 terbutaline tablets ip 2.5 mg 1652 testosteron propionate 250mg 1653 testosteron propionate 50mg 1654 tetanus immunoglobulin ip 250 iu/ vial 1655 tetanus vaccine (adsorbed) ip 5 ml vial 1656 tetanus vaccine (adsorbed) ip in 0.5 ml 1657 tetrabenazine 25mg 1658 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 1659 theophylline and etofylline injection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 1660 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) 1661 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) 1662 thiamine 100ml 1663 thiamine tablets ip 100 mg 1664 thiopentone inj ip 0.5 g 1665 thyroxine sodium tablets ip 100mcg 1666 thyroxine tablets ip 50 mcg 1667 ticagrelor 90mg 1668 ticarcillinand clavulanic acid 1669 tigecycline for injection 100mg 1670 tigecycline for injection 50mg 1671 timolol eye drops ip 0.5 o/o w/v 1672 tinidazole tab ip 300 mg (film coated) 1673 tinidazole tab ip 500 mg (film coated) 1674 tiotropium + glycopyrolate 25mg 1675 tiotropium 9mcg inhaler 1676 tiotropium bromide dry powder30/pack 1677 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 1678 tobaramycin 80mg 1679 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o 1680 tobramycin eye drops 0.3% [331] 1681 tobramycin ophthalmic ointment usp 0.3% 1682 tofacitinib 5 mg 1683 tolvapatan 15mg 1684 tooth gel sodium monofluorophosphate 0.7 o/o and potassium nitrate 5 o/o (in flavoured base) 1685 topiramate50mg 1686 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 1687 topotecan 2.5 mg 1688 topotecan 4 mg 1689 topotecan1 mg 1690 torsemide20mg 1691 torsemide inj 10 mg/ml 1692 torsemide tab 10 ip mg 1693 t pa 20mg alteplase for injection 1694 t pa 50mg alteplase for injection 1695 trabectedin 1 mg 1696 tracheostomy tube (pvc), cuffed all sizes(details in rc) 1697 tracheostomy tube, plain all sizes(details in rc) 1698 tramadol 37.5mg + paracetamol 325mg 1699 tramadol cap ip 50 mg 1700 tramadol inj 50 mg/ml 1701 trametinib 0.5mg + davarafenide 150mg (monopoly) 1702 tranexamic acid 500mg/5ml 1703 tranexamic acid injection ip 100mg/ml 5ml size 1704 tranexamic acid tablets ip 500 mg 1705 trastuzumab 440 mg 1706 trastuzumab150mg 1707 travapost+timolol 1708 travoprost eye drops ip 0.004 o/o 1709 tretenoin cream usp 0.025% 1710 triamcinolone acetonide 10 mg per ml 1711 triamcinolone acetonide 40 mg per ml 1712 triclofos oral suspension500 mg/ 5mlin 30ml 1713 trifluperazine tab ip 5 mg coated 1714 trihexyphenidyl hcl tab ip 2 mg 1715 trimetazidine 35mg 1716 trimetazidine 60mg 1717 triptorelin 0.1 mg 1718 triptorelin 11.25 mg 1719 triptorelin 3.75 mg 1720 tropicamide eye drop ip 1o/o 1721 tropicamide+phenylepherine 1722 trypan blue 0.6% 1723 trypsin + rutoside+bromelain 1724 trypsin chymotripsin 1725 t tube for common bile duct drainage, length 20x60 cm, size (details in rc) 1726 ulipristal 5mg 1727 umbilical catheter for new born, all sizes (details in rc) 1728 umbilical cord clamp (details in rc) 1729 urethral catheter 90 (fg 14) made up of medical grade pvc (detail in rc) 1730 urethral catheter 91 (fg 10), made up of medical grade pvc (detail in rc) 1731 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml (details in rc) 1732 urine collecting bag, disposable 2000 ml(details in rc) 1733 urokinase injection 5 lac unit (lyophilized) 1734 ursodeoxycholic acid tablets ip 300 mg 1735 ursodeoxycholic oral suspension 125mg/5ml in 100ml 1736 vaccum suction set, 2.5 meter length (detail in rc) 1737 valethamate bromide inj 8mg / ml 1738 valganciclovir tablet 450 mg 1739 vancomycin for intravenous infusion ip 1 gm 1740 vancomycin for intravenous infusion ip 500 mg 1741 varicella immunoglobulin for iv use 1742 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) (detail in rc) 1743 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) (detail in rc) 1744 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) (detail in rc) 1745 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) (detail in rc) 1746 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) (detail in rc) 1747 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) (detail in rc) 1748 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) (detail in rc) 1749 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) (detail in rc) 1750 vasopressin 3ml 1751 vdrl antigen (with + ve and ve control) / rpr slide kit 1752 vecuronium bromide for injection 4mg (freeze dried) 1753 verapamil2.5 mg/ml 1754 verapamil hydrochloride sustained release 120 1755 verapamil hydrochloride sustained release 40 1756 verapamil tab ip 40 mg film coated 1757 vildagliptin 50mg 1758 vinblastine inj ip 10mg/ 10ml 1759 vincristine inj ip 1mg(vial)/vincristin injection usp 1mg/ml (amp) 1760 vinorelbine 10mg 1761 vinorelbine 50mg 1762 vitamin – e50mg/ml, 400 iu 1763 vitamin a 25000 iu 1764 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 1765 vitamin b complex inj nfi 1766 vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 1767 vitamin d (600000 iu) 1768 vitamin d3 400iu/ml 1769 vitamin d3 800iu/ml 1770 vitamin d3 oral solution 60000 iu 1771 vitamin e capsule 400 mg 1772 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. (aqueous solution) 1773 vitamin k 1 (phytomenadione) ip 1mg/0.5ml injection (detail in rc) 1774 voglibose 0.2 mg tab 1775 voglibose 0.3 mg tab 1776 voriconazole 1777 voriconazole 200 mg 1778 voriconazole injection 200mg/vial 1779 warfarin 1mg 1780 warfarin 2mg 1781 warfarin 3mg 1782 warfarin sodium. tab ip 5mg 1783 water for inj ip 1784 xylocaine lubricating30gm 1785 xylometazoline nasal drops ip 0.1% 1786 zinc 50mg 1787 zinc oral suspension 20 mg/100 ml 1788 zinc oxide +alo vera +semethicone 1789 zinc sulphate dispersible tablets ip elemental zinc 10 mg 1790 zoledronic acid injection ip 4mg vial 1791 zolpidem 10mg 1792 zolpidem tablet 5 mg 1793 zonisamide 100 mg 1794 zonisamide 50mg 1795 non edl 1796 balance salt solution glass bottle 500ml (sterile opthelmic irrigatiing sol.) sodium chloride 0.49%, pottasium chloride 0.075% , calcium chloride 0.048% , magnisium chloride 0.03% , sodium acetate 0.39% ,sodium citrate 0.17% 1797 inj. sodium chloride 0.9% 1798 micronised progesteron soft gelatin capsule 100mg 1799 sterilium 2propanolol 45gm , 1 propanolol 30mg/100mg 1800 korsolex rapid gluteraldehyde 15.2mg , 1.6 dihyroxy 2,5 dioxahaxane 19.7gm 1801 taurine 500mg + n acetylcysteine 150mg tablets 1802 adhesive tap cotton 6inch 1803 autoclave indicator tap (sigma lock) 1804 bandages 5cm x 4mts 2 1805 bandages 10cm x 4mts 4 1806 bandages 15cm x 4mts 6 1807 crescent 2.6 mm (sharpedge) 1808 dispo needle 26.5 1809 ecoshield/bacillocid (hydrogen peroxide 11% with silver nitrate 0.01%) 1810 surgical pad 1811 gauze than 120cm x 9mts 1812 keratom 2.8 mm (sharpedge) 1813 opthalmic micro surgical blade(mvr knife 20 g) 1814 cotton roll 1815 cotton buds 1816 makintosh 1817 bleeching powder 1818 haemocoagulase topical sol. 1819 charcoal powder 1820 suture needle (size 11 15) 1821 face shield 1822 n 95 mask 1823 hand rub 1824 glass ionomer cement (gic) 1825 personal protection equipment (ppe kit) ...

Jawaharlal Nehru Medical College - Rajasthan

32809777 supply of drug & medicines tender injection tablet syrup etc 1.5% hydrogen peroxide mouthwash 3 way stop cock non pyrogenic and single use, should be leak proof, , 2 s119 each piece with smooth movements (detail in rc) 3 way stop cock with extension tube (vein o extension line) size 3 s122 each piece 100cm (non pyrogenic & single use) (detail ln rc) 3 way stop cock with extension tube (vein o extension line) size 1ocm 4 s1 20 each piece pyrogenic & single use) (detail in rc) lnon 3 way stop cock with extension tube (vein o extension line) size 5 s1 23 each piece 150cm (non pyrogenic & single use) (detail ln rc) 3 way stop cock with extension tube (vein o extension line) size 50cm 6 s1 21 each piece (non pyrogenic & single use) (detail in rc) 7 750 3rd generation recombinant f vlll 1000 lu with diluent vial with diluent 8 749 3rd generation recombinant f vlll 250 lu with diluent vial with diluent 5 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 9 742 rc not exists thioguanine usp 40 mg) 10 nrd 534 5 mercaptopurine 20 mg tab. abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) 11 547.a each piece abdominal drain kit, sterile, having drainage catheter and collection bag 12 s124 each piece (2000 ml) (size 16) (detail in rc) abdominal drain kit, sterile, having drainage catheter and collection bag 13 s1 25 each piece (2000 ml) (size 20) (detail in rc) abdominal drain kit, sterile, having drainage catheter and collection bag l4 s47.b each piece (2000 ml) size 28 (details in rc) abdominal drain kit,sterile,having drainage cather and collection 15 547.c each piece baq(2000) ml size 32 (details in rc) abiraterone acetate tablet lp 250 mg (each uncoated tablet contains 16 731 bottle of 30 tablets abiraterone acetate lp 250 mq) 77 s1 absorbable gelatin sponge b0 x 50x 1omm(details in rc) piece absorbable oxidized regenerated cellulose netsize 2 x 3 topical 18 s9s rc not exists absorbable haemostatic bactericidal property(details in rc) absorbable surgical suture (sterile catgut) bp/usp needled suture 19 r2 chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 1l0 1x12 20 r4 3hromic(l/2 cir rb needle 30 mm length 76 cm) size foils absorbable surgical suture (sterile catgut) bp/usp needled suture 2t r3 3hromic(1/2 cir rb needle 30 mm length 76 cm) size 2l0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 22 r5 chromic(1/2 cir rb needle 40mm length 76 cm) size 1l0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 23 r7 1xl 2 foils chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 absorbable surgical suture (sterile catgut) bp/usp needled suture 24 r6 chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 1x12 foils absorbable surgical suture (sterile catgut) bp/usp needled suture 25 r,i 3hromic(3/8 cir rb needle 40 mm length 76 cm) size 1l0 1 x12 foils absorbable surgical suture (sterile catgut), needled suture chromic size 26 r8 1x12 foils 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 110 112 27 r72 1x12 foils :ircle reverse cutting 36mm, os needle, suture length 90 cm absorbable surgical suture (synthetic) antibacterial with sterilised reedled suture (braided coated polyglactin / polyglycolic acid violet)size 28 r70 1x12 foils 210 112 cicle round bodied 30mm, suture length 90 cm absorbable surgical suture (synthetic) antibacterial with sterilised 29 r71 needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 lx1 2 foils 112 circle reverse cutting,os 40mm, suture length 90 cm ry l}.d s,no. il:: orug t{ame packino unlt rate/unit cst finafrate without gst rate wlth gsr absorbable surgical s@ sterilised needled suture(braided polyglactin/polygtycolic 30 r73 coated acid violet)size 3/0 112 cicle round bodied 20mm, suture 1x12 foils length 70 cm aosoroadte uurgrcat suture (synthetic) sterilised needled (braioedl 31 rl0 coated polyglactin /porygrycoric acid / pory(grycoride co ljactide)dize 2/0 1x12 foils 1/2 cir rb needle 30mm length g0 cm 32 r16 a co b a so te rb d a p b _ le oly s g u la r c g tin ica / l p s o u ry t g u r r y e co l r s ic yntn p@ory(grycoride co l ractide)size 2/o acid / 1x12 foils 1/2 cir rb needle 40mm l g0cm absorbabte surgical suture (synthetic; steritised neeege sg 33 r65 monofilament polydioxanone violet size i (1d cnde reverse cutting 50 lx1 2 foils mm leng g0cm) th aosordadte surgicat suture (synthetic) sterilised needled sutlrre 34 r67 monofilament polydioxanone violet size 110(112 circle rb 30mm 1x12 foils needle,length 70cm) absorbable su 35 r66 monofilament polydioxanone vioret size 2ro (1t2 circle rb 3rmm needre, 1x36 foils length 7ocm) absorbable surgical suture lsynt@ coated polyglactin /porygrycoric pory(grycoride co l ractide)1/2 acid / cir 36 rl 1 rb needle size 1/0 30mm length g0 1x12 foils cm absorbable surgical s /potygtycotic poty(gtycolide_co_l_tactide)size acid / _ 37 r9 99a!9 d^polglacrin 310 1l2cir rb needle 20mm length 70 1x12 foils cm absorbabte surgical suture (synthetic) sterilised naaled(berdeo coated p,olyglactin /polyglycolic poly(glycolide_co_l lactide)size_ 1 acid / 38 r13 1/2 cir rb needle40mm length g0 1x12 foils cm absorbable surgical suture 1sy /potystycotic poty(gtycotide co_l_tactide)size_ acid / 39 r17 99a199 fglis]actin 110(112 cir rb needle 40mm tength g0 1x12 foils cm) absorbable surgical suture (synthetic) s@ coated polyglactin /porygrycoric pory(grycoride co l ractide)bize 4/0 acid / 40 r15 (1/2 cir rb needte 20mm length 1x12 foils 70 cm) absorbable surgical suture 1 4t r18 coated polyglactin/porygrycoric acid/pory(grycoride co l ractide)size 3/o 3/8 circle cutting needle 22mm length 1x12 foils 45 cm adsordabre surgicat suture (synthetic)antibacterial witn sgriliseo neeeiil suture (braided coated porygractin/ porygrycoric 42 r74 acid vioret)size 3/0 3/8 circle r cutting, ps 1,24mm, suture 1x12 foils length 70 cm adsorda0re $urgicar suture (synthetic)sterilised needtedlbraidedpoated 43 r12 polyglactin/polygtycotic acid/poty(gtycotide co ljacride)size 1 1 i cn tapercut needte (heavy) 40mm length 1x12 foils 90 cm absorbabte surgical suture(syntheticyantibacterial oagd sgriiildneedled(braided po .t 44 r6b coated lyglactin/polyglycolic acid violet)size 1/2 circle ct round bodied 40mm,gs needle,suture g0 1x12 foils length cm absorbable surgical suturelsyntheffi needle d(braided porygractin/porygrycoric 45 r69 coated acid vioret)size 1/0 1/2 circle ct round bodied 40mm,gs need 1x12 foils le,suture length 90 cm adsoroa0re !iurgrcar suture(synthetic)sterilised needledlbraidedlcoated 46 r14 polyglactin/polygtycotic acid/poty(ctycotide co l tactide)size_3 to(1n cu 1x12 foils 30nventronal 25mm length 90 cm)undyed adsorbabre surgicar suture(synthetic)steritised rueeoteo@raioeoffizif polyglactin/polygtycotic acid/poly(glycolide co l tactide)size_4/0 47 r19 3/g circle cutting 16mm needle,suture 1x12 foils length tocm %*ji.si$lod .dc ro ua ol f,ate/unit gst final rate s,no. drug name packldg unit without gst rate with gst absorbable surgical sutures sterilised needled 48 r62 monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 1x12 foils circle ovalrb contrast needle 26mm, suture length 70cm) absorbable surgical sutures sterilised needled 49 r64 monofilamentpolyglecaprone /polyglyconale size 3/0 (3/8 circle cutting 1x12 foils 25mm needle, suture length of 70cm) absorbable surgical sutures sterilised needled 50 r63 monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 1 x12 foils 16mm needle,suture length 70cm) absorbable surgical sutures,sterilised needled 51 r61 polyglecaproneipoiyg|yconate,monofilament sutures size 1x12 foils 210 (112 circle oval rb needle 26mm needle,suture length of 70cm) 52 s2 absorbent cotton wool lp 500 gm rc not exists 53 nrd 535 acebrophylline sr 200 mg tab 54 780 acebrophylline tableucapsule 100 mg 10x10 tablets nrd 536 aceclofenac + thiocolchicoside 55 tab. aceclofenac and paracetamol tablets aceclofenac 100 mg and 56 492 rc not exists paracetamol 325 mg 57 nrd 537 aceclofenac sr 200 mg tab. 58 nrd 538 aceclofenac+paracetamol+ serratiopeptidase (1 00+325+1 5 mg) tab. 59 163 acenocoumarol tab lp/ nicoumalone tab lp 2 mg 10x10 tab slrip 60 253 acetazolamide tab lp 250m9 10x10 tab blister 61 nrd 89 acetic acid otic solution 2% ear drop 62 500 acetylcystine solution usp (lnjection) 200 mg/ml rc not exists 63 nrd 7 acitretin 10 mg cap. nrd 8 acitretin 25 mg 64 cap act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of 65 647 one combi blister pack sulphadoxine and pyrimethamine(750m9+37,5mq) act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of 66 648 one combi blister pack sulphadoxine and pvrimethamine(500mq+25mo) act kit containing 3 tablets of artesunate(2smg each) and 1 tablet of 67 645 one combi blister pack sulphadoxine and pyrimethamine(250m9+1 2.5m9) act kit containing 3 tablets of artesunate(so mg each) and 1 tablet of 68 646 one combi blister pack sulphadoxine and pyrimethamine(500mq+25mq) 69 nrd 146 acth synacthen 250 mcg lnj acyclovir cream 5% 70 213 5 gm tube in unit carton 71 769 acyclovir eye ointment lp 3% w/w 5gm size 5 gm tube 72 502 acyclovir lntravenous lnfusion lp 250m9 vial 73 503 acyclovir lntravenous lnfusion lp 500m9 rc not exists acyclovir oral suspension lp 400m9/5ml 50 ml bottle (with 74 62 vleasurinq cao) 75 bj acyclovir tab lp 200 mg 10x10 tab blister 76 64 acyclovir tab lp 800 mg 10x10 tab strip 77 nrd 147 adalimumab 40 mg lnj. 78 nrd 60 adaplene (0.1% waiv) gel 79 547 adenosine lnjection lp 6 mg/2ml 2ml vial/ ampoule 80 nrd 148 ado trastuzumab 100 mg lnj. 81 nrd.149 ado trastuzumab 160 mg lnj, adrenaline lnjection lp 1mg/ml lm/lv use 1ml 82 34 amp(ambercolor)25 amp 83 nrd 539 afatinib 20 mg tab. 84 nrd 540 afatinib 30 mg tab. 85 nrd 541 afatinib 40 mg tab. 86 65 albendazole oral suspension lp 400 mg/10m1 10 ml bottle 87 66a albendazole tablets lp 400 mg(detail in rc) rc not exists nrd alectinib 150 mg (monopoly) 88 9 cap. 89 nrd 542 alendronate sodium 70 mg tab ct) drug rate/unit gst finat rate s.no. drug name packlng unlt code without gst rate with gst alendronate sodium tablets usp / bp 35 mg .4tablet) 90 631 4 tablets (20 91 nrd.543 alfuzosin 10 mg tab alkylizer 1 gm/s 100 92 788 syrup .4 ml( ml )(disodium hydrogen citrate) rc not exists 93 nrd.1o all trans retinoic acid 10 mg cap 94 598 allopurinol tablets lp 100 mg 10x10 tablets 95 nrd 44 aloe vera moisturizing cream nrd alpelisib 150 mg (monopoly) 96 544 tab. nrd alpelisib 200 mg (monopoly) 97 .545 tab. nrd alpelisib 250 mg (monopoly) 98 ..546 tab. 99 nrd 150 qlpha beta arteether 2 ml lnj. alpha lnterferon lnlection lnterferon alpha 2 concentrated solution lp 3 100 525 vial vlillion unit l 01 nrd 3 alpha+lipoic acid + leycopen +multivitamin and miltiminerals cap. alprazolam tab lp 0.25 mg 102 339 1 0x1 0 tab strip/blister alprazolam tab lp 0.5m9 103 340 10x10 tab strip/blister 104 nrd.547 amantidine 100m9 tab. 105 nrd 77 ambroxol drop 106 o/ amikacin lnj lp 100 mg 2 ml vial 707 504 amikacin lnj lp 250 mg vial 108 6b amikacin lnj lp 500 mg 2 ml vial 109 794 amino acid 10% lnjection 100m1 size 100 ml bottle 110 nrd 152 aminocaproic acid 20ml nj. 111 365 aminophylline lnj lp 25 mg/ml 10 ml amp 25 ampoules 712 183 amiodarone hydrochloride lnj 50 mg/ml 3 ml amp (10 amp) tab 100 113 181 amiodarone