Jawaharlal Nehru Medical College - Rajasthan

34135658 pathology lab items pathology lab items , list of pathology lab items reagents / kits / chemical / glassware / polyware etc year 2022 24 , acetic acid glacial sq 99 100% 2.5 ltr. , acetone ar 2.5 ltr. , acid fuschin 25gm , aluminium chloride sq anhydrous 500gm , aluminium potassium sulphate ( postassium alum ) ar 500gm , albuno meter , alcian blue 8 gs , ammonia solution lr 500ml , ammonium bromide 100gm , ammonium oxalate 500gm , aniline blue ( water soluble ) 25gm , anti sera a , anti sera b , anti sera d , azure ii 100 gm , atrx antibody , basic fuschin 25gm , biebrick scarlet 25 gm , blood / serum sample tube , borex ar 500gm , boric acid 500gm , brilliant cresyl blue 25gm , chromogranin antibody , calcium chloride lr 500gm , carbol fuchsin conc. stain solution 200ml , carbol fuchsin ( zn strong ) 500ml , carmine ar 25gm , cd 3 antibody , cd 5 antibody , cd 10 antibody , cd 20 antibody , cd 23 antibody , cd 30 antibody , cd 45 antibody , charcoal ar 200gm , chlorauric acid ( gold chloride ) , chromium trioxide ( chromic acid, ) , chromotrope ar 25 gm , citric acid ar 500gm , sta c.k. prest , ck 7 antibody , ck 20 antibody , ck 5 / 6 antibody , calretinin antibody , coag control , congo red ar 100gm , coombs serum ( ahg ) polyclonal 5ml , cover glass , crystal violet 25gm , crystal violet 100gm , d.m. water 5ltr , dab background sniper mach 2 hrp polymer combo , deionised water ( triple deionised ) , deka phan ( 100 strips ) , urine control urinorm , desmin antibody , diluent for dna extraction , diva decloakerm 20x , dpx mountant 250ml , disposable esr pipette , ema antibody , er antibodies , esr pipette ( glass ) ( marrienfield made in germany ) , esr pipette glass , ethanol , eosin yellow ( water soluble ) , erba h3 contri level , ferric ammonium sulphate , filter paper sheet , filter card for cytospin , formaldehyde solution 37 41% w / v ar 5 ltr. , funnel filtering for glass , gentian violet ar 25gm , giemsa.s staining powder 25 gm , glass beaker various sizes , glass slide 1.35 mm , glass slides , glass test tube 100 x 12 mm , glass test tube 75 x 12 mm , glycerol ( glycerine ) ar 500ml , gfap antibody , haemeto critcapillary , haemotoxylin crystal 25gm , hand sanitizer , hmb 45 antibody , hep par 1 antibody , her 2 antibodies ( creb 2 ) , hplc variants ii test kit ar 500 test , hplc lyphocheck a2 control 0.5 ml x 4 , hydrochloric acid ( conc ) 2.5ltr. , hydrogen peroxide ( 3% ) 500ml , hydrogen peroxide solution 30% w / v ( 100 volumes ) lr 500ml , hydroquinone ar 5 gm , hypochlorite solution , idh1 antibody , iodine crystal ar 100gm , isopropyl alcohol 2.5 ltr. , jet cassettes with lid disposable , k3 edta tube vacutainer , 3.2% sodium ctrate vacutainer , ki67 antibody , lancet , leishman stain liquid , light green, sf yellowish , liquid parafin , lithium carbonate , lysercell wnr ( 5 ltr. ) , flourocell wnr , sulfolyser 5l , xn control l1 , xn control l2 , xn control l3 , xn cal , measuring cylinder 1000 ml , measuring cylinder 250 ml , measuring cylinder 500 ml , mercuric chloride 100gm , mercuric oxide ( yellow ) , methanol ar 2.5 ltr. , methyl blue 10 gm. , methyl orange 5 gm. , methyl violet 20 gm. , micro pipette 100?l , micro pipette 200?l , micro pipette 50?l , micropipette variable volume upto 1 ml , micropipette variable volume upto 200 micro ltr. , microscope bulb ( philips ) ( .6v / 20w ) , microscopic cover glass 22x 50 mm , mpo ( myeloperoxidease ) stain kit , museum mounting jar ( glass ) ( varioussize ) , multistix ( urine ) , nuclear fast red stain 5 gm , nuclear fast red ( kernechtrot ) , neubaur counting chamber ( marrien field made in germany ) , nitric acid ( 69 72% ) , napsin a antibody , oil red o ar 100gm , orcein synthetic 5gm , orinasys gk , orinasys gp , orange g6 , oxalic acid 500gm , pan ck antibody , periodic acid phenol ( carbolic acid ) , phosphotungstic acid ar 100gm , p63 antibody , phosphomolybdic acid , picric acid ar 500 gm , pipette tips blue vol . 1000 ?l , pipette tips yellow vol . 200 ?l , ph strips , polylysine coated slides , ponceau 2r 25 gm , potassium acetate , potassium bromide 100gm , potassium carbonate 10 gm , potassium carbonate 25 gm , potassium chloride 500 gm , potassium dichromate 500gm , potassium dihydrogen phosphate 500gm , potassium ferocyanide ar 500 gm , potassium hydroxide ( koh ) , potassium iodide ar 100 gm , potassium nitrate , potassium permanganate lr 100gm , procold coolent , propylene glycol , pr antibodies , pt kit , qualitative filter paper diameter mm size 460x570 sheets grade 1 , quinoline yellow 25gm , rapid pap stain , resorcinol , reticulocyte count stain 25 ml , reti culocyte counting reagent , sodium acetate , sodium bicarbonate , sodium nitrate lr 25 gm , sodium bisulfite 500gm , sma antibody , sodium barbiturate 500gm , sodium chloride lr 500gm , sodium citrate 500gm , sodium hydroxide pellets , sodium hypochlorite 4% 2.5 ltr. , sodium hypochlorite solution ( 4% naclo 74.4 ) , sodium metabisulfite ar 500 gm , sodium phosphate monobasic 500gm , sodium black b 100gm , sodium thiosulphate 500gm , sta balls , sta cacl 2 , sta c.k prest , sta neoplastin cl+10 , sta cuvette , stago coagulation control. ( n+p ) , sta neophnal , sta cleaner solution , sta cuvettes 1000 , sta coag control n+p vial , stago coagulation control , sulfolyser 5 ltr. , sulphuric acid , sysmex cell pack dcl , sysmex sulfolyser , sysmex stromatolyser 4dl , sysmex stromatolyser 4ds 42 ml x 3 , s100 antibody , synaptophysin antibody , tartazine 5 gm , tbs 40x buffer , test tube l x b=12x100 mm , thermal paper roll 47 x55mm x 30 mts. , tissue paper roll , thionine , toluidine blue o , torniquete , transponder ( esr ) , trichloroacetic acid 100gm , 500ml ready made , tri sodium citrate dihydrate 500gm , ttf1antibody , tdt antibody , universal card alifex , latex control , urine container , urine control urinorm , vimentine antibody , writing pen for thermograph temperature recording , xylene , xylene ( sulphur ) free ar , xn check l1 , xn check l2 , xn check l3 , xn cal , zinc sulphate , tbs auto wash buffer 40 x 250 ml , mach 2 univ hrp polymer with dab & background sniper , diva decloakerm 20x 250 ml , er monoclonal ( clonal sp1 ) , pr monoclonal ( clonal sp2 ) , creb b 2 , hydrophobic pap pen , orinasys gp , micro pipette 1000 ?l , sta neoplastin 12x10x5 ml , phloxine b 25 gm , sulphuric acid 500 ml , tbs solution 40x biocare 250 ml , transponder , paraffin wax with ceresin 2 kg , periodic acid 100 gm , phenol 500gm , sta cephascreen , sta cacl 2 , sta liquid fib , sta dwren koller , sta liatest fdp , sta fdp control , sta fdp calibrator , sta desorb u , 3.2 % sodium citrate vial ( vacutainer ) , field stain i 500 ml , field stain ii 500 ml , glass marking pen...

District Hospital - Rajasthan

34128768 supply of pathology lab items 1 p1 acetic acid glacial sq 99 100% 2.5 ltr. 2 p2 acetone ar 2.5 ltr. 3 p3 acid fuschin 25gm 4 p4 aluminium chloride sq anhydrous 500gm 5 p5 aluminium potassium sulphate ( postassium alum ) ar 500gm 6 p6 albuno meter 7 p7 alcian blue 8 gs 8 p8 ammonia solution lr 500m1 9 p9 ammonium bromide 100gm 10 p10 ammonium oxalate 500gm 11 p11 aniline blue ( water soluble ) 25gm 12 p12 anti sera a 13 p13 anti sera b 14 p14 anti sera d 15 p15 azure 11100 gm 16 p16 atrx antibody 17 p17 basic fuschin 25gm 18 p18 biebrick scarlet 25 gm 19 p19 blood / serum sample tube 20 p20 borex ar 500gm 21 p21 boric acid 500gm 22 p22 brilliant cresyl blue 25gm 23 p23 chromogranin antibody 24 p24 calcium chloride lr 500gm 25 p25 carbol fuchsin conc. stain solution 200m1 26 p26 carbol fuchsin ( zn strong ) 500m1 27 p27 carmine ar 25gm 28 p28 cd 3 antibody 29 p29 cd 5 antibody 30 p30 cd 10 antibody 31 p31 cd 20 antibody 32 p32 cd 23 antibody 33 p33 cd 30 antibody 34 p34 cd 45 antibody 35 p35 charcoal ar 200gm 36 p36 chlorauric acid ( gold chloride ) 37 p37 chromium trioxide ( chromic acid, ) 38 p38 chromotrope ar 25 gm 39 p39 citric acid ar 500gm 40 p40 sta c.k. prest 41 p41 ck 7 antibody 42 p42 ck 20 antibody 43 p43 ck 5 / 6 antibody 44 p44 calretinin antibody 45 p45 coag control 46 p46 congo red ar 100gm 47 p47 coombs serum ( ahg ) polyclonal sml 48 p48 cover glass 49 p49 crystal violet 25gm 50 p50 crystal violet 100gm 51 p51 d.m. water 5ltr 52 p52 dab background sniper mach 2 hrp polymer combo 53 p53 deionised water ( triple deionised ) 54 p54 deka phan ( 100 strips ) 55 p55 urine control urinorm 56 p56 des min antibody 57 p57 diluent for dna extraction 58 p58 diva decloakerm 20x 59 p59 dpx mountant 250m1 60 p60 disposable esr pipette 61 p61 ema antibody 62 p62 er antibodies 63 p63 esr pipette ( glass ) ( marrienfield made in germany ) 64 p64 esr pipette glass 65 p65 ethanol 66 p66 eosin yellow ( water soluble ) 67 p67 erba h3 contri level 68 p68 ferric ammonium sulphate 69 p69 filter paper sheet 70 p70 filter card for cytospin 71 p71 formaldehyde solution 37 41% wilt ar 5 ltr. 72 p72 funnel filtering for glass 73 p73 gentian violet ar 25gm 74 p74 gietnsa.s staining powder 25 gm 75 p75 glass beaker various sizes 76 p76 glass slide 1.35 mm 77 p77 glass slides 78 p78 glass test tube 100 x 12 nun 79 p79 glass test tube 75 x 12 mm 80 , p80 glycerol ( glycerine ) ar 500m1 81 p81 gfap antibody 82 p82 haemeto critcapillary 83 p83 haemotoxylin crystal 25gm 84 p84 hand sanitizer 85 p85 hmb 45 antibody 86 p86 hep par 1 antibody 87 p87 her 2 antibodies ( creb 2 ) 88 p88 hplc variants ii test kit ar 500 test 89 p89 hplc lyphocheck a2 control 0.5 ml x 4 90 p90 hydrochloric acid ( conc ) 2.5ltr. 91 p91 hydrogen peroxide ( 3% ) 500m1 92 p92 hydrogen peroxide solution 30% w / v ( 100 volumes ) lit 500m1 93 p93 hydroquinone ar 5 gni 94 p94 hypochlorite solution 95 p95 idh1 antibody 96 p96 iodine crystal ar 100gm 97 p97 isopropyl alcohol 2.5 ltr. 98 p98 jet cassettes with lid disposable 99 p99 k3 edta tube vacutainer 100 p100 3.2% sodium cu ate vacutainer 101 p101 ki67 antibody 102 p102 lancet 103 p103 leishman stain liquid light green, sf yellowish 104 p104 105 p105 liquid parafin 106 p106 lithium carbonate 107 p107 lysercell wnr ( 5 hr. ) 108 p108 flourocell wnr 109 p109 sulfolyser 5l 110 p110 xn control l1 111 p111 xn control l2 112 p112 xn control l3 113 p113 xn cal 114 p114 measuring cylinder 1000 ml 115 p115 measuring cylinder 250 ml 116 p116 measuring cylinder 500 ml 117 p117 mercuric chloride 100gm 118 p118 mercuric oxide ( yellow ) 119 p119 methanol ar 2.5 ltr. 120 p120 methyl blue 10 gm. 121 p121 methyl orange 5 gm. 122 p122 methyl violet 20 gin. 123 p123 micro pipette 100p1 124 p124 micro pipette zoori 125 p125 micro pipette 50111 126 p126 micropipette variable volume _ipi to 1 ml micropipette variable volume upto 200 micro ur. 127 p127 128 p128 microscope bulb ( philips ) ( .6v / 20w ) 129 p129 microscopic cover glass 22x 50 mm 130 p130 mpo ( myeloperoxidease ) stain kit 131 p131 museum mounting jar ( glass ) ( various size ) 132 p132 multistix ( urine ) 1.33 p133 nuclear fast red stain 5 gm 134 p134 nuclear fast red ( kernechtrot ) 135 p135 neubaur counting chamber ( marrien field made in germany ) 136 p136 nitric acid ( 69.72% ) 137 p137 napsin a antibody 138 p138 oil red 0 ar 100gm 139 p139 orcein synthetic 5gm 140 p140 orinasys gk 141 p141 orinasys gp 142 p142 orange g6 143 p143 oxalic acid 500gm 144 p144 pan ck antibody 145 p145 periodic acld phenol ( carbolic acid ) 146 p146 phosphotungstic acid ar 100gm 147 p147 p63 antibody 148 p148 phosphomolybdic acid 149 p149 picric acid ar 500 gm 150 p150 pipette tips blue vol . 1000 tl 151 p151 pipette tips yellow vol .200 pl 152 p152 ph strips 153 p153 polylysine coated slides 154 p154 ponceau 2r 25 gm 155 p155 potassium acetate 156 p156 potassium bromide 100gm 157 p157 potassium carbonate 10 gin 158 p158 potassium carbonate 25 gm 159 p159 potassium chloride 500 gm 160 p160 potassium dichromate 500gm 161 p161 potassium dihydrogen phosphate 500gm 162 p162 potassium ferocyanide ar 500 gin 163 p163 potassium hydroxide ( koh ) 164 p164 potassium iodide ar 100 gm 165 p165 potassium nitrate 166 p166 potassium permanganate liz 100gm 167 p167 procold coolent 168 p168 propylene glycol 169 p169 pr antibodies 170 p170 pt kit 171 p171 qualitative filter paper diameter mm size 460x570...