ip mg 10x10 tablets t74 182 amiodarone tab lp 200 mg 10x10 tab strip 115 nrd.54b amisulpride 50 mg tab. 116 341 amitriptyline tab lp 25mg film coated 10x10 tab strip amlodipine and atenolol tablet (amlodipine besilate equivalent to 717 461 10x10 tab blister amlodipine 5mg,atenolol 50mg) amlodipine and enalapril maleate tablets (amlodipine besilate equivalent t.18 457 10x10 tab strip to amlodipine 5 mg, enalapril maleate 5 mq) amlodipine and lisinopril tablets amlodipine besilate equivalent to 119 460 10x10 tab strip/blister amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mo 120 nrd 477 amlodipine oral solution 1 mg/ ml syrup amlodipine tab lp 2.5 mg 721, 184 1 0x1 0 tab strip/blister 722 185 amlodipine tablets lp 5 mg 10x10 tab blister 1,23 nrd 45 amophous hydrogel with colloid silver wound dressing cream 124 nrd 46 amorolflne 0 25% cream 12s 506 amoxicillin and potassium clavulanate lnj lp 1.2gm vial 726 505 amoxicillin and potassium clavulanic lp lnj 600mg 10 ml vial 1.27 nrd 153 amoxycillin & clavulanic acid 300 mg lnj 728 69 amoxycillin and cloxacillin cap 250 + 250 mg 1 0x10 cap strip amoxycillin and potassium clavulanate tabs lp 500 mg + llg 69 729 70 rc not exists amoxycillin and potassium clavunate oral suspension lp 200 mgr|z8s 30 ml bottle with 130 507 mg/5 ml (30m1 bottle) measurinq cao amorycillin cap lp 250m9 131 71 10xl 0 cap strip/blister amoxycillin cap lp 500m9 132 72 1 0x10 cap strip/blister 133 t3 amoxycillin dispersible tablets tp 125 mg 10x10 tab strip amoxycillin oral suspension lp (dry syrup) 125 mg/sml 30 ml bottle with 134 473 /easurino cao a. .r l r{6. ii: d,g n4n , < ..no. druo . rate/unit gst final rate drug name unlt coai acxtng witho;t gsr rate wath gst amorycillin tablet 250 mg+calvulanic acid 125 mg lp each film coated 135 706 tab conatin amorycillin trihydrate lp 250 mg & potassium clavulanate lp 10x10 tablets 125 mg 136 74 amphotericin b lnj lp 50 mg vial 737 nrd.154 ampicillin + salbactum 1.59 lnj 138 412 ampicillin cap lp 500m9 10x10 cap blister 139 75 ampicillin lnjection lp 500 mg vial antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg 30 ml bottle (with 140 261a magnesium hydroxide 250m9, activated polydimethyl siloxane 50mg n/easuring cap) antacid tablets. formula,each chewable tablet contains magnesium 747 260a trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint 10x10 tab blister cil 742 225 anti a blood grouping serum lp(anti a monoclonal serum) 10 ml vial l43 lzo anti b blood grouping serum lp(anti b mono clonal serum) 10 ml vial anti d(rh) blood grouping serum lp/anti d blood grouping serum lp l44 227 10 ml vial anti lnhibitor coagulation complex (human plasma protein with a factor 145 407 vial with 20ml solvant vlll lnhibitor bypassing activity of 500 l.u. per vial) 146 nrd.78 anticold drop anticold syrup each 5 ml contains phenylephrine hydrochloride 2.smg , 30 ml bottle with 147 497 chlorpheniramine maleate 1 mg, and paracetamol 125 mg measuring cap anti oxidants (beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 148 nrd 11 mg,managanesel.5 mg,zinc 7.5 m cap mg,selenium,l50 icrogram) l49 nrd 549 apixaban 2.5 mg tab. 150 nrd 550 apixaban 5mg tab. 151 nrd.12 aprepitant 125 mg cap. 752 nrd.551 aripiprazole 10 mg tab 153 nrd 552 aripiprazole 5 mg tab 754 nrd 478 artemether 40mg + lumefantrine 240 mg 30ml syrup 155 686 artemether and leumefantrine tablet (40 mg and 240 mg) lx6 tablet blister 156 651 artemether and leumefantrine tablet (80 mg and 480 mg) 1x6 tablet blister l57 nrd 156 artesunate 120 mg nj. artesunate lnjection 60 mg (1.m. l.v.use) each combo pack contains artesunate lnjection 60 mgvial, sodium bicarbonate lnjection lp 5 o/o w/v each combo pack in a 158 508a (lml ampoule),sodium chloride lnjection lp 0.9o/o w/v (5ml ampoule) unit carton 159 nrd.1 artificial saliva solution asceptic ( chlorhexadine gluconate 7.5o/o +=1so/ocatrimide solu + lsopropyl 160 nrd 410 lotion 17o/o 161 j6/ ascorbic acid tab lp 500 mg 10x10 tab strip t62 s3 asepto syringe with transparent bulb sterile, 60 ml rc not exists 163 nrd.553 aspirin lp 300 mg tab, aspirin delayed release tablet / aspirin gastroresistant tab lp (each 164 444 10x14 tab strips 3nteric coated tablet contains acetyl salicylic acid 75 mg) 165 nrd.554 aspirin dispresible 325m9 tab. 166 679 aspirin tablet lp (gastro resistant) 150 mg 14x10 tablet 167 nrd.79 astymine c (vitamin c+ essential amino acid) drop 168 462 atenolol tab lp 25 mg 10x14 tab blister 169 186 atenolol tab lp 50 mg 10x14 tab blister tt0 nrd.157 atezolizumab 1 200 mg(monopoly) ni. t7t nrd 555 atomoxetin 10 mg tab. 772 nrd 556 atomoxetin 18 mg l ab. 173 nrd.557 atomoxetin 25 mg tab. atorvastatin tab lp 1omg 174 187 l 0x1 0 tab strip/blister 175 548 atorvastatin tablets lp 40 mg 1 0x 10 tablets atracurium lnj 10 mg/ml 2.5 ml amp(10 176 311 ampoules) orug s,no. drug name packins un final late g rt ode #irtj|[t, :j: wltt gst 777 319 atropine eye ointment lp 1% rc not exists atropine sulphate lnjection 0.6m9/ml 178 654 1ml amp 25 ampoules atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized 779 320 dropper,or squeeze vial 180 nrd.558 atroxentine 250m9 (trientine hcl) tab. 181 nrd.158 avelumab 200 mg (monopoly) lnj 182 nrd.559 axitinib 5 mg tab. 183 nrd 160 azacitidine 100m9 lnj 184 nrd.159 azacitidine 50mg lnj 18s 133 azathioprine tab lp 50 mg 10x10 tab strip 186 nrd 47 azelaic acid 20% cream 187 nrd.120 azithromycin 1% eye ointment 188 nrd 161 azithromycin 10 ml vial equaivelent to 500 mg lnj. azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 10x3x3 tab 189 78a strip/blister(strip/blister of 3 tab) azithromycin tab lp 500 mg 10x3x3 tab 190 80a strip/bliste(strip/blister of 3 tab) azithromycin tablets lp 250m9 l0x3x3 tab 191 79a strip/bliste(strip/blister of 3 tab) 792 683 aztreonam lnjection 1gm vial 193 509 azlreonam lnjection usp 500 mg vial 194 nrd.479 b. complex syrup b,b silk suture (3/b cir rb needle 16mm, length 76 cm size 5/0 (details 195 r79 1x12 foils in rc) b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details 196 r78 1x12 foils in rc) 197 nrd.162 bacitracin for lnjection 25,000 lu lnj. 198 nrd 4bo baclofen oral solution 5 mg /ml syrup baclofen tablet lp 10 mg (each uncoated tablet contains baclofen lp 10 199 698 m 10x10 tablets g) balanced salt calcium free 1000 ml [solution], non pvc polyolefin sterile 200 nrd.2 solution free flex bag beclomethasone lnhalation lp 200 mcg/dose 200metered dose 201 366 container beclomethasone, neomycin and clotrimazole cream (beclomethasone 202 445 dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) 10 gm tube in unit carton 203 726 3endamustine ln.jection 100 mg vial 204 b1 3enzathine benzylpenicillin lnjlp 12lac units vial 205 82 benzalhine benzylpenicillin lnj lp 6 lac units vial 206 nrd 48 benzoyl peroxide 2.5 % cream 207 nrd 97 betadin 5% eye drop 208 542 betahistine tab lp16 mg 10x10 tablets 209 541 betahistine tab lp 8 mg 10x10 tablets 210 558 betamethasone dipropionate cream lp 0.05% 15gm tube in a unit carton 21.1 <(o betamethasone lotion lp 0.05 o/o rc not exists 272 418 betamethasone sod phos lnj lp 4mg/ml 1 ml ampouletuial 213 1e betamethasone tab lp 0,5m9 10x10 tab blister 274 612 betaxolol eye drops 0,5 o/o rc not exists 275 735 bevacizumab lnjection 100 mg vial 276 734 bevacizumab lnjection 400 mg vial bicalutamide tablet lp 50 mg (each film tablet contains gicalutamide lp 277 741 50 mg) rc not exists 278 nrd.56o bilastin 20 mg tab gt j.. r+ , (i1 r r {1 l ? i o , druo rate/unit gst final rate .,s.no, , drug name packing unit coal without gst rate with gst :i 219 nrd 561 3iotin 5 mg tab. o/o biphasic lsophane lnsulin lnj lp (30 % soluble insulin and 70 isophane 220 279 10 ml vial nsulin) ini. 40 lu/ml(r dna oriqin) 221 262 bisacodyl tab lp 5 mg 10x10 tab strip 222 398 black disinfectant fluid (phenyl) as per schedule o grade lll 5 ltrs can 223 134 bleomycin lnjection lp 15mg (bleomycin sulphate lnjection 15 units) vial 224 s4 blood administration set blood transfusion set (details in rc) unit 225 s98 bone cement rc not exists 226 s80 bone wax sterilised 2.5 gram/packet 227 nrd 163 bortezomib 2.5 lnj. 228 730 bortezomib lnjection 2mg vial 229 nrd 562 bosentan 62.5 mg tab. 230 nrd.563 bosutinib 500 mg tab botulinum toxin type a for injection/botulinum toxin type b for inlection 231 nrd 164 ln,i 100 tu botulinum toxin type a for injection/botulinum toxin type b for injection 232 nrd ,i65 lnj. 50 lu 233 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5 ml squeeze vial 234 nrd.98 brin ozo la m ide+ brim on id ine eye drop 235 nrd 564 brivaracetam 50mg tab. 236 540 bromocriptine tablets lp 2.5 mg 10x10 tab strip 237 nrd 456 budesonide 0.5mg/ml respules nrd budesonide 1ml 238 457 respules 239 nrd 421 3udesonide 200 mcg mdi 240 nrd 66 budesonide 400 mcg dpi 247 nrd 13 budesonide 9 mg oap budesonide nebulizer suspension 0.25m9/ml 242 367 2 ml amp 10 ampoules 243 617 budesonide powder for lnhalation 200 mcg 30 capsules bupivacaine hydochloride in dextrose lnjection usp each ml contains 244 2 4ml amp(10 ampoules) buoivacaine hvdrochloride 5.0 mq dextrose 80.0 mq 245 4 bupivacaine lnj lp 0.5% 20 ml vial 246 nrd 565 buprinorphine 2 mg tab, nrd busulfan 60mg/1ml 247 .166 lnj 248 694 butorphanol tartrate lnjection usp 1mg/ml 1ml size rc not exists 249 nrd 167 cabazitaxel 20 mg ln.i 250 nrd 168 cabazitaxel 40 mg lnj. cabergoline tablet lp 0.5m9 (each uncoated coated tablet contains 251 773 10x10 tablets caberqoline lp 0.smo) nrd caffeine cirate 20mg/ml 252 .169 ni laffeine citrate usp lnjection 20mg/ml (equivalent to 10 mg caffeine 253 793 3ml vial )ase/ml) 3ml size 254 nrd 443 laffiene citrate oral solution sral drop 25s 671 lalamine lotion lp 100m1 100 ml bottle 3alcitriol capsules lp 0.25 mcg 256 630 1 0xl 0 cap strip/blister 257 nrd 566 lalcium acetate 667 tab. 3alcium and vitamin d3 suspension (each 5 ml contains calcium 100 ml bottle(with 258 441 3arbonate equivalent to elemental calcium 250 mg, vitamin d3 125 lu ) measuring cap) nrd calcium chloride 5ml vial 259 .170 lnj 260 nrd 14 calcium dobesilate 500mg cap 261 nrd 567 calcium folinate 15 mg tab. 262 388 calcium gluconate lnj lp 10% (lv use) rc not exists 263 nrd.,i71 calcium gluconate/folinate lnj, nrd calcium phosphate 200 ml 264 481 syrup :setr1 {l.f{q drug rat€/unlt gst flnal rate s,no. drug name packlng unit code without gst rate wlth gst calcium with vitamin d tablets usp /calcium and colecalciferol tablets 26s 622 bp/calcium and vitamin d3 tablets lp(elemental calcium 500 mg, 10x10 tablets vitamin d3 250 lu) (non chewable) capecitabine tablet lp 500 mg (each film coated tablet contains 266 727 10x10 tablets capecitabine lp 500 mq) nrd capmatinib 200 mg (monopoly) 267 .56b tab. carbamazepine oral suspension usp 100 mg/sml 100 ml bottle(with 268 474 measurino cao) carbamazepine tab lp 100 mg 269 54 1 0x1 0 tab strip/blister carbamazepine tab lp 200 mg 270 53 1 0x1 0 tab strip/blister 271 nrd 172 carbetocin 1 ml/1 00micro. lnj. 272 nrd.569 carbimazole 10 mg tab. 273 280 3arbimazole tabs lp 5 mg (film coated) 10x10 tab blister nrd larbolic acid 100% in 500 ml 274 .4o solution nrd larbolic acid 50% in 500 ml 275 .39 solution 276 526 3arboplatin lnjection lp 150 mg 15 ml vial 277 527 carboplatin lnjection lp 450 mg 45 ml vial carboprosl tromethamine lnjection lp each ml contains carboprost 0.25 278 281 rc not exists mq/ml 279 nrd 92 )arboxymethylcellulose + glycerin eye drop 280 613 arboxymethylcellulose eye drops lp 0.5% 10 ml squeeze vial 281 nrd.173 arfilzomib 20 mg lnj. 282 nrd 174 arfilzomib 60 mg lnj. 283 nrd.175 carmustine 100 mg lnj. 284 aae carvedilol tablet 3.125 mg 10x10 tablets 28s nrd 176 caspofungin 50 mg lnj. 286 nrd.177 caspofungin 70 mg lnj catheter,size 10(foleys ballon catheter sterile,2 way for urinary 287 s9.b drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 16(foleys ballon catheter sterile,2 way for urinary 288 s9.c drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 18(foleys ballon catheter sterile,2 way for urinary 289 s9.d drainage,single use,)silicon coated natural latex material(details in rc) each piece satheter,size 20(foleys ballon catheter sterile,2 way for urinary 290 s9.e drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size 22(foleys ballon catheter sterile,2 way for urinary 29]. s9.f drainage,single use,)silicon coated natural latex material(details in rc) ach piece catheter,size 24(foleys ballon catheter sterile,2 way for urinary 292 ssg drainage,single use,)silicon coated natural latex material(details in rc) each piece catheter,size b(foleys ballon catheter sterile,2 way for urinary 293 s9.a drainage,single use,)silicon coated natural latex material(details in rc) each piece 294 nrd 475 cefaclor each 5 ml contain cefaclor 125 mg svp. cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet 295 709 10x10 tablets contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 296 710 cefadroxil tablet 500 mg rc not exists 297 510 cefepime lnjection lp 500 mg vial 298 nrd 1 78 3efipime 1000mg + tazobactum 125mg lnj 299 nrd.57o 3efixime + potassium clavulanate 200+125m9 tab. 300 nrd.482 3eflxime oral suspension 50mg syrup 301 nrd 483 3efixime oral suspension 100mg syrup 302 511 sefixime oral suspension lp 2smg/ml (paediatric drops) 10 ml bottle 303 b4 oefixime tab lp 100 mg 10x10 tab strip gaj . ,;. 1l *€g rate/unit gst fanal rate uithout gst rate with gsf ie lefixime tab lp 200 mg 10x10 tab strip 304 85 i @mg nj. 305 nrd.179 1mg ln.i 3efoperazone lnj. 306 nrd.48b l ce 500m9 lnj. nrd 180 foperazone 307 erazone sodium eq.to 1gm and sulbactum sodium eq. to sulbactum 0 sgm)(lm/lv rc not exists 308 86 )efoperazone rse) 250 mg vial 8b cefotaxime lnj lp 309 cefotaxime lnjection lp 1 g rc not exists 310 87 cefpodoxime 200m9 tab 311 nrd.572 ce cv 375 tab. 3 nrd.573 fpodoxime t2 10x10 tab strip 313 475 @ drops 3t4 nrd 86 rmt iab. 315 nrd.571 3etpoooxime proxetil oral suspension 100mg syrup 316 nrd.485 cetpoooxime proxetil oral suspension 50mg syrup 317 nrd 484 ce 1 gm+sulbactam500 mg lnj. nrd.1b1 ftazidime 318 vial ceftazidime lnj lp 1g 319 89 lp 250 mg vial ceftazidime lnj 320 90 vial ceftazidime lnj lp 500 mg 321 91 av 29m+59969 inl. nrd 182 ceftazldime+ ibactum 322 ce 1 gm lnj nrd.1 83 ftizoxime 323 ce lp 125 mg lnt. nrd.184 ftriaxone 324 ce +salbactum+ disodium edta lni nrd 185 ftriaxone 325 seftriaxone 1 gm + tazobactum 125 mg lnjection rc not exists 326 708 se sulbactam 1.59 lnj. nrd.186 ftriaxone and 327 vial (packed in cef lnj lp 1g /vial lriaxone 328 93 monocarton) ce lnj lp 250 mg/vial vial (amber colour) 94 ftriaxone 329 vial (packed in ceftriaxone lnj lp 500m9/vial 330 95 monocarton) 000m9+ tazobactom 1 25mg lnj. nrd leftriaxonel 331 187 ce 1gm lnj nrd.l bb furoxime 332 ce axetil 500 mg. ab. nrd 591 furoxime 333 cefuroxime axetil oral suspension 125m9/5ml syrup 334 nrd 486 xfuroxirne nxetil tab lp 250 mg 10x10 tab strip 335 512 3epha cap lp 250 mg 0x10 cap blister 96 lexin 336 oepha cap lp 500 mg 0x10 cap blister 97 lexin 337 g lp (cephalexin dry syrup lp) 125m9/ 5 ml 30 ml bottle with pe atexin od=uspension 338 427 measurino cao ceph lexin tablets 125 mg (dispersible tablets) 0x10 tab strip 339 476 nrd ceritinib 100 mg cap, 340 .16 nrd ]eritinib 200 mg cap. 341 17 nrd 0eritinib 250m9 cap. 342 18 nrd ceritinib 50 mg cap. 343 15 eeum drops (wax dissolving ear drops) paradichlorobenzene 2 inolytf benzocain e 2.7 olo chlorbutol 5 o/o, turpentine oil 15 o/o 10 ml bottle 344 589 o/o , , lp 5mg/5 ml 30 ml bottle.with 3etirizine syrup 345 499 veasurino cao setirizine,phenylephrine & paracetamol tablets cetirizine 5 rc not exists 346 498 mq.phenvlephrine 10 mq & paracetamol 325 mg tab gm 1sgm tube in a unit cetrimide cream lp 15 347 2l5a carton nrd cetrorelix acetate 0.25 mg lni 348 .189 nrd cetuximab 100 mg lnj. 349 190 nrd 3etuximab 500m9 lni. 350 .191 c) qil.{(h{ s dfuo final fate no drsg name packrns unit coal #i.:jl*, :;: with cst chemotherapy port & non coring needles(pediatric) (detail in rc) 351 s1 37 each piece 352 s136 chemotherapy port and non coring needles(adult) (detail in rc) each piece 353 tjt) chlorambucil tab lp 5 mg rc not exists 354 nrd 121 chloramphenicol 0.5% eye ointment nrd 122 chloramphenicol +polymycin 355 eye ointment 3s6 nrd 123 chloramphenicol +polymycine + dexamethasone eye ointment 357 771 chloramphenicol 1% w/w eye ointment lp, 3gm size rc not exists nrd chloramphenicol 1 gm/vial 358 .,i92 lnl. 359 321 chloramphenicol eye drops lp 0.5 0/0 5 ml. vial 360 nrd 574 chlordiazepoxide 25 mg tab. 361 342 chlordiazepoxide tablets lp 1omg 10x10 tab strip 362 nrd 575 chlordiazsepoxide 10 mg + clidinium 25 mg tab. 363 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 364 580 chlorhexidine mouthwash lp 0.2 olo 50 ml bottle 365 9b chloroquine phosphate lnj lp 40 mg/ ml 5 ml amp(25 amp) chloroquine phosphate suspension lp 50 mg/sml 50 ml bottle (with 366 1 00a measurino cao) chloroquine phosphate tab. lp 250m9 eq to 155 mg of chloroquine base oo 367 1 0x1 0 tab strip/blister film coated 368 37 chlorpheniramine maleate tab lp 4mg rc not exists 369 346 chlorpromazine lnj. lp 2smg/ml rc not exists 370 343 chlorpromazine tablets lp 100 mg (coated tablet) 10x10 tab strip 37r 344 chlorpromazine tablets lp 25 mg (sugar coated) 10x10 tab strip 372 345 chlorpromazine tablets lp 50 mg (coated tablets) 10x10 tab strip 373 nrd.576 chlorthalidone 6,25 mg tab. chlorzoxazone , diclofenac sodium & paracetamol tablets 374 610 (chlorzoxazone 250m9 , diclofenac sodium 50mg paracetamol 325 mg) rc not exists 375 nrd 577 cholchicine 0.5m9 tab. holecalciferol granules 60,000 lu /gm 1 gm sachet(s0 376 623 sachets) chromic catgut suture(3/b cir cutting needle 8 mm, suture length 35 cm) 377 r77 rc not exists size 6/0 (details in rc) chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture 378 rbo lx12 foils length 76 cm) size 4/0 (details in rc) chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 379 r76 1x12 foils cm) size 5/0 (details in rc) 380 nrd.584 cilnidipine 20 mg tab. 381 nrd.582 cilnidipine 5 mg tab. 382 nrd.5b3 urlnrdrprnel u mg tab. 383 nrd.579 cilostazol 100m9 tab. 384 nrd.57b cilostazol 50mg tab. 385 544 cinnarizine tablet lp 75 mg 10x10 tab blister 386 543 cinnarizine tablets lp 25 mg 10x10 tab blister ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin 387 585 5 ml. vial and dexamethasone otic suspension usp 388 322 ciprofloxacin eye drops lp 0.3 o/o w/v 5 ml squeeze vial ciprofloxacin lnjection lp 200m9/1 00ml 389 101 100 ml ffs / bfs bottle ciprofloxacin ophthalmic ointment usp 0.3% 390 323 5 gm tube in unit carton 391 103 ciprofloxacin tablet lp 500 mg film coated rc not exists 392 102 ciprofloxacin tablets lp 250 mg film coated 10x10 tab blister 393 768 cis atracurium besylate lnjection 2 mg/ml in 5 ml vial 5 ml vial 394 528 cisplatin lnj lp 10 mg/10 ml 10 ml vial 395 137 oisplatin lnj lp 50 mgi 50 ml 50 ml vial 396 nrd.1 93 3ladrabine 10 mg lnl. 397 nrd 580 3larithromycin 250 mg tab. a^) rtrrtr fiffa drug hate/unlt gst fanal iate 6.no. drug name packang unit .code without gst rate with gst 398 nrd 581 clarithromycin 500m9 tab. 399 nrd 194 clarithromycin 500m9 lnt. nrd clarithromycin for oral suspension 125m9/5ml 400 487 syrup nrd clindamycin 600m9/4ml 401 .195 nj clindamycin capsule lp 150m9 402 s13 10x10 cap strip/blister clindamycin capsule lp 300 mg 403 514 1 0x1 0 cap strip/blister clindamycin phosphate gel usp 1 o/o 20gm tube in mono 404 560 carton 405 714 3lindamycin phosphate lniection lp 300 mg vial/ampoules clobazam tableucapsule 10 mg 10x10 tablet/capsule 406 663 blister clobazam tablet/capsule 5 mg 10x10 tablet/capsule 407 662 blister 408 561 3lobetasol propionate cream lp 0.05 o/o 20 gm tube 409 nrd 435 llobetasol+salicylic acid 0.5%+6% sintment 410 282 3lomifene tab lp 25 mg 10x10 tab strip 411 283 3lomiphene tab lp 50 mg 10x10 tab strip 412 nrd .19 3lomipramine lp 25 mg 3ap. 413 nrd 585 3lonazepam 0.25 tab. 414 nrd 586 3lonazepam 1mg tab. 415 678 3lonazepam tablet 0.5 mg 10x10 tablets 4l6 nrd 196 llonidine 150mcg/ml nj. llonidine hydrochloride tablet lp 0.1 mg (each tablet contains clonidine 4l7 751 10x10 tablets lydrochloride lp 0.1 mg) clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 418 549 10x10 tab strip 4t9 188 clopidogrel tab lp 75 mg 10x10 tab strip close wound drainage device under negalive pressure (closed wound 420 s96.a suction unit) size of bellow 800 ml, catheter size 16 (details in rc) each piece close wound drainage device under negative pressure (closed wound 421 s96.b suction unit) size of bellow 800 ml, catheter size 18 (details in rc) each piece clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 422 586 5 ml ear drops 423 nrd 41 t clotrimazole 1 %+beclomethasone 0.25% lotion 424 nrd 419 clotrimazole 10mg lozenses clotrimazole cream lp 2o/owlw 1sgm tube in a unit 425 104 carton 426 443 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 15 ml squeeze bottle clotrimazole vaginal tab lp 500m9 single tablet(10 tabs 427 105 with an applicator) 428 417 cloxacillin sodium lnj lp 500m9 vial 429 nrd 589 clozapine 100 mg tab 430 nrd.587 i.;lozaprne 25 mg tab 43l nrd 588 clozapine 50 mg tab. 432 670 coal tar 6% & salicylic acid 3% ointment 20gm 433 nrd.476 codiene phosphate syrup 434 718 colistimethate lnjection lp 1m lu powder for solution vial 435 nrd.446 ooloplast 60 gm paste compound benzoic acid ointment lp benzoic acid 6 o/o + salicylic acid 3 1sgm tube in mono 436 106 clo carton 437 244 compound benzoin tincture lp 500 ml bottle compound sodium lactate (ringer lactate) in glass bottle 500m1 438 nrd 197 lnj. ,it l eye drop 569 s41.a double j stent, sterile, both ends open size +f, lengt6 16 crn rc not exists 570 s41 b double j stent, sterile, both ends open, size sf, lengtn z0 crn rc not exists 577 542.a double j stent, sterile, one end closed size 4f, length t6 cm rc not exists 572 s42.b double j stent, sterile, one end closed, size sf, lengtn 20 cm rc not exists 573 144 doxorubicin lnj lp 50 mg/ 25 mt rial doxycycline cap lp 100 mg 574 111 1 0x10 cap strip/blister 575 nrd 221 doxycycline for lnjection 100 mg nj. 6) ) ;h.t+.,.t,11 ,rf}f7tr s,no . .. dc r o u a o l d rate/unit gst final rate rug name packing unit without gst rate with gst dorylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet 576 763 (each enteric coated tablet contains doxylamine succinate usp 20 mg 10x10 tablets & pyridoxine hydrochloride lp 20 mg ) 577 689 dried factor vlll fraction lp (lv use) 1000 iua/ial vial with diluent 688 dried factor vlll fraction lp (lv use) 500 iua/ial 578 r,rial with diluent dried human anti haemophlic fraction lp (dried factor vlll fraction lp) 579 171 /ial with diluent 250 lu/ vial (lv use) 580 nrd 4s4 )rotavarine syrup )rotaverine and mefenamic acid tablets drotaverine 80 mg and 581 591 t0x10 tablets vefenamic acid 250 mg jrotaverine hydrochloride lnj 40 mg/2 ml e 582 2 ml amp 10 ampoules 583 415 jrotaverine tab lp 40 mg 10x10 tab blister 584 nrd 614 juloxetine gastro resistant 20 mg l ab. 585 nrd 615 fuloxitine gastro resistant30 mg iab. nrd )urvalumab 120 mg (monopoly) 586 222 lni. 587 nrd 223 durvalumab 500m9 (monopoly) lni. 588 787 dutasteride tablet 0.5 mg 10x10 tablets s89 nrd 616 dydrogesterone 10mg tab each 15 ml contains: milk of magnesia 11.25 ml+ liquid paraffin 3.75 ml 590 nrd 495 syrup 170 ml each 5 ml containing:paracetamol 125 mg + lbuprofen 100 mg 60 ml 591 nrd.496 syrup each combi bliste pack: containing 3 tablets of artesunate(2oo mg each) and 2 tablet of sulphadoxine pyrimethamine(750m9+37,5m9)each or 3 s92 649 one combi blister pack tablets of sulphadoxine pyrimethamine(500+25)mg 593 s1 04 ecg electrode (detail in rc) each piece 594 nrd 447 eeg 4oogm paste elastic adhesive bandage bp 1ocm x l mtr stretched length adhesive 595 s127 material should have good quality sticking property (detail in rc) each piece 596 nrd.617 eltrombopag 25mg tab. 597 nrd 618 eltrombopag 50mg tab. 598 nrd 619 empagliflazone 1omg tab. 599 nrd 620 empagliflazone 25mg tab. 600 nrd 224 enalapril 1.25 mg 1 ml lnj. 601 195 enalapril maleate tab lp 2.5m9 10x10 tab strip 602 194 enalapril maleate tab lp 5mg 10x10 tab strip 603 463 enalapril maleate tablets lp 10 mg 10x10 tab strip 604 s44.b endotracheal tube, cuff size 4.5 (details in rc) each piece 605 s44.c endotracheal tube, cuff size 5 details in rc each piece 606 s44.d endotracheal tube, cuff size 6 (details in rc) each piece 607 s44.f endotracheal tube, cuff size 7 (details in rc) each piece 608 s44.9 endotracheal tube, cuff size 7.5 (details in rc) each piece 609 s44.h ndotracheal tube, cuff size 8 (details in rc) each piece 610 s44.i endotracheal tube, cuff size 8.5 (details in rc) each piece 611 s44.j endotracheal tube, cuff size 9 (details in rc) each piece 672 s44.e endotracheal tube, cuff size 6.5 (details in rc) each piece 613 s44.a endotracheal tube, cuffed size 4 (details in rc) each piece 614 s43.a endotracheal tube, plain size 2.5 (details in rc) each piece 615 s43.b endotracheal tube, plain size 3 (details in rc) each piece 616 543.c endotracheal tube, plain size 3.5 (details in rc) ach piece 617 s43.d endotracheal tube, plain size 4 (details in rc) each piece 618 543.e endotracheal tube, plain size 4.5 (details in rc) each piece 619 s43.f endotracheal tube, plain size 5 (details in rc) each piece 620 sa3.g endotracheal tube, plain size 5.5 (details in rc; each piece 621 s43.h endotracheal tube, plain size 6 (detaits in re each piece ,)^ q{{q 1if{q fe i{{(q ffia ffq qtr ic druo sno drug name rate/unit gst flnatrnte coal packlng unlt wlthout gst rate wlth gst 622 s43 j endotracheal tube, plain size 7 (details in rc) ach piece 623 s43 k endotracheal tube, plain size = @etails in rc) each piece 624 s43.t endolracheal tube, plain size 8 loetarts in nc) rc not exists 625 543.m endotracheal tube, plain see s^s(daarb rn rc) each piece 626 s43.i ndotracheal tube, plain size 6.5 (details in rc) each piece 627 172 enoxaparin sodium tn1 le oo mg vial/pfs 628 nrd.621 ntacapone 200 mg tab. 723 entecavir tablet tp 0.5 mg (each fitm coated te6let conatrns enge 629 10x10 lp 0.5 mg) tablets 630 nrd 452 enterogermina zuittion spores srnl resp 631 nrd 627 enzalupamide 40mg tab. 632 nrd bo enzyme drop 633 nrd 497 enzyme 100 ml syrup 634 nrd 225 ephedrine 30 mg/ml lnj epidural minipack lsg 63s s1 10 sterile (detail in rc) each piece 636 nrd 227 epirubicin 150m9/ml lnj. 637 nrd 226 epirubicin 50mg/ml lnj 638 nrd.22b eribulin 0.5m9 lnj 639 nrd.229 eribulin 1 mg nj. 640 nrd.623 erlotinib 100m9 tab. 641, nrd.622 erlotinib 150 mg tab. .1 642 nrd.230 rtapenem sodium 1gm = ertapenem .046 gm n,. escitalopram tab lp 10 mg 643 351 1 0xl 0 tab strip/blister 644 smolol hydrochloride 1omg j0nrl 753 lnjection /ml size 10 ml vial esmoprazole lomg 645 nrd.1 33 granules 646 nrd.624 esomeprazole 40 mg tab. 647 nrd.498 esomperazole syrup 648 nrd 626 estradiol valerate cream 649 nrd.625 estradiol valerate 2 mg tab 650 nrd.468 ttanercept 25mg/o.5m1 lnj. ethamsylate lnj 250 mg/ 2mt (tm/tv) l aa 651 2 ml amp 10 ampoules ethamsylate tablet 500 mg (each unffi 6s2 745 ethamgylate 500 mg) rc not exists 653 286 ethinyloestradiot taos tt, so nrcg 10x10 tab strip 654 nrd 628 ethynil estradiol 0.02m9+ tab desogestrat o.tsrng tab. 655 nrd 629 etizolam 0.5 mg tab. 656 nrd 231 etomidate 20 mg nj. 657 nrd 232 etomidate ivct/lct 1on rl lal nj. 658 146 etoposide lnj lp 100 mg 5 ml glass vial 6s9 495 toricoxib tab lp 120m9 10x10 tab blister 660 658 toricoxib tablet lp 90 mg 10x 10 tablets 661 nrd 630 etoricoxib+thiocotcfricosioe1oo*a mg; tab. 662 nrd 23 evening primosa 1000 fig cap. 663 nrd 531 everolimus 1omg tab./cap. 664 nrd 530 everolimus 5mg tab./cap. 66s nrd 631 exemestane 25 mg tab. 666 770 eye drop tvtoxifl oxa@sml size 5 ml. vial 667 sb5 face mask, disposabteldetails in rc) siece factor lx concentrate (purified) tp 500 600 l.u.(human coagulation 668 406 = lx) 500 lu vial with solvent actor =aropenem tablet sodium 200 mg (each film tantei contalns 669 713 :aropenem sod 10x10 tablets ium gquivalent to faropenem sodium 200 mg) 670 nrd.632 febuxostat 40 mg tab. 671 nrd.633 ebuxostat b0 mg tab. o) , druo nate/unit gst fanal rate s.no, ,code drug name packang unit without gst rate with gst 672 550 fenofibrate capsules/ tab lp 200 mg rc not exists 673 nrd 233 fentanyl 25lu patch patch 674 nrd.234 fentanyl 50lu patch patch 675 655 fentanyl citrate lnjection 50mcg/ml 10ml vial/amp fentanyl citrate lnjection lp 2 ml 676 21 2 ml amp 10 ampoules 677 nrd 50 fenticonazole 2% sream 746 treracrylum 1% w/v sterile solution 100 ml 678 100m1 679 789 ferric carborymaltose lnjection 50 mg/ml 10 ml size 10 ml vial ferrous sulphate with folic acid tab (paediatric) lp each film coated tab 680 391 3ontaining dried ferrous sulphate lp eqivalent to 20mg elemental lron 10x10 tab strip/blister and folic acid lp 100 mcg ferrous sulphate with folic acid tab lp each film coated tab. containing 10x10 tab strip/blister 681 390 dried ferrous sulphate lp equiv 100 mg elemental lron and folicacid lp ).5 mg 682 nrd.634 fexofenadine 120 mg tab. 683 nrd.635 fexofenadine 180 mg tab. filgrastim lnjection lp (granulocyte colony stimulating factor) (sc/lv 684 530 pre filled syringea/ial use) 300 mcq finasteride tablets lp 5 mg 685 575 10x10 tab strip/blister 686 nrd.636 fingolimod 0.5 mg tab. 687 579 flavoxate tablets lp 200 mg (coated tablet) 10x10 tablets nrd 235 fluconazole 100m9 688 ln.i, nrd 236 fluconazole 200 mg 689 lni 690 425 fluconazole eye drops 0.3% 5 ml. vial 691 nrd 499 fluconazole oral suspension syrup fluconazole tablets lp 150m9 10 10 1 tab strip 692 114a (perforated) 693 nrd 237 fludarabine phosphate lnjection 1 00mg lnj 694 nrd 238 fludarabine phosphate lnjection 50mg lnj. 69s nrd.637 fludrocortisone 1 00mcg tab. 696 nrd.638 flunarizine 10mg tab. 697 147 flunarizine tab 5 mg 10x10 tab blister fluorescien sodium lp 20o/o vail3 ml for diagnostic fundus fluorescien 698 nrd 239 lnj. angiography 699 148 fluorouracil lnj lp 250 mg/ sml rc not exists fluoxetine cap lp 20 mg 700 352 10x10 cap strip/blister 701 nrd 240 fluphenazine deconate lnjection (long acting) 25mg/ml ampule lnj, 702 421 flurbiprofen sodium ophthalmic solution lp 0.03 o/o w/v 5 ml squeeze vial 703 nrd.102 fluromethalone 0.1% ye drop 704 nrd 437 fluticasone cintment 705 nrd 429 fluticasone ft nasal spray 706 nrd 639 fluvoxamine 100 mg tab. 707 nrd 640 fluvoxamine 50 mg tab. 708 s87.a foldable lntra ocular lense with lnjector (details in rc) 11 to 17.5 each piece 709 s87.b foldable lntra ocular lense with lnjector (details in rc) 18 to 24 each piece foldable lntra ocular lense with lnjector (details in rc) 24.5 to 28.5 710 sb7.c each piece 771 s1 02 foleys catheter no. 14 (detail in rc) each piece 772 nrd 241 folic acid +methylcobalamine 10 ml pack lnj 773 392 folic acid tab lp 5 mg 10x10 tab blister 714 nrd.641 folinic acid 1smg tab. 715 nrd.144 folinic acid 200m9/vial nj 716 nrd 242 fondaparinux 2.5m9 lnj 717 245 formaldehyde solution (34.5 per. 38 per.) rc not exists 71,8 nrd 642 formaline tab. 0r €ttlq iifl.q orug packrns flnal rate s,no, orug name unrt gode :;: with gst iffiji[:, 719 nrd 453 formelerol 20mcg +su6seonide 0.5m9 resp. 720 nrd 422 formeterol 6mcg.+ fluticasone 250 mcg. lnhalation n/ldi 727 nrd 24 formetrol 12mcg + budesonide 400 mcg. respule 722 nrd.423 formoterol 6 mcg. + budesonide 200 mcg. mdi 723 nrd 424 formoterol 6 mcg. + budesonrde 400 mcg. mdi formoterol fumerate & budesonide powder for lnhalation lp 6 mcg + 30 capsules 724 616 200 mcq 725 nrd.463 fosfomycin 39m sachet nrd fosphenytoin sodium 150m9/ml 726 .243 lnj. 727 685 framycetin sulphate cream 1 o/o 100 gm pack 1009m pack 728 684 framycetin sulplrate cream 1 o/o 30gm pack 30gm pack 729 254 frusemide tab lp 40 mg 10x10 tab strip 730 nrd.245 fsh 150 iu lnj 73r nrd.244 fsh 75 iu lnj. 732 nrd.246 fulvestrant 250m9 lnj, 733 nrd 72 furosemide 10mg/ml drop 734 nrd.643 furosemide 20mg + spironolactone 50mg tab. 735 .ef furosemide lnjection lp 10mg/ml (lm and lv use) 2 ml ampoule 736 nrd 5oo furosemide oral solution 10mg/30m1 syrup fusidic acid cream lp 2% 1ogm tube in mono 737 216a carton gabapentine tablevcapsule 1 00mg 10x10 tableucapsule 738 bb/ blister/strip gabapentine tablet/capsule 300m9 10x10 tablevcapsule 739 668 blister/strip 740 235 gadodiamide ln.i. 0 5mml/ml vial 10 ml vial 741 446 gamma benzene hexachloride lotion 1%(lindane lotion usp) 100 ml bottle 742 nrd,124 ganciclovir 0.1 5% eye ointment ganciclovir sodium lnjection 500m9 (lyophilized powder for reconstitution) 743 724 vial 744 nrd 129 gatifloxacin 0.3% eye drop 745 nrd.103 satifloxacin+prednisolone eye drop 746 nrd 247 3dw 5% glass bottle/500m1 lnj. 3efitinib tablet lp 250 mg (each film coated tablet contarns gefitinib lp 747 t3t 10x10 tablets 250 mq) 748 531 3emcitabine for lnjection 200 mg vial e1a 749 gemcitabine for lnjection lp 1gm vial 750 nrd 90 gentamycin ear drop gentamycin lnjection lp 80mg/2ml (lm/ lv use) 751 116 2 ml amp 50 ampoules 752 246 gentian violet topical solution usp 1olo 200 ml bottle glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 753 453 mg, metformin hydrochloride 500 mg (sustained release) rc not exists glibenclamide tab lp 5 mg 754 287 10x10 tab strip/blister gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 10x10 tablets 755 603 500 mg) gliclazide tab lp 40 mg 756 288 1 0x1 0 tab strip/blister glimepiride tab lp1mg 757 290 1 0x1 0 tab stripiblister glimepiride tab lp 2 mg 758 289 1 0x1 0 tab strip/blister glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 759 456 10x10 tab blister mg, metformin hydrochloride (sustained release) 500 mg a) 1, .4:t .,ftt4 i4ilr(d i . druo s.no. d final .ate coal rug name packins unit #ffij$l :;: wath gst glipizide and melformin hydrochloride tablets usp (glipizide 5 mg, 760 452 m 10x10 tab blister etformin hydrochloride 500 mg) 767 291 glipizide tab lp 5mg 10x10 tab blister gloves size 6.5 lnches,powder free (disposable sterile surgical rubber 762 s5.b pair glovesxdetails in rc) gloves size 6.5 lnches,powdered (disposable sterile surgical ruouer 763 s5.a pair gloves)(details in rc) gloves size 7 .5lnches,powder free (dlsposablesterile surgical rubber 764 s7.b pair gloves)(details in rc) gloves size 7 lnches,powder free (disposable sterile surgical rubber 765 s6.b pair gloves)(details in rc) gloves size 7 lnches,powdered (disposabte sterile surgical rubber 766 56.a pair gloves)(details in rc) gloves size 7.5 lnches,powdered (disposable sterile surgical rubber 767 s7.a pair 3loves)(details in rc) 768 604 glucagon for lnjection usp 1 mg/ml vial 769 nrd 4 glucosamine + hydrochloride +methylsulfonylmethane cap 770 nrd 644 glucosamine hydrocloride + diacerin 50 mg tab. 771 247 gluteraldehyde solution 2% 5 ltrs can nrd glycerin 2 gm/ml 772 .473 suppsitory 773 564 glycerin lp 100 ml rc not exists 774 217 glycerin lp 400 gm rc not exists 775 nrd 248 glyceryl trinitrate injection, diluted smglml tnl. 776 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles s 1.5olo 777 nrd 1 32 glycine lrrigation olution 3ltr solution 778 nrd 51 glycolic acid 6% cream 779 312 glycopyrrolate lnj lp 0.2 mg/ml 1 ml amp (10 amp) 780 nrd 68 slycopyrronium 25 dpi 787 nrd 67 slycopyrronium 25 + formoterol 6 mcg )pt 782 nrd 458 3lycopyrronium 25mcg. lnhalation 2ml. lespules 783 nrd 69 3lycopyrronium 50 )pr 784 nrd 249 3oserelin acetate implant 3.6 mg lnj 785 117 griseofulvin tab lp 125 mg rc not exists gum paint containing tannic acid 2%, cetrimide o.1o/o, zinc chloridel./. 