Medical And Health Services - Rajasthan

34058742 supply of lab regents and x ray green senstive, x ray developer, x ray fixer and hardener, 1 micros es 60 ) abx minidil lmg. ( diulent ) 2oltr. ( for haematology analyser hori 2 abx cleaner 01 ltr. ( for haematology analyser horiba micros es 60 ) 3 abx lyse bic ) 01 ltr. ( for haematology analyser horiba micros e5 60 4 minoclair ( for haematology analyser horiba micros es 60 ) 500 ml 5 thermal paper roll for cell counter. ( horiba micros es 60 ) 6 others hiv rapid test card ( maxline / jmitra / merril ) 7 vdrl rapid card ( maxline / jmitra / merril ) 8 anti abd set 10 ml ( tulip / arkray / span ) 9 micro tips blue ( big size ) 10 micro tips white / yellow ( small size ) micro pipete ( 100 ul to 1000 ul ) micro pipete ( 10 ul to 100 ul ) distilled water ( deionsed water ) 5 ltr. widal test ( slide method ) 5 ml ( tulip / span / arkray ) 15 sodium citrate 3.8% 560 ml ( nice / merck ) 16 n / 10 hcl 500 ml ( nice / merck ) 17 urine pregnancy card ( transasiya / ds / maxline / merril ) 18 urine strip ( albumin♦ sugar ) ( precision / sd / siemens ) , 19 urine multistrip ( alb . / sugar / ph / sg aceton e / bilesalt / bile pigment / ketone ) ( precision / sd / siemens ) 20 malaria rapid antigen test ( jmitra / ozone / 5d ) 21 j.5.8 stain i for malaria 500 ml ( witro / rankem ) 22 i j.s.b stain ii for malaria 500 ml ( witro / rankemy 23 cover sup 24 test tube glass 12x75 ( borossil ) 25 esr tube ( disposable ) 26 hb pipet ( gla55 ) ( borossil ) 27 hb tube round ( glass ) ( borossil ) 28 sample collection vial plane 29 sample collection vial with cover k3 ( edta ) 30 i glass slide 31 filter paper 32 sticker for sample vial 33 dispo needle 24n0 ( dispovan ) 4 dispo syringe 2 ml ( dispovan ) 35 dispo syringe 5 ml ( dispovan ) 36 capillary tube ( glass ) 37 tourniquet 38 dengue rapid antigen test / serology ( j mitra / sd / ozone ) 39 chikungunia ( igm / igg ) rapid card ( j mitra / sd / ozone ) 40 i sodium hypochloride 05 itr 41 spirit 500m1 42 dispo urine container 43 labowash for glass test tube cleaning 44 tissue roll 45 blood glucose strip ( glucospark / morpen 46 cotton 500 gm 47 immersion oil 48 dropping bottle for hb 49 wash bottle 500 ml size 50 fib meter ( sahli s method ) 51 test tube rack ( plastic / aluminium ) 52 slide staining rack ( aluminium ) 53 forcep ( iron / plastic ) steel tray 55 test tube brush ( small ) 56 glass beaker ( 100ml / 200m1 ) 57 syringe / needle destroyer machine 58 gloves 7.5 size ( sterile ) face mask ( disposable ) . 60 ecg roll 61 ecg jelly 62 slide stand lencet ( glucometer ) 63 66 alkaline phosphatese kit mini ( 4*35+2*18 ) 67 alanine aminotrans ferase kit ( 4*35+2*18 ) 68 bilirubine direct kit ( 4*20+2*20 ) 69 bilirubine total kit ( 4*20+2*20 ) 70 crea s ( 2*35ml+1*18ml ) 71 glucose kit ( 4*40+2*20 ) 72 hdl chlostrole ( 1*40+1*14 ) 73 ldl chlostrole ( 1*40+1*14 ) 74 total chlostrole ( 4*40 ) 76 triglycerides kit ( 4*40 ) 76 total protein kit ( 4*46 ) 77 albumin kit ( 4*40 ) 78 urea kit ( 4*20+2*20 ) 79 aspratate aminotranfersae ( 4*35+2*18 ) 80 controls normal ( randox / spinreact ) 81 controls low ( randox / spinreact ) 82 controls high ( randox / spinreact ) . 83 calibrators ( randox / spinreact ) 85 diatro diulent ( 20 litre ) diatron 86 diatro cleaner ( 1 litre ) diatron 87 diatro ly5e ( 1 litre ) diatron...

Medical And Health Services - Rajasthan

33926279 supply of lab regents and x ray 1 preg. card ( mankind ) 2 multi uristix ( mission ) 3 blood group reagent ( tulip ) 4 esr tube disposable 5 sample vial with clotapplicator 6 k 3 vial ( double cap ) 7 sugar kit ( equacheck / dibascan ) 8 widal test kit ( becon / span ) / arkray 9 glass slide 10 cover sleep 11 urea test kit ( erba ) ( 5x20m1 ) 12 erba sgot test kit ( erba ) ( 5x20m1 ) 13 erba sgpt test kit ( erba ) ( 5x20m1 ) 14 sarum alkaline phosphatase test kit ( erba ) ( 10ax2.2m1 ) 15 lancet 16 bilrubin test kit erba ( direct & total ) 17 creatinine test kit ( erba ) 18 cholesterol test kit ( erba ) 19 vdrl test kit ( sd ) 20 hbsag test kit / card ( sd ) 21 analyzer. cleaner solution ( erba ) 22 hdl cholesterol direct mahtod ( erba ) 23 tri glicride test kit ( erba ) 24 mp card ( sd ) antigen 25 dengue card ( j mitra ) 26 total protien ( erba ) 27 utistix a / s 28 gluco strip ( accu check ) / one touch 29 hb pipette 30 leishman stain ( tanbaxy ) 31 rbc diluting fluid 500m1 32 wbc diluting fluid 500m1 33 auto pipette tips 100 to 1000u1 blue 34 auto pipette tips ( 1 to 100u1 ) yellow 35 sodium citrate 500m1 36 n / 10 hcl 500m1, 37 i xyiene 500m1 38 urine container 39 sprit ( 5ltr. ) 40 test tube without cat ( riavial ) 41 touriquet 42 distilled water ( 5ltr. ) 43 jsb 1st 44 jsb 2nd 45 capillary tube •• 46 hemoglobin strip ( hemocue ) 47 hb scale strip ( hemocheck ) 48 analyzer printer roll 49 fillter paper _... 50 serum allvumin kit ( erba ) 51 marker pencil 52 parmanent marker 53 liqued hand wash ( 5ltr. can ) 54 abxlyse bio ( 1 ltr. ) ( horriba ) 55 abxcleaner ( 1 ltr. ) ( horriba ) 56 minoclair ( 0.5 ltr. ) ( horriba ) 57 minidil lmg ( 20 ltr. ) 58 albumin kit ( erba ) 59 vldl kit ( erba ) 60 hydro chloric acid solution 61 cader wood oil 62 facemask ( n 95 ) 63 sharp container 64 glassware container 65 glass beaker ( 1000m1 / 200m1 ) ....

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical And Health Services - Rajasthan

33872013 supply of rmrs chc sawa lab and xray reagent and equipment 1 ecg gelly 2 s. alkaline phosphatase kit 3 s.glucose reagent 4 total protine reagent 5 s. albumin reagent 6 tlc fluid 7 abo rh kit 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastik knob 11 urine suger / alubmine 12 urine preg. test stripe 13 hiv rapid test kit 14 h c l n / 10 500m1 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol 20 s. hdl 21 s. triglyceride 22 serum creatnine 23 serum bilirubin t, d 24 sgot 25 sgpt 26 vdrl rapid test kit en urine complete by strip , 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6108t ) 38 ecg pper roll ( cardiofax ce1023 ) esr pipet 150mm 39 40 sugar strip ( glucose ) test tube glass 41 42 test tube glass 43 glass beaker 44 test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) 47 cbc roll paper 48 phenyl for hospital use 49 fibsag rapid card 50 cottan roll 51 torniqut 52 x ray film ( digital ) 10*12 53 x ray film ( digital ) 8 10 54 esr test cap 55 crp kit quantitative 56 glass slide 57 blood clot activater vail 58 blood lancet steel 59 abx cleaner 60 abx lysebio 61 abx minidil 62 abx minocular 63 capillary tube 64 cover slip ( micro scop cover glass 22mm 65 micro pipette ( 10 100u1 ) micro tips 66 micro pipette ( 10 1000ui ) micro tips , 67 tips stand 68 test tube plastic 69 sahils hemoglobin meter 70 urine container 71 pera film 72 weight machine baby 73 weight machine baby digital 74 weight machine adult 75 b.p instrument digital 76 b.p. instrument mercury 77 ecg roll 50*20 78 stetho scope 79 glucometer with 25 strip 80 cotton roll 81 micro pipete 82 micro pipete 83 micro pipete 84 blue tips 85 yellow tips....

Medical Health And Family Welfare - Rajasthan

33724703 supply of mnjy_labrejants_pmosuj mnjy_labrejants_pmosuj , blood sugar kit , blood sugar kit , blood sugar kit , blood urea kit , blood urea , blood urea kit kinetic , urea end point , s. creatnine r1 2*60 ml , r2 2*60 ml , s. creatnine r1 2*50 ml , s. creatnine , s. bilirubine (t) , s. bilirubin d & t , s. bilirubine (t) , s. bilirubine t&d r1 2*60 ml ,r2 2*60 ml , s. bilirubine t&d , sgot , sgot , sgot , sgpt , sgpt , sgpt , s. alk. phosphate , s. alk. phosphate , s. alk. phosphate , total protein , total protein , total protein , s. albunum , s. albunum , s.albumin , s. calcium r1 1*50 ml, r2 1*50 ml , s. calcium , s.calcium , s. ck nac r1 2*8 ml, r2 2*2 ml , s. ck nac , ck mb , ck mb , s.ldh r1 4*8 ml, r2 1*8 ml , s. ldh , s.amylase , s. amylase , s.amylase , s. uric acid , s. uric acid , s. uricacid , s.uric acid , s. t. cholesterol , s.t. cholesterol , s.t. cholesterol , s. trigly ceride , s. trigly ceride , s. trigly ceride , s.hdl , dirrecthdl , s.hdl direct , s.hdl , ldl cholestrol , ldl cholestrol , csf dilution fluid , plueural dilution fluid , acetic dilution fluid , semen dilution fluid , urine strip for alb & sugar(uristix) , urine strip for sugar & ketone(ketodiastic) , multistrip10 para for accurex urine analyser ( express 10) , urine strip 4 para (alb,sugar,ph,sp. gravity) , pregnancy test card , sulphur powder , edta powder , nitric acid , glacial acetic acid , eosino dilution fluid , ligeul iodine for stool exam , anti abd set , anti d (igg & igm) , total rbc dilution fluid , field stain i , field stain ii , platelest dilution fluid , fouchest reagent , liesman stain , tissue paper roll , filter paper 0 no. , mp card(antigen) , dengue card antigen (day 1) ns1 iggigm , vdrl strip , jsb i stain , jsb ii stain , liquid parafine oil , crp kit , ra kit , aslo kit , widal , bovine album 22% , hiv tridols , esr tube glass , hb meter squer , hb meter round , hb tube round , hb pipate , distilled water , n/10 hcl , glass slide , riya vial , urine container with label (non sterilized 30 ml) , tips stand for yellowtips , tips stand blue tips , iron esr stand 6 tube capicity , throm bo span ls , test tube glass , test tube glass , measuring pipalte glasss 1ml , measuring pipalte glasss 2ml , measuring pipalte glasss 5ml , measuring pipalte glasss 10 ml , hbsag card , sodium citrate vial for pt test , mearing flask 250 ml , mearing flask 500 ml , mearing flasic 1 lit , glass funnel , glass beaker 50ml , glass beaker 100ml , tlc dilution fluid , 3.1% sodium citrat , for ceff steel , combs sera , cbc vial mixer , hb tube squar , syringe needle distoryed maschine , thermal paper 50mm*20 mtr , thermal paper 110mm*20 mtr , alluminiumtest tube stand 4*8 holl , new bar chamber , urine container with label(sterilized) 50 ml , cover glass , cover slip , bt ct capiliry tube , esrite esr stand , droper bottle plastic 60ml , wash bottle plastic 250ml , washbottel plastic 500 ml , blue tips , yello tips , slide box plastic (big size) , slide box plastic (smallsize) , kidney tray plastic , alluminumtest tube stand 3*8 holl , alluminum tast tube stand 3*4 holl , blood sugarstrip for glucometer , biochemistry reagent for rendox fully auto analyser , blood uria kit birthload method , gram stain , giemsa stain with fixative , sodium hypocloride solution 5% , hiv sd card , micro pipet veriable , micro pipet veriable , micro pipet veriable , stop watch , tunicate belt , disposable esr tube ( 1 to 200 mm.) , disposable serum vial , lense cleaning paper , dengu kit for alisa mathed ns1 , dengu kit for alisa mathed igg , dengu kit for alisa mathed igm , anti ab vial , centrifuse machine [ r 8cdx] , centrifuse machine , rotator machine , j.s.b. firststain , j.s.b.second stain , sterile disposable needle no 22 , sterile disposable needle no 23 , sterile disposable needle no 24 , sterile disposable needle no 26 , dispovan 5ml syringe , edta k3 non vccum blood collection tube 1 to 4 ml withtray paking , clot activator non vccum blood collection tube 1 to 4 mlwithtray paking , floride non vccum blood collection tube 1 to 4 ml withtray paking , citrate 3.2 % non vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % non vccum blood collection tube 1 to 4 mlwithtray paking , lithium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , gel non vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 5 to 6 mlwithtray paking , clot activator vccum blood collection tube 1 to 4 mlwithtray paking , clot activator vccum blood collection tube 5 to 6 mlwithtray paking , floride vccum blood collection tube 1 to 4 mlwithtray paking , floride vccum blood collection tube 5 to 6 mlwithtray paking , citrate 3.2 % vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % vccum blood collection tube 1 to 4 ml , gel vccum blood collection tube 1 to 4 mlwithtray paking , gel vccum blood collection tube 5 to 6 ml , lithium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , needle for vaccume tube , iron ball for prothombin test , cuvet for prothrombine test , dengue ns 1 elisa test , dengue igg elisa test , dengue igm elisa test , hbsag elisa test , hb test strip for hemocue hb 301 , cleaning solution , de ionised water , stool container , typhi dot rapid test , t3 for elisa reader , t4 for elisa reader , tsh for elisa reader , wash solution for elisa reader , typhoid test repid test kit , haem test for occult blood kit for stool , lancet for glucometer , methanol for fixative , slide fixative spray , sonographyroll , sonography jelly , ecg roll for single channel bpl(6108 t) , ecg roll for six channel allengers , ecg roll for twelve channel cp 200 welch allyn , ecg jelly , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray film blue base (conventional) , x ray film blue base (conventional) , x ray film blue base (conventional) , esr tube stand , x ray dental film...

Medical And Health Services - Rajasthan

33713870 supply of laboratory reagents, x ray, ecg, sonography material supply blood sugar kit ,blood urea kit,blood urea, blood urea kit kinetic,7 urea end point,s. creatnine r1 2*60 ml , r2 2*60 ml,s. creatnine,s. bilirubine,s. alk. phosphate,total protein,s.albumin, s.amylase,s. uric acid,s.t. cholesterol,plueural dilution fluid, urin strip, urin strip, pregnancy test card, edta powder, sulphur powder, nitric acid, glacial acetic acid, eosino dilution fluid, ligeul iodine, anti abd set, tissue paper roll, dengue card antigen, vdrl strip, widal, riya vial, measuring pipalte glass, hbsag card, glass beaker, glas funnel, thermal paper, sterile disposable needle, dispovan syringe, sodium heptarin non vaccum blood collection tube, clot activator vcum blood collection tube, needle, iron ball, cuvet, dengue ns , dengue igm elisa, de ionised water, stool container, typhi dot rapid test, haem test, x ray film digital, x ray film blue base, x ray dental film. etc ...

Medical And Health Services - Rajasthan

33628691 supply of chc ghatiywali dist chittorgarh reagents required ecg gelly — 2 s alkaline phosphatase kit — s glucose reagent — total protein reagent s. albumin reagent 6 tlc fluid 7 abo rh kit — 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastic knob urine sugar / alubmine l 2 urine pregnancy test stripe 13 hiv rapid test kit 14 hcl n / io 500ml 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol — — 21 s. hdl s. triglyceride 22 serum creatnine — 23 serum bilirubin t,d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip _ method 2ss total rbc fluide 29 oil emersion 30 disil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 3o1 (iiacmocue) 35 h13 pipet 20 mic.ltr — 36 hb test tube ecg paper roll(caard1vt6 i 08t) 8 ecg pper roll icartmofax ce 1o23) esr pipet 15omm 40 sugar sthp (glucose) 41 test tube glass tcst tube glass 43 glass beaker ‘ test tube stand 45 glass pipete 46 sodium hypochioride solution jj0°/o) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll torniqut 52 x ray film(digjtal j1092 53 x ray film(digital j? l0d 54 55 esr test cap crp kit quantttative 56 57 glass slide blood clot activa(er vail 58 blood lancet steel 59 abx cleaner 60 abxlysebio 61 abxminidii. 62 abxminocular 63 capillary tube 64 cover slip (micro scop cover glass 22mhmo micro pipette micro tips 67 tips stand 68 test tube plastic 69 sahil’s hemoglobin meter 70 urine container li.perafilm? 72 — .weight muchine baby 73 weight machine baby digital 74? — weight machine adult 75 b.p instrument oigital 76? — b.p. instrument mercury — 77 ecg roll 5020r 78? stetho scope 79 glucometer with 2s strip 80? — cotton roll micro pipette ...

Medical And Health Services - Rajasthan

33459518 supply of reagent , x ray film and equipment 1 ecg gelly — 2 s alkaline phosphatase kit — s glucose reagent — total protein reagent s. albumin reagent 6 tlc fluid 7 abo rh kit — 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastic knob urine sugar / alubmine l 2 urine pregnancy test stripe 13 hiv rapid test kit 14 hcl n / io 500ml 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol — — 21 s. hdl s. triglyceride 22 serum creatnine — 23 serum bilirubin t,d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip _ method 2ss total rbc fluide 29 oil emersion 30 disil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 3o1 (iiacmocue) 35 h13 pipet 20 mic.ltr — 36 hb test tube ecg paper roll(caard1vt6 i 08t) 8 ecg pper roll icartmofax ce 1o23) esr pipet 15omm 40 sugar sthp (glucose) 41 test tube glass tcst tube glass 43 glass beaker ‘ test tube stand 45 glass pipete 46 sodium hypochioride solution jj0°/o) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll torniqut 52 x ray film(digjtal j1092 53 x ray film(digital j? l0d 54 55 esr test cap crp kit quantttative 56 57 glass slide blood clot activa(er vail 58 blood lancet steel 59 abx cleaner 60 abxlysebio 61 abxminidii. 62 abxminocular 63 capillary tube 64 cover slip (micro scop cover glass 22mhmo micro pipette micro tips 67 tips stand 68 test tube plastic 69 sahil’s hemoglobin meter 70 urine container li.perafilm? 72 — .weight muchine baby 73 weight machine baby digital 74? — weight machine adult 75 b.p instrument oigital 76? — b.p. instrument mercury — 77 ecg roll 5020r 78? stetho scope 79 glucometer with 2s strip 80? — cotton roll ...

Medical And Health Services - Rajasthan

33454624 supply of laboratory reagent and equipment 1 glass slides 1x50 per box 2 cover slip 1x2o tissue paper roll 4 n / 1ohcl500mi vdrl test strip kit . 6 hiv test card hiv lvth generation test card 8 widal test kit agglutita ion method 4x5m1 serum total protein reagent 1o blood glucose reagent semi auto od urea reagent semi auto 12 bilibruine reagent semi auto . 13 creatitine reagent semi auio 14 sgot reagent semi auto prseenem i au to 16 serum uric acid semi auto 17 serum album inc semi auto 1 blood cholesterol semi auto 19 20 blood crp test 100 test hbsag card test 0.1iu / mi sensitivity 23 glucose test strips 24 j gulcometer with strips ( 50 strips in pit ) xray fiim size 12x15 ( 1 pkt 5o pec. ) green 12x10 ( 1 pkt 50 pec. ) green xray film size 10x08 ( 1 pkt 50 pec. ) green ray film size 12x15 ( 1 pkt 50 pec. ) 29 digital xray film size 12xi0 ( 1 pkt 50 pec. ) x ray film size 1ox08 ( 1 pkt 5o pec. ) develope 22 .05 l it powd ixer 22.5 lit powder 33 ag cardiste needle syringe destroy ( electric ) pricking needle _ j.s.b. stain 15t ( 1x500 ml ) j.&b.stainii’i ( 1x5oo m i ) __ | hivisyph iils duo test strip 39 glass beakar! ( 100ml ) 40 | s.hil ( direct ) 36 38 digital x ray film developer 22.05 lit powder fixer 22.5 lit powder , needle syringe destroyer , pricking needle , covid 19 ag card test jsb stain ist iind , hiv syphillis duo test strip , glass beaker , s.hdl direct , ldl direct visual inspection smear for filaria , rapid test kit syphillis test for iodine in salt , water testing by strip method sputum for afb as per fdsi guideline , auto pipet 10 to 100 ul 5 tto 50 ul auto pipet stand bikar 100 250 ml dropper plastic 15 ml glass test tube e.d.t.a. varl ( double cork ) lxl00 55 e.s.r. filar 1x500 56 glass slides 1x50 57 ) d i djt tus|, iu, ( / ) mm lxl00 58 | clnss testtube t2 m x too mm 59 i mrcroscope cover silp 18mm x igm 1x100 1x10 60 eti { nol lrq. 500 ml each 61 i freld a s00ml j i f ] eld b 5ooml i i nrlran paper so mm i i i ltsman lisman stain 500 ml 66 oil immersion 3oml 67 mthnol liq. 50o ml 68 vtm tube w.b.c solution 500ml . 7o4:b.cpipet ._ 71 w.b.c. diluting acid 25om1 72 jib test filter paper scale book 73 br ctt filter paper capallary | neuubar chamber — etc...

Medical And Health Services - Rajasthan

33335305 supply of lab reagents 1 ecg gelly 2 s. alkaline phosphatase kit 3 s.glucose reagent 4 total protine reagent 5 s. albumin reagent 6 tlc fluid 7 abo rh kit 8 widal slide test kit 9 sodium citrate solution 10 edta k3 tube with plastik knob 11 urine suger / alubm ine 12 urine preg. test stripe 13 hiv rapid test kit 14 h c l n / 10 500m1 15 lismen sten 16 jsb 1 17 jsb 2 18 blood urea 19 s. cholesterol 20 s. hdl 21 s. triglyceride 22 serum creatnine 23 serum bilirubin t d 24 sgot 25 sgpt 26 vdrl rapid test kit 27 urine complete by strip method 28 total rbc fluide 29 oil emersion , 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6108t ) ecg pper roll ( cardiofax ce1023 ) esr pipet 150mm 38 39 40 sugar strip ( glucose ) 41 test tube glass 42 test tube glass 43 glass beaker 44 test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) 47 cbc roll paper 48 phenyl for hospital use 49 hbsag rapid card 50 cottan roll 51 torniqut 52 x ray film ( digital ) 10*12 53 x ray film ( digital ) 8*10 54 esr test cap 55 crp kit quantitative glass slide 56 57 blood clot activater vail 58 blood lancet steel 59 abx cleaner 60 abx lysebio 61 abx minidil 62 abx minocular 63 capillary tube 64 cover slip ( micro scop cover glass 22mm 65 micro pipette ( 10 100u1 ) micro tips 66 micro pipette ( 10 1000u1 ) micro tips, 67 tips stand 68 test tube plastic 69 sahils hemoglobin meter 70 urine container 71 pera film 72 weight machine baby 73 weight machine baby digital 74 weight machine adult , 75 b.p instrument digital 76 b.p. instrument mercury 77 ecg roll 50*20 78 stetho scope 79 glucometer with 25 strip 80 cotton roll....

Medical College - Rajasthan

33076251 supply of various type of test kits and consumables for microbiology dept supply of various type of test kits and consumables for microbiology dept , dengue rapid test for detecting ns1 antigen & igg & igm antibody. • should be capable of detecting dengue infection from day 1 & should be preferably capable of detecting all 04 serotypes of dengue virus. • should have high sensitivity and specificity and +ve control. , ra(latex agglutation test) • should be preferably ce marked/certified. • reagent should be calibrated against who international standard. • latex particles coated with purified human gamma globulin. • should have with +ve control. , crp(latex agglutation test) • should be preferably ce marked/certified. • latex particles coated with anti human crp. • should have with +ve control. , aso(latex agglutation test) • should be preferably ce marked/certified. • latex particles coated with purified streptolysin o. , hbsag rapid test • should be capable of detecting preferably all subtypes of hbsag. • antigen sensitivity should be around 0.5ng/ml. • should have with +ve control. note: sensitivity & specificityshould preferably be >99% , anti hcv rapid test should be preferably 4th generation test. flow through technology. should be capable of detecting preferably all subtypes of hcv. note: sensitivity & specificityshould preferably be >99% , rapid malaria antigen test based on pldh for pv & hrp 2 detection for pf i.e. should be pv & pf specific. should preferably be developed according to who guidelines & hence approved. , widal slide test stabilized reagent for long shelf life(18 months or more at 2 to 8o c.) available in 5ml vials separately salmonella o, salmonella h, salmonella a(h) & salmonella b(h). should be preferably ce marked/certified. , upt card test , rpr slide test should be preferably ce marked/certified. ready to use reagent. positive control provided with kit. stabilized reagent for long shelf life (18 months or more) specimen can be plasma/serum can be used without heat inactivation. preferrably calibrated to who reference serum for serodiagnostic test for treponemal infection. , glass slide (75 x 25mm) thickness 1.45 mm , cover slip 22 x 22 mm thickness 0.13 0.16 , measuring cylinder 100ml made up of borosilicate (borosil) , glass beaker 250 ml capacity made up of borosilicate (borosil) , reagent bottle with stopper 50ml , glass petridishautoclavable 150mm x 20mm , plasticpetridishautoclavable 100 mm x 17mm , plasticpetridishdisposable sterile100 mm x 17mm , glass petridishautoclavable 100mm x 17mm , disposable sterile petridish , glass tubes( with rim) 6 x1 inches 20ml capacity , glass tubes( with rim) 5 x1 inches 10ml capacity , glass tubes( with rim) 4 x 0.5 inches 5ml capacity , glass stock vial 10ml , plastic dustbin 10 ltr. , yellow tips (20 200 ul) , blue tips upto 1000 ul , gloves (non sterile) 7 no. , gloves (non sterile) 7 ½ no. , staining racks stainless steel , test tube stand of hard plastic/ steel • 96 vials, 12mm x 75 mm / 100 mm test tubes • 12 places for 25 mm diameter test tubes • stand for centrifuse tubes 1.5 ml, 2.2 ml & 2.7ml capacity • stand for vials 5 ml vial with 24 vial holding capacity, hole size 14mm • 2 shelves folding stand, 18 tubes holding capacity, hole size 18 mm. • 3 shelves folding stand, 18 tubes holding capacity, hole size 16 mm , magnifier hand lens , stop watch , universal sterile container screw cap 30ml capacity (plastic) , blood culture bottle (120 ml) (glass) capacity with aluminum screw cap with rubber lining of cap. , ready made pre prepared blood culture bottles with media complete for adult , ready made pre prepared blood culture bottles with media complete for children , micropipette fixed 20ul , micropipette fixed 50ul , micropipette fixed 100ul , micropipette variable 5 50ul , micropipette variable 10 100ul , micropipette variable 100 1000ul , antiseptic soap for hand wash , hand sanitizer 200 ml , sample collection tube with screw cap 10ml capacity (plastic) , tissue paper rollpremium extra large with425 sheets (2 ply ) size 95 x 110 mm. , nichrome loop d 1, 1.3mm diameter , nichrome straight wire , widal tubes , drayers tubes , felix tubes , glass flask (500 ml capacity) , glass flask (250 ml capacity) , glass flask (150 ml capacity) , aluminum bucket ( 6x 6 inches) , aluminum bucket ( 8x8inches) , disposable mask (sterile) , cotton roll , gauze roll , marker fine tip black/red/blue , glass marking pencil white/black , whatman filter paper grade 1 , postmartum gloves (7.5 inches) , match box , glass bottle with aluminum cap for l.j. medium (80mm x 20 mm) , hi flexi loop 2 sterlized flexible loop2.2 mm diameter , brucella (rose bengal test) • should be preferable ce marked/ certified. • positive control should preferably be supplied along whit kit. • more than 12 months eagent shelf life at 2 to 8 degree c. , scrub typhus rapid card test , dengue ns1 elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , dengue igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , dengue igg elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , scrub typhus igm elisa • should be preferable ce marked/ certified. qc certificate to be enclosed with each kit. , hav igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hev igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , brucella iggelisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , brucella igm elisa • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , vdrl rotator , chikungunya rapid card test. • based in sandwich immunoassay principle. • high sensitive & specific. • more than 12 months shelf life. , chikungunya igm elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hbsag elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hcv elisa test. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit. , hiv (rapid tests of two different types based on different principles) • 4th generation test for differential detection of p24 antigen & hiv i & ii antibody. flow through technology & interpretation time around 5 to 10 minutes, approved & evaluated by niv/nari and who(naco). • test for detecting both antigen & antibody of hiv by examination of whole blood/ plasma/serum. should be who/naco approved. note: sensitivity & specificity should preferably be >99% , syphilis rapid strip/ card test , torch igg+igm (elisa) (toxoplasma+rubella+cmv+herpes) igg 4 nos.+igm 4 nos. (elisa) (1x96) pack+ total 8 nos. • should be preferable ce marked/ certified. • qc certificate to be enclosed with each kit....

Rajasthan Medical Services Corporation Limited - Rajasthan

33033667 the rate contract for ( 1 ) breast pump electric ( professional ) hospital use ( multi user ) ( 2 ) containers polypropylene ( bpa free ) ( 3 ) glass beaker , breast pump electric ( professional ) hospital use ( multi user ) , containers polypropylene ( bpa free ) , glass beaker...

Sardar Patel Medical College - Rajasthan

33003578 supply of various type of test kits and consumables for microbiology dept 01 [ ) engue rapid test for detecting nsi anigcn & igg & 1gm antibody. • should he caeable or&iectine dengue infect ion i runi | day i & should be preferably capable of detecting ali 04 serotypcs or dengue virus. • should have high sensitivity and spccinlcity and ‘ ye ( ‘ontrol. 02 ra ( latex agglutation test ) should be preferably ( ‘it markcdocrtiifmj? . reagent should be calibrated against who internaljonal standard. • lanex particles coated with purifind hunan gamma globulin. • should have with ve ( ‘ontrol. 03. cr p ( i aiex aggiutation test ) • should be prefemably ce narkedcer, jf, ed. • latex particles coated with anti human crp. • shound havc with 4 vc contnol, 04. 1 aso ( laiex aggiutation test ) • should be preferably ( ‘e markcdlccrtified. • latex rarticles coated winh purificd strcpeolysi.i 0. — 05. libsag rapid lest • should be capable or detecting prefernbly aul subwypes of hbsag. • antigen sensiaivity should be around o.sng / ml. • should hnve with +ve ( gontrol. note:. sensitivity & spcciricity should prcfernbly be 9p4 . 06. anti iicv rapid test hhnud? be preferablb 4th generation uest of inri%is j pnrksj, ? l isscey&s should prefera be 07. rapid malaria antigen test based oe pldii for iv & iip 2 detection for pr i.e. should be pv & pf specific. should prefernbly be developecd according to who j guidelines & hence approved. o8. widal slide test stabilized reagent for long shelr life ( is months or more at 2 to 8o c. ) available in 5m1 vials separately salmonella 0, salnonella h, salmonella a ( l i ) & salmonella b ( i i ) . 09. upt card test . to. rpr slide test should bc preferably ( ‘e markcdjcenlified ready to use reagent. positive control provided with kit. stabiiized reagent for long shelf iife ( 18 moaths or more ) specimee can he plasma / serum can be used without heat inactivation prefemnably calibrated to whio refnnence senum for 4 serodiggo%iic test for ‘onemal infection, i i. glass slide ( 75 x 2smm ) tiiainess i.45 mm 12. cover slip 22 x 22 mm thickness 0.i3 0.16 i3. measuring cyiindei i oornl made up of jjiorosjlicate ( borosil ) 14. glass beaker 250 ml capacity made up of 4i0rosllucai’e ( borosjl ) 15. reagent boiile wiih stopper somi 16. glass petridisi autoclavabie isomm x 2imm il. tpiasiic petridisii autoclayaale iao mm x i 7mm ix. f plasñc x 17mm 19. glass petridisi autoclavabie ioomm x 17mm i.noijijii a? jllmm i9. glass iitridisi auloclavabic iiomm x i7mm 20. disposabie sierile petridish 21. tg1ass thbes with iimi 6 xl inches 20m1 capacity 22. tijlass ttl1ls wits iimi s xl inches lomi capacity 23. glass iuh [ s ( wiihi.ini ) 4 xo.5 inches 5mlcapaciy 24. gilass stock siociç via!. lomi plastic dustbin 10 ltr. yellow tips ( 20 200 ul ) blue tips upto 1000 ul gloves ( non sterile ) 7 no. gloves ( non sterile ) 7 v2 no. staining racks stainless steel test tube stand of hlard plastic / steel • 96 vials, 12mm x 75 mm / 100 mm test tubes • 12 places for 25 mm diameter test tubes • stand for centrifuse tubes 1.5 ml, 2.2 ml & 2.7m1 capacity • stand for vials 5 ml vial with 24 vial holding capacity, hole size 14mm 2 shelves foldine stand, 18 tubes holding capacity, hole size 18mm. • 3 shelves folding stand, 18 tubes holding capacity, hole ______ size 16mm 32. magnifier tiand lens 33. stop watci i 34. universal sterile conjaini.r screw cap 30mnl capat ( plastic ) _____ 35. blooi ) culture bottle ( 120 ml ) rgiass ) capacity with aluminun screw cap with rubber lining of cap. 36. ready made pre prepared blood culture bottles with media .____complete for adult ._.___ compicte i1or arjuitt 37. ready made prc prepared blood culture bottles with nredia complete for children 38. micropipette fix el ) 20u1 39. micropipette fixed 50ul 40. miuropipetie fixed l00ul 41. micropipejte variable 5 50ul 42. +micropipe1te variable i0 iooul i micropiiei ] ’evariaa [ jimjóojaoouj? 44. fan11septic soap for iand iasi 45. hand saniti2er 200 ml 46. sample collection tujbe with screw cap joml capacity ( plastic ) 1w 1t [ mis? f 47. i tissue paper roll. premium extra large with 42s jshees ( 2 ply ) size95 xil 10mm. — 48. niciirome i.oopd l. l.3mm [ ) iametiir? 49. nichromf; straight wire fsffwidaltubes — . 51. i ) rayers tue3es 52. felix tubes 53. glass flask ( 500 ml capacity ) 54. glass flask ( 250 ml capaciiy ) 55. glass [ m5j ( iso ml capaciiy ) 56. 1!nlim iicket ( 6x 6 inches ) 57. aluminum hi ] ck [ t ( 8x8 inches ) 58. disposabie mask ( sterlij ) 59. cotton roll 60. gauze roll 6i. marker fine tip black / rl [ ) , l1 [ i ) e? 62. glass markin ( ; pen ( ii. wiiite / black1 61 whatman fiiter paper grnde i 64. postmartijmgloves ( 75 inches ) 65. matchbox 66. glass bottle wimi aluminum cap ior l.j. mei ) ium ( somn x 20 mm ) lw7 1u, 1m — (owomm x 20 mm) 67. [iiii huexi [.oop 2 sthrl.izii) fl fxihle 1ixw 2.2 — mm i)iameter 61t. i4rucelia rrose bengal test) • should be preferable ce marlhedj certified. • positive control shouud prefernbwy be supplied alone whit kit. • more than 12 months cagent shelr life at 2 to 8 degreec. 69. scrub typhus rapid eard [est 7i. tbcngue nsi elisa • should be preferable cf marked/ certified. . qf nriifcii to be enclosed with each kit. 71. j dcngue 1gm fiisa • should be preferable ce marked/cenfift(d? • qc certificate to be enclosed with each kit. 72. i)engue lgg elisa • shoul(l be preferable ce marked! certified. • qc certificate to be enclosed with each kit. 73. scrub typhus lgm elisa • should be preferable ce marked! certified. qc certificate to be enclosed with each kit. 74. hav lgm elisa • should be preterable ce marked! certified. ____ —e • qc centificate to be enclosed with each kit. 75. hev 1gm elisa • should be preferable ce marked! certified. • qc ccrtificate to be enclosed with each kit. 76. flrucella lgg lilisa • should be preferable ce marked! certified. • qc certificate to be enclosed with each kit. 77. brucella lgm lilisa • should be preferable (‘ii marked? certified. • qc certificate to be enclosed with each kit. 78. v1)rl rotator . tchikungunya rapid card test. ...t • based in sandwich immunoassay principle. • high sensitive & specific. e more than 12 months shelf life. 80. c’hikungunya lgm elisa test.hcv elisa test hiv rapid test of two diffretn types syphilis rapid strip / card test torch igg igm elisa etc ...