786 583 15 ml squeeze vial 787 nrd.25o haemocoagulase 1 ml lnj 788 nrd 251 haloperidol (long acting) 50mg/ml ampoule lnj 789 353 haloperidol lnj lp 5 mg/ml 1 ml amp (10 amp) 790 354 haloperidol tab lp 1.5 mg 10x10 tab strip 79t 355 haloperidol tab lp 5 mg 10x10 tab strip halothane bp 250 ml in amber colour 792 6 bottle 793 nrd 436 heparin 50 lu benzyl nicotinate 2 mg ointment 794 174 heparin sodium lnj lp 5000 lu/ml (lm/lv use) rc not exists 795 767 hepatitis b lmmunologlobin lnjection lp 200 l.u vial/pfs 796 nrd 464 hmf for pretem sachet 797 485 homatropine eye drops lp 2% 5 ml squeeze vial 798 nrd 134 hormonal lntra uterine device 799 nrd 252 horse atg(anti thymocyte globulin) 250 mg lnj hp kit (pantoprazole 40 mg +metronidazole 400 mg +clarithromycin 500 800 nrd 1 35 m tab. g hp hmg (highly human menopausal parodied gonadotropin) 150 iu 801 nrd 253 lnj. hp hmg (highly human menopausal parodied gonadotropin) 75 llj 802 nrd.254 lnj. 803 nrd 104 hpmc 0.3% eye drop 804 nrd 823 human albumin 20% in 50 ml vial lnj 805 175 human albumin solution lp 20% 100 ml bottle 806 304 human anti d lmmunoglobulin 150 mcg pre filled syringea/ial try +._ir rrflra 6.no. drug drug ltlame rate/unit cst final ra.te code packlng unlt wlthout gst rate with gst 807 303 human anti d lmmunoglobulin lnjection 300mcg (lm use) pre filled syringea/ial 808 774 human chorionic gonadotropin lnjection lp 5000 l.u vial human lmmunoglobulin inj with 12%lgm,t2%194,z6ollgg in pack of 809 798 1oml vial (0.59m) 1oml(0 59m) 810 305 human rabies lmmunoglobulin lnj 150 lu/ ml rc not exists hyaluronidase lnjection lp each vial contains hyaluronidase lp 1so0 llj. 811 423 vial 872 nrd.255 hydralazine 20mg/ml lnj. 813 256 hydrochlorthiazide tab lp 12.5 mg 10x10 tab strip 874 464 hydrochlorthiazide tab lp 25mg 10x10 tab strip 815 nrd.52 hydrocortisone 1% ream 816 nrd 138 hydrocorlisone oromucosal 20 mg tab. 877 nrd 136 hydrocortisone oromucosal 5 mg tab. 818 nrd.1 37 hydrocortisone oromucosal 10 mg tab. hydrocorlisone sodium succinate lnjection lp 100 mg brse h/ial ([r//lv 819 42 vial use) 820 nrd 139 hydrogen 11% + silver nitrate .01% solution 82l 248 hydrogen peroxide solution tp 6 o/o (20 vot) rc not exists 822 nrd 53 hydroquinone 2% 3ream 823 599 hydroxychloroquine sutpfrate taotets 200rng 10x10 tablets hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride og o/,0 w/v 416 lntravenous lnfusion / balanced electrolyte solution of sodium chloride, 500 ml plastic bottle/s0o 824 sodium acetate, potassium chloride, magnesium chloride lntravenous ml free flex lnfusion lydroxyprogesterone lnj lp 250m9 /ml 82s 293 lml amp 25 ampoules hydroxypropylmethyl cellulose solution 20 mg/ ml 826 2ml glass syringe(with 324 cannula) 827 nrd.528 hydroxyurea 500m9 tab./cap. 828 nrd 76 hydroxyzine oral solution 15 ml drop hydroxyzine tab lp 25 mg 829 43 t oxt o f.u slrip/blister 830 414 hyoscine butyl bromide tablets lp 1omg 10x10 tab blister hyoscine butylbromide lnj lp 20 mg/ ml 831 268 1ml amp 25 ampoules 832 nrd 645 lbrutinibl40mg tab. lbuprofen and paracetamol tablets lp lbuprofen 400 mg*paracetamol 833 22 325 mg l 0x10 tab blister lbuprofen oral suspension bp /usp 100 mg/ 5 ml 60 ml bottle (with 834 477 measurrno cao) 835 aa lbuprofen tab lp 200 mg (coated) 10x10 tab blister 836 24 lbuprofen tab lp 400 mg (coated) rc not exists all 533 lfosfamide lnjection lp/bp/usp 1 gm vial 838 534 lmatinib tab lp 400m9 10x10 caps/tab lmipenem + powoeifor cilastatin lnjection 500mg/500mg tp sotution 839 715 vial 840 356 lmipramine tab lp 25 mg (coated tab) rc not exists 841 357 lmipramine tab lp 75 mg (coated) 10x10 tab blister 842 nrd.25 lndacaterol and glycopyronium inhalation powoei t toiso rncg 3ap. 843 nrd.646 lndomethacin 75 mg sr iab. 844 436 ndomethacin cap lp 25 mg 10x10 cap strip 845 nrd.256 ndomethacin lyophilized powder 1mg lnj. 846 s10.a nfant feeding tube size 10fg(details in rc) each piece 847 s10.c nfant feeding tube size sfg(details in rc) each piece 848 s10.b lnfant feeding tube size bfg(details in rc) each piece 849 sl3 lnfusionsetwithmicrodrip,(l.v.)steritedispos@ unit 850 796 lnj poractant alpha b0 mg/ml in pack of 1.5 ml ldetail in re 1.5m1 vial 851 nrd 647 lnositol + myoinositol 1000m9 ab. cn tih.q 1{ { {u{ . l.c ;1ilrfi t . druo final rate s.no. , drug name packinsunit codi ff: with gst lxtjilt, 852 nrd.257 lnotuzumabl mg(monopoly) lnj 853 nrd 258 insulin aspart nj. lnsulin glulisine (monocomponent lnsulin glulisine) 100 lu/ml/3 m 854 nrd.259 nj. 0artridqes insulin glulisine (monocomponent lnsulin glulisine) 100 lu/ml/3 ml 855 nrd 260 nj. orefilled pen 8s6 nrd.4o3 lnsulin glargine 300 lu per ml/prefilled pen nj. nsulin glargine 10 ml vial (100 lu/ml) with 30 lnsuline syringes wrth 857 693 10 ml vial needle lnsulin glargine 3ml (1001u/ml) with 15 lnsulin syringes and 858 680 needles/cartridge 3ml (1001u/ml) with 15 needles and 1 pen per 20 3ml vial cartridqes insulln lnjection lp (soluble lnsulin/neutral lnsulin lnjection)4o lu/ml(r.dna 859 300 10 ml vial criqin) 860 nrd 261 lnsulin lispro lnj lnsulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to ls 861 s14 unit 12227 862 nrd.4o4 nsuline 50/50 lnj 863 nrd.262 nterferon beta 1 a 30mg lni. 864 nrd.263 ntralipds lni. 865 791 ntravenous fat emulsion 20o/owlv 250m1 250 ml bottle 866 nrd 264 nvert sugar 10% (fructodex 10%) 500 cc lnj lohexol usp (solution for lnlection) non lonic contrast medium in sterile 867 nrd 265 lnj aqueous solution, 300 mg lodine/ml non ionic 50 ml lohexol usp (solution for lnjection) non lonic contrast medium in sterile 868 482 20 ml pack aquous solution 300 mg lodine/ml lohexol usp(solution for lnjection) non lonic contrast medium in sterile 869 672 rc not exists aqueous solution 350 mg lodine/ml. nrd.266 lpilimumab 50 mg 870 lnj 871 369 lpratropium bromide nebulizer solution 250 mcg/ ml 15 ml glass bottle lpratropium powder for lnhalation lp 40 mcg 872 618 30 capsule (rota caps) 873 nrd 268 lrinotecan 100 mg/sml lnj 874 nrd 267 lrinotecan 40mg/5ml lnj 875 nrd 81 lron (ferrous ascorbate) drop lron and folic acid suspension. each 5ml contains ferrous fumerate 876 448 100 ml bottle equivalent to elemental iron 100m9, folic acid 500 mcg lron sucrose lnjection usp/bp 20mg/ml (for lv use) each ml conlains 5 ml ampoule (amber 877 488 ferric hydroxide in complex with sucrose equiv. to elemental lron 20 mg colour) 878 7 lsoflurane usp 100 ml bottle 879 nrd 269 lsolyte g lnj. nrd.27o lsolyte p 10% 500 ml 880 lnj. 881 294 lsophane lnsulin lnj lp 40 lu /ml 10 ml vial 882 aa4 lsoprenaline lnjection lp 2mg / ml rc not exists 883 197 lsosorbide dinitrate tab lp 5 mg 10x10 tab blister 884 198 lsosorbide mononitrate tabs lp 20 mg 10x10 tab strip nrd.26 lsotretinoin 10mg 88s cap. nrd 27 lsotretinoin 20 mg 886 cap 887 333 lsoxsuprine lnj lp 5 mg/ml rc not exists 888 334 lsoxsuprine tab lp 20 mg 10x10 tab strip 889 nrd 105 itraconazole 1% eye drop 890 nrd 125 itraconazole 1% eye ointment 891 118 itraconazole cap 100 mg 10x4 cap strip 892 nrd 648 lvabradine 5mg tab. 893 nrd.65,i lvermectin 12mg tab. 894 nrd 649 lvermectin 6 mg + 415s66rzole 400 mg tab. 895 nrd 650 lvermectin 6mg tab. 896 s84.b k wire, length 375 mm; 1.6mm(details in rc) rc not exists a) h{iq ehe trr+iq frtmft f{fth ntdq rate/unit gst final rate drug d name packlng unlt s,no. rug wlthout gst rate wlth gst code s84.c k wire, length 375 mm; 1.8mm(details in rc) rc not exists 897 s84.a k wire, length 375 mm; 1mm(details in rc) rc not exists 898 nrd 412 ketaconazole 2% lotion 899 k 10 a etamine lnj lp 50 mg/ml ml vial 900 nrd keloconazole 200 mg iab. 901 .652 ketoconazole cream 2o/o 1sgm tube in mono 902 565 carton t 10 t.e :;t{fffil * c do rua o i rate/unit gst fanal rate s.no. drug name packang unit urithout gst rate with gst )olypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 1356 s74 piece )olypropylene s73 nonabsorbable synthetic surgical mesh 7.6cm x 1scm or riece 7357 /.scm x 1 scm 1358 nrd 740 romalidomide 2 mg ab 13s9 nrd 741 pomalidomide 4 mg fab. 1360 nrd.742 posacozazole 100m9 fab. 1361 nrd 743 posacozazole 40mg/ml svp t362 nrd.34o potassium chloride for lnjection lnj potassium chloride lnj. 0.15 gm/ml 1363 383 10 ml amp 10 ampoules potassium chloride oral solution u.s.p 500m9/ sml 200m1 bottle(amber 1364 384 solor) 1365 nrd.515 )otassium magnesium citrate syrup 1355 nrd 128 povidone iodine 3argle nrd 449 rovidone iodine ressary t367 )ovidone lodine ointment 5% 15 gm 15gm tube in a unit 1368 221 carton 1369 571 )ovidone lodine ointment usp 250 gm 250 gm pack rovidone lodine scrub solution / cleansing solution 7.5 o/o w/v povidone 1370 250 500 ml bottle odine (suitable for hand wash) )ovidone o/o 7371 572 lodine solution lp 10 100 ml bottle 7372 222 rovidone lodine solution lp 5 % 500 ml 500 ml bottle rovidone 7373 450 lodine solution lp 5% 100m1 bottle 100 ml bottle rowder 7374 759 clotrimazole 1o/o w/w 30 gm 30 gm bottle 1375 52 )ralidoxime chloride lnjection lp 25 mg/ml / 500 mg i/ial rrasugrel 1376 nrd 744 1omg tab iab. rrazosin 1377 nrd.745 5mg iab. 7378 555 rrazosin tablets (extended release) 2.5 mg rc not exists rrednisolone nrd.746 lp 40mg 1379 tab. f,rednisolone 1380 nrd.513 lp 50mg tab. rrednisolone 1381 nrd 74 acetate opthalmic suspension 10 ml ye drop rrednisolone 1382 nrd 113 sodium phosphate 1% eye/ear drop rrednisolone tab lp 20 mg 1383 470 1 0x1 0 tab strip/blister f,rednisolone tab lp 5 mg 1384 47 1 0x1 0 tab strip/blister 3rednisolone tablet lp 10 mg 1385 469 1 0xl 0 tab strip/blister 1386 634 rregabalin cap lp 75 mg 10 x 10 capsule 3ressure monitoring line / high pressure extension line (details in rc) each piece in blister 1387 s91 pack )rimaquine tab lp 2.5 mg 1388 128 10x10 tab strip/blister primaquine tab lp 7.5 mg 1389 129 1 0x1 0 tab strip/blister )rimidone 1390 nrd 748 250 mg tab. )rimidone 1391 nrd 747 50 mg tab. probiotic sachets 1 gm size (each gram sachet contains saccharomyces l392 765 boulardii 250m9 & lactic acid bacillus 150 million spores) 1 gm each sachet procaine 1393 nrd 341 penicillin fortified 2 lack nj procarbazine hydrochloride capsule usp 50 mg (each capsule contains 7394 725 rc not exists procarbazine hydrochloride usp 50 mg) rrochlorperazine 1395 nrd 749 5mg tab rrochlorperazine 1396 764 mesylate lnjection 12.5mg/ml 5ml size rc not exists )rogesterone lnj 200 mg/ 2ml 1397 298 2 ml amp 10 ampoules drogesterone 1398 nrd 155 lnjection 50 nl 1399 nrd 750 progesterone only pills tab. iifl:l {rrq s druo rate/unit gsf final rnte no drug name facklng unlt corl*e wlthout gst rate with gst promethazine lni lp 25mg/ml 2 ml amp (amber 1400 49 colo0(10 ampoules) promethazine syrup lp 5 mg/sml 60 ml bottle (with 1407 48 measurinq cap) i402 50 promethazine tab lp 25 mg 10x10 tab strip 1403 nrd.,i ,14 proparacaine 0.5% wv eye drop l404 14 propofol lnj lp 10 mg/ml 20 ml vial / ampoule 1405 nrd 751 propranolol 1omg tab. 1406 nrd.752 propranolol 40 mg sr tab. propranolol tab lp 40 mg r407 207 i 0x1 0 tab strip/blister 1408 nrd 753 propylthiouracil 100 mg tab. 1409 nrd 15,i prostaglandin 500mcg/ml lnj. 1,41,0 nrd 342 protamine sulphate 5ml 08 nrd 753 propylthiouracil 100 mg tab. 1409 nrd 15,i prostaglandin 500mcg/ml lnj. 1,41,0 nrd 342 protamine sulphate 5ml nj. pyridostigmine tablet lp 60 mg (each tablet contains pyridosigrnrne lp 74t1 792 10x10 tablets 60mg) 1472 nrd.754 pyridoxine 100 mg tab, t473 626 pyridoxrne tablet lp 10 mg rc not exists dyridoxine 74t4 627 tablet lp 40mg 10x10 tab strip 1415 675 quetiapine tablet lp 25mg 10x10 tab blister t416 674 quetiapine tablet lp 50mg 10x10 tab blister quinine dihydrochloride lnj lp 300 mg/ml 1477 131 2 ml amp 25 ampoules t4t8 132 quinine sulphate tablets lp 300 mg (film coated) 10x10 tab blister t4t9 nrd.490 rabbit atg (anti thymocyte clobulin) 250 mg lnj. l420 nrd 343 rabbit atg (anti thymocyte globulin)100 mg ln.l 1427 nrd.6 rabeprazole +levosulpiride 3ap. rabies antiserum lp (equine) 300 units per ml contains equine anti+abies 1422 408 5 ml vial immunoglobulin fragments (1.m./sc use) rabies vaccine human (cell culture) lp 2.5 lu 1 l llntradermal) ml vial with .0 ml t423 306 diluent rabies vaccine human (cell culture) lp (lntramuscula4 2^s rul oose single dose vial with 1424 307 diluent and syringe with needle 1425 nrd 5 racecadotril 100m9 cap. r426 nrd.467 racecadotril sachet 30 mg sachet 1.427 nrd.32 ramipril lp 5 mg cap. 1428 636 ramipril tablets lp 2,5 mg 10x10 tablets 1429 nrd 344 ramucirumab 1 00 mg(monopoly) lnj 1430 nrd.345 ramucirumab 500 mg (monopoly) lnj 7431 lt6 ranitidine hcl lnjection lp 50mg/2ml rc not exists 1432 nrd.516 anitidine oral suspension syrup 1433 277 anitidine tab lp 150m9 film coated rc not exists 1434 433 anitidine tab lp 300m9 film coated rc not exists 1435 nrd.346 anizumab 10mg/ml lnj 7436 nrd 755 anolazine 500mg ab 1437 nrd 756 asagilinel mg ab 1438 nrd.347 asburicase 1.5 mg nj 7439 690 recombinant coagulation factor vlla 1mg vial 1440 691 recombinant coagulation factor vlla 2mg vial r447 748 recombinant f lx 500 lu with diluent vial with diluent t442 nrd.34b recombinant fsh 150 lu inj. t443 nrd 349 recombinant fsh 3001u lnj. 444 nrd 350 recombinant hcg 250 lu nj. 445 nrd.451 recombinant human growth hormone 4lu vial with syringe nj. 446 nrd.351 recombinant lh 75lu nj. nrd regorafenib 40 mg ab. 447 .757 cj :..4 +.v:l !;:i1.rt ., ,.a . ?*mmrdq rate/unit gst final rate ,!j|! drug name packtng unlt witho;t gsr rate with gst ... 7727 s94 umbilical cord clamp (details in rc) each piece urethral catheter 90 (fg 14) made up of medical grade pvc (detail in l728 s1 07 each piece rc) urethral catheter 91 (fg 10), made up of medical grade pvc (detail in 1729 s1 08 each piece rc) urine collecting bag for new born /paediatric urine collection bag, 1730 s92 each piece capacity 100m1 (details in rc) 1731 s40 urine collecting bag, disposable 2000 ml(details in rc) rc not exists 7732 ee1 urokinase lnjection 5 lac unit (lyophilized) rc not exists ursodeorycholic acid tablets lp 300 mg 7733 597 10x10 tab strip/blister 1734 nrd 523 ursodeoxycholic oral suspension 125m9/5ml in 100m1 syrup s vaccum suction set, 2.5 meter length (detail in rc) 7735 109 each piece 7736 318 valethamate bromide lnj 8mg / ml rc not exists 7737 722 valganciclovir tablet 450 mg rc not exists 1738 524 vancomycin for lntravenous lnfusion lp 1 gm vial 1739 523 vancomycin for lntravenous lnfusion lp 500 mg vial 1740 nrd 397 varicella immunoglobulin for lv use lnj vascular catheter with metal guide no. 16 double lumen size 45 cm 174t s1 15 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 16, double lumen size 30 cm 7742 s111 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 18 double lumen size 30 cm 7743 s112 each piece (longline lv) (detail in rc) vascular catheter with metal guide no. 18 double lumen size 45 cm 7744 s116 rc not exists (longline lv) (detail in rc) vascular catheter with metal guide no. 20 double lumen size 30 cm 1745 st 13 each piece (detail llonqline lv) in rc) vascular catheter with metal guide no. 20 double lumen size 45 cm 1746 s117 rc not exists (lonqline lv) (detail in rc) vascular catheter with metal guide no. 22 double lumen size 30 cm l747 s114 each piece (lonsline lv) (detail in rc) vascular catheter with metal guide no. 22 double lumen size 45 cm 7748 s1 18 rc not exists (longline (detail lv) in rc) nrd 398 vasopressin 3ml 7749 lnj. 1750 242 vdrl antigen (with + vg and ve control) / rpr slide kit 1o0 test kits 415 vecuronium bromide for lnjection 4mg (freeze dried) t757 rc not exists verapamil 2.5 mg/ml l752 nrd.399 lnj. 1753 nrd 811 verapamil hydrochloride sustained release 120 tab. 1754 nrd.81o verapamil hydrochloride sustained release 40 tab. 1755 211 verapamil tab lp 40 mg film coated 10x10 tab strip 1756 nrd 812 vildagliptin 50mg tab 1757 158 vinblastine lnj lp 10mg/ 1oml vial 1758 159 vincristine lnj lp 1mg(vial)a/incristin lnjection usp 1mg/ml (amp) vial/ampoules 1759 nrd.4oo vinorelbine 1omg nj 7760 nrd 401 vinorelbine 50mg nj 1767 nrd.b3 r/itamin e s0mg/ml, 400 lu frop yitamin 1762 nrd 38 a 25000 lu lap. ritamin a paediatric oral solution lp(vitamin a concentrate oil lp)each 100 ml bottle and spoon 7763 409 nl contains vitamln a 100000 lu with marking 1 ml/2ml in unit carton 7764 395 ritamin b complex lnj nfi 10 ml vial yitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg 86 0.5m9 1765 397 iacinamide 2smg calcium pantothenate 1mg (with appropriate 1 0x1 0 tab strip/blister rveraqes) 1766 nrd.402 yitamin d (600000 lu) nl. 7767 nrd 84 /itamin d3 4001u/ml drop 1768 nrd.85 vitamin d3 b00lu/ml drop vitamin d3 oral solution 60000 lu 5ml glass bottle in unit 7769 676 carton n :..( . i e , :11 druo flnal rate sno drug name packrns unrt coal *ti.tjl[j, :11 witt gst vitamin e capsule 400 mg t770 795 1 0x10 cap strip/blister k lml vitamin lnjection each ml contains menadione sodium bisulphite 1omg t77t 180 equivalenl to 5.2 mg of menadione. (aqueous solution) amp(ambercolor)25 amp vitamin k 1 (phytomenadione) lp 1mg/o.5m1 injection (detail in rc) each pack along with 1772 644 syringe in a unit carton 1773 nrd.813 voglibose 0,2 mg tab tab. r774 nrd 814 voglibose 0.3 mg tab tab. 1,775 nrd.1 19 voriconazole eye drop 1776 nrd bo9 vonconazole 200 mg tab. 720 voriconazole lnjection 200mga/ial 7777 /ial 7778 nrd.815 warfarin 1mg tab. 1,779 nrd 816 warfarin 2mg tab. 1780 nrd.b17 warfarin 3mg tab. 1781 546 warfarin sodium. tab lp smg 10x10 tablets 1782 404 water for lnj lp rc not exists 7783 nrd.4o5 xylocaine lubricating 30gm jelly xylometazoline nasal drops lp 0.1% 5ml vial/bottle(with a 1784 620 seperate dropper) in a unit carton 1,785 nrd b1b zinc 50mg tab. 7786 nrd 524 zinc oral suspension 20 mg/100 ml syrup nrd zinc oxide +alo vera +semethicone 1787 441 3intment zinc sulphate dispersible tablets lp elemental zinc 10 mg 1788 472 1 0x1 0 tab strip/blister l789 743 zoledronic acid lnjection lp 4mg vial rial zolpidem lomg t790 nrd.b19 tab. t797 779 zolpidem tablet 5 mg 10x10 tablets 1792 nrd.821 zonisamide 100 mg tab. 1793 nrd 820 zonisamide 50mg tab. non edl balance salt solution glass bottle 500m1 (sterile opthelmic irrigatiing sol.) 500m1 glass bottle sodium chloride 0.49%, pottasium chloride 0.075o/o, calcium chloride7794 0.048% , magnisium chloride 0.03% , sodium acetate 0.39% ,sodium citrate 0.17% r795 lnj. sodium chloride 0.9% 500m1 glass bottle micronised s gelatin l00mg 1,796 progesteron oft capsule rap. l797 sterilium 2propanolol 45gm , 1 propanolol 30mg/100m9 korsolex rapid gluteraldehyde 15.2m9 1.6 dihyroxy 2,5 dioxahaxane (lnstrumental , lt98 19.79m disinfactant concentration) 1799 taurine 500m9 + n acetylcysteine 150m9 tablets tab. 1800 adhesive tap cotton 6inch 1ocm x smts 1801 autoclave indicator tap (sigma lock) l8mm x 55 mts 1802 bandages scm x 4mts 2 scm x 4mts 1803 bandages locm x 4mts 4 1ocm x 4 mts 1804 bandages 1scm x 4mts 6 lscm x 4mts 1805 crescent 2.6 mm (sharpedge) 2.6 mm 1806 dispo needle 26.5 26.5 g/ 0.45 x 13mm ecoshield/bacillocid (hydrogen peroxide 1 1% with silver nitrate 0.01%) 500m1 1807 1808 surgical pad gauze 120cm gmts 1809 than x 120cm x 9mts 1810 keratom 2,8 mm (sharpedge) 2.8 mm 181 1 cpthalmic micro surgical blade(mvr knife 20 g) 22g l8l2 0otton roll 5009m d rate/unit gst final rate 3 rug name packing unit ;:: .d without gst rate with cst 1813 cotton buds 1814 makintosh rubber sheet 1815 bleeching powder 1816 haemocoagulase topical sol. 10ml 1877 charcoal powder 1818 suture needle (size 1 1 1 5) 18 19 face shield 1820 n 95 mask rilhout valve 182 1 hand rub sanitizer 500m1) 7822 glass lonomer cement (glc) 1823 personal protection equipment (ppe kit) ...