State Agriculture Marketing Board - Rajasthan

32660485 food testing laboratory in gon mandi yard sohela. hot air oven , drying oven analytical balance distiled water plant , water bath autoclave microbio logical incubator , refrigerator , deep fridge , colony counter , laminar flow chamber bunsen burner micro pipette ph meter brix refractometer uv lamp , abbe refractometer , soxhlet apparatus , muffle furnance , kjeldal distilation unit , erlenmeyer flask , conical flask , flat bottom flask , tlc plates , separating funnel , glass beaker distillation flask , burette petri plates ...

Medical And Health Services - Rajasthan

32611025 supply of laboratory reagents item at govt hospital bundi , test tube with screw cup plastic , test tube with out screw cup plastic ( plan for calcium sample ) , plastic disposable vial plan , plan vial with cap , edta vial doubble cap , test tube disposable , serum vial with cap , vacutainer tubes 5 ml ( blood collection vial edta ) , test tube glass , test tube glass , test tube glass , test tube glass , test tube stand, plastic / aluminium , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , fixedvalue tips , tips for auto pipette , tips blue for auto pipette ( p1000 ) , tips blue for auto pipette ( p20 ) , tips blue for auto pipette ( p10 ) , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , micro glass sildes, polished edges, lint free ( transparent ) , capillary tubes , measuring cylinder graduated , tissue paper , 10% sodium hypohlorite solution , tri sodium citrate , deionozed water , edta powder , giemsa stain powder m.s / certifed , giemsa stain , methyline blue m.s / certifed , platelet count fluid , rbc counting fluid , semen diluting fluid , wbc counting fluid , urine strip for albumin & suger , urine strip for ketone bodies & suger , disposable esr marking tubes for esr estimation , 3.8% sodium cytrate tube with cap , semi auto analyzer biochemistry cpc 3300 , albumin, bcg, with standard , alkaline, phosphatase, kinetic, dgkc , amylase, kinetic, cnpg, ifcc , bilirubin ( total ) jendrassik & grof , bilirubin ( direct ) jendrassik & grof , ck mb immunoinhibition , ck nac kinetic , cholesterol, chod pod, with standard , hdl cholesterol , s. calciumarsenazo method with standard , uric acid enzymatic, end point with standard , glucose, with standard enzymatic god pod , protein total, biuret, with standard , sgot ( alt ) kinetic uv ifcc , sgpt ( ast ) kinetic uv ifcc , triglycerides, gpo pap with standard , urea, uv gldh, kinetic , urea end point ( berthelot ) with standard , multi calibrator, clinical chemistry ( normal ) , creatinine , dsfedyl ] fdv~l fj, tsuv~l dh vuqlqph , hbsag test rapid card , hiv rapid card , hiv tri dot test , hcv rapid card , vdrl rapid card , hbsag elisa test kit , hiv elisa test kit , hcv elisa test kit , crp latex kit , ra factor kit , scrubtyphuselise kit , scrubtyphus rapid card , malaria antigen card test , malaria antibody card test , dengue elisa igm , printer roll 57 mm , disposable single blood collection cpda bag 350 ml , rapid card test detection of malarial antigen , thermal printer roll , pregnancy card , 3 disposable plastic test tube , 4 disposable plastic test tube , gloves latex 6 no. , edta vial single cap , glueometer strip suger check ( whokhardt ) , measuring cylender , beaker glass , beaker glass , beaker glass , copling jar , esr kit tube with cups and stand , esr estimation tube , disposable swab stic tube , cover silip english glass , rubber teat for dropper 3or 4 or 6 , conical flask flat bottom , stickers for labling test tube , adhesiv tape micropore , disposable plastic droper , sponge ball for doners , cedar wood oil , ethylene diamine tetra acitic acid ( edta ) , hydrochloric acid ( concentrated ) , jsb stan 1&2 , leishmans stain solution m.s. , new methylene blue m.s / certifed , sodium chloride , fields iodine solution , csf count fluid , csf chloride kit , csf protein kit , hiv test comb aids , urine container ( plastic ) , hb tube round top / gdr isi mark , hb pipetter 20u top isi mark with rubber test ( sahil ) , bulb for microscpes halogen ( 6v 12v ) make philips for microscope , brushes for test tubes washing , brushes for test tubes washing , filter papers ( whatman ) no 1 , 10% sodium hypchlorite solution , methanol , normal saline for laboratory , hand wash liquid , haemoglobin standerd , liquid paraffin oil light , potassium metabisulphitear , reticulocyte count fluid , sodium citrate 3.8% , lipase kinetic , control for ck mb , control for lipid profile , glucose god pap liquid , dropper big size glass , slid staining stand , disposable latex glovesh 7 inch , disposable latex glovesh 6.5 inch , methy1 violet m.s. / certified , csf suger kit , blood grouping sera a , blood grouping sera b , blood grouping sera ab , blood grouping sera d , anti human globulin , widal test kit slide method , aslo titre kit , dengue rapid test igg&igm , anti a 1 lectin , bovine serum albumin 22% , disposable single blood collection cpda bag 350 ml , rapid card test detection of malarial antigen , widal test card igg&igm , dengue ns 1 kit , dengue repid card antibody , biochemical tests reagents ( for rx imola randox auto analyser ) , wash solution no 1 , wash solution no 2 , humanassay control 2 , humanassay control 3 , c1 wash solution , albumin, bcg, with standard , alkaline, phosphatase, kinetic, dgkc ( liquid ) , amylase, , bilirubin ( total ) jendrassik ( liquid ) , bilirubin ( direct ) jendrassik ( liquid ) , ck mb immunoinhibition , ck nac kinetic , creatinine, jaffe, kinetic, ( liquid ) , hdl cholesterol ( liquid ) , cholesterol, chod pod, ( liquid ) , urea kinetic ( liquid ) , ldh , protein total, biuret, ( liquid ) , sgot ( ast ) mod ifcc ( liquid ) , sgpt ( alt ) mod dgkc ( liquid ) , triglycerides, gpo pap , , ( liquid ) , uric acid ( liquid ) , s. calciumarsenazo method with ( liqiud ) , lipase , auto analyser sample cup normal , glucose liquidgod pap 2232 test , aliquot vial plane , calibrators & controls , urine assayed control level 2 , urine assayed control level 2 , calibration sera level 2 , calibration sera level 3 , hdl / ldl cholesterolcalib. , ck mb control , ck mb calib , crp calib ( multi poin, liquid ) , crp high sensitivity control level 1 ( liquid ) , crp high sensitivity control level 1 ( liquid ) , crp high sensitivitycalib series , crp calib series ( multi point, liquid ) , crp control level 2 ( liquid ) , crp control level 3 ( liquid ) , crp fulll range ( 0.1 160 mg ) calib series , tri level careiaccontrol , tri level careiaccontrol , liquid cardiac control level 1 , liquid cardiac control level 2 , liquid cardiac control level 3 , ammonia ethanol control level 1 , ammonia ethanol control level 2 , ammonia ethanol control level 3 , fructosamine calib , fructosamine control level 1 , fructosamine control level 3 , hba1c calib. series , hba1c control level 1 and level 2 , human assayed multi sera level 3 , human assayed multi sera level 3 , immununoassay control premium plus level 1 , immununoassay control premium plus level 2 , immununoassay control premium plus level 3 , specific protein calib ( liquid ) , specific protein calib ( liquid ) , calib . ( single point ) , lipid controllevel 1 , lipid controllevel 2 , lipid controllevel 3 , lipid controllevel 1 , lipid controllevel 2 , lipid controllevel 3 , aso calib. , apolipoprotein calibrator , lipoprotein ( a. ) calib. series , lipoprotein ( a. ) control level 3 , microslbumin control level 1 andlevel2 ( liquid ) , microalbumin calib. series , multi calibrator anmonia , myoglobin calib. , specific protein assayed control level 1 ( liquid ) , specific protein assayed control level 2 ( liquid ) , specific protein assayed control level 3 ( liquid ) , rheumatoid factor calib.series , urine precision control level 2 , urine precision control level 3 , serum diluent water , sample cups for rendox machine ...

Medical Health And Family Welfare - Rajasthan

32609353 supply of lab reagent item at govt hospital bundi lab resigent item at govt hospital bundi , items , test tube with screw cup plastic , test tube with out screw cup plastic ( plan for calcium sample ) , plastic disposable vial plan , plan vial with cap , edta vial doubble cap , test tube disposable , serum vial with cap , vacutainer tubes 5 ml ( blood collection vial edta ) , test tube glass , test tube glass , test tube glass , test tube glass , test tube stand, plastic / aluminium , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , auto pipette fixed volume , fixedvalue tips , tips for auto pipette , tips blue for auto pipette ( p1000 ) , tips blue for auto pipette ( p20 ) , tips blue for auto pipette ( p10 ) , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , adjustable auto pipette , micro glass sildes, polished edges, lint free ( transparent ) , capillary tubes , measuring cylinder graduated , tissue paper , 10% sodium hypohlorite solution , tri sodium citrate , deionozed water , edta powder , giemsa stain powder m.s / certifed , giemsa stain , methyline blue m.s / certifed , platelet count fluid , rbc counting fluid , semen diluting fluid , wbc counting fluid , urine strip for albumin & suger , urine strip for ketone bodies & suger , disposable esr marking tubes for esr estimation , 3.8% sodium cytrate tube with cap , semi auto analyzer biochemistry cpc 3300 , albumin, bcg, with standard , alkaline, phosphatase, kinetic, dgkc , amylase, kinetic, cnpg, ifcc , bilirubin ( total ) jendrassik & grof , bilirubin ( direct ) jendrassik & grof , ck mb immunoinhibition , ck nac kinetic , cholesterol, chod pod, with standard , hdl cholesterol , s. calciumarsenazo method with standard , uric acid enzymatic, end point with standard , glucose, with standard enzymatic god pod , protein total, biuret, with standard , sgot ( alt ) kinetic uv ifcc , sgpt ( ast ) kinetic uv ifcc , triglycerides, gpo pap with standard , urea, uv gldh, kinetic , urea end point ( berthelot ) with standard , multi calibrator, clinical chemistry ( normal ) , creatinine , dsfedyl ] fdv~l fj, tsuv~l dh vuqlqph , hbsag test rapid card , hiv rapid card , hiv tri dot test , hcv rapid card , vdrl rapid card , hbsag elisa test kit , hiv elisa test kit , hcv elisa test kit , crp latex kit , ra factor kit , scrubtyphuselise kit , scrubtyphus rapid card , malaria antigen card test , malaria antibody card test , dengue elisa igm , printer roll 57 mm , disposable single blood collection cpda bag 350 ml , rapid card test detection of malarial antigen , thermal printer roll , pregnancy card , 3 disposable plastic test tube , 4 disposable plastic test tube , gloves latex 6 no. , edta vial single cap , glueometer strip suger check ( whokhardt ) , measuring cylender , beaker glass , beaker glass , beaker glass , copling jar , esr kit tube with cups and stand , esr estimation tube , disposable swab stic tube , cover silip english glass , rubber teat for dropper 3or 4 or 6 , conical flask flat bottom , stickers for labling test tube , adhesiv tape micropore , disposable plastic droper , sponge ball for doners , cedar wood oil , ethylene diamine tetra acitic acid ( edta ) , hydrochloric acid ( concentrated ) , jsb stan 1&2 , leishmans stain solution m.s. , new methylene blue m.s / certifed , sodium chloride , fields iodine solution , csf count fluid , csf chloride kit , csf protein kit , hiv test comb aids , urine container ( plastic ) , hb tube round top / gdr isi mark , hb pipetter 20u top isi mark with rubber test ( sahil ) , bulb for microscpes halogen ( 6v 12v ) make philips for microscope , brushes for test tubes washing , brushes for test tubes washing , filter papers ( whatman ) no 1 , 10% sodium hypchlorite solution , methanol , normal saline for laboratory , hand wash liquid , haemoglobin standerd , liquid paraffin oil light , potassium metabisulphitear , reticulocyte count fluid , sodium citrate 3.8% , lipase kinetic , control for ck mb , control for lipid profile , glucose god pap liquid , dropper big size glass , slid staining stand , disposable latex glovesh 7 inch , disposable latex glovesh 6.5 inch , methy1 violet m.s. / certified , csf suger kit , blood grouping sera a , blood grouping sera b , blood grouping sera ab , blood grouping sera d , anti human globulin , widal test kit slide method , aslo titre kit , dengue rapid test igg&igm , anti a 1 lectin , bovine serum albumin 22% , disposable single blood collection cpda bag 350 ml , rapid card test detection of malarial antigen , widal test card igg&igm , dengue ns 1 kit , dengue repid card antibody , biochemical tests reagents ( for rx imola randox auto analyser ) , wash solution no 1 , wash solution no 2 , humanassay control 2 , humanassay control 3 , c1 wash solution , albumin, bcg, with standard , alkaline, phosphatase, kinetic, dgkc ( liquid ) , amylase, , bilirubin ( total ) jendrassik ( liquid ) , bilirubin ( direct ) jendrassik ( liquid ) , ck mb immunoinhibition , ck nac kinetic , creatinine, jaffe, kinetic, ( liquid ) , hdl cholesterol ( liquid ) , cholesterol, chod pod, ( liquid ) , urea kinetic ( liquid ) , ldh , protein total, biuret, ( liquid ) , sgot ( ast ) mod ifcc ( liquid ) , sgpt ( alt ) mod dgkc ( liquid ) , triglycerides, gpo pap , , ( liquid ) , uric acid ( liquid ) , s. calciumarsenazo method with ( liqiud ) , lipase , auto analyser sample cup normal , glucose liquidgod pap 2232 test , aliquot vial plane , calibrators & controls , urine assayed control level 2 , urine assayed control level 2 , calibration sera level 2 , calibration sera level 3 , hdl / ldl cholesterolcalib. , ck mb control , ck mb calib , crp calib ( multi poin, liquid ) , crp high sensitivity control level 1 ( liquid ) , crp high sensitivity control level 1 ( liquid ) , crp high sensitivitycalib series , crp calib series ( multi point, liquid ) , crp control level 2 ( liquid ) , crp control level 3 ( liquid ) , crp fulll range ( 0.1 160 mg ) calib series , tri level careiaccontrol , tri level careiaccontrol , liquid cardiac control level 1 , liquid cardiac control level 2 , liquid cardiac control level 3 , ammonia ethanol control level 1 , ammonia ethanol control level 2 , ammonia ethanol control level 3 , fructosamine calib , fructosamine control level 1 , fructosamine control level 3 , hba1c calib. series , hba1c control level 1 and level 2 , human assayed multi sera level 3 , human assayed multi sera level 3 , immununoassay control premium plus level 1 , immununoassay control premium plus level 2 , immununoassay control premium plus level 3 , specific protein calib ( liquid ) , specific protein calib ( liquid ) , calib . ( single point ) , lipid controllevel 1 , lipid controllevel 2 , lipid controllevel 3 , lipid controllevel 1 , lipid controllevel 2 , lipid controllevel 3 , aso calib. , apolipoprotein calibrator , lipoprotein ( a. ) calib. series , lipoprotein ( a. ) control level 3 , microslbumin control level 1 andlevel2 ( liquid ) , microalbumin calib. series , multi calibrator anmonia , myoglobin calib. , specific protein assayed control level 1 ( liquid ) , specific protein assayed control level 2 ( liquid ) , specific protein assayed control level 3 ( liquid ) , rheumatoid factor calib.series , urine precision control level 2 , urine precision control level 3 , serum diluent water , sample cups for rendox machine...