Medical And Health Services - Rajasthan

32599654 supply of medicine drugs in general hospital hydrochlorothiazide (12.5mg) + olmesartan medoxomil (20mg) 1*10 2 tab hydrochlorothiazide (12.5mg) + olmesartan medoxomil (40mg) 1*10 3 tab nicumalone 1 mg 1*10 4 tab nicumalone 4 mg 1*10 5 tab chymotrysin 1*10 6 tab citicoline 1*10 7 tab clarithromycin 500mg 1*10 8 tab dapagliflozin 10mg 1*10 9 tab deflazacort 6 mg 1*10 10 tab esomeprazole 40 mg 1*10 11 tab febuxastat 40 mg 1*10 12 tab febuxastat 80 mg 1*10 13 tab glucosamine + diacerein 50 mg tab 1*10 14 tab ketorolac 10 mg 1*10 15 tab levothyroxine sodium tablet 25 mcg 1*10 16 tab methylpredinisolone 16 mg 1*10 17 tab methylpredinisolone 8 mg 1*10 18 tab moxifloxacin 400 mg 1*10 19 tab nitrazepam 10 mg 1*10 20 tab paracetamol 650 mg 1*10 21 tab pentoprazole 40 + levosulpiride 150 mg cap 1*10 22 tab propylthiouracial 100 mg 1*10 23 tab repaglinide and voglibose (0.5+0.3) 1*10 24 tab rifaximin 500mg 1*10 25 tab rosuvastatin 160mg + finofib 10mg 1*10 26 tab serratiopeptidase 10mg 1*10 27 tab silodocin 4 mg cap 1*10 28 tab silodocin 8 mg cap 1*10 29 tab sitagliptin 50mg 1*10 30 tab sulphasalazine 500 mg 1*10 31 tab thiocolchicosite 4 mg 1*10 32 tab vildagliptine 50mg 1*10 33 tab voglibose 0.2 mg tab 1*10 34 tab voglibose 0.3 mg tab 1*10 35 tab zinc 50mg 1*10 36 syp azithromycine 100 mg per bottal 37 syp azithromycine 200 mg per bottal 38 syp cefpodoxime 100 mg per bottal 39 syp cyproheptidine per bottal 40 syp drotavarine per bottal 41 syp mefenamice acid 100mg/5ml per bottal 42 syp montelucast+levocetrizine per bottal 43 syp phenobarbitone 20mg/5ml, 100 ml per bottal 44 syp levofloxacine per bottal 45 syp ondansetron per bottal 46 syp zink 20 mg, 100 ml per bottal 47 surgical abdominal suction set per piece 48 surgical arterial line per piece 49 surgical av blood line per piece 50 surgical av fistula needle 16g per piece 51 surgical av fistula needle 17g per piece 52 surgical baby diaper small size for infents per piece 53 surgical bain circuit adult per piece 54 surgical bain circuit ped. per piece 55 surgical bains circuit paediatric/ adult per piece 56 surgical bandage 10 inch per piece 57 surgical bandage 15 inch per piece 58 surgical bandage 2.5 inch per piece 59 surgical bandage 4 inch per piece 60 surgical bandage 6 inch per piece 61 surgical bandage 7.5 inch per piece 62 surgical bipolar prosthesis set per piece 63 surgical calcanum plate all size per piece 64 surgical ccs screw 4 mm, 6mm, 5mm per piece 65 surgical chest drainage catheter (i.c.d.) (thoracic catheter) size : fg: 16, 20, 24, 28, 32, 36 & 40. per piece 66 surgical chlorhexidine inpregnade paraffin gauze 10x10 per piece 67 surgical chlorhexidine inpregnade paraffin gauze 30x10 per piece 68 surgical chlorhexidine inpregnade paraffin gauze roll per piece 69 surgical clavical plate all size per piece 70 surgical close circuit per piece 71 surgical close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, (all size) per piece 72 surgical creep bandage 10 inch per piece 73 surgical creep bandage 2 inch per piece 74 surgical creep bandage 4 inch per piece 75 surgical creep bandage 6 inch per piece 76 surgical diaper adult(s/m/l) per piece 77 surgical distal femur plate all size per piece 78 surgical distal humerus (posterial & medial) plate all size per piece 79 surgical distal humerus extra artecuilar plate all size (right & left) per piece 80 surgical distal radius t/oblique plate all size per piece 81 surgical distal tebia medial plate all size per piece 82 surgical dynamic hip screw size 80 to 110 with plate long barrer & short barrer all size per piece 83 surgical endres nail 2.5mm,3 mm,3.5mm,4mm,4.5mm per piece 84 surgical febulla tubualar plate all size per piece 85 surgical femur nail no. 9/32, 9/34, 9/36, 9/38, 9/40, 9/42, 10/32, 10/34, 10/36, 10/38, 10/40, 10/42, 11/32, 11/34, 11/36, 11/38, 11/40, 11/42, 12/32, 12/34, 12/36, 12/38, 12/40, 12/42 per piece 86 surgical fistula needle 16 g per piece 87 surgical fixator set per piece 88 surgical gudel airway per piece 89 surgical hook plate all size per piece 90 surgical humerus nail all size per piece 91 surgical i/l femur nail set per piece 92 surgical i/l tibile nail with bolt set per piece 93 surgical knee cap per piece 94 surgical lignocain 10 % spray per piece 95 surgical locking plateall size per piece 96 surgical merocel nasal pack per piece 97 surgical needle (all size 14 to 27 g) per piece 98 surgical pedicle screw titanium with set all size per piece 99 surgical poteriomedial proximal tebia plate all size per piece 100 surgical proximal femur nail long & short no. 9/32,9/34,9/36,9/38,9/40,9/42, 10/32,10/34,10/36,10/38,10/40,11/4211/32,11/34,11/36,11/38,11/40,11/4,29/25,10/ 25,11/25,12/25 per piece 101 surgical proximal hocky plate set per piece 102 surgical proximal humerus plate all size per piece 103 surgical proximal tebia t plate all size per piece 104 surgical raft plate (right & left) all size per piece 105 surgical recon plate all size per piece 106 surgical spine feusion cage all size per piece 107 surgical square nail 2 mm, 2.5mm,3 mm,3.5mm per piece 108 surgical tibia nail & femur nail no. 8/28, 8/30, 8/32, 8/34, 8/36, 8/38, 9/28, 9/30, 9/32, 9/34, 9/36, 9/38, 10/28, 10/30, 10/32, 10/34, 10/36, 10/38, 11/28, 11/30, 11/32, 11/34, 11/36, 11/38 per piece 109 oint cream luliconazole 1% w/w per piece 110 mouth paint lignocain mouth paint per piece 111 injection alpha beta arteether [lp.26] [m] each amp 112 inj multivitamine each amp 113 inj azithromycin 10 ml vial equivalent to 500 mg each amp 114 inj caffein 10 mg each amp 115 inj citicoline 250/500 mg each amp 116 inj colistine 10 lakh unit each amp 117 inj compound sodium 500ml, glass bottel each amp 118 inj dexmedetomidine 100mcg/ml each amp 119 inj doxcyline 100 mg each amp 120 inj etomidate 10ml each amp 121 inj etomidate 20 mg each amp 122 inj ferric carbo maltose 500mg/ 10 ml vial each amp 123 inj fluconazole 200mg each amp 124 inj gdw 5% glass bottle each amp 125 inj levofloxacine 100 ml each amp 126 inj l ornithine l aspartate 10 ml each amp 127 inj mephentermine 30ml/ml each amp 128 inj methylprednisolon injection 40mg each amp 129 inj moxifloxacin 100ml each amp 130 inj nandrolone decanoate 50 mg inj each amp 131 inj nicorandil 48 mg each amp 132 inj normal saline 500 ml glass bottle each amp 133 inj ondansetron 8 mg each amp 134 inj pilocarpine 0.5 %v/v each amp 135 inj piracetam 200 mg each amp 136 inj ravici 5 ml each amp 137 inj reteplase 18 mg each amp 138 inj tirofiban 0.5 mg each amp 139 inj vitamin d (600000 iu) each amp 140 eye ointment chloramphenicol +polymycine per piece 141 eye ointment chloramphenicol +polymycine + dexamethason per piece 142 eye drop carboxymethylcellulose + glycerin per piece 143 eye drop gatifloxacin and prednisolone per piece 144 eye drop moxifloxacilline+ dyliprednate per piece 145 eye drop moxifloxacilline+ prednisone per piece 146 eye drop natamycin 5% per piece 147 eye drop sodium chloride 5% per piece 148 eye drop tropicamide + phenlyephrine per piece 149 eye drop dorzolamide per piece 150 eye drop moxifloxacin and prednisolone eye drop per piece 151 eye drop olaptadine & ketrolac per piece 152 ear drop polymyxin b 10000iu/gm + neomycin 3400iu/gm per piece 153 drop anti cold 15 ml per piece 154 drop calcium 30 ml per piece 155 drop diastase pepsin with simethicone 15 ml per piece 156 drop digestive enzyme 15 ml per piece 157 drop hydroxyzine 15 ml per piece 158 drop ondensetrone 30 ml per piece 159 drop prednisolone 10 ml per piece 160 drop terbutalin per piece 161 drop vitamind3 400 iu per piece 162 drop vitamind3 800 iu per piece 163 cap alpha+lipoic acid + leycopen +multivitamin and miltiminerals 1*10 164 cap anti oxidants capsule(beta carotene 10 mg,vit e 25mg,vit c 100 mg,copper 1.5 mg,managanese 1.5 mg,zinc 7.5 mg,selenium 150 microgram) 1*10 165 cap aprebitant 125/80 1*10 166 cap dulexitim 20mg 1*10 167 cap dulexitim 30mg 1*10 168 cap glucosamine + chloride +msm 1*10 169 cap racecadotril 100mg 1*10 170 cap rebeprazole +levosulpiride 1*10 s. no. (2) drug name (4) packing unit (12) rate with gst other 1 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp(10 ampoules) 2 bupivacaine inj ip 0.5% 20 ml vial 3 halothane bp 250 ml in amber colour bottle 4 isoflurane usp 100 ml bottle 5 ketamine inj ip 50 mg/ml 10 ml vial 6 lignocaine ointment 5 o/o 10 gm tube in unit carton 7 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 8 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose (monohydrate) 75 mg rc not exists 9 lignocaine gel ip 2% 30gm tube in a unit carton 10 lignocaine inj ip 2 o/o 30 ml vial 11 propofol inj ip 10 mg/ml 20 ml vial / ampoule 12 thiopentone inj ip 0.5 g vial 13 sevoflurane rc not exists 14 atropine sulphate injection 0.6mg/ml 1ml amp 25 ampoules 15 liquid medical oxygen (lmo) rc not exists 16 diclofenac sodium inj ip 25 mg/ ml (im/iv use) 3 ml amp (10 amp) 17 diclofenac gastro resistant tablet ip 50 mg(enteric coated) rc not exists 18 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 19 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 20 ibuprofen tab ip 200 mg (coated) rc not exists 21 ibuprofen tab ip 400 mg (coated) rc not exists 22 morphine sulphate inj ip 10mg/ml 1 ml 10 ampoules 23 paracetamol drops paediatric paracetamol oral suspension ip(each ml contains paracetamol 150mg) 15 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 24 paracetamol syrup ip 125 mg/5ml (detail in rc) 60 ml bottle (with measuring cap) 25 paracetamol tab ip 500 mg 10x10 tab blister 26 paracetamol inj. 150 mg/ml 2 ml amp 50 ampoules 27 pentazocine inj ip 30mg/ml (im/iv use) 1ml amp 25 ampoules 28 tramadol cap ip 50 mg 10x10 cap strip/blister 29 tramadol inj 50 mg/ml 2 ml amp 10 ampoules 30 indomethacin cap ip 25 mg 10x10 cap strip 31 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 32 ibuprofen oral suspension bp /usp 100 mg/ 5 ml 60 ml bottle (with measuring cap) 33 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg rc not exists 34 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg rc not exists 35 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 36 etoricoxib tab ip 120mg 10x10 tab blister 37 mefenamic acid tablets bp 500 mg 10x10 tablets 38 fentanyl citrate injection 50mcg/ml 10ml vial/amp 39 naproxen tablet ip 500mg 10x10 tab blister 40 naproxen tablet ip 250mg 10x10 tab blister 41 etoricoxib tablet ip 90 mg 10x10 tablets 42 aspirin tablet ip (gastro resistant) 150 mg 14x10 tablet 43 butorphanol tartrate injection usp 1mg/ml 1ml size rc not exists 44 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use 1 ml. ampoule 45 paracetamol infusion ip 1% w/v 100ml size 100 ml bottle 46 ketorolac tromethamine dispersible tablet 10 mg(each uncoated dispersible tablet contains ketorolac tromethamine 10 mg) 10x10 tablets 47 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 48 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 10x10 tablets 49 adrenaline injection ip 1mg/ml im/iv use 1ml amp(ambercolor)25 amp 50 betamethasone tab ip 0.5mg 10x10 tab blister 51 chlorpheniramine maleate tab ip 4mg rc not exists 52 dexamethasone inj ip 8mg/2ml rc not exists 53 dexamethasone tab ip 0.5 mg 10x10 tab strip 54 hydrocortisone sodium succinate injection ip 100 mg base / vial (im/iv use) rc not exists 55 hydroxyzine tab ip 25 mg 10x10 tab strip/blister 56 methyl prednisolone sodium succinate for injection usp 500 mg rc not exists 57 pheniramine inj ip 22.75mg /ml 2 ml amp 25 ampoules 58 prednisolone tab ip 5 mg 10x10 tab strip/blister 59 promethazine syrup ip 5 mg/5ml 60 ml bottle (with measuring cap) 60 promethazine inj ip 25mg/ml 2 ml amp (amber color)(10 ampoules) rajasthan medical services corporation ltd. rmsc essential drug list drug type : all drug catergory : all group name (1) :: 01. anaesthetics group name (1) :: 02. analgesic antipyretices and anti inflammatory drugs group name (1) :: 03. antiallergics and drugs used in anaphylaxis 61 promethazine tab ip 25 mg 10x10 tab strip 62 betamethasone sod phos inj ip 4mg/ml 1 ml ampoule/vial 63 prednisolone tablet ip 10 mg 10x10 tab strip/blister 64 prednisolone tab ip 20 mg 10x10 tab strip/blister 65 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg rc not exists 66 cetirizine,phenylephrine & paracetamol tablets cetirizine 5 mg,phenylephrine 10 mg & paracetamol 325 mg tab rc not exists 67 cetirizine syrup ip 5mg/5 ml rc not exists 68 levoceitrizine tablet 5mg 10x10 tablets 69 montelucast(10mg) + levocetrizine tablet (5mg) 10x10 tablet blister/strip/alu alu pack 70 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 10x10 tablets 71 naloxone inj ip 0.4mg/ ml 1 ml 10 ampoules 72 pralidoxime chloride injection ip 25 mg/ml / 500 mg vial 73 acetylcystine solution usp (injection) 200 mg/ml rc not exists 74 carbamazepine tab ip 200 mg 10x10 tab strip/blister 75 carbamazepine tab ip 100 mg 10x10 tab strip/blister 76 phenobarbitone tab ip 30 mg 10x10 tab strip 77 phenytoin injection bp 50mg/ml 2 ml amp(amber colour)(25 ampoules) 78 phenytoin oral suspension ip 25mg/ml 100 ml glass bottle with measuring cap 79 phenytoin tab ip 100 mg (film coated) 10x10 tab strip 80 sodium valproate inj 100 mg/ ml rc not exists 81 sodium valproate gastro resistant tablets ip 200 mg rc not exists 82 phenobarbitone inj ip 200mg/ml 1 ml ampoule/vial 83 carbamazepine oral suspension usp 100 mg/5ml 100 ml bottle(with measuring cap) 84 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle(with measuring cap) 85 sodium valproate tablet(gastro resistant) ip 500mg 10x10 tab strip 86 clobazam tablet/capsule 5 mg 10x10 tablet/capsule blister 87 clobazam tablet/capsule 10 mg 10x10 tablet/capsule blister 88 levetiracetam tablet ip 500 mg 10x10 tab blister 89 levetiracetam oral solution/suspension 100mg/ml 100ml 90 levetiracetam injection 500mg/5ml vial 91 gabapentine tablet/capsule 100mg 10x10 tablet/capsule blister/strip 92 gabapentine tablet/capsule 300mg 10x10 tablet/capsule blister/strip 93 lamotrigine tablet ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) rc not exists 94 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 10x10 tablets 95 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 10x10 tablets 96 lacosamide tablet 100 mg (each film coated tablet contains lacosamide 100 mg) 10x10 tablets 97 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 10x10 tablets 98 acyclovir oral suspension ip 400mg/5ml 60 ml bottle (with measuring cap) 99 acyclovir tab ip 200 mg 10x10 tab blister 100 acyclovir tab ip 800 mg rc not exists 101 albendazole oral suspension ip 400 mg/10ml 10 ml bottle 102 albendazole tablets ip 400 mg(detail in rc) rc not exists 103 amikacin inj ip 100 mg 2 ml vial 104 amikacin inj ip 500 mg rc not exists 105 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 106 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg rc not exists 107 amoxycillin cap ip 250mg 10x10 cap strip/blister 108 amoxycillin cap ip 500mg 10x10 cap strip/blister 109 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 110 amphotericin b inj ip 50 mg vial 111 ampicillin injection ip 500 mg vial 112 azithromycin tab 100 mg dispersible tabs (3 tab strip 10x3x3) 10x3x3 tab strip/blister(strip/blister of 3 tab) 113 azithromycin tablets ip 250mg 10x3x3 tab strip/blister(strip/blister of 3 tab) 114 azithromycin tab ip 500 mg 10x3x3 tab strip/blister(strip/blister of 3 tab) 115 benzathine benzylpenicillin inj ip 12 lac units vial 116 benzathine benzylpenicillin inj ip 6 lac units vial 117 cefixime tab ip 100 mg 10x10 tab strip 118 cefixime tab ip 200 mg rc not exists 119 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) rc not exists 120 cefotaxime injection ip 1 g rc not exists 121 cefotaxime inj ip 250 mg vial 122 ceftazidime inj ip 1g vial 123 ceftazidime inj ip 250 mg vial 124 ceftazidime inj ip 500 mg vial 125 ceftriaxone inj ip 1g /vial vial (packed in monocarton) group name (1) :: 05. anti epileptic drugs group name (1) :: 06. anti infective drugs group name (1) :: 04. antidotes and other substances used in poisoning 126 ceftriaxone inj ip 250 mg/vial vial (amber colour) 127 ceftriaxone inj ip 500mg/vial vial (packed in monocarton) 128 cephalexin cap ip 250 mg 10x10 cap blister 129 cephalexin cap ip 500 mg 10x10 cap blister 130 chloroquine phosphate inj ip 40 mg/ ml 5 ml amp(25 amp) 131 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip/blister 132 chloroquine phosphate suspension ip 50 mg/5ml 60 ml bottle (with measuring cap) 133 ciprofloxacin injection ip 200mg/100ml 100 ml ffs / bfs bottle 134 ciprofloxacin tablets ip 250 mg film coated rc not exists 135 ciprofloxacin tablet ip 500 mg film coated rc not exists 136 clotrimazole cream ip 2% w/w 15gm tube in a unit carton 137 clotrimazole vaginal tab ip 500mg single tablet(10 tabs with an applicator) 138 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle (with measuring cap) 139 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 140 diethylcarbamazine tab ip 100 mg 10x10 tab blister 141 doxycycline cap ip 100 mg 10x10 cap strip/blister 142 fluconazole tablets ip 150mg rc not exists 143 gentamycin injection ip 80mg/2ml (im/ iv use) 2 ml amp 50 ampoules 144 griseofulvin tab ip 125 mg rc not exists 145 itraconazole cap 100 mg 10x4 cap strip 146 meropenem inj ip 500 mg rc not exists 147 metronidazole inj ip 500 mg/100ml 100 ml ffs / bfs bottle 148 metronidazole benzoate oral suspension ip 100 mg of base/5ml 60 ml bottle(amber colour) with measuring cap 149 metronidazole tablets ip 200 mg (film coated) 10x10 tab blister 150 metronidazole tablets ip 400 mg (film coated) rc not exists 151 norfloxacin tab ip 400mg film coated 10x10 tab blister 152 ofloxacin tab ip 200 mg 10x10 tab blister 153 primaquine tab ip 2.5 mg 10x10 tab strip/blister 154 primaquine tab ip 7.5 mg 10x10 tab strip/blister 155 quinine dihydrochloride inj ip 300 mg/ml 2 ml amp 25 ampoules 156 quinine sulphate tablets ip 300 mg (film coated) 10x10 tab blister 157 ampicillin cap ip 500mg 10x10 cap blister 158 nitrofurantoin tab ip 100mg 10x10 tab blister 159 cloxacillin sodium inj ip 500mg vial 160 cephalexin oral suspension ip (cephalexin dry syrup ip) 125mg/ 5 ml 30 ml bottle with measuring cap 161 ofloxacin oral suspension ip 50mg/ 5ml 30 ml. bottle 162 tinidazole tab ip 300 mg (film coated) 10x10 tab blister 163 tinidazole tab ip 500 mg (film coated) 10x10 tab blister 164 piperacillin + tazobactum for injection ip 4gm+500mg vial 165 amoxycillin oral suspension ip (dry syrup) 125 mg/5ml rc not exists 166 cefpodoxime dispersible tab 50 mg 10x10 tab strip 167 cephalexin tablets 125 mg (dispersible tablets) 10x10 tab strip 168 meropenem inj. ip 1gm rc not exists 169 acyclovir intravenous infusion ip 250mg vial 170 acyclovir intravenous infusion ip 500mg rc not exists 171 amikacin inj ip 250 mg vial 172 amoxicillin and potassium clavulanic ip inj 600mg 10 ml vial 173 amoxicillin and potassium clavulanate inj ip 1.2gm vial 174 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg/5 ml (30ml bottle) rc not exists 175 artesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o/o w/v (1ml ampoule),sodium chloride injection ip 0.9o/o w/v (5ml ampoule) each combo pack in a unit carton 176 aztreonam injection usp 500 mg vial 177 cefepime injection ip 500 mg vial 178 cefixime oral suspension ip 25mg/ml (paediatric drops) rc not exists 179 cefuroxime axetil tab ip 250 mg 10x10 tab strip 180 clindamycin capsule ip 150mg 10x10 cap strip/blister 181 clindamycin capsule ip 300 mg 10x10 cap strip/blister 182 levofloxacin tablets ip 250 mg 10x10 tab blister 183 linezolid tablets ip 600 mg 10x10 tablets 184 linezolid inj 200mg/100ml rc not exists 185 mefloquine tablets ip 250 mg 10x6 tablet blister 186 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 187 ofloxacin infusion ip 200mg / 100 ml(in nacl inj) 100 ml bottle 188 vancomycin for intravenous infusion ip 500 mg vial 189 vancomycin for intravenous infusion ip 1 gm vial 190 artemether and leumefantrine tablet (80 mg and 480 mg) 1x6 tablet blister 191 co trimoxazole tablet ip (trimethoprim 160mg+sulphamethoxazole 800mg) rc not exists 192 aztreonam injection 1gm vial 193 framycetin sulphate cream 1 o/o 30gm pack 30gm pack 194 framycetin sulphate cream 1 o/o 100 gm pack 100gm pack 195 artemether and leumefantrine tablet (40 mg and 240 mg) 1x6 tablet blister 196 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 10x10 tablets 197 piperacillin injection 2 gm + tazobactom 250mg ip rc not exists 198 ceftriaxone 1 gm + tazobactum 125 mg injection rc not exists 199 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) 10x10 tablets 200 cefadroxil tablet 500 mg rc not exists 201 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size rc not exists 202 levofloxacin tablet ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 10x10 tablets 203 faropenem tablet sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) rc not exists 204 clindamycin phosphate injection ip 300 mg vial/ampoules 205 imipenem + cilastatin injection 500mg/500mg ip powder for solution rc not exists 206 polymixin sulphate b injection usp 5 lac i.u. rc not exists 207 meropenem injection ip 250 mg rc not exists 208 colistimethate injection ip 1m iu powder for solution vial 209 voriconazole injection 200mg/vial vial 210 terbinafine hydrochloride tablet 250 mg 10x10 tablets 211 valganciclovir tablet 450 mg rc not exists 212 entecavir tablet ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 10x10 tablets 213 ganciclovir sodium injection 500mg (lyophilized powder for reconstitution) vial 214 azathioprine tab ip 50 mg 10x10 tab strip 215 bleomycin injection ip 15mg (bleomycin sulphate injection 15 units) vial 216 chlorambucil tab ip 5 mg rc not exists 217 cisplatin inj ip 50 mg/ 50 ml 50 ml vial 218 cyclophosphamide inj ip 200 mg 10 ml glass vial 219 cyclophosphamide inj ip 500 mg 25ml glass vial 220 cytarabine injection bp 500mg rc not exists 221 danazol cap ip 50 mg 10x10 cap blister 222 daunorubicin inj ip 20 mg 10 ml glass vial 223 doxorubicin inj ip 50 mg/ 25 ml vial 224 etoposide inj ip 100 mg 5 ml glass vial 225 fluorouracil inj ip 250 mg/ 5ml rc not exists 226 l asparaginase inj 10000 iu vial 227 leucovorin calcium inj ip / calcium folinate inj ip 10 mg /ml 5 ml vial 228 melphalan tab ip 5 mg rc not exists 229 mercaptopurine tab ip 50 mg 10x10 tab strip 230 methotrexate inj ip 50 mg/2 ml rc not exists 231 methotrexate tab ip 2.5 mg 10x10 tab strip 232 paclitaxel inj ip 260 mg rc not exists 233 paclitaxel inj ip 100 mg 16.7 ml vial 234 tamoxifen tab ip 10 mg 10x10 tab strip 235 vinblastine inj ip 10mg/ 10ml vial 236 vincristine inj ip 1mg(vial)/vincristin injection usp 1mg/ml (amp) vial/ampoules 237 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit vial 238 carboplatin injection ip 150 mg 15 ml vial 239 carboplatin injection ip 450 mg 45 ml vial 240 cisplatin inj ip 10 mg/10 ml 10 ml vial 241 dacarbazine injection 500 mg usp/ bp rc not exists 242 filgrastim injection ip (granulocyte colony stimulating factor) (sc/iv use) 300 mcg pre filled syringe/vial 243 gemcitabine for injection 200 mg vial 244 gemcitabine for injection ip 1gm vial 245 ifosfamide injection ip/bp/usp 1gm vial 246 imatinib tab ip 400mg 10x10 caps/tab 247 methotrexate tablets ip 10 mg 10x10 tab strip 248 mitomycine injection ip 10 mg/mitomycine for injection usp 10 mg rc not exists 249 oxaliplatin injection usp 50 mg 25 ml vial 250 cyclosporin capsule usp/ip 50 mg 50 caps pack 251 procarbazine hydrochloride capsule usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) rc not exists 252 bendamustine injection 100 mg vial 253 capecitabine tablet ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 10x10 tablets 254 letrozole tablet ip 2.5 mg (each film coated tablet contains letrozole ip 2.5 mg) 10x10 tablets 255 temozolomide capsule ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) strip of 5 cap/bottele of 5 cap 256 bortezomib injection 2mg vial 257 abiraterone acetate tablet ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) bottle of 30 tablets 258 lomustine capsule ip 40 mg (each capsule contains lomustine ip 40 mg) rc not exists 259 thalidomide capsule usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) rc not exists 260 bevacizumab injection 400 mg rc not exists group name (1) :: 07. anti neoplastic and immuno suppressant drugs palliative care 261 bevacizumab injection 100 mg rc not exists 262 cyclophosphamide tablet ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) rc not exists 263 gefitinib tablet ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 10x10 tablets 264 mycophenolate mofetil capsule/tablets ip 250 mg (each capsule/tablets conatin mycophenolate mofetil ip 250 mg) 10x10 caps/tab 265 tacrolimus capsule ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 10 x 10 capsule 266 mycophenolate sodium tablet 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 10x10 tablets 267 bicalutamide tablet ip 50 mg (each film tablet contains bicalutamide ip 50 mg) rc not exists 268 6 thioguanine tablet usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) rc not exists 269 zoledronic acid injection ip 4mg vial vial 270 dasatinib tab 100 mg rc not exists 271 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg rc not exists 272 levodopa and carbidopa tab 250 mg+ 25 mg 10x10 tab strip 273 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 274 bromocriptine tablets ip 2.5 mg 10x10 tab strip 275 acenocoumarol tab ip/ nicoumalone tab ip 2 mg 10x10 tab strip 276 deferasirox tab 100 mg 30 tablets 277 deferasirox tab 500 mg 30 tablets 278 deferiprone cap 250 mg 50 caps 279 deferiprone cap 500 mg 50 caps 280 desferrioxamine injection ip 500 mg / vial (for i.m. inj and i.v s.c. infusion) vial 281 dried human anti haemophlic fraction ip (dried factor viii fraction ip) 250 iu/ vial (iv use) rc not exists 282 enoxaparin sodium inj ip 60 mg rc not exists 283 ethamsylate inj 250 mg/ 2ml (im/iv) 2 ml amp 10 ampoules 284 heparin sodium inj ip 5000 iu/ml (im/iv use) rc not exists 285 human albumin solution ip 20% rc not exists 286 rh erythropoetin inj ip 10000 iu vial/pfs 287 rh erythropoetin inj ip 2000iu vial/pfs 288 rh erythropoetin inj 4000 iu vial/pfs 289 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. (aqueous solution) 1ml amp(ambercolor)25 amp 290 polygeline 3.5% solution with electrolytes for i.v. infusion rc not exists 291 factor ix concentrate (purified) ip 600 i.u.