Medical And Health Services - Rajasthan

32554997 lab reagents and chemicals for laboratory and x ray department / dental department / bio medical waste cbc printer roll edta k3 vial , esr pipette disposable glass slides , jsb stain , b sodium citrate cappilary tube , filter paper hb meter n 10 hcl blood group kit , cover slip , pt reagent with machine pt vail pt tube , leishmens stain , tec diluting fluid , petiet diluting fluid wbc fluid , rbc fluid , sperm diluting fluid , lugois iodine solution , widal kit , 23 vdrl card 24 hiv card 25 unnecontamw 26 urmne multi strip ( 9 strip ) 27 urine stnp ( at ) sugar ) 28 pregnancy card 29 deionized water ( dw ) 5ltr. 30 tissue paper 31 clinic spirit cotton roll syringe , niddle tourniquet dropper dispo , cbc control positive negative , dengue rapid test card malaria card test , ra test , aslo test crp test hbs ag rapid test , urine strip keto sugar , anti abd , anti h anti combs coomb test direct indirect , blood bank refrigerator temp graph paper , glucose kit liquid , blood urea liquid kinetic , creatinine liquid kinetic , biluribi t d liquid , sgot sgpt liquid kinetic alk. phasspastse liquid kinetic total protien liquid , cholestrol liquid , trigelsrides hdl iquid 69 vldl liquid 70 gtucorneter stnp 71 plain tube riya vals without cap plain ‘vail with clott activator with cap 72 s. calcium test liquid — — 73 s. ck nac liquid kgnetic 74 s ck mb liquid kinetic 75 s ldh iql.sd kinetic 76 s. uric acd iqud 77 s.amylasebquid kinetie 78 s albumine qud 79 tips yellow ( 1 5o mc ltr. ) 80 tips blue ( 1 mi. ) 81 micro pipette stand 83 occult blood card 85 sulphur powder 86 wash bottle 500 ml plastic 87 glass beaker 500 ml 88 glass beaker 250 ml 89 oil lmmersonl 90 accu ct, eck ( glucorneter caln i mere ) micro pipptte ( variable ) 1o micro liter 5 50 micro liter 91 micro pipptte neubars counting chamber wbc rbc pipette , disposable gloves , mask triple layer , mask n95 ppe kit patient ppe kit , face shield , bleaching , surgical cap , sodium hypochloride , liquid hand wash cbc humacount reagent hc lyse hc cleanier diluent cbc horiba reagents lyse cleaner minidle lmg diluient minoclair , , bio medical waste plastic bags buckets , x ray saction items x ray film , fixer powder , developer , x ray envelope , x ray film digital , dental x ray film , ecg roll ecg jelly , denta section material , silver alloy measure endo rotary files , paper point , gutta percha point , root canal sealant bio ceramic nitrile gloves ...

Medical And Health Services - Rajasthan

32266506 rate contract for mnjy lab reagent horiba abx diulent , horiba abx lysebio , horiba abx cleaner , abx minoclair , paper printing roll , hemocue cuvette , k3 tube for cbc cover slip , clot activator tube blood collection otube , micro auto pipette tips , test tube stand, urine container , prick niddle , leishman stain , sodium citrate , filter paper , hiv card vdrl card widal , blood group , hydrochloric acid n/10 distilled water wbc diluting fluid , glass slide , esr tube dispo , field stain a b , pregnancy card , leugole iodine , m p cards antigen , vldl hdl , triglyceride , cholestrol alk phosphates albumi total protein sgot sgpt , bilirubin creatinine blood urea blood suga jsb filed stain , urine complete by strip method , urine alg sugar strip , lence clean paper , lence clean solution , n s for lab , tissue paper , pipette stand , hb tube , hb pipette , hb meter , semi autoanalyzer , hypoclorite solution , glass beaker etc ...

Medical And Health Services - Rajasthan

32136574 supply of lab reagent & x ray film 1 ecg gelly 2 s. alkaline phosphatase kit 3 s. glucose reagent 4 total protein reagent 5 s. albumin reagent 6 tlc fluid m aborm kit widal slide test kit j sodiun citrate soiunoe 10 edtak3tub 1 1 urine suger / alubmn 12 urine prey. test stripe 133 h1v rapid test kit 14 rd. n / i0 500ml — 17 jsb2 18 blood urea 19. s. cholesterol . i 1idi_ 21 s. triglyceride 22 serum creatnine . 23 serum biiirutin t.d — 24 sgot 25 sgpt 26 vdrl rapid test kit — 27 txine complete by strip method 28 total rbc fluide . 29 oil emersion 30 distil water 31 vdrl rapid card 32 mp rapid card 33 dengu rapid card 34 hb qubit 301 ( haemocue ) 35 hb pipet 20 mic.ltr 36 hb test tube 37 ecg paper roll ( caardiart6 1 08t ) ecg pper roll ( cardiofax 38 ce1023 ) 39 esr pipet 150mm sugar strip. ( glucose ) 41 test tube class 42 test tube glass 43 glass beaker test tube stand 45 glass pipete 46 sodium hypochloride solution ( 10% ) cbc roll paper phenyl for hospital use libsag rapid card cottan roll _ torniqut _. 5 ray film ( digital ) l0*12 esr test cap crp kit quantitative 49 50 5! 54 55 glass slide 56 blood clot activater vail 57 jxray film ( digiial ) etc...

Medical And Health Services - Rajasthan

32122147 supply of lab reagent & x ray reagent abx minidil lmg 20 ltr bloood mixture abx mioclar abx cleaner , malaria card , vdrl strip k3 edta tube esr tube glase creatinine sgot bilirubin field staind a plus b , sgpt total protein hdl cholesterol blue tips cbc roll sodium citrate solution pregancy card leishman stain k3 edta tube yellow tips urine container glucose strip test tube brush hb tube square hb meter sq top widal kit alkalene phosphate oxy mask urea tissue roll hiv card hbsag triglyceride albumin total cholesterol ant abd glass slide micropipette stand , test tube stand glass beaker gloves rubber exam slide rack dropking bottle n /10 hcl urine sugar albunim fixer tank developer cotton roll sugar meter x ray film , x ray drying clip , safe light , esr pipette pump ...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical And Health Services - Rajasthan

31498004 provide of laboratory chemical and reagents cbc printer roll, ech jelly, j.s.b. stain, sodium citrate, filter paper, hb meter, blood group, cover slips, coomb test, pt reagent, widal kit, vdrl card, hiv card, urine container, urine multi strip, preganancy card, tissue water, clinic spirit, cotton roll, syringe, niddle, tarnicute, soup bar, dropper, rapid test card, glucose kit liquid, blood urea liquid, hdl liquid, uric acid, wash botte, glass beaker, oil immersion, plastic bag, dustbin, stop watch, microscope, ecg roll, surgical mask, nebulizer, surgical gloves, handwash....

Medical And Health Services - Rajasthan

31396149 supply of reagent kit equipment cmho tonk no — chikungunya elisa kit scrub typhus elisa kit hepatitis a elisa kit hepatitis e elisa kit widal typhi dot kit mine weighing scale (measuring in gram) 3terilized disposable petrrplates (90 mm) glass petriplate 90 mm sterilized disposable test tubes (12x100 mm) blunt forcep artery forcep spirit lamp himedia gram staining kit himedia brain heart infusiuon broth (250 gm) himedia sterile urine container aluminium test tube stand 12 hole himedia amikacan antibiotic disc himedia nitrofurantoin antibiotic disc himedia levofloxacin antibiotic disc — himedia gentamicin antibiotic disc himedia doxycycline antibiotic disc himedia clindamicin antibiotic disc 23 himedia tetracycline antibiotic disc — — —a — —rv • .w. .— . 24 25 himediaerythromycin antibiotic disc himedia azythromnycin antibiotic disc 26 himedia piperacillin + tazobactum antibiotic disc 27 himedia ceftriaxone antibiotic disc 28 himedia imepenem antibiotic disc 29 himedia cefexime antibiotic disc l3° borosil glass beaker (500 ml) 31 boroxii glass beaker (10o0 ml) 32 borosil glass conical riask(100o ml) 33? — boresil glass conical fiask(500 ml) 34 himedia cotton swab 35? — nichrome straight wire 36 himedia nichrome loop (1 mm) fi himedianuirjentagar500gm l — himedia mactonkeyagar500gm ...

Medical And Health Services - Rajasthan

31191865 supply of laboratory reagent item tender for tb clinic dholpur 1 sputum container ( size 5x4cm ) sputum container sample a sputum container sample b sputum container sample c 2 microscope glass slide is! mark phenol crystal solid 3 4 soap lifeboy ( 100 gm ) 5 basic fusion powder 6 ethnol 99.9% 7 methylena blue powder — 8 sulphuric acid 99.9% 9 distilled water 10 match box 11 12 tissue paper roll diamond glass cutter — marker 13 filter paper whatmen 14 broom stick ( length 16 ___ cm ) 15 washing bottel ( plastic ) 16 glass beaker ( sltr capacity ) 17 dropping bottle ( 100 ml capacity plastic ) 18 phenyal lsl marka best quality 19 sodium hypocloride 10% 20 cotton roll 200gm 21 exammation gloves 22 sprit lamp 23 thermacol box ( die making best qualityl eentth 17 cm x width 17 cm x depth 14 cm ) approx 24 plastic box ( length 26 cm x width 17 cm x depth 6 cm ) approx . e____r ice gel pack ( 100 gm ) 25 26 packing bag with zipper ( 5x7 inch ) 27 falcon tube 50ml 28 falcon tube stand 29 lense paper 30 burning sprit 31 auramin!powder o? 32 potasium permegnet 33 parafilm tape 34 brown tape 3inch...

Medical And Health Services - Rajasthan

31009329 purchase of blood bank regents hiv rapid test, hbs ag card, hcv rapid test, bouin albumin, coombs reagent, hiv tridot rapid test, hbs ag card, hcv rapid test, hcv elisa, antriscra a1, anti ab, anti abd, anti sera d, malaria test card, weight machine digital, with needle for blood collection up to 1 kg, vdrl rpr, bp instrument with stand, cpd a blood bag, bp instrument dial, sponge ball, band aid, normal saline, micropipette, multichannel micropipette, electric chemical balance, magnifying hand lense, bp instrument bladder, bp instrument valve, bulb, pasteur pipette, bp instrument combined, bp instrument mercury less led, vdrl tesrt strip, copper sulphat powder, borosil glass beaker, measuring cylinder....

Medical Health And Family Welfare - Rajasthan

30672725 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

30106373 purchase of lab reagent purchase of lab reagent , laboratory items , 100x lens , 10x lens , 40x lens , ammonia concentrated , antirh 10 ml , anti a 10 ml , anti a1 10 ml , anti ab 10 ml , anti abd 10 ml , anti d igg+igm & monoclonal , anti d inj , aslo kit 30 test , b.p. instrument , b.sugar kit end point (semi auto analyzer) 1000ml , b.urea kit end point (semi auto analyzer) 1000ml , band aid , barium chlorid solution , bbr round graph 2°c to 8° c , beaker 250 ml glass , beaker glass 500 ml , blood bag 100 ml cpda , blood bag 350 ml cpda(single) , blood bag 350 ml double , blood bag 350 ml triple (sagm) , blood bag 350 ml triple (without sagm) , blood bag 450ml (sagm) tripple bag , blood bag 450ml (without sagm) tripple bag , blue tip (small) , body fulid chemical estimation kit , bovine albumin 22%5 ml , brumm stick , buffer solution , c.r.ptest(30 test) , capillary tube , cbc roll horiba , cbc roll vector , chickungunea elisa kit , chikungunya card , coagulation analyzer (atutomated) , colorimeter cuvette glass , colorimeter digital 8 filter , control material for quality control of sugar, urea, creatine, biltbild, ot,pt , coombs serum 5 ml , copper sulphate solution 1 ltr , cotton roll 500 gm. , counting chameber improved silver line , cover slip 18*18(12pc) , cover slip 18*36(12pc) , cuvette for randoximola , dengu antigen card 1x10 pack size , dengue card lgg, lgm 1x10 pack size , dengue card ns1, igg,igm , dengue elisa , dengue igg elisa , dengue igm elisa , dengue ns 1 elisa , disposable glove size 7.5/7 , disposable needle no. 22,23,24 , disposable syringe 2 ml , disposable syringe 5 ml , distilled water 5 ltr. , e.d.t. a tube 5 ml (k3) , e.d.t. a vial 5 ml (k3) , e.d.t.atest tube cap 5 ml(k2/k4) with blue cap , e.d.t.atest tube cap 5 ml(k2/k4) with greencap , e.d.t.atest tube cap 5 ml(k2/k4) with red cap , e.d.t.atest tube cap 5 ml(k2/k4) with yellow cap , e.d.t.a vial with cap 5 ml (k2/k4) , e.s. r. fluid1x500ml , e.s.r. tube (0 200) westergreen glass , e2cleaner , elisa reader printer roll(multiscan) , elisa reader printer roll(robonic) , eosin nigrosin solution for semen analysis.125ml , eosin phil diluting fluid 100ml , esr analyzer , esr pipette , esr stand (wester green iron 6 key) , esr stand plastic with 6 tube, scale and cap , esr tube (disposable) , esr tube with cap , esr tube with cap reusable , filter paper (round) , fouchet reagent (100ml) , funnel (conical )keep plastic transparent , gel card for blood group , gel card for cross match , giemsa stain solution 500ml , glass marker diamond , glass marking pencil , glass slide , glass test tube 12*100 , glass test tube 12*75 , glass test tube 15*100mm , glass test tube 15*150 , h2so4 20% , h2so4 25% , h2so4 concentrated , hb estimation kit ( drabkin solution whith standard solution by colorimter method ) , hb meter(top square) , hb pipette , hb tube round , hb tube square , hbsag card , hbsag elisa 96 tests kit (dghs approved) , hcl concentrated , hcl n/10 500ml , hcv card , hcv elisa 96 tests kit (dghs approved) , hivcard hiv comb 48 test , hiv elisa 96 test , hiv rapid card , hiv tri dot card , horiba abx diluent , horiba calibration , horiba cleaner/minoclear , horiba control , horiba lyse , insulin syringe , iodine solution , j.s.b stain solution500ml , leishman stain solution 500ml , lens paper kit , liquid ammonia , liquid soap , liss solution500ml , lyoplastin kit. , malaria card test antigen (pv/pf) , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol5 ltr , methylene blue100ml , micro tips stand plastic (large) , micro tips stand plastic (small) , micro tips white(1000 pc) , micro tips yellow(1000 pc) , micropipette 0 10 ul , micropipette 100 1000 ul , micropipette 10 100 ul , microscope binocular , microtips blue(500 pc) , multi calibrator for biochemistry analyser , multi channel pipette (8 key ) 0 10 ul , multi channel pipette (8 key )10 1000 ul , multistix 100 strips , naoh concentrated , needle 22g , needle 23g , normal saline solution500ml , normal saline solution (0.9%) 500ml , oil immersin lens , p.t. vial (prothrombin time vial) , paraffin film (1piece) , paraffin liquid heavy500ml , pasteur pipette (dropper) , pcv tube (wintrobe tube) , penta blood bag , ph paperpkt , pipette delivery fixed volume multiple times(100 1000ml) , plain test tube cap 5 ml plastic with blue cap , plain test tube cap 5 ml plastic with green cap , plain test tube cap 5 ml plastic with red cap , plain test tube cap 5 ml plastic with yellow cap , plastic cotton ball , plastic test tube 5 ml (disposable) , platelet diluting fluid100ml , powder sulphur , printer roll cbc 50mm*20 mt for trivitron , r.a test (50 test) , r.b.c pipette , red blood cells diluting fluid , round graph ( 40° c to 80° c) , s. ck nac kit (semi auto analyzer ) 10ml , s. ck mb kit 10ml , s. total protein kit (semi auto analyzer ) 5x20ml , s.albumin kit(semi auto analyzer ) 5x20ml , s.alkaline phosphate (semi auto analyzer )4x100ml , s.amylase kit (semi auto analyzer ) 4x25ml , s.bilirubin kit direct (semi auto analyzer ) 500ml , s.bilirubin kit total (semi auto analyzer ) 500ml , s.calcium kit (semi auto analyzer )5x20ml , s.creatinine kit (semi auto analyzer )4x60ml , s.g.o.t kit (semi auto analyzer ) 5x200ml , s.g.p.t (semi auto analyzer )5x200ml , s.l.d. h. kit (semi auto analyzer ) , s.uric acid kit(semi auto analyzer )5x20ml , safari quench , sample vial stand plastic small 16 keys , sample vial stand plastic small 48 keys , scrub typhus card , scrub typhus elisa kit , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml (fresinius kabi) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml (fresinius kabi) , semen container , semen diluting fluid 100ml , serum hdl kit ((semi auto analyzer ) 5x20ml , serum total cholsterol kit (semi auto analyzer ) 5x20ml , serum triglyceride kit (semi aut analyzer)4x60ml , serum vldl kit (semi auto analyzer ) 5x20ml , sfri cleanser 10 ltr. , sfri diluent 20 ltr. , sfri lyse 500 ml , sfri sheeth 10 ltr. , single donor platelets (sdp) kit , slide stain rack(20 slide ss) , slide stain stand (20 slide ss) , slide stain tray (20 slide ss) , sodium hypoclhorid , spirit lamp , sprit rectified clinical , sputum conatiner , stethoscope , sticker , stool container , stop watch racer (plastic ) , strong carbol fuchsin , sudan black stain solution , syringe 20ml , syringe holder (20ml syringe) , test tube holder , test tube stand (12*75mm) ss , test tube stand (15*100 mm )ss , test tube stand ss ( 15*150) , thermocal box (5liter) , tips blue , tips white , tips yellow , tissue paper , torniquet heavy , trichrome stain solution , tscd cutting blade , urine analyzer , urine ketone strips 50 strips , urine pregnancy card , urine pregnancy strips , urine strips multipleparameter (100) , uriner container , urinometer , uristicks 100 strips , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with greencap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vdrl card test , vdrl rpr rapid kit 50 test , vdrl strip , vector control , vector diluent 20 liter , vector ez 100 ml , vector lyse 500 ml , vector rinse 20 liter , vtm kit , w.b.c diluting fluid500ml , w.b.c pipette , weighin machine 500 gm (manual type) , weighing machine 100 kg. , weighing scale 1 kg manual , widal test kit (slide ) 2x25 test , xylene , z.n. stain solution , thermal graph round for 80°c refridgrator , thermal graph round for 40°c refridgrator , thermal graph round for platlets agitator refri , fistula canula 16 no. , sdp acd solution 1000 ml , sdp ns solution 1000 ml , waffers for tube cutting machine , normal saline technical 5 liter , centrifuge bucket componant 350 ml bag , centrifuge bucket componant 450 ml bag , field stain a&b...

Medical College - Rajasthan

30014570 rate contract for consumable items falcon tubes, elisa plates, ethyl alcohol, micro centrifuge tube, tissue paper roll, glass beaker, filter paper sheet, vtm storage rack, ppe, pipette, tips for micropipette, triple layer mask, sample try96 holes, nuclease free water, thermocol box medium, pcr tube strip, pcr cap, isopropanol molecular grade, mask, sanitizer, power free gloves, sodium hypo chloride, powder free gloves, liquid soap, zip locks, liquid soap, zip locks, slipper etc ...

Government Medical College - Rajasthan

30012493 rate contract for consumable items rate contract for consumable items , falcon tube 50 ml , elisa plate 96 wells (flat bottom) , ethyl alcohol for moleculer biology 500 ml , micro centriufuge tube 1.5 ml , micro centrifuge tube 2 ml , tissue paper roll , glass beaker 2.0 lt (borosil) , filter paper sheet 46x57 hole , vtm storage rack 50 hole , p.p.e including (as per specification attached) , pipette 0 10 ul , pipette 10 100 ul , pipette 100 1000 ul , tips for micropipette 0 10 ul , tips for micropipette 10 100 ul , tips for micropipette 100 1000 ul , triple layer mask , sample try 96 holes , nuclease free water , tharmocol box medium size 18x18x18 , pcr tube strip 0.1 ml (1x8) , pcr cap (1x8) , isopropanol molecular grade , mask n 95 , sanitizer 500 ml , powder free gloves 7 (medium) , sodium hypo chloride , powder free glover 7.5 (large) , liquid soap 250 ml , zip locks , slipper (a blueb redc greend black)...

Geological Survey Of India - Rajasthan

29997367 bids are invited for beaker 500 ml 500 ml capacity, borosilicate glass , beaker 250 ml 250 ml capacity, borosilicate glass , separating funnel 250 ml capacity , measuring cylinder 1000 ml capacity, borosilicate glass , funnel 3 inch, glass material , brush for bottle (nylon) small size, nylon brush , separating funnel stand double funnel stand, wooden/metal , laboratory flask conical flask 250 ml capacity, borosilicate glass , watch glass 3” 3 inch, borosilicate glass , lab tray 340 mm x250 mm (+/ 35mm), metal tray total quantity : 1...

Medical And Health Services - Rajasthan

29829633 supply of x ray sonography and chemical regents in sanwaliya ji govt hospital chittorgarh 2 computerize digital x ray film ( 1x150 ) 3 dental film ( 1x150 ) 4 sonography paper roll 5 sonography jelly 6 e.c.g. jelly 7 e.c.g. paper roll bpl 8 biochemistery reagentblood suger ( end point ) 9 blood urea ( fixed time, end point brith lotreagent ) 10 blood ureabrith lotreagent ) 11 s.creatanine ( fixed time ) 12 cholestrol ( end point ) 13 triglyceride ( end point ) 14 hdl reagent direct 15 bilirubin t&d ( end point ) 16 sgot ( kinetic ) 17 sgpt ( kinetic ) 18 alkaline phosphatase 19 s. a. phosphatas 20 amylase 21 uric acid 22 s. ldh 23 s.ck mb 24 s.ck nac 25 calcium 26 albumin 27 total protine 28 crpquantitative ( turbi ) 29 raquantitative ( turbi ) 30 bio chemistery reagents for fully autometicwash 1 31 wash 2 32 blood sugar 33 blood urea 34 blood creatinine 35 blood cholesterol 36 blood triglycerides 37 hdl 38 blood bilirubin total 39 blood bilirubin direct 40 blood s.g.p.t. 41 blood s.g.o.t. 42 blood total protein 43 blood albumin 44 alk. phos. 45 uric acid 46 calcium 47 amylase 48 ck mb 49 ck nac 50 ldh 51 crp 52 auto wash 53 xl wash 54 erba norm 55 xl multical 56 albumin 57 alkaline phosphatase 58 bilirubin direct 59 bilirubin total 60 calcium 61 creatinine enzymatic 62 creatininejaffe 63 cholestorele 64 glucose ( god pod ) 65 glucose hexokinase uv 66 total protine 67 trigl yceride 68 crp control low 69 sgot el 70 sgpt 71 amylase 72 urea 73 uric acid 74 hdl cholesterol with calibrator 75 ldh p 76 phosphorus 77 rapid test 78 hbsag 79 hcv rapid 80 dengue combo ns1 antigen+lgg 1gm antibodytest 81 dengue antibody test 82 malariyaantigen test 83 pregnancy test 84 thaypi dot test 85 scrub thypus igm antibody test 86 chikungunya igm antibody test 87 vdrl test strip 88 urine albumin sugar test 89 urine analyser test strip 10 paramiter 90 leptospirosis elisa kit 91 elisa test kit for lab 92 dengue ns1ag microlisa 93 scrub typhus igm elisa 94 chikungunya igmelisa 95 dengue 1gm microlisa 96 leptospirosis elisa kit 97 regents for 5 part hematology analyser ( trans ) 98 h 560 diluent 99 h 560 lyse 1 100 h 560 lyse 2 101 h 560 elite h clean 102 h 560 controls ( h.n.l ) 103 h 560 calibrator 104 regents for 5 part hematology analyser ( mindray ) 105 m 52 diluents 106 m 52 diff lyse 107 m 52 lh lyse 108 probe cleaner 109 regents for ecl 105 110 erbaprotime ls 111 erba actime 112 erba calcium chloride 113 erba ddimer 114 erba ddimer calibrator 115 erba ddimer control n+p 116 erba single reactioncuvettes src 10 117 thermal printer paper rolles 3x57 mmx15m 118 test kit forictc ( subject tonacoapproved ) 119 hiv tridot 120 hiv comb 121 rekteble neddle 122 vacuum 3.8 % sodium citrate esrblood collection. tube 123 floride blood collection vail 124 blood sample trensport vail ct gel 125 elisa kits for blood bank ( subject tonacoapproved ) 126 h.i.v.kit 127 h.c.v. kit 128 hbs ag. kit 129 reagents for blood bank 130 bovine albumin 131 anti a1b 132 anti “a1, ( lectin ) 133 anti “h” 134 anti “d”. igg+igm ( monoclonal ) 135 anti humen globuline ( ahg ) 136 blood grouping anti sera abd 137 r.p.r. test ( latex ) 138 cpda blood collection bag 350 ml 139 cpda blood collection bag 100 ml 140 cpda blood collection bag triple 350 ml 141 cpda blood collection bag triple 450 ml 142 cpda blood collection bag double 350 ml 143 cpda blood collection bag penta 450 ml 144 screw cap vial plain 5 ml 145 tourniquit belt ( standred quality ) 146 glass droper ( pauster pipet ) 147 hb haemocue 301 cuvet 148 serology kits 149 r.a. factor 150 widal test 151 crp test qualitative 152 aso test 153 others 154 vtm 155 perafilms tape roll 4 inchx125 f.t. ) 156 n / 10hcl 157 3.8% sodium citrate 158 field’s stain a 159 field’s stain b 160 10% soduum hypo. 161 k3 vaccuim blood collection duble cape vail 162 clot activator vail gel 2 ml 163 citratevail2 ml 164 yellow tips 165 blue tips 166 micro slide 167 test tube 12*100mm 168 test tube 12*75mm 169 test tube plastic 170 lab use tissue paper roll 171 test tube stand 48 holes 172 micro auto pipet 173 micro auto pipet 174 micro auto pipet 175 micro auto pipet 176 micro auto pipet 177 micro auto pipet 178 micro auto pipet 179 mathnol 180 urine dispo contaner plastic 50 ml 181 bio waste bag ( red, yellow, black, blue colour ) 182 cover slip 183 gimsa stain solution 184 leisman stain 185 glycerin 186 zedinol 187 glass beaker 500 ml 188 glass beaker 250 ml 189 glass beaker 100 ml 190 liquid parrafin 191 gluco strip with glucometer 192 auto pipete 193 auto pipete 194 auto pipete 195 auto pipete 196 auto pipete 197 multi channel auto pipete ( 8 channel ) 198 multi channel auto pipete ( 8 channel ) 199 e.c.g. roll 200 bandaid ( round ) 201 gel card for cross match 202 gel card for blood group 203 liquid handwash 204 urine analyser printer pepar roll 50 / 52 mm x ray, & sonography items, computerize digital x ray film (1x150), dental film (1x150), sonography paper roll, sonography jelly, e.c.g. jelly, e.c.g. paper roll bpl, biochemistery reagentblood suger (end point), blood urea (fixed time,end point brith lot reagent), blood urea brith lot reagent), s.creatanine (fixed time), cholestrol (end point), triglyceride (end point), hdl reagent direct, bilirubin t&d (end point), sgot (kinetic), sgpt (kinetic), alkaline phosphatase, s. a. phosphatas, amylase, uric acid, s. ldh, s.ck mb, s.ck nac, calcium, albumin, total protine, crp quantitative(turbi), ra quantitative (turbi), bio chemistery reagents for fully autometicwash 1, wash 2, blood sugar, blood urea , blood creatinine, blood cholesterol, blood triglycerides, hdl, blood bilirubin total, blood bilirubin direct, blood s.g.p.t., blood s.g.o.t., blood total protein, blood albumin, alk. phos., uric acid, calcium, amylase, ck mb, ck nac, ldh, crp, auto wash, xl wash, erba norm, xl multical, albumin, alkaline phosphatase, bilirubin direct, bilirubin total, calcium, creatinine enzymatic, creatinine jaffe, cholestorele, glucose (god pod), glucose hexokinase uv, total protine, trigl yceride, crp control low, sgot el, sgpt, amylase, urea, uric acid, hdl cholesterol with calibrator, ldh p, phosphorus, rapid test, hbsag, hcv rapid, dengue combo ns1 antigen+lgg 1gm antibody test, dengue antibody test, malariya antigen test, pregnancy test, thaypi dot test, scrub thypus igm antibody test, chikungunya igm antibody test, vdrl test strip, urine albumin sugar test, urine analyser test strip 10 paramiter, leptospirosis elisa kit, elisa test kit for lab, dengue ns1ag microlisa, scrub typhus igm elisa, chikungunya igm elisa, dengue 1gm microlisa, leptospirosis elisa kit, regents for 5 part hematology analyser (trans), h 560 diluent, h 560 lyse 1, h 560 lyse 2, h 560 elite h clean, h 560 controls (h.n.l), h 560 calibrator, regents for 5 part hematology analyser (mindray), m 52 diluents, m 52 diff lyse, m 52 lh lyse, probe cleaner, regents for ecl 105, erba protime ls, erba actime, erba calcium chloride, erba ddimer, erba ddimer calibrator, erba ddimer control n+p, erba single reaction cuvettes src 10, thermal printer paper rolles 3x57 mmx15m, test kit for ictc( subject to naco approved), hiv tridot, hiv comb, rekteble neddle, vacuum 3.8 % sodium citrate esr blood collection. tube, floride blood collection vail, blood sample trensport vail ct gel, elisa kits for blood bank( subject to naco approved), h.i.v.kit, h.c.v. kit, hbs ag. kit, reagents for blood bank, bovine albumin, anti a1b, anti “a1, (lectin), anti “h”, anti “d”. igg+igm (monoclonal), anti humen globuline(ahg), blood grouping anti sera abd, r.p.r. test (latex), cpda blood collection bag 350 ml, cpda blood collection bag 100 ml, cpda blood collection bag triple 350 ml, cpda blood collection bag triple 450 ml, cpda blood collection bag double 350 ml, cpda blood collection bag penta 450 ml, screw cap vial plain 5 ml, tourniquit belt(standred quality), glass droper(pauster pipet), hb haemocue 301 cuvet, serology kits, r.a. factor, widal test, crp test qualitative, aso test, others, vtm, perafilms tape roll 4 inchx125 f.t.), n/10hcl, 3.8% sodium citrate, field’s stain a, field’s stain b, 10% soduum hypo., k3 vaccuim blood collection duble cape vail, clot activator vail gel 2 ml, citrate vail 2 ml, yellow tips, blue tips, micro slide, test tube 12*100mm, test tube 12*75mm, test tube plastic, lab use tissue paper roll, test tube stand 48 holes, micro auto pipet, micro auto pipet, micro auto pipet, micro auto pipet, micro auto pipet, micro auto pipet, micro auto pipet, mathnol, urine dispo contaner plastic 50 ml, bio waste bag (red,yellow,black,blue colour), cover slip, gimsa stain solution, leisman stain, glycerin, zedinol, glass beaker 500 ml, glass beaker 250 ml, glass beaker 100 ml, liquid parrafin, gluco strip with glucometer, auto pipete, auto pipete, auto pipete, auto pipete, auto pipete, multi channel auto pipete (8 channel), multi channel auto pipete(8 channel), e.c.g. roll, bandaid (round), gel card for cross match, gel card for blood group, liquid handwash, urine analyser printer pepar roll 50/52 mm etc ...