(human coagulation factor ix) rc not exists 292 anti inhibitor coagulation complex (human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial) rc not exists 293 hydroxyethyl starch (130/0.4) 6 o/o w/v with sodium chloride 0.9 o/o w/v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle/500 ml free flex 294 tranexamic acid tablets ip 500 mg 10x6 tablet blister 295 warfarin sodium. tab ip 5mg 10x10 tablets 296 vitamin k 1 (phytomenadione) ip 1mg/0.5ml injection (detail in rc) rc not exists 297 dried factor viii fraction ip (iv use) 500 iu/vial rc not exists 298 dried factor viii fraction ip (iv use) 1000 iu/vial vial with diluent 299 recombinant coagulation factor viia 1mg vial 300 recombinant coagulation factor viia 2mg rc not exists 301 n butyl alcohol injection 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size rc not exists 302 ethamsylate tablet 500 mg (each uncoated coated tablet contains ethamsylate 500 mg) rc not exists 303 feracrylum 1% w/v sterile solution 100 ml 100ml 304 tranexamic acid injection ip 100mg/ml 5ml size 5ml vial/amp 305 recombinant f ix 500 iu with diluent rc not exists 306 3rd generation recombinant f viii 250 iu with diluent vial with diluent 307 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 308 amiodarone tab ip 100 mg 10x10 tablets 309 amiodarone tab ip 200 mg 10x10 tab strip 310 amiodarone hydrochloride inj 50 mg/ml 3 ml amp (10 amp) 311 amlodipine tab ip 2.5 mg 10x10 tab strip/blister 312 amlodipine tablets ip 5 mg 10x10 tab blister 313 atenolol tab ip 50 mg 10x14 tab blister 314 atorvastatin tab ip 10mg 10x10 tab strip/blister 315 clopidogrel tab ip 75 mg 10x10 tab strip 316 digoxin inj ip 0.25 mg/ml rc not exists 317 digoxin tab ip 0.25 mg. 10x10 tab strip 318 diltiazem tabs ip 30 mg film coated 10x10 tab blister 319 dobutamine inj ip 50mg/ml/250mg (vial/)dobutamine inj ip 250 mg/5ml(amp) 10 vial/amp 320 dopamine hydrochloride inj ip 40 mg/ml 5 ml amp(amber colour)25 ampo 321 enalapril maleate tab ip 5mg 10x10 tab strip 322 enalapril maleate tab ip 2.5mg 10x10 tab strip group name (1) :: 08. anti parkinsonism drugs group name (1) :: 09. drugs affecting the blood group name (1) :: 10. cardio vascular drugs 323 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 324 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 325 lisinopril tab ip 5 mg rc not exists 326 losartan tab ip 50 mg rc not exists 327 magnesium sulphate inj. ip 500mg/ml (50%w/v) 2 ml amp 25 ampoules 328 methyldopa tab ip 250mg film coated rc not exists 329 nifedipine cap ip 5mg 10x10 cap strip 330 nifedipine tablets ip 10 mg (sustained release) 10x10 tab blister 331 nitroglycerin inj 5 mg/ ml 5 ml amp(10 ampoules) 332 propranolol tab ip 40 mg 10x10 tab strip/blister 333 streptokinase injection 15 lac units ip vial 334 verapamil tab ip 40 mg film coated 10x10 tab strip 335 labetalol tab ip 100mg 10x10 tab blister 336 labetalol hcl inj ip 20mg/4ml 4 ml ampules 337 aspirin delayed release tablet / aspirin gastroresistant tab ip (each enteric coated tablet contains acetyl salicylic acid 75 mg) 10x14 tab strips 338 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) 10x10 tab strip 339 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) 10x10 tab strip/blister 340 losartan potassium and hydrochlorothiazide tablets ip(losartan potassium 50 mg, hydochlorothiazide 12.5 mg) rc not exists 341 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg 10x10 tab strip/blister 342 amlodipine and atenolol tablet (amlodipine besilate equivalent to amlodipine 5mg,atenolol 50mg) 10x10 tab blister 343 atenolol tab ip 25 mg 10x14 tab blister 344 enalapril maleate tablets ip 10 mg 10x10 tab strip 345 lisinopril tablets ip 10 mg 10x10 tab strip/blister 346 lisinopril tab ip 2.5 mg 10x10 tab strip/blister 347 losartan tab ip 25 mg 10x10 tab blister 348 adenosine injection ip 6 mg/2ml 2ml vial/ ampoule 349 atorvastatin tablets ip 40 mg 10x10 tablets 350 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg rc not exists 351 fenofibrate capsules/ tab ip 200 mg rc not exists 352 isoprenaline injection ip 2mg / ml rc not exists 353 metoprolol tablets ip 25 mg 10x10 tablets 354 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 355 noradrenaline injection ip 2 mg/ml 2ml vial/ ampoule 356 prazosin tablets (extended release) 2.5 mg rc not exists 357 telmisartan tablets ip 40 mg 10x10 tablets 358 urokinase injection 5 lac unit (lyophilized) rc not exists 359 ramipril tablets ip 2.5 mg 10x10 tablets 360 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 361 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) 10x10 tablets 362 sotalol hydrochloride tablet usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 10x10 tablets 363 esmolol hydrochloride injection 10mg/ml 10ml size 10 ml vial 364 sodium nitroprusside injection 25mg/ml 2ml size 2ml vial/ ampoule 365 carvedilol tablet 3.125 mg 10x10 tablets 366 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 10x10 tablets 367 rosuvastatin tablet 10 mg 10x10 tablets 368 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 369 chlorhexidine mouthwash ip 0.2 o/o 50 ml bottle 370 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) 10 gm tube 371 tooth gel sodium monofluorophosphate 0.7 o/o and potassium nitrate 5 o/o (in flavoured base) 50 gm tube in unit carton 372 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 373 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 374 compound benzoic acid ointment ip benzoic acid 6 o/o + salicylic acid 3 o/o 15gm tube in mono carton 375 acyclovir cream 5% 5 gm tube in unit carton 376 cetrimide cream ip 15 gm 15gm tube in a unit carton 377 fusidic acid cream ip 2% 10gm tube in mono carton 378 glycerin ip 400 gm rc not exists 379 liquid paraffin ip 400 ml 400 ml bottle 380 miconazole nitrate cream ip 2% 15gm tube in a unit carton 381 povidone iodine ointment 5% 15 gm rc not exists 382 neomycin bacitracin and sulphacetamide powder (neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg) 10 gm plastic bottle with nozzle to sprinkle powder 383 silver sulphadiazine cream ip 1% 50gm tube rc not exists 384 gentian violet topical solution usp 1o/o 200 ml bottle 385 clotrimazole mouth paint (clotrimazole 1 o/o w/v) 15 ml squeeze bottle 386 beclomethasone, neomycin and clotrimazole cream (beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 %) rc not exists 387 gamma benzene hexachloride lotion 1%(lindane lotion usp) 100 ml bottle group name (1) :: 11. dental drugs group name (1) :: 12. dermatological drugs 388 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 389 betamethasone lotion ip 0.05 o/o rc not exists 390 clindamycin phosphate gel usp 1 o/o 20gm tube in mono carton 391 clobetasol propionate cream ip 0.05 o/o 20 gm tube 392 glycerin ip 100 ml rc not exists 393 ketoconazole cream 2% 15gm tube in mono carton 394 permethrin lotion 5% 30 ml 395 permethrin cream 5% 30gm tube in a unit carton 396 tretenoin cream usp 0.025% 20 gm tube in unit carton 397 coal tar 6% & salicylic acid 3% ointment 20gm 398 calamine lotion ip 100ml 100 ml bottle 399 powder clotrimazole 1% w/w 30 gm rc not exists 400 terbinafine cream 1%w/w (10 gm tube) 10 gm tube 401 olopatadine hydrochloride ophthalmic solution 0.1% w/v ip (e/d) 5ml size 5ml bottle 402 oitment mupirocin ip 2% 5 gm tube 403 anti a blood grouping serum ip(anti a monoclonal serum) 10 ml vial 404 anti b blood grouping serum ip(anti b mono clonal serum) 10 ml vial 405 anti d(rh) blood grouping serum ip/anti d blood grouping serum ip 10 ml vial 406 diatrizoate meglumine & diatrizoate sodium inj usp 60% (iodine conc.= 292 mg/ml) 20 ml vial / ampoule 407 diatrizoate meglumine and diat sod inj usp 76%w/v (iodine = 370 mg/ml) 20 ml ampoule 408 gadodiamide inj. 0.5mml/ml vial rc not exists 409 vdrl antigen (with + ve and ve control) / rpr slide kit 100 test kits 410 iohexol usp (solution for injection) non ionic contrast medium in sterile aquous solution 300 mg iodine/ml 20 ml pack 411 iohexol usp(solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. rc not exists 412 multistix test strip rc not exists 413 povidone iodine solution ip 5 % 500 ml 500 ml bottle 414 compound benzoin tincture ip 500 ml bottle 415 formaldehyde solution (34.5 per. 38 per.) rc not exists 416 gluteraldehyde solution 2% 5 ltrs can 417 hydrogen peroxide solution ip 6 o/o (20 vol) rc not exists 418 lysol (cresol with soap solution) ip (cresol 50 o/o + soap 50 o/o) 5 ltrs can 419 povidone iodine scrub solution / cleansing solution 7.5 o/o w/v povidone iodine (suitable for hand wash) 500 ml bottle 420 surgical spirit ip (500 ml) 500 ml opaque white bottle with inner cap 421 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 422 surgical spirit ip (100 ml) 100ml opaque white bottle with inner cap 423 povidone iodine solution ip 5% 100ml bottle 100 ml bottle 424 povidone iodine ointment usp 250 gm 250 gm pack 425 povidone iodine solution ip 10 % 100 ml bottle 426 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 427 acetazolamide tab ip 250mg 10x10 tab blister 428 frusemide tab ip 40 mg 10x10 tab strip 429 furosemide injection ip 10mg/ml (im and iv use) 2 ml ampoule 430 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 431 mannitol inj ip 20% w/v 100 ml ffs / bfs bottle 432 spironolactone tab ip 25mg 10x10 tab blister 433 torsemide tab 10 ip mg 10x10 tab strip/blister 434 hydrochlorthiazide tab ip 25mg 10x10 tab strip 435 torsemide inj 10 mg/ml rc not exists 436 spironolactone tablets ip 50 mg 10x10 tablets 437 ciprofloxacin 0.3 o/o and dexamethasone 0.1 o/o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vial with sterilized dropper,or squeeze vial 438 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops 5 ml ear drops 439 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial/bottle with a seperate dropper 440 ceruminolytic drops (wax dissolving ear drops) paradichlorobenzene 2 o/o , benzocaine 2.7 o/o , chlorbutol 5 o/o, turpentine oil 15 o/o 10 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 441 drotaverine hydrochloride inj 40 mg/2 ml 2 ml amp 10 ampoules 442 ointment containing lidocaine ip 3 o/o zinc oxide ip 5 o/o , hydrocortisone ip 0.25 o/o, allantoin ip 0.5 o/o 15gm tube in a unit carton 443 antacid tablets.formula,each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 444 antacid liquid,each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle (with measuring cap) 445 bisacodyl tab ip 5 mg 10x10 tab strip 446 dicyclomine tab ip 10 mg 10x10 tab strip/blister 447 dicyclomine inj ip 10 mg /ml 2 ml amp 25 ampoules 448 dicyclomine hydrochloride oral solution ip 10mg /5ml 30 ml bottle with measuring cap 449 domperidone suspension ip 5mg/5ml 30 ml bottle with measuring cap group name (1) :: 17. gastro intestinal drugs group name (1) :: 16. drugs for ear ailments group name (1) :: 13. reagents and diagnostic agents group name (1) :: 14. disinfectants and antiseptics group name (1) :: 15. diuretics 450 domperidone tab ip 10 mg 10x10 tab blister 451 hyoscine butylbromide inj ip 20 mg/ ml 1ml amp 25 ampoules 452 loperamide tab ip 2 mg 10x10 tab strip 453 metoclopramide inj ip 10mg/2ml 2 ml amp(amber colour)(25 ampoules) 454 metoclopramide tab ip 10 mg 10x10 tab blister 455 omeprazole cap ip 20 mg rc not exists 456 ondansetron inj ip 2mg/ml 2 ml amp 10 ampoules 457 ors powder ip rc not exists 458 pentoprazole inj 40 mg rc not exists 459 ranitidine hcl injection ip 50mg/2ml rc not exists 460 ranitidine tab ip 150mg film coated rc not exists 461 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o/o disodium hydrogen phosphate dodecahydrate 8 o/o 100 ml polypropylene pack 462 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 463 drotaverine tab ip 40 mg 10x10 tab blister 464 ranitidine tab ip 300mg film coated rc not exists 465 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 466 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 467 metoclopramide hydrochloride syrup ip 5 mg/ 5ml 30 ml bottle (with a seperate dropper which should be able to screw & cap the bottle) in unit carton 468 domperidone oral drops 10mg/ ml (10ml) 10 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 469 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 470 lactic acid bacillus tab 60 million spores 10x10 tablets 471 lactulose solution usp/bp 10gm/15ml or 3.35 gm/5ml rc not exists 472 liquid paraffin ip 100 ml 100 ml bottle 473 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 474 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets rc not exists 475 ursodeoxycholic acid tablets ip 300 mg rc not exists 476 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 477 prochlorperazine mesylate injection 12.5mg/ml 5ml size rc not exists 478 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1 gm each sachet 479 mesalamine tablet usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 10x10 tablets 480 allopurinol tablets ip 100 mg 10x10 tablets 481 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 482 leflunomide tablets ip 10mg(film coated) 10x10 tablets 483 leflunomide tablets ip/usp 20mg (film coated) 10x10 tablets 484 sulfasalazine gastroresistant tablets ip 500 mg ip 10x10 tablets 485 biphasic isophane insulin inj ip (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) rc not exists 486 carbimazole tabs ip 5 mg (film coated) 10x10 tab blister 487 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg/ml rc not exists 488 clomifene tab ip 25 mg 10x10 tab strip 489 clomiphene tab ip 50 mg 10x10 tab strip 490 conjugated estrogen tabs usp 0.625 mg. rc not exists 491 dinoprostone cream/ gel 0.5 mg dinoprostone in syringe syringe 492 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 493 glibenclamide tab ip 5 mg 10x10 tab strip/blister 494 gliclazide tab ip 40 mg 10x10 tab strip/blister 495 glimepiride tab ip 2 mg 10x10 tab strip/blister 496 glimepiride tab ip 1mg 10x10 tab strip/blister 497 glipizide tab ip 5mg 10x10 tab blister 498 hydroxyprogesterone inj ip 250mg /ml 1ml amp 25 ampoules 499 isophane insulin inj ip 40 iu /ml 10 ml vial 500 metformin tab ip 500 mg(film coated) 10x10 tab blister 501 norethisterone tab ip 5 mg 10x10 tab strip 502 pioglitazone tab ip 15 mg 10x10 tab blister 503 progesterone inj 200 mg/ 2ml 2 ml amp 10 ampoules 504 insulin injection ip (soluble insulin/neutral insulin injection)40 iu/ml(r.dna origin) rc not exists 505 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 506 metformin hydrochloride(sustained release tablets ip 1000 mg 10x10 tab blister 507 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) 10x10 tab blister 508 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) rc not exists group name (1) :: 18. gout and rheumatiod arthritis group name (1) :: 19. hormones other endocrine drugs and contraceptives 509 metformin hcl (sustained release) and glimepiride tab metformin hcl (sustained release) 500mg ,glimepiride 1mg rc not exists 510 metformin hydrochloride (sustained release) and glimepiride tablets ip (metformin hydrochloride(sustained release) 500 mg, glimipiride 2mg) 10x10 tab blister 511 glimepiride, pioglitazone and metformin hydrochloride (sustained release) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride (sustained release) 500 mg 10x10 tab blister 512 gliclazide and metformin tablets (gliclazide 80 mg and metformin hcl 500 mg) 10x10 tablets 513 glucagon for injection usp 1 mg/ml vial 514 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 515 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 516 octreotide injection 50 mcg/ml 1 ml. ampoule 517 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges 3ml vial 518 tenaligliptin tablet ip 20mg 10x10 tablet blister/alu alu pack 519 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle rc not exists 520 human anti d immunoglobulin injection 300mcg (im use) rc not exists 521 human anti d immunoglobulin 150 mcg pre filled syringe/vial 522 human rabies immunoglobulin inj 150 iu/ ml rc not exists 523 rabies vaccine human (cell culture) ip (intradermal) 2.5 iu 1 ml vial with 1.0 ml diluent 524 rabies vaccine human (cell culture) ip (intramuscular) 2.5 iu/ dose single dose vial with diluent and syringe with needle 525 snake venum anti serum ip (lyophilized)polyvalent anti snake venum,serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum,0.45 mg of common kraite(bungaras)venum(details in rc) vial 526 tetanus immunoglobulin ip 250 iu/ vial rc not exists 527 tetanus vaccine (adsorbed) ip 5 ml vial rc not exists 528 rabies antiserum ip (equine) 300 units per ml contains equine anti rabies immunoglobulin fragments (i.m./sc use) 5 ml vial 529 diphtheria antitoxin 10000 iu vial 530 hepatitis b immunologlobin injection ip 200 i.u rc not exists 531 human immunoglobulin inj with 12%igm,12%iga,76%igg in pack of 10ml(0.5gm) 10ml vial (0.5gm) 532 atracurium inj 10 mg/ml 2.5 ml amp(10 ampoules) 533 glycopyrrolate inj ip 0.2 mg/ml 1 ml amp (10 amp) 534 midazolam inj ip 1 mg/ml 5 ml vial 535 neostigmine inj ip 0.5 mg/ml 1 ml 10 ampoules 536 neostigmine tab ip 15 mg rc not exists 537 succinylcholine inj. ip 50 mg/ml (iv use) 10 ml vial 538 valethamate bromide inj 8mg / ml rc not exists 539 vecuronium bromide for injection 4mg (freeze dried) rc not exists 540 chlorzoxazone , diclofenac sodium & paracetamol tablets (chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg) rc not exists 541 neostigmine injection ip 2.5mg/5ml 5 ml amp(10 ampoules) 542 cis atracurium besylate injection 2 mg/ml in 5 ml vial 5 ml vial 543 tropicamide eye drop ip 1o/o 5 ml. vial with sterilized dropper,or squeeze vial 544 atropine eye ointment ip 1% rc not exists 545 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper,or squeeze vial 546 chloramphenicol eye drops ip 0.5 0/0 5 ml. vial with sterilized dropper,or squeeze vial 547 ciprofloxacin eye drops ip 0.3 o/o w/v 5 ml squeeze vial 548 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 549 hydroxypropylmethyl cellulose solution 20 mg/ ml 2ml glass syringe(with cannula) 550 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o/o +0.1 o/o rc not exists 551 tobramycin eye drops 0.3% [331] 5 ml. vial with sterilized dropper,or squeeze vial 552 tobramycin ophthalmic ointment usp 0.3% rc not exists 553 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v 5 ml squeeze vial 554 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 555 lidocaine hcl topical solution usp 4% rc not exists 556 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper,or squeeze vial 557 timolol eye drops ip 0.5 o/o w/v 5 ml squeeze vial 558 homatropine eye drops ip 2% 5 ml squeeze vial 559 travoprost eye drops ip 0.004 o/o 3 ml squeeze vial 560 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 5 ml squeeze vial 561 betaxolol eye drops 0.5 o/o rc not exists 562 carboxymethylcellulose eye drops ip 0.5% 10 ml squeeze vial 563 phenylephrine hydrochloride opthalmic solution usp/phenylephrine eye drops bp 5% rc not exists 564 acyclovir eye ointment ip 3% w/w 5gm size 5 gm tube 565 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper,or squeeze vial 566 chloramphenicol 1% w/w eye ointment ip, 3gm size rc not exists group name (1) :: 20. immunologicals group name (1) :: 21. muscle relaxants and cholinestrase inhibitors group name (1) :: 22. opthamological preparations group name (1) :: 23. oxytocics and antioxytocics 567 isoxsuprine inj ip 5 mg/ml rc not exists 568 isoxsuprine tab ip 20 mg 10x10 tab strip 569 methylergometrine inj ip 0.2 mg/ml 1ml amp(ambercolor)25 amp 570 methylergometrine tab ip 0.125 mg 10x10 tab strip 571 misoprostol tab ip 200 mcg 10x10 tablets 572 oxytocin inj ip 5 iu/ml rc not exists 573 mifepristone tab ip 200mg single tablet 574 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg)/natural micronised progesteron tablet 200 mg (each tablet contains progesteron ip 200 mg) 10x10 tablet/capsule blister/strip 575 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 10x10 tablets 576 human chorionic gonadotropin injection ip 5000 i.u. rc not exists 577 leurprolide acetate depot 3.75 mg vial 578 leurprolide acetate depot 11.25 mg vial 579 alprazolam tab ip 0.25 mg 10x10 tab strip/blister 580 alprazolam tab ip 0.5mg 10x10 tab strip/blister 581 amitriptyline tab ip 25mg film coated 10x10 tab strip 582 chlordiazepoxide tablets ip 10mg 10x10 tab strip 583 chlorpromazine tablets ip 100 mg (coated tablet) 10x10 tab strip 