Medical Health And Family Welfare - Rajasthan

29825109 supply of chemical and regents in govt hospital chittorgarh x ray, & sonography items 2 computerize digital x ray film ( 1x150 ) 3 dental film ( 1x150 ) 4 sonography paper roll 5 sonography jelly 6 e.c.g. jelly 7 e.c.g. paper roll bpl 8 biochemistery reagentblood suger ( end point ) 9 blood urea ( fixed time, end point brith lotreagent ) 10 blood ureabrith lotreagent ) 11 s.creatanine ( fixed time ) 12 cholestrol ( end point ) 13 triglyceride ( end point ) 14 hdl reagent direct 15 bilirubin t&d ( end point ) 16 sgot ( kinetic ) 17 sgpt ( kinetic ) 18 alkaline phosphatase 19 s. a. phosphatas 20 amylase 21 uric acid 22 s. ldh 23 s.ck mb 24 s.ck nac 25 calcium 26 albumin 27 total protine 28 crpquantitative ( turbi ) 29 raquantitative ( turbi ) 30 bio chemistery reagents for fully autometicwash 1 31 wash 2 32 blood sugar 33 blood urea 34 blood creatinine 35 blood cholesterol 36 blood triglycerides 37 hdl 38 blood bilirubin total 39 blood bilirubin direct 40 blood s.g.p.t. 41 blood s.g.o.t. 42 blood total protein 43 blood albumin 44 alk. phos. 45 uric acid 46 calcium 47 amylase 48 ck mb 49 ck nac 50 ldh 51 crp 52 auto wash 53 xl wash 54 erba norm 55 xl multical 56 albumin 57 alkaline phosphatase 58 bilirubin direct 59 bilirubin total 60 calcium 61 creatinine enzymatic 62 creatininejaffe 63 cholestorele 64 glucose ( god pod ) 65 glucose hexokinase uv 66 total protine 67 trigl yceride 68 crp control low 69 sgot el 70 sgpt 71 amylase 72 urea 73 uric acid 74 hdl cholesterol with calibrator 75 ldh p 76 phosphorus 77 rapid test 78 hbsag 79 hcv rapid 80 dengue combo ns1 antigen+lgg 1gm antibodytest 81 dengue antibody test 82 malariyaantigen test 83 pregnancy test 84 thaypi dot test 85 scrub thypus igm antibody test 86 chikungunya igm antibody test 87 vdrl test strip 88 urine albumin sugar test 89 urine analyser test strip 10 paramiter 90 leptospirosis elisa kit 91 elisa test kit for lab 92 dengue ns1ag microlisa 93 scrub typhus igm elisa 94 chikungunya igmelisa 95 dengue 1gm microlisa 96 leptospirosis elisa kit 97 regents for 5 part hematology analyser ( trans ) 98 h 560 diluent 99 h 560 lyse 1 100 h 560 lyse 2 101 h 560 elite h clean 102 h 560 controls ( h.n.l ) 103 h 560 calibrator 104 regents for 5 part hematology analyser ( mindray ) 105 m 52 diluents 106 m 52 diff lyse 107 m 52 lh lyse 108 probe cleaner 109 regents for ecl 105 110 erbaprotime ls 111 erba actime 112 erba calcium chloride 113 erba ddimer 114 erba ddimer calibrator 115 erba ddimer control n+p 116 erba single reactioncuvettes src 10 117 thermal printer paper rolles 3x57 mmx15m 118 test kit forictc ( subject tonacoapproved ) 119 hiv tridot 120 hiv comb 121 rekteble neddle 122 vacuum 3.8 % sodium citrate esrblood collection. tube 123 floride blood collection vail 124 blood sample trensport vail ct gel 125 elisa kits for blood bank ( subject tonacoapproved ) 126 h.i.v.kit 127 h.c.v. kit 128 hbs ag. kit 129 reagents for blood bank 130 bovine albumin 131 anti a1b 132 anti “a1, ( lectin ) 133 anti “h” 134 anti “d”. igg+igm ( monoclonal ) 135 anti humen globuline ( ahg ) 136 blood grouping anti sera abd 137 r.p.r. test ( latex ) 138 cpda blood collection bag 350 ml 139 cpda blood collection bag 100 ml 140 cpda blood collection bag triple 350 ml 141 cpda blood collection bag triple 450 ml 142 cpda blood collection bag double 350 ml 143 cpda blood collection bag penta 450 ml 144 screw cap vial plain 5 ml 145 tourniquit belt ( standred quality ) 146 glass droper ( pauster pipet ) 147 hb haemocue 301 cuvet 148 serology kits 149 r.a. factor 150 widal test 151 crp test qualitative 152 aso test 153 others 154 vtm 155 perafilms tape roll 4 inchx125 f.t. ) 156 n / 10hcl 157 3.8% sodium citrate 158 field’s stain a 159 field’s stain b 160 10% soduum hypo. 161 k3 vaccuim blood collection duble cape vail 162 clot activator vail gel 2 ml 163 citratevail2 ml 164 yellow tips 165 blue tips 166 micro slide 167 test tube 12*100mm 168 test tube 12*75mm 169 test tube plastic 170 lab use tissue paper roll 171 test tube stand 48 holes 172 micro auto pipet 173 micro auto pipet 174 micro auto pipet 175 micro auto pipet 176 micro auto pipet 177 micro auto pipet 178 micro auto pipet 179 mathnol 180 urine dispo contaner plastic 50 ml 181 bio waste bag ( red, yellow, black, blue colour ) 182 cover slip 183 gimsa stain solution 184 leisman stain 185 glycerin 186 zedinol 187 glass beaker 500 ml 188 glass beaker 250 ml 189 glass beaker 100 ml 190 liquid parrafin 191 gluco strip with glucometer 192 auto pipete 193 auto pipete 194 auto pipete 195 auto pipete 196 auto pipete 197 multi channel auto pipete ( 8 channel ) 198 multi channel auto pipete ( 8 channel ) 199 e.c.g. roll 200 bandaid ( round ) 201 gel card for cross match 202 gel card for blood group 203 liquid handwash 204 urine analyser printer pepar roll 50 / 52 mm...

Medical Health And Family Welfare - Rajasthan

29796963 srno.01 supply of chemical and reagents items in govt laboratory district hospital chittorgarh , ( a ) biochemisteryreagent blood suger ( end point ) 500 ml , blood urea ( fixed time, end point brith lotreagent ) 100ml , s.creatanine ( fixed time ) 100ml , cholestrol ( end point ) 100ml , triglyceride ( end point ) 100ml , hdl reagent direct 100ml100ml , bilirubin t&d ( end point ) 100ml , sgot ( kinetic ) 100ml , sgpt ( kinetic ) 100ml , alkaline phosphatase100ml , s. a. phosphatas100ml , amylase 100ml , uric acid 100ml , s. ldh 100ml , s.ck mb 100ml , s.ck nac 100ml , calcium 100ml , crp ( turbi ) 100ml , albumin 100ml , total protine 100ml , crpquantitative ( turbi ) 100ml , raquantitative ( turbi ) 100ml , ( b ) test card hbsag card 100 test , hcv rapid card 100 test , denguens1 antigen test card 100 test , dengue antibody test card 100 test , malariyaantigen test card100 test , pregnancy test card100 test , thaypi dot test card 50 test , surub thypus igm antibody test card50 test , chikungunya igm antibody test card50 test , ( c ) test strip pregnancy strip 50test , vdrl strip 50test , malaiyarapid antigen test ( strip ) 24 test , urine albumin sugar100 test , urine analyser test strip 10 paramiter 100 test , ( d ) elisa test kit for lab dengue ns1ag microlisa 96 test , scrub typhus igm elisa96 test , chikungunya igmelisa 96 test , t3, t4, tsh elisa test kit 96 test , ( e ) test kit forictc ( subject tonacoapproved ) hiv card50 / 100 t , hiv tridot 50 / 100 t , hiv comb 48 / 96 t , hiv signal dot 50 / 100 t , rekteble neddle 100 , vacuum 3.8 % sodium citrate esr blood collection. tube100 tube , ( f ) elisa kits for blood bank ( subject tonacoapproved ) h.i.v.kit 96 testeach kit , h.c.v. kit96 testeach kit , hbs ag. kit96 testeach kit , ( g ) reagents for blood bank igg+igm monoclonalanti abd 3x10ml , bovine albumin5ml , anti a1b10ml , anti “a1, ( lectin ) 10ml , anti “h” 10ml , anti “d”. igg+igm ( monoclonal ) 10 / 05 ml , anti humen globuline ( ahg ) 10*3 ml , blood grouping anti sera abd10*3 ml , r.p.r. test ( latex ) 50 test , cpda blood collection bag350 ml , cpda blood collection bag100 ml , screw cap vial plain 5 ml , tourniquit belt ( standred quality ) 100 per pack , glass droper ( pauster pipet ) , hb haemocue 301 cuvet200 t , ( i ) serology kits as per 50 test r.a. factor 50 test , widal test , crp test qualitative , aso test , prothurombin kit , ( j ) others as per ml, kg and per piece items rate gimsa stain solution , leisman stain , glycerin , zedinol , glass beaker , liquid parrafin , k 3 edta vial ( double cap / ce approved ) , gluco strip with glucometer , bio waste beg ( red, yellow, black, blue colour ) , vacutainer neddle , vacutainer holder , floride blood collection vail , blood sample transport vail ctgel , liqued hand wash , urine analyser printer paper roll 50 / 52 mm , d.water , glass micro slide , glass test tube 12*100mm , glass test tube 12*75mm , test tube plastic , tissu paper roll , test tube stand , hb tube round , automicro pipet , automicro pipet , automicro pipet , automicro pipet , automicro pipet , automicro pipet , automicro pipet , multi channel auto pipete , multi channel auto pipete ( 8 channel ) , multi channel auto pipete ( 8 channel ) , mathenol , hb meter , urine dispo contaner plastic , glass cover slip , n / 10 hcl , 3.8% sodium citrate , field’s stain a , field’s stain b , 10 %sodium hypo. , edta k2, k3 vaccuim blood collection tuble cape vail , clot activator vail , yellow tips , blue tips , reagents for haemo dialysis av fistula needle pair ( 2 piece ) 16 g , dialyzer with tubbing surface 1.3 sqm , dialyzer with tubbing surface 1.3 sqm , haemo dialysis solutionbi carb part ( a ) , haemo dialysis solution bi carb part ( b ) powder , dialyzer reprocessing cold sterilent for tuscano – dcs fsparacetic acid 4% hydrogen peroxide 21% , hot sterilent for 21% citric acid + malic acid + lactic acid , hd machine21% citric acid + malic acid + lactic acid , doublelumen catheterkit for subclavian / internal juglar cathateradult , doublelumen cathaterkit for subclavian / internal juglar catheter pediatric , liq. hydrogen peroxide 30% , liq. formaline 40% , liq. sodium hypochloride5% , hd solution acetate , acetic acid glacior , bi bag with bi carb solutionfrusenious , citrosterile solution frusenious , dia safe plus filter frusenious...

Medical And Health Services - Rajasthan

29788180 supply of chemical and regents in district hospita laboratary chittorgrah ja ) blochemisteryreagent — 1 blood suger 500 ml 2 jend point ) blood urea ( fixed time, end point brith lot reagent ) 100ml — 3 s.creatanjne ( fixed time ) 100 ml 4 cholestrol ( end point ) 100 ml 5 triglyceride ( endpoint ) 100 ml 6 hdl reagent direct 100 ml 7 bilirubin t&d ( endpoint ) 100 ml 8 sgot ( kinetic ) 100 ml 9 sopt ( kinetic ) 100 ml 10 alkaline phosphatase 100 ml 11 s. a. phosphatas 100 ml — 12 amylase 100 ml 13 uric acid 1o0ml 14 s.ldh 15 s.ck mb 16 s.ck nac 17 calcium 18 crp ( turbi ) 19 albumin 20 total pro1tne 21 crp quantitative ( turbi ) 22 ra quantitative iturb i ) jb ) test_card 23 hbsag card 24 hcv rapid card 25 dingue nsi antigen test card 26 dengue antibody test card 27 malariya antigen test card 28 pregnancy test card 29 thaypi dot test card 30 surub ti iypus 1gm antibody_test card 31 chikungunya 1gm antibody test card ( c ) test strip 32 pregnancy strip 33 vdrl strip 34 malaiya rapid antigen test ( strip ) 35 urine albumin sugar 36 urine analyser test strip 10 paramiter ( d ) elisa test kit for lab 37 denguensiag mjcrolisa 38 scru8 typhus 1gm elisa 39 chikungunya 1gm elisa 40 t3, t4, tsh elisa test kit ( e ) test kit for ictc 41 hiv card 42 f { iv tridot 43 f { iv comb 44 hiv signal dot 45 rekteble neddle 46 vacuum 3.8% sodiium citrate esr blood collection. tube — — .f.w.w.4sina.&4 s t ( f ) elisa kits for blood bank ( subject to naco approved ) 47 h.l.v.kit 96 test each_kit per kit 48 h.c.v.kit 96 test each_kit per kit 49 hbs ag. kit 96 test each.kit per kit ( g ) reagents for blood bank 50 igg+igm monoclonal antiabd 3xl0mi per vial 3xl0ml. 51 bovine albumin 5ml per vial 52.antia1b j0mi per vial 53 anti “a 1, ( lectin ) l0ml per vial 55 anti 1 ) ”. igg+lgm ( monoclonal ) 56 anti ilumcn _... globuline ( aiig ) 57 58 59 cpda blood collection bag 60 cpda blood collection bag 61 screw cap vial plain 5 ml 62 tourmiquit belt ( standred quality ) 63 glass droper ( pauster pipet ) 64 hb haemocue 301 cuvet j serolody kits 65 r.a. factor 66 widal test 67 crp test quslitative 68 aso test 69 prothuronibin kit biood grouping anti sera abo..i r.p.r. test ( latex ) ( j ) others 70 gimsa stain solution 71 leisman stain 72 glycerin 73 zedinol 74 — glass beaker 75 liquid parrafin 76 k 3 edta vial ( double cap? ce appwvcd ) 77 gluco strip with glucometer 78 bio waste beg ( redyeliow, i3lack, blue vacutainer neddle 80 vacutainer holder 81 floride blood collection vail — v 82 blood sample transport vail ctgel 83 lioued hand wash urine analyser __ printer paper roll 50152mm 85 d.water 86 glass micro slide 87 glass testtube 12*100mm 88 glass test tube 12*75mm 89 test tube plastic 90 tissu paper roll 91 test tube stand 92 tube round automicro pipet 94 automicro pipet 95 automicro pipet 96 automicro pipet 97 automicro pipet 98 automicro pipet 99 automicro pipet 100 multi channel auto pipete 101 multi channel auto ____ pipete (8 channel) 102 multi channel auto _ pijpete(8 channel) 103 mathenol 104 meter 105 urine dispo __. contaner plastic 106 glass cover slip 1 av fistula needle pair 2piece) 2 dialyzer with tubbing 3 diatyzer with tubbing 4 haemo dialysis solution 5 haerno diatysis solution 6 dialyzer reprocessing cold sterilent for tuscano — dcs_ __? fs 7 hot sterilent for _.._ hd machine 8 double lumen catheter kit for subclavian / internal juglar cathater 9 double lumen cathater kit for subclavian / intemnal juglar catheter 10 liq. hydrogen peroxide 30% i i liq. formaline 40% 12 liq. sodium hypochloride 5% 13 hd solution acetate 14 acetic acid glacior 15 bi bag with bi carb solution 16 j ciirosierjle solgtion 17 t dia safe plus filter etc 107 n/1ohcl 108 3.8% sodium c itrate 109 field’s statn a .110 field’ s stain b 10% sodium hypo. 112 edtak2,k3 vaccuim blood collection tuble cape vail 113 clot activator vail 114 yellow tips 115 blue tips ...