584 chlorpromazine tablets ip 25 mg (sugar coated) 10x10 tab strip 585 chlorpromazine tablets ip 50 mg (coated tablets) 10x10 tab strip 586 chlorpromazine inj. ip 25mg/ml rc not exists 587 diazepam inj ip 10mg/2ml (1m/iv use) rc not exists 588 diazepam tab ip 5 mg 10x10 tab strip/blister 589 escitalopram tab ip 10 mg 10x10 tab strip/blister 590 fluoxetine cap ip 20 mg 10x10 cap strip/blister 591 haloperidol inj ip 5 mg/ml 1 ml amp (10 amp) 592 haloperidol tab ip 1.5 mg 10x10 tab strip 593 haloperidol tab ip 5 mg 10x10 tab strip 594 imipramine tab ip 25 mg (coated tab) rc not exists 595 imipramine tab ip 75 mg (coated) 10x10 tab blister 596 lithium carbonate tab ip 300 mg 10x10 tab strip 597 lorazepam inj ip 2 mg/ml 2 ml amp 25 ampoules 598 olanzapine tab ip 5 mg 10x10 tab strip 599 risperidone tab 2mg 10x10 tab strip/blister 600 risperidone tab 1 mg 10x10 tab strip/blister 601 sertraline tab ip 50 mg 10x10 tab strip/blister 602 trifluperazine tab ip 5 mg coated 10x10 tab strip/blister 603 quetiapine tablet ip 50mg 10x10 tab blister 604 quetiapine tablet ip 25mg 10x10 tab blister 605 clonazepam tablet 0.5 mg 10x10 tablets 606 levosulpiride tablet 25 mg (each uncoated tablet contains levosulpiride 25 mg) 10x10 tablets 607 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 608 zolpidem tablet 5 mg 10x10 tablets 609 aminophylline inj ip 25 mg/ml 10 ml amp 25 ampoules 610 beclomethasone inhalation ip 200 mcg/dose rc not exists 611 budesonide nebulizer suspension 0.25mg/ml 2 ml amp 10 ampoules 612 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg,ammonium chloride 130 mg, sodium citrate 65 mg,menthol 0.5 mg, syrup q.s. 50 ml bottle (with measuring cap) 613 ipratropium bromide nebulizer solution 250 mcg/ ml 15 ml glass bottle 614 salbutamol tablet ip 4 mg 10x10 tab strip/blister 615 salbutamol inhalation 100 mcg /dose 200metered dose container 616 salbutamol nebuliser solution bp 5 mg/ml 10 ml vial 617 salbutamol tab ip 2 mg 10x10 tab strip/blister 618 theophylline and etofylline injection (anhydrous theophylline 50.6mg + etofylline 169.4 mg) 2 ml amp 25 ampoules 619 theophylline and etofylline tablets (theophylline ip 23mg + etofylline 77 mg) rc not exists 620 theophylline tablet 400mg sustained release/ controlled release (theophylline prolonged released tablet ip) rc not exists 621 salbutamol syrup ip 2mg/ 5ml 100 ml bottle(with measuring cap) 622 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 623 saline nasal solution (drops) (sodium chloride 0.65 o/o) 10 ml bottle with dropper/squeeze bottle 624 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 625 budesonide powder for inhalation 200 mcg 30 capsules 626 ipratropium powder for inhalation ip 40 mcg 30 capsule (rota caps) 627 terbutaline tablets ip 2.5 mg 10x10 tablets 628 xylometazoline nasal drops ip 0.1% 5ml vial/bottle(with a seperate dropper) in a unit carton 629 cough syrup/expectorant(50) ml 50 ml bottle (with measuring cap) 630 acebrophylline tablet/capsule 100 mg 10x10 tablets 631 compound sodium lactate inj. ip 500 ml ffs/bfs bottle group name (1) :: 24. psychotropic drugs group name (1) :: 25. drugs acting on the respiratory tract group name (1) :: 26. solution correcting water electrolyte and acid base disturbance 632 dextrose inj ip 25% w/v 100 ml ffs / bfs bottle 633 dextrose inj ip 10% 500 ml ffs/bfs bottle 634 dextrose inj ip 5% 500 ml ffs/bfs bottle 635 multiple electrolytes and dextrose injection type i ip (electrolyte p injection ) 500 ml ffs/bfs bottle 636 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs/bfs bottle 637 potassium chloride inj. 0.15 gm/ml 10 ml amp 10 ampoules 638 potassium chloride oral solution u.s.p 500mg/ 5ml 200ml bottle(amber color) 639 sodium chloride and dextrose injection ip 0.9 o/o + 5 o/o 500 ml ffs/bfs bottle 640 sodium chloride inj ip 500 ml 500 ml ffs/bfs bottle 641 sodium chloride injection ip 100 ml rc not exists 642 ringer acetate infusion 500 ml 500 ml bottle 643 sodium chloride 0.45% w/v polypack 500 ml 500 ml bottle 644 finasteride tablets ip 5 mg 10x10 tab strip/blister 645 tamsulosin hcl tablets/capsule 0.4 mg 10x10 tablet/cap strip 646 flavoxate tablets ip 200 mg (coated tablet) 10x10 tablets 647 savelamer carbonate tablet 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 10x10 tablets 648 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) rc not exists 649 levamisol hydrochloride tablet ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 10x10 tablets 650 phenazopyridine tablet 5 mg rc not exists 651 dutasteride tablet 0.5 mg 10x10 tablets 652 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) rc not exists 653 betahistine tab ip 8 mg 10x10 tablets 654 betahistine tab ip 16 mg 10x10 tablets 655 cinnarizine tablets ip 25 mg 10x10 tab blister 656 cinnarizine tablet ip 75 mg 10x10 tab blister 657 ascorbic acid tab ip 500 mg 10x10 tab strip 658 calcium gluconate inj ip 10% (iv use) rc not exists 659 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg rc not exists 660 ferrous sulphate with folic acid tab (paediatric) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip/blister 661 folic acid tab ip 5 mg 10x10 tab blister 662 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle (with dropper which should be able to screw and cap the bottle) in a unit carton 663 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip/blister 664 vitamin b complex inj nfi 10 ml vial 665 vitamin b complex tablet nfi (prophylactic) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg (with appropriate overages) 10x10 tab strip/blister 666 vitamin a paediatric oral solution ip(vitamin a concentrate oil ip)each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml/2ml in unit carton 667 calcium and vitamin d3 suspension (each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle(with measuring cap) 668 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper (details in rc) 669 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip/blister 670 iron sucrose injection usp/bp 20mg/ml (for iv use) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule (amber colour) 671 calcium with vitamin d tablets usp /calcium and colecalciferol tablets bp/calcium and vitamin d3 tablets ip(elemental calcium 500 mg, vitamin d3 250 iu) (nonchewable) rc not exists 672 cholecalciferol granules 60,000 iu /gm 1 gm sachet(50 sachets) 673 mecobalamin inj 500 mcg/ml 1 ml. ampoule 674 pyridoxine tablet ip 10 mg rc not exists 675 pyridoxine tablet ip 40mg 10x10 tab strip 676 thiamine tablets ip 100 mg 10x10 tab strip 677 calcitriol capsules ip 0.25 mcg 10x10 cap strip/blister 678 methyl cobalmine tablet 500mcg 10x10 tab strip/blister 679 methyl cobalmine tablet 1500mcg 10x10 tab strip/blister 680 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 681 ferric carboxymaltose injection 50 mg/ml 10 ml size rc not exists 682 multi vitamin syrup rc not exists 683 flunarizine tab 5 mg 10x10 tab blister 684 black disinfectant fluid (phenyl) as per schedule o grade iii 5 ltrs can 685 conc haemodialysis fluid b.p acetate concentrate 10 litre can rc not exists 686 peritonial dialysis solution ip 1000 ml ffs/bfs pack 687 sodium bicarbonate inj ip 7.5% w/v 10 ml amp 25 ampoules 688 water for inj ip rc not exists 689 alendronate sodium tablets usp / bp 35 mg 4 tablets (20 *4tablet) 690 mannitol with glycerin injection 10 o/o + 10 o/o w/v (for intravenous infusion) 100 ml ffs / bfs bottle group name (1) :: 29. vitamins and minerals group name (1) :: 30. miscellaneous drugs group name (1) :: 28. antivertigo group name (1) :: 27. drugs for urology 691 normal human intravenous immunoglobulin 5g/100ml 100 ml vial 692 pregabalin cap ip 75 mg 10 x 10 capsule 693 surfactant for intratrecheal instillation (natural bovine lung surfactant) 4ml vial 694 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans rc not exists 695 intravenous fat emulsion 20% w/v 250ml 250 ml bottle 696 pyridostigmine tablet ip 60 mg (each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 697 caffeine citrate usp injection 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 3ml vial 698 amino acid 10% injection 100ml size 100 ml bottle 699 vitamin e capsule 400 mg rc not exists 700 inj poractant alpha 80 mg/ml in pack of 1.5 ml (detail in rc) 1.5ml vial 701 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 40 mm length 76 cm) size 1/0 1x12 foils 702 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 20 mm length 76 cm) size 3/0 1x12 foils 703 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 1x12 foils 704 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 1x12 foils 705 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 1x12 foils 706 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(3/8 cir rb needle 30 mm length 76 cm) size 2/0 1x12 foils 707 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 45 mm length 100 cm) size 1 1x12 foils 708 absorbable surgical suture (sterile catgut), needled suture chromic size 3/0 (3/8 cir rcutting needle 26mm, length 76 cm) 1x12 foils 709 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm 1x12 foils 710 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm 1x12 foils 711 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm 1x12 foils 712 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm 1x12 foils 713 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm 1x12 foils 714 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed 1x12 foils 715 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) 1x12 foils 716 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm 1x12 foils 717 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) 1x12 foils 718 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm 1x12 foils 719 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm 1x12 foils 720 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) 1x12 foils 721 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) rc not exists 722 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) 1x12 foils 723 non absorbable surgical suture, sterilised needled black braided silk size 3/0(1/2 cir rb needle 20mm, length 76 cm) 1x12 foils 724 non absorbable surgical suture, sterilised needled black braided silk size 3/0(3/8cir reverse cutting needle 26mm, length 76 cm) 1x12 foils 725 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) 1x12 foils 726 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) 1x12 foils 727 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) 1x12 foils 728 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 4/0 (3/8 conventional cutting needle 19mm length 60 cm.) 1x12 foils 729 non absorbable surgical suture,sterilised needled polyamide monofilament black (nylon)size 5/0(3/8 cir slim blade cutting needle 15mm length 70 cm) 1x12 foils 730 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1x12 foils group name (1) :: 31. absorbable sutures group name (1) :: 32. non absorbable surgical suture sterilised surgical needled suture 731 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) 1x12 foils 732 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb 13 mm needle,length 75cm) double arm 1x12 foils 733 non absorbable surgical suture,sterilised needled monofilament polypropylene blue (3/8cir rb 16 mm needle,length 90 cm)size 6/0 1x12 foils 734 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 7/0 (3/8cir rb double 8mm needle, length 60 cm) 1x12 foils 735 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(3/8cir rb 16 mm needle, length 70 cm) 1x12 foils 736 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) 1x12 foils 737 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1(1/2 cir rb heavy needle 45mm length 90 cm) 1x12 foils 738 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5/0(1/2 cir rb double needle 17mm length 90 cm)(detail in rc) 1x12 foils 739 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 cir tapercut double needle 17mm length 70 cm)(detail in rc) 1x12 foils 740 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm 1x12 foils 741 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) 1x12 foils 742 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir tapercut needle 17mm length 75 cm) double arm 1x12 foils 743 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0(1/2 cir tapercut needle,25 mm length 90 cm) double arm 1x12 foils 744 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 6/0(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 1x12 foils 745 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6/0(3/8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 746 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 4/0(1/2 cir rb needle 16 mm length 70 cm) 1x12 foils 747 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0(3/8 cir cutting needle 25mm length 45 cm) 1x12 foils 748 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) 1x12 foils 749 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir reverse cutting, 45 mm needle length 100 cm) 1x12 foils 750 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 8/0 (3/8 cir rb , 8mm double needle, suture length of 70cm) 1x12 foils 751 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4/0 (1/2 circle tapercut 13mm double needle 70cm) 1x12 foils 752 non absorbable surgical suture,sterilised needled monofilament polypropylene blue size 5/0 (1/2 circle cc 13mm needle, suture length of 70cm) double arm 1x12 foils 753 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 1x12 foils 754 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, suture length of 75cm) double arm 1x12 foils 755 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/ blue size 4/0(1/2 cir tapercut ,17 mm double needle, length 75 cm) rc not exists 756 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2/0 (1/2 cir tapercut ,17 mm double needle, length 90 cm) 1x12 foils 757 non absorbable surgical suture, sterilised needled polybutylate/silicon coated polyster braided green/blue size 2/0(1/2 cir tapercut ,17 mm double needle, length 90 cm)(detail in rc) 1x12 foils 758 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2/0 1/2 circle taper cut,17mm double armed needle,suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 759 non absorbable surgical suture sterilized needled polybutylate/silicon coated with polyster braided(green/blue)size 2 0 1/2 circle taper cut,25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 760 non absorbable surgical suture, sterilised needled coated polyster braided, green/white or blue/white coated polyster braided (green / blue) with size 3/0 1/2 circle tapercut double needle 25mm,suture length 90 cm 1x12 foils 761 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 10/0 (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 762 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) 1x12 foils 763 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) 1x12 foils 764 absorbable surgical sutures,sterilised needled polyglecaprone/polyglyconate,monofilament sutures size 2/0 (1/2 circle oval rb needle 26mm needle,suture length of 70cm) 1x12 foils 765 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate,size 3/0 (1/2 circle ovalrb contrast needle 26mm, suture length 70cm) 1x12 foils 766 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 4/0 (1/2 circle cutting 16mm needle,suture length 70cm) 1x12 foils 767 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) 1x12 foils 768 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1 (1/2 circle reverse cutting 50 mm length 90cm) 1x12 foils 769 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 2/0 (1/2 circle rb 31mm needle, length 70cm) 1x36 foils 770 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) 1x12 foils 771 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 1x12 foils 772 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm 1x12 foils 773 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm 1x12 foils 774 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm 1x12 foils 775 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 776 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm 1x12 foils 777 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps1,24mm, suture length 70 cm 1x12 foils 778 absorbable gelatin sponge 80 x 50x 10mm(details in rc) piece 779 absorbent cotton wool ip 500 gm rc not exists 780 asepto syringe with transparent bulb sterile, 60 ml rc not exists 781 blood administration set blood transfusion set (details in rc) unit 782 gloves size 6.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) pair 783 gloves size 6.5 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) pair 784 gloves size 7 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) pair 785 gloves size 7 inches,powder free (disposable sterile surgical rubber gloves)(details in rc) pair 786 gloves size 7.5 inches,powdered (disposable sterile surgical rubber gloves)(details in rc) pair 787 gloves size 7 .5inches,powder free (disposablesterile surgical rubber gloves)(details in rc) pair 788 suction catheter, sterile.size: fg 5 (details in rc) each piece 789 suction catheter, sterile. size: f g 6 (details in rc) each piece 790 suction catheter, sterile. size: f g 8 (details in rc) each piece 791 suction catheter, sterile. size: f g 10 (details in rc) each piece 792 suction catheter, sterile. size: f g 12 (details in rc) each piece 793 suction catheter, sterile. size: f g 14 (details in rc) each piece 794 suction catheter, sterile. size: f g 16 (details in rc) each piece 795 suction catheter, sterile. size: f g 18 (details in rc) each piece 796 suction catheter, sterile. size: f g 20 (details in rc) each piece 797 suction catheter, sterile. size: f g 22 (details in rc) each piece 798 catheter,size 8(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 799 catheter,size 10(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 800 catheter,size 16(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 801 catheter,size 18(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 802 catheter,size 20(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 803 catheter,size 22(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece 804 catheter,size 24(foleys ballon catheter sterile,2 way for urinary drainage,single use,)silicon coated natural latex material(details in rc) each piece group name (1) :: 34. polyglecraprone 25 monofilament sutures group name (1) :: 35. monofilament polydioxanone suture group name (1) :: 36. antibacterial coated suture group name (1) :: 37. surgicals 805 infant feeding tube size 10fg(details in rc) each piece 806 infant feeding tube size 8fg(details in rc) each piece 807 infant feeding tube size 5fg(details in rc) each piece 808 perfusion set with airway and needle,(adult use) sterile disposable(details in rc) unit 809 perfusion set (infusion set) with airway and needle (paediatric use)sterile disposable(details in rc) unit 810 infusion set with microdrip,(i.v.)sterile disposable(details in rc) unit 811 insulin syringe ( 40 units) with (fixed) 30 g needle shall conforn to is 12227 unit 812 sterile disposable (single use) teflon/ptfe i.v cannula with integrated 3 way stop cock size 16g (details in rc) each piece 813 sterile disposable (single useteflon / ptfe i.v. cannula with integrated 3 way stop cock.) size 18g (details in rc) each piece 814 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 20 g (details in rc) each piece 815 sterile disposable (single use) teflon/ptfe i.v. cannula with integrated 3 way stop cock.size 22g (details in rc) each piece 816 sterile disposable (single use) teflon/ ptfe i.v. cannula without port size 24g (details in rc) each piece 817 mucus extractor sterile(details in rc) unit 818 nasal oxygen set, twin bore all sizes adult (details in rc) each piece 819 nasal oxygen set, twin bore all sizes paediatrics (details in rc) each piece 820 paper adhesive plaster 1 inch x 9.0 mts (with cutter) non woven adhesive tape unit 821 paper adhesive plaster 2 inch x 9.0 mts (with cutter) non woven adhesive tape unit 822 paper adhesive plaster 3 inch x 9.0 mts (with cutter) non woven adhesive tape unit 823 plaster of paris bandage 15cm x 2.7 mts/roll unit 824 plaster of paris bandage 10cm x 2.7mts unit 825 ryles tube / nasogastric tube size: 10(details in rc) each piece 826 ryles tube / nasogastric tube size: 12(details in rc) each piece 827 ryles tube / nasogastric tube size:14 (details in rc) each piece 828 ryles tube / nasogastric tube size: 16 (details in rc) each piece 829 ryles tube / nasogastric tube size: 18 (details in rc) each piece 830 scalp vein set (disposable) size 18g (details in rc) each piece 831 scalp vein set (disposable) size 20g (details in rc) each piece 832 scalp vein set (disposable) size 22g (details in rc) each piece 833 scalp vein set (disposable) size 24 g (details in rc) each piece 834 syringe 2 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 835 syringe 5 ml hypodermic with needle attached 24g,sterile,single use disposable(details in rc) unit 836 syringe 10 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) unit 837 syringe 20 ml hypodermic with needle attached 22g,sterile,single use disposable(details in rc) unit 838 surgical blade sterile, size 11(details in rc) 100 blades/packet 839 surgical blade sterile, size 15(details in rc) 100 blades/packet 840 surgical blade sterile, size 22(details in rc) 100 blades/packet 841 suture needles curved 1/2 circle round body assorted size 11 15(details in rc) rc not exists 842 suture needles curved 1/2 circle round body assorted size 1 5(details in rc) rc not exists 843 suture needles curved 1/2 circle round body assorted size 16 20(details in rc) rc not exists 844 suture needles curved 1/2 circle round body assorted size 6 10(details in rc) rc not exists 845 suture needles curved and cutting 1/2 circle cutting size 6 10(details in rc) rc not exists 846 suture needles curved and cutting 1/2 circle size 11 15(details in rc) rc not exists 847 suture needles curved and cutting 1/2 circle size 16 20(details in rc) rc not exists 848 suture needles curved and cutting size 1 5(details in rc) rc not exists 849 sterile disposable spinal needle for single use. 22g x 3 1/2 inch (details in rc) each piece 850 sterile disposable spinal needle for single use. 25g x 3 1/2 inch (details in rc) each piece 851 urine collecting bag, disposable 2000 ml(details in rc) rc not exists 852 double j stent, sterile, both ends open size 4f, length 16 cm rc not exists 853 double j stent, sterile, both ends open, size 5f, length 20 cm rc not exists 854 double j stent, sterile, one end closed size 4f, length 16 cm rc not exists 855 double j stent, sterile, one end closed, size 5f, length 20 cm rc not exists 856 endotracheal tube, plain size 2.5 (details in rc) each piece 857 endotracheal tube, plain size 3 (details in rc) each piece 858 endotracheal tube, plain size 3.5 (details in rc) each piece 859 endotracheal tube, plain size 4 (details in rc) each piece 860 endotracheal tube, plain size 4.5 (details in rc) each piece 861 endotracheal tube, plain size 5 (details in rc) each piece 862 endotracheal tube, plain size 5.5 (details in rc) each piece 863 endotracheal tube, plain size 6 (details in rc) each piece 864 endotracheal tube, plain size 6.5 (details in rc) each piece 865 endotracheal tube, plain size 7 (details in rc) each piece 866 endotracheal tube, plain size 7.5 (details in rc) each piece 867 endotracheal tube, plain size 8 (details in rc) rc not exists 868 endotracheal tube, plain size 8.5 (details in rc) each piece 869 endotracheal tube, cuffed size 4 (details in rc) each piece 870 endotracheal tube, cuff size 4.5 (details in rc) each piece 871 endotracheal tube, cuff size 5 details in rc each piece 872 endotracheal tube, cuff size 6 (details in rc) each piece 873 endotracheal tube, cuff size 6.5 (details in rc) each piece 874 endotracheal tube, cuff size 7 (details in rc) each piece 875 endotracheal tube, cuff size 7.5 (details in rc) each piece 876 endotracheal tube, cuff size 8 (details in rc) each piece 877 endotracheal tube, cuff size 8.5 (details in rc) each piece 878 endotracheal tube, cuff size 9 (details in rc) each piece 879 tracheostomy tube, plain all sizes(details in rc) each piece 880 tracheostomy tube (pvc), cuffed all sizes(details in rc) each piece 881 abdominal drain kit (with collection bag 2000 ml size 24 (details in rc) each piece 882 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) size 28 (details in rc) each piece 883 abdominal drain kit,sterile,having drainage cather and collection bag(2000) ml size 32 (details in rc) each piece 884 corrugated drainage sheet all sizes(details in rc) rc not exists 885 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 886 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 887 sterilized umbilical cotton tape width 3 mm, length 75 cm(details in rc) each piece 888 bone wax sterilised 2.5 gram/packet 889 temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm rc not exists 890 skin graft knife blade (sterile)(details in rc) one pack each 891 k wire, length 375 mm; 1mm(details in rc) rc not exists 892 k wire, length 375 mm; 1.6mm(details in rc) rc not exists 893 k wire, length 375 mm; 1.8mm(details in rc) rc not exists 894 face mask, disposable(details in rc) piece 895 surgical cap disposable (for surgeons)(details in rc) piece 896 surgical cap, disposable (for nurses) (details in rc)(details in rc) piece 897 foldable intra ocular lense with injector (details in rc) 11 to 17.5 each piece 898 foldable intra ocular lense with injector (details in rc) 18 to 24 each piece 899 foldable intra ocular lense with injector (details in rc) 24.5 to 28.5 each piece 900 standard pama intra ocular lenses (details in rc) 11 to 17.5 each piece 901 standard pama intra ocular lenses (details in rc) 18 to 24 each piece 902 standard pama intra ocular lenses (details in rc) 24.5 to 28.5 each piece 903 disposable sterile surgical rubber gloves size 8 inches,powdered pair 904 disposable sterile surgical rubber gloves size 8 inches,powder free pair 905 rubber examination gloves, non sterile, extra small(details in rc) dispenser box of100 gloves 906 rubber examination gloves,size small (details in rc) dispenser box of100 gloves 907 rubber examination gloves,size medium (details in rc) dispenser box of100 gloves 908 rubber examination gloves made of natural rubber latex, non sterile, size large (details in rc) dispenser box of100 gloves 909 pressure monitoring line / high pressure extension line (details in rc) each piece in blister pack 910 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml (details in rc) each piece 911 umbilical catheter for new born, all sizes (details in rc) each piece 912 umbilical cord clamp (details in rc) each piece 913 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property(details in rc) rc not exists 914 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 16 (details in rc) each piece 915 close wound drainage device under negative pressure (closed wound suction unit) size of bellow 800 ml, catheter size 18 (details in rc) each piece 916 t tube for common bile duct drainage, length 20x60 cm, size (details in rc) rc not exists 917 bone cement rc not exists 918 sanitary napkin beltless(details in rc) 6 napkin/pack 919 sanitary pads belt type(details in rc) 6 napkin/pack 920 sanitary napkin beltless with wings (details in rc) rc not exists 921 oxygen mask (adult) unit 922 oxygen mask (pediatric) unit 923 foleys catheter no. 14 (detail in rc) each piece 924 nelaton catheter size 14 fg(detail in rc) each piece 925 ecg electrode (detail in rc) each piece 926 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) each piece 927 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) each piece 928 urethral catheter 90 (fg 14) made up of medical grade pvc (detail in rc) each piece 929 urethral catheter 91 (fg 10), made up of medical grade pvc (detail in rc) each piece 930 vaccum suction set, 2.5 meter length (detail in rc) each piece 931 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile (detail in rc) each piece 932 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv) (detail in rc) rc not exists 933 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv) (detail in rc) each piece 934 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv) (detail in rc) each piece 935 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv) (detail in rc) each piece 936 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv) (detail in rc) rc not exists 937 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv) (detail in rc) rc not exists 938 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv) (detail in rc) rc not exists 939 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv) (detail in rc) rc not exists 940 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements (detail in rc) each piece 941 3 way stop cock with extension tube (vein o extension line) size 10cm (non pyrogenic & single use) (detail in rc) each piece 942 3 way stop cock with extension tube (vein o extension line) size 50cm (non pyrogenic & single use) (detail in rc) each piece 943 3 way stop cock with extension tube (vein o extension line) size 100cm (non pyrogenic & single use) (detail in rc) each piece 944 3 way stop cock with extension tube (vein o extension line) size 150cm (non pyrogenic & single use) (detail in rc) each piece 945 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) (detail in rc) each piece 946 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) (detail in rc) each piece 947 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) each piece 948 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property (detail in rc) each piece 949 sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g (detail in rc) rc not exists 950 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for ventilator without vent (detail in rc) each piece 951 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for ventilator without vent (detail in rc) each piece 952 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult large size for bipap with vent (detail in rc) each piece 953 niv mask (noninvasive ventilation mask) oro nasal covering (nose & mouth) mask adult medium size for bipap with vent (detail in rc) each piece 954 niv mask (noninvasive ventilation mask) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support (detail in rc) each piece 955 nebulization mask adult (detail in rc) each piece 956 nebulization mask paediatric (detail in rc) each piece 957 chemotherapy port and non coring needles(adult) (detail in rc) each piece 958 chemotherapy port & non coring needles(pediatric) (detail in rc) each piece 959 oseltamivir capsule ip 75 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg) strip/blister of 10 capsule 960 oseltamivir capsule ip 45 mg capsule(each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg) strip/blister of 10 capsule 961 oseltamivir capsule ip 30 mg (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg) rc not exists 962 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) rc not exists 963 oseltamivir phosphate for oral suspension ip 12 mg/ml (each ml contains 12 mg oseltamivir base after reconstitution) rc not exists 964 act kit containing 3 tablets of artesunate(25mg each) and 1 tablet of sulphadoxine and pyrimethamine(250mg+12.5mg) one combi blister pack 965 act kit containing 3 tablets of artesunate(50 mg each) and 1 tablet of sulphadoxine and pyrimethamine(500mg+25mg) one combi blister pack 966 act kit containing 3 tablets of artesunate(100 mg each) and 1 tablet of sulphadoxine and pyrimethamine(750mg+37.5mg) one combi blister pack 967 act kit containing 3 tablets of artesunate(150 mg each) and 2 tablet of sulphadoxine and pyrimethamine(500mg+25mg) one combi blister pack 968 each combi bliste pack: containing 3 tablets of artesunate(200 mg each) and 2 tablet of sulphadoxine pyrimethamine(750mg+37.5mg)each or 3 tablets of sulphadoxine pyrimethamine(500+25)mg one combi blister pack 969 liposomol amphotericine injection b 50mg vial group name (1) :: 38. swine flu drugs group name (1) :: 40 anti malerial drugs group name (1) :: 42 covid19 s.no. drug name packing size rate with gst other 1 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 40mm length 76 cm) size 1/0 [r5] 1*12 2 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 30mm length 90 cm [r10] 1*12 3 absorbable surgical suture (synthetic) sterilised needled (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 2/0 1/2 cir rb needle 40mm l 90cm [r16] 1*12 4 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet size 1/0(1/2 circle rb 30mm needle,length 70cm) [r67] 1*12 5 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle size 1/0 30mm length 90 cm [r11] 1*12 6 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 3/0 1/2cir rb needle 20mm length 70 cm [r9] 1*12 7 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1 1/2 cir rb needle40mm length 90 cm [r13] 1*12 8 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 1/0(1/2 cir rb needle 40mm length 90 cm) [r17] 1*12 9 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone /polyglyconate size 3/0 (3/8 circle cutting 25mm needle, suture length of 70cm) [r64] 1*12 10 acenocoumarol tab ip/ nicoumalone tab ip 2 mg [163] 1*10 11 acetylcystine solution usp (injection) 200 mg/ml [500] each amp 12 adenosine injection ip 6 mg/2ml [547] each amp 13 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit [525] each amp 14 amiodarone hydrochloride inj 50 mg/ml [183] each amp 15 amiodarone tab ip 200 mg [182] 1*10 16 atracurium inj 10 mg/ml [311] each amp 17 azathioprine tab ip 50 mg [133] 1*10 18 b.b silk suture (3/8 cir rb needle 20mm, length 76 cm size 4/0 (details in rc) [r78] 1*12 19 baclofen tablet ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) [698] 1*10 20 betahistine tab ip 16 mg [542] 1*10 21 betahistine tab ip 8 mg [541] 1*10 22 bone wax sterilised [s80] 1*12 23 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg [2] each amp 24 bupivacaine inj ip 0.5% [4] each vial 25 cabergoline tablet ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) [773] 1*10 26 carvedilol tablet 3.125 mg [755] 1*10 27 cefoperazone and sulbactum for inj (cefoperazone sodium eq.to cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm)(im/iv use) [86] each vial 28 ceftazidime inj ip 250 mg [90] each vial 29 ceftazidime inj ip 500 mg [91] each vial 30 ceftazidime inj ip 1g [89] each vial 31 chromic catgut suture(3/8 cir cutting needle 8 mm, suture length 35 cm) size 6/0 (details in rc) [r77] 1*12 32 chromic catgut suture(3/8 cir r cutting needle 19 mm needle, suture length 76 cm) size 4/0 (details in rc) [r80] 1*12 33 chromic catgut suture(3/8 cir rcutting needle 16 mm, suture length 76 cm) size 5/0 (details in rc) [r76] 1*12 34 clomifene tab ip 25 mg [282] 1*10 35 clomiphene tab ip 50 mg [283] 1*10 36 dexamethasone tablet ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) [700] 1*10 37 divalproex extended release tablet ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) [702] 1*10 38 dutasteride tablet 0.5 mg [787] 1*10 39 enoxaparin sodium inj ip 60 mg [172] each amp 40 escitalopram tab ip 10 mg [351] 1*10 41 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size [770] per piece 42 fentanyl citrate injection 50mcg/ml [655] each amp 43 gabapentine tablet/capsule 300mg [668] 1*10 44 glycopyrrolate inj ip 0.2 mg/ml [312] each amp 45 insulin glargine 10 ml vial (100 iu/ml) with 30 insuline syringes with needle [693] each vial 46 insulin glargine 3ml (100iu/ml) with 15 insulin syringes and needles/cartridge 3ml (100iu/ml) with 15 needles and 1 pen per 20 cartridges [680] each vial mndy drugs category change anexture b 47 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg [160] 1*10 48 lorazepam inj ip 2 mg/ml [359] each amp 49 lorazepam tablet ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) [778] 1*10 50 methotrexate inj ip 50 mg/2 ml [153] each amp 51 midazolam inj ip 1 mg/ml [313] each amp 52 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube (detail in rc) [s126] per piece 53 nebulization mask adult (detail in rc) [s134] per piece 54 nebulization mask paediatric (detail in rc) [s135] per piece 55 non absorbable surgical suture, sterilised needled black braided silk size 2/0(3/8cir reverse cutting needle 45mm, length 76 cm) [r22] 1*12 56 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 (1/2 cir rb heavy 40mm, length 90 cm) [r45] 1*12 57 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1/0(1/2 cir rb needle 30mm length 90 cm) [r33] 1*12 58 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon) size 8/0 (3/8 cir micropoint round body ,6mm length 38 cm) [r23] 1*12 59 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 1/0 (3/8 cir r cutting needle 45mm length 70 cm.) [r28] 1*12 60 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 2/0 (3/8 cir r cutting needle 45mm length 70 cm.) [r27] 1*12 61 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size [711] per piece 62 oitment mupirocin ip 2% [762] per piece 63 oxcarbazepine tablet ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) [703] 1*10 64 post expousure prophylaxis drugs for hiv drug combination: tenofivir 300mg+ lamivudin 300mg+ efavirenz 600mg [ne11] 1*10 65 prazosin tablets (extended release) 2.5 mg [555] 1*10 66 pyridoxine tablet ip 40mg [627] 1*10 67 rh erythropoetin inj ip 2000iu [177] each amp 68 ringer acetate infusion 500 ml [781] each piece 69 sodium bicarbonate tablet usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) [784] 1*10 70 sodium chloride 0.45% w/v polypack 500 ml [782] each piece 71 sterile hypodermic syringe with needle attached, 22g, single use 50 ml (detail in rc) [s106] each piece 72 streptokinase injection 15 lac units ip [209] each vial 73 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 (detail in rc) [s105] 1*100 74 terbinafine cream 1%w/w (10 gm tube) [760] each piece 75 terbinafine hydrochloride tablet 250 mg [721] 1*10 76 tizanidine hydrochloride tablet ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) [699] 1*10 77 tranexamic acid injection ip 100mg/ml 5ml size [747] each amp 78 urokinase injection 5 lac unit (lyophilized) [557] each vial 79 vancomycin for intravenous infusion ip 500 mg [523] each vial 80 zolpidem tablet 5 mg [779] 1*10 81 topiramate tablet ip 25 mg (each film coated tablet contains topiramate ip 25 mg )[705] 1*10 82 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0 3/8 circle cutting needle 22mm length 45 cm [r18] 1*12 83 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 4/0 3/8 circle cutting 16mm needle,suture length 70cm [r19] 1*12 84 b.b silk suture (3/8 cir rb needle 16mm, length 76 cm size 5/0 (details in rc) [r79] 1*12 85 betaxolol eye drops 0.5 o/o [612] each piece 86 clonidine hydrochloride tablet ip 0.1 mg (each tablet contains clonidine hydrochloride ip 0.1 mg) [751] 1*10 87 finasteride tablets ip 5 mg [575] 1*10 88 isoprenaline injection ip 2mg / ml [551] 89 leflunomide tablets ip 10mg(film coated) [600] 1*10 90 leflunomide tablets ip/usp 20mg (film coated) [601] 1*10 91 rosuvastatin tablet 10 mg [757] 1*10 92 sacubitril 24 mg and valsartan 26 mg tablet [758] 93 absorbable surgical suture (synthetic) sterilised needled(braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)size 4/0 (1/2 cir rb needle 20mm length 70 cm) [r15] 1*12 94 absorbable surgical suture (synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 1 1/2 cir tapercut needle (heavy) 40mm length 90 cm [r12] 1*12 95 absorbable surgical suture(synthetic)sterilised needled(braided)coated polyglactin/polyglycolic acid/poly(glycolide co l lactide)size 3/0(1/2 cir conventional 25mm length 90 cm)undyed [r14] 1*12 96 cefepime injection ip 500 mg [510] each vial 97 ceftriaxone 1 gm + tazobactum 125 mg injection [708] each vial 98 esmolol hydrochloride injection 10mg/ml 10ml size [753] each vial 99 linezolid inj 200mg/100ml [517] each bottal 100 linezolid tablets ip 600 mg [516] 1*10 101 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2/0 (1/2 cir rb needle 30mm, length 90 cm) [r38] 1*12 102 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3/0 (1/2 cir rb needle 25mm, length 90 cm) double arm [r37] 1*12 103 non absorbable surgical suture, sterilised needled polyamide monofilament black (nylon)size 3/0 (3/8 conventional cutting needle 16mm length 70 cm) [r24] 1*12 104 normal human intravenous immunoglobulin 5g/100ml [633] each bottal 105 rh erythropoetin inj 10000 iu [176] each vial 106 rh erythropoetin inj 4000 iu [179] each vial 107 rosuvastatin tablet ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) [756] 1*10 108 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg [602] 1*10 109 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 1 1/2 circle reverse cutting,os 40mm, suture length 90 cm [r71] 1*12 110 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 2/0 1/2 circle round bodied 30mm, suture length 90 cm [r70] 1*12 111 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)size 1/0 1/2 circle reverse cutting 36mm, os needle, suture length 90 cm [r72] 1*12 112 absorbable surgical suture (synthetic)antibacterial with sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)size 3/0 3/8 circle r cutting, ps 1,24mm, suture length 70 cm [r74] 1*12 113 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 1/0 [r4] 1*12 114 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 1*12 115 absorbable surgical suture (sterile catgut) bp/usp needled suture chromic(1/2 cir rb needle 30 mm length 76 cm) size 2/0 [r3] 1*12 116 absorbable surgical suture (synthetic) antibacterial with sterilised needled suture(braided coated polyglactin/polyglycolic acid violet)size 3/0 1/2 circle round bodied 20mm, suture length 70 cm [r73] 1*12 117 absorbable surgical suture(synthetic)antibacterial coated sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm [r68] 1*12 118 absorbable surgical suture(synthetic)antibacterial with sterilised needled(braided coated polyglactin/polyglycolic acid violet)size 1/0 1/2 circle ct round bodied 40mm,gs needle,suture length 90 cm [r69] 1*12 119 acebrophylline tablet/capsule 100 mg 1*10 120 acetazolamide tab ip 250mg [253] 1*10 121 acyclovir oral suspension ip 400mg/5ml [62] 1*10 122 acyclovir tab ip 200 mg 1*10 123 alkylizer syrup 1.4 gm/5 ml( 100 ml )(disodium hydrogen citrate) [788] each bottal 124 allopurinol tablets ip 100 mg [598] 1*10 125 amikacin inj ip 100 mg [67] 1*10 126 amikacin inj ip 250 mg [504] 1*10 127 amlodipine and enalapril maleate tablets (amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg) [457] 1*10 128 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril (anhydrous) 5 mg [460] 1*10 129 atropine eye ointment ip 1% [319] each piece 130 betamethasone lotion ip 0.05 o/o [559] each bottal 131 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% [487] each piece 132 calcitriol capsules ip 0.25 mcg [630] 1*10 133 carbamazepine oral suspension usp 100 mg/5ml [474] 134 carbamazepine tab ip 200 mg [53] 1*10 135 carbimazole tabs ip 5 mg (film coated) [280] 1*10 136 cefadroxil dispersible tablet 250 mg(each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg) [709] 1*10 137 cefadroxil tablet 500 mg [710] 1*10 138 cefixime oral suspension ip 25mg/ml (paediatric drops) [511] 139 cefixime tab ip 100 mg [84] 1*10 140 cefixime tab ip 200 mg [85] 1*10 141 chlordiazepoxide tablets ip 10mg [342] 1*10 142 chlorhexidine mouthwash ip 0.2 o/o [580] each bottal 143 chlorpromazine tablets ip 100 mg (coated tablet) [343] 1*10 144 cholecalciferol granules 60,000 iu /gm [623] 145 clonazepam tablet 0.5 mg [678] 1*10 146 clotrimazole 1 o/o with beclomethasone dipropionate 0.025 o/o ear drops [586] each piece 147 clotrimazole mouth paint (clotrimazole 1 o/o w/v) [443] each piece 148 cloxacillin sodium inj ip 500mg [417] each vial 149 coal tar 6% & salicylic acid 3% ointment [670] each piece 150 dental gel choline salicylate 8.7 o/o, benzalkonium chloride 0.01 o/o, lignocaine hcl 2 o/o (flavoured gel base) [581] each piece 151 diclofenac sodium aqueous injection 75mg/ml 1ml size, iv & im use [695] each amp 152 digoxin inj ip 0.25 mg/ml [189] each amp 153 digoxin tab ip 0.25 mg. [190] 1*10 154 flavoxate tablets ip 200 mg (coated tablet) [579] 1*10 155 fluconazole eye drops 0.3% [425] 156 fluoxetine cap ip 20 mg [352] 1*10 157 flurbiprofen sodium ophthalmic solution ip 0.03 o/o w/v [421] each piece 158 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg [616] per piece 159 gabapentine tablet/capsule 100mg [667] 1*10 160 glibenclamide and metformin hydrochloride (sr) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg (sustained release) [453] 1*10 161 glipizide and metformin hydrochloride tablets usp (glipizide 5 mg, metformin hydrochloride 500 mg) [452] 1*10 162 hydrochlorthiazide tab ip 25mg [464] 1*10 163 hydroxychloroquine sulphate tablets 200mg [599] 1*10 164 hyoscine butyl bromide tablets ip 10mg [414] 1*10 165 ipratropium bromide nebulizer solution 250 mcg/ ml [369] each piece 166 ipratropium powder for inhalation ip 40 mcg [618] each piece 167 ivermectin 12 mg [ne41] 1*10 168 ketamine inj ip 50 mg/ml [8] each vial 169 levetiracetam tablet ip 500 mg [664] 1*10 170 levodopa and carbidopa tab 250 mg+ 25 mg [161] 1*10 171 levofloxacin tablets ip 250 mg [515] 1*10 172 lidocaine hcl topical solution usp 4% [424] each bottal 173 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg [10] each amp 174 lisinopril tab ip 2.5 mg [466] 1*10 175 lisinopril tab ip 5 mg [199] 1*10 176 lisinopril tablets ip 10 mg [465] 1*10 177 losartan potassium and amlodipine tablets ip (losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg) [458] 1*10 178 mannitol inj ip 20% w/v [257a] each bottal 179 mecobalamin inj 500 mcg/ml [624] each amp 180 methyl prednisolone sodium succinate for injection usp 500 mg [44] each vial 181 metronidazole 1% and chlorhexidine gluconade 0.25% gel [584] each piece 182 multi vitamin syrup [790] each bottal 183 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp [588] each piece 184 paracetamol infusion ip 1% w/v 100ml size [696] each bottal 185 phenytoin oral suspension ip 25mg/ml [58] each bottal 186 pioglitazone tab ip 15 mg [297] 1*10 187 plaster of paris bandage 10cm x 2.7mts [s22] each piece 188 potassium chloride inj. 0.15 gm/ml [383] each amp 189 potassium chloride oral solution u.s.p 500mg/ 5ml [384] each bottal 190 powder clotrimazole 1% w/w 30 gm [759] each piece 191 prednisolone tab ip 20 mg [470] 1*10 192 pregabalin cap ip 75 mg [634] 1*10 193 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) [765] each piece 194 progesterone inj 200 mg/ 2ml [298] each amp 195 pyridoxine tablet ip 10 mg [626] 1*10 196 ramipril tablets ip 2.5 m