Medical Health And Family Welfare - Rajasthan

29623232 supply of various types of test kits, rejents and materials for laboratory and blood bank at mahatma gandhi hospital bhilwara supply of various types of test kits, rejents and materials for laboratory and blood bank at mahatma gandhi hospital bhilwara , n / 10 hcl ( h b meter sahilis ) 1x500 ml , hb meter tube ( square ) ( h b meter sahilis ) 1x1 tube , whatsmans filter paper ( circular ) ( bt manual ) 1x100 pcs , lancet ( bt manual ) 1x100 pcs , lancet ( bt manual ) 1x200 pcs , capillary tube fine ( bt ct manual ) 1x100 tube , wbc diluting fluid ( tlc manual ) 1x500 ml , neubar chamber ( tlc manual ) 1x1 unit , wbcpipette ( tlc manual ) 1x1 pcs , methanol ( dlc & pbf manual ) 1x2.5 ltr , methanol ( dlc & pbf manual ) 1x500 ml , field stain ( dlc & pbf manual ) 1x500 ml a+1x500 ml b ( a+b ) kit , field stain ( dlc & pbf manual ) 1 kit , glass slides ( dlc & pbf manual ) 1x50 slide pkt , cedar wood oil ( dlc & pbf manual ) 1x500 ml , platelate count fliud ( dlc & pbf manual ) 1x100 ml , petridish ( for moisture ) ( dlc & pbf manual ) 1*1 pcs , petridish glass small ( 1x1 ) , petridish glass medium ( 1x1 ) , reticulocytecount fliud ( dlc & pbf manual ) 1x100 ml , mgg stain ( dlc & pbf manual ) 1 kit , rapid papstain ( dlc & pbf manual ) 1 kit , leishmansstain ( dlc & pbf manual ) 1*500 ml cytochrome+1x500 ml stock buffer ( 2x ) , leishmansstain ( dlc & pbf manual ) 1 kit , esr stand with marking ( esrmanual ) 1x1 pcs , esr test cup ( plastic ) ( esrmanual ) 1x500 cup pkt , esr pipette ( glass ) ( esrmanual ) 1x5 pipette , esr pipette with bulb ( disposable autosuck ) ( esr manual ) 1x100 pipette , tri sodium citrate 3.8% ( solution ) ( esr manual ) 1x500 ml , stop watch ( esr manual ) 1x1 pcs , k3 edta tube ( double cap ) cbc ( 1x100 tube pkt ) , eosinophil diluting fluid ( tec manual ) 1x125 ml , rbc pipette ( tec manual ) 1x1 , urine albumin / sugar strip ( manual ) 1x100 strip , container 50 ml capacity disposable with screw cap plastic ( urine albumin / sugar manual ) 1x100container , multi stix ( urine complete manual ) 16 parameter 1x100 stix , multi stix ( urine complete manual ) 12 parameter 1x100 stix , paper roll 2 thermostat ( urine complete manual ) ( 1x1 roll ) , cover slip ( urine complete manual ) ( 1x50x20 ) , urine pregnancy test strip ( manual ) ( 1x100 strip ) , urine pregnancy test strip ( manual ) ( 1x50 strip ) , urine pregnancy test card ( manual ) ( 1x30 card ) , urine pregnancy test card ( manual ) ( 1x50 card ) , lugols iodine ( stool test manual ) ( 1x125 ml ) , benedict reagent ( common reagent for urine stool manual ) ( 1x500 ml ) , 3% sulfosalicylic acid ( common reagent for urine stool manual ) ( 1x500 ml ) , modified rothras nitropruside ( common reagent for urine stool manual ) ( 1x250 gm ) , 33% acetic acid ( common reagent for urine stool manual ) ( 1x500 ml ) , 5% barrium chloride powder ( common reagent for urine stool manual ) ( 1x500 gm ) , fouchetes reagents ( common reagent for urine stool manual ) ( 1x125 ml ) , sulpher powder ( common reagent for urine stool manual ) ( 1x400 gm ) , hydrogen peroxide ( common reagent for urine stool manual ) ( 1x400 ml ) , benzidine powder ( common reagent for urine stool manual ) ( 1x25 gm ) , semen diluting fluid ( semen analysis manual ) ( 1x100 ml ) , keto diastic ( for urine manual ) ( 1x50 ) , hemo spot test for occult blood ( 1x100 ) , hemo spot test for occult blood ( 1x200 ) , glass jar ( for staining ) 150ml ( 1x1 ) , glass jar ( for staining ) 250ml ( 1x1 ) , trop t rapid ( cardic enzyme test ) ( 1x1 ) , trop irapid ( cardic enzyme test ) ( 1x1 ) , sky blue cap tube ( for pt inr ) ( 1x100 ) , trbc fluid ( rbc count manual ) ( 1x100 ml ) , wintrobes tube with pipette ( for pcv manual ) ( 1x1 ) , coombs reagent ( abo rh agglutination, slide ) ( 1x5 ml ) , coombs reagent ( abo rh agglutination, slide ) ( 1x10 ml ) , bovine albumin 22% ( abo rh agglutination, slide ) ( 1x5 ml ) , bovine albumin 22% ( abo rh agglutination, slide ) ( 1x10 ml ) , blood sugar reagent enzymatic ( for semi auto god / pod ) ( 2x200 ml ) , urea berthlot ( for semi auto urease end point ( liquid ) ) ( 2x100 ml ) , urea kinetic ( for semi auto ) ( 5x20 ml ) , creatinine ( jaffes for semi auto, initial rate ) ( r1 2x60 ml r2 2x60 ml ) , sgot for semi auto ( without pridoxal phosphate ifcc method ) ( 5x20 ml ) , sgpt for semi auto ( without pridoxal phosphate ifcc method ) ( 5x20 ml ) , alkaline phosphate kinetic ( for semi auto, pnpp ) ( 12x5 ml ) , total protein ( semi auto analyzwer ) ( 2x50 ml ) , albumin ( semi auto analyzwer ) ( 2x50 ml ) , bilirubin total ( for semi auto, jendrassik & grof ( 1x200 ml ) , bilirubin direct ( for semi auto, jendrassik & grof ( 1x200 ml ) , uric acid ( for semi auto, mono vial ) ( 1x50 ) , calcium ( for semi auto, mono vail ) ( 1x50 ml ) , ck mb kinetic ( for semi auto ) ( r1 2x8 mlr2 2x1 ml ) , ck nac kinetic ( for semi auto ) ( r1 2x8 mlr2 2x1 ml ) , amalyse kinetic ( for semi auto ) ( 2x20 ml ) , cholesterol ( for semi auto, enzymatic ) ( 20x50 ml ) , hdl cholesterol ( for semi auto ) ( 2x20 ml ) , triglycerides enzymatic ( for semi auto ) ( 1x50 ml x4 ) , csf protein fluid ( for csf protein manual ) ( 1x100 ml ) , code free ( blood sugar strip rapid ) ( 1x100 ) , sample cup plastic ( for biochemistry ) ( 1x500 ) , hepatitis b ( hbsag ) card ( 1x100 ) , hepatitis b ( hbsag ) card ( 1x50 ) , hepatitis b ( hbsag ) card ( 1x30 card ) , hepatitis b ( hbsag ) strip ( 1x30 ) , hepatitis b ( hbsag ) strip ( 1x50 ) , hepatitis b ( hbsag ) strip ( 1x100 ) , hepatitis b ( hbsag ) elisa 3rd generation ( 1x96 ) , hepatitis b ( hbsag ) elisa 4th generation ( 1x96 ) , vdrl carbon reagent ( 1*10 ml ) , vdrl elisa anti body test ( 1*96 ) , vdrl rapid strip ( 1x30 ) , vdrl rapid strip ( 1x50 ) , vdrl rapid strip ( 1x100 ) , vdrl rpr ( rapid ) kit ( 1x50tests ) , vdrl rpr ( rapid ) kit ( 1x100 test ) , hiv rapid card triline ( 1x30 ) , hiv rapid card triline ( 1x50 ) , hiv rapid tridot ( 1x50 ) , hiv rapid tridot ( 1x100 ) , hiv rapid combaids ( 1x48 ) , hiv elisa 3rd generation ( 1x96 ) , hiv elisa 4 thgeneration ( 1*96 ) , anti hcv anti bodyrapid card ( 1x30 ) , anti hcv anti bodyrapid card ( 1x50 ) , hcv elisa 3 rd generation ( 1x96 ) , hcv elisa 4thgeneration ( 1x96 ) , malaria rapid card antigen / ldh ( 1x30 ) , malaria rapid card antigen / ldh ( 1x50 ) , malaria rapid card antigen / ldh ( 1x100 ) , malariaelisa pan antigen ( 1*96 ) , pan malaria ( rapid pf / pv ) ( 1x100 ) , pan malaria ( rapid pf / pv ) ( 1x50 ) , pan malaria ( rapid pf / pv ) ( 1x30 ) , widal test kit ( vials ) ( to, th, ah, bh ) agglutination rgf ) ( 1*4*5 ml ) , typhoid igm antibody card test ( 1x1 ) , aslo kit ( agglutination ) ( 1x50 ) , aslo kit ( agglutination ) ( 1x100 ) , r.a. factor kit ( agglutination, qualitative ) ( 1x50 ) , r.a. factor kit ( agglutination, qualitative ) ( 1x100 ) , jsb i ( mp test slide method ) ( 1x500 ml ) , jsb ii ( mp test slide method ) ( 1x500 ml ) , z.n. stain rapid kit ( sputum for afb ) ( 1x2x100 ml ) , z.n. stain rapid kit ( sputum for afb ) 1 kit , sprit lamp ( sputum for afb staining ) ( 1x1 ) , geimsa stain , crp ( latex agglutination ) ( 1x100 ) , crp ( latex agglutination ) ( 1x50 ) , dengue rapid antibody ( igg+igm ) +antigen ( ns1 ) combo card ( 1x1 ) , dengue antibody ( igg+igm ) rapid card ( 1x1 ) , dengue antigen ( ns1 ) rapid card ( 1x1 ) , dengue elisa antibody ( igm ) ( 1x48 ) , dengue elisa antibody ( igm ) ( 1x96 ) , dengue elisa antigen ( ns1 ) ( 1x48 ) , dengue elisa antigen ( ns1 ) ( 1x96 ) , scrub tyhpus rapid card ( antibody igm ) ( 1x30 ) , scrub tyhpus elisa ( antibody igm ) ( 1x96 ) , scrub tyhpus elisa ( antibody igm ) ( 1x48 ) , chikungunya rapid card ( antibody igm ) ( 1x30 ) , chikungunya elisa ( antibody igm ) ( 1x48 ) , chikungunya elisa ( antibody igm ) ( 1x96 ) , vtm with swab ( for swine fiu ) ( 1x1 ) , ppe kit ( for swine flu ) ( 1x1 ) , transfer blood bag ( without anti coagulant ) 100 ml ( 1x10x10 ) , transfer blood bag ( without anti coagulant ) 50 ml ( 1x10x5 ) , blood collection bag ( cpda single bag ) 350 ml ( 1x10x10 ) , blood collection bag ( cpda single bag ) 100 ml ( 1x10x10 ) , blood collection bag ( cpda double bag ) 350 ml ( 1x6x10 ) , blood collection bag ( cpda double bag ) 450 ml ( 1x6x10 ) , blood collection bag ( cpda tripple bag withoutsagam ) 450 ml ( 1x5x10 ) , blood collection bag ( cpda tripple bag withsagam ) 450 ml ( 1x5x10 ) , blood collection bag ( cpda tripple bag with sagam ) 350 ml ( 1x5x10 ) , blood collection bag ( cpda quadriplebag with sagam ) 350 ml ( 1x4x10 ) , blood collection bag ( cpda quadriplebag with sagam ) 450 ml ( 1x4x10 ) , bio medical waste white bucket with pedal top 25 lit. ( 1x1 ) , ns ( 0.9% ) normal saline ( 1x500 ml ) , test tube rack plastic 1x96 wells ( 1x1 ) , soft ball ( exercise ball ) ( 1x8 ) , pipette stand plastic ( 1x1 ) , antisera stand plastic ( 1x1 ) , antisera anti a1 lactin ( 1x5 ml ) , antisera anti h ( 1x5 ml ) , anti a polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , anti b polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , anti d polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , a, b, d vial ( abo rh agglutination, slide ) ( 1x3x10 ml ) , anti sera amonoclonal ( abo rh agglutination, slide ) ( 1x10 ml ) , anti sera bmonoclonal ( abo rh agglutination, slide ) ( 1x10 ml ) , anti sera dmonoclonal ( abo rh agglutination, slide ) ( 1x10 ml ) , glass test tube 4 ( 1x100 ) , glass test tube 3 ( 1x100 ) , disposable mask ( 1x100 ) , disposable mask ( 1x50 ) , mask tripple layer ( 1x1 ) , mask n 95 ( 1x1 ) , dropper plastic 5 ml ( 1x100 ) , micropore transparent tape 1 ( 1x1 ) , micropore transparent tape 3 ( 1x1 ) , band aid ( 1x100 ) , tongue dipresser wooden ( 1x100 ) , zipper polythen ( for packing medium size ) ( 1x100 ) , printer ribbon dot matrix ( 1x10 ) , vaccutainer ( red top ) for biochemistry 5ml ( 1x100 ) , bio medical waste greenbucket with pedal top 25 lit. ( 1x1 ) , bio medical waste red bucket with pedal top 25 lit. ( 1x1 ) , bio medical waste blue bucket with pedal top 25 lit. ( 1x1 ) , bio medical waste yellow bucket with pedal top 25 lit. ( 1x1 ) , bio medical waste black bucket with pedal top 25 lit. ( 1x1 ) , gel+clot activatervial with cap ( 1 *100 ) , clot activator vial 4ml ( 1 *100 ) , plain screw cap tube 5ml ( 1x100 ) , oil immersion lens ( for microscope ) ( 1x1 ) , liquid paraffin ( for microscope ) ( 1x500 ml ) , tourniquet ( buckle type ) ( 1x1 ) , touniquiet ( velcro ) ( 1x1 ) , rectified spirit ( 1x500 ml ) , phenyl ( 1x5 ltr ) , lyzol ( 1x5 ltr ) , toilet cleaner ( 1x500 ml ) , acid for washing ( 1x500 ml ) , mop ( 1x1 ) , dusting cloth ( 1x1 ) , doormat 4*6 ( 1x1 ) , glass cleaner ( 1x500 ml ) , puncture proof box ( 1x1 ) , b.p. instrument ( mercury ) ( 1x1 ) , b.p. instrument dial ( 1x1 ) , b.p. instrument digital ( 1x1 ) , b.p. instrument cuff with cover ( 1x1 ) , b.p. instrument armlet rubber ( 1x1 ) , bulb rubber ( 1x1 ) , weight machine digital up to 150 kg ( 1x1 ) , weight machine arroe up to 150 kg ( 1x1 ) , postal scale 1kg ( 1x1 ) , tips stand ( 1x1 ) , beaker glass 250 ml ( 1x1 ) , beaker glass 500 ml ( 1x1 ) , measuring cylinder 250 ml ( 1x1 ) , measuring cylinder 500 ml ( 1x1 ) , measuring cylinder 1 ltr ( 1x1 ) , slipeer rubber ( 1x1 ) , calcium sandoz 100 tablet chewable ( 1x100 ) , bucket blue with sieve ( for bio medical waste ) 25 ltr ( 1x1 ) , bucket red with sieve ( for bio medical waste ) 25 ltr ( 1x1 ) , micro pipette 10ul ( fix volume ) ( 1x1 ) , micro pipette 20ul ( fix volume ) ( 1x1 ) , micro pipette 50ul ( fix volume ) ( 1x1 ) , micro pipette 100ul ( fix volume ) ( 1x1 ) , micro pipette 500ul ( fix volume ) ( 1x1 ) , micro pipette 1000ul ( fix volume ) ( 1x1 ) , micro pipette 5 50ul ( variable ) ( 1x1 ) , micro pipette 20 200ul ( variable ) ( 1x1 ) , micro pipette 100 1000ul ( variable ) ( 1x1 ) , paper gloves ( 1x100 ) , surgical gloves latex disposable ( larg ) ( 1x100 ) , surgical gloves latex disposable ( medium ) ( 1x100 ) , surgical gloves latex disposable ( smsll ) ( 1x100 ) , surgical gloves latex 6 ( 1x1 pair ) , surgical gloves latex6.5 ( 1x1 pair ) , surgical gloves latex7 ( 1x1 pair ) , surgical gloves latex7.5 ( 1x1 pair ) , surgical examinination gloves ( free size ) ( 1x100 ) , hand sanitizer ( liquid ) ( 1x500 ml ) , sodium hypo chloride 5% ( 1x5 ltr ) , test tube rack aluminium ( 1x72 wells ) ( 1x1 ) , test tube rack aluminium ( 1x96wells ) ( 1x1 ) , test tube rack plastic ( 1x48 wells ) ( 1x1 ) , test tube rack plastic ( 1x96 wells ) ( 1x1 ) , test tube rack plastic ( 1x24 wells ) ( 1x1 ) , slide tray aluminium for 20 slides ( 1x1 ) , slide tray aluminium for 24 slides ( 1x1 ) , disposable needle 20 nos ( 1x100 ) , disposable needle 22 nos ( 1x100 ) , disposable needle 24 nos ( 1x100 ) , disposable needle 26 nos ( 1x100 ) , disposable needle 23 nos ( 1x100 ) , disposable syringe 2cc with needle ( 1x100 ) , disposable syringe 5cc with needle ( 1x100 ) , disposable syringe 10cc with needle ( 1x50 ) , blue tips ( 1x500 ) , yellow tips ( micro ) ( 1x1000 ) , tissue paper ( 1x1 roll ) , d.i. water ( 1x5 ltr ) , glass marking pencil ( 1x10 ) , permanent marker pen ( 1x1 ) , marker pen fine tip ( 1x1 ) , cotton ( 1x500 gm ) , cpda penta bag 450 ml ( 1x1x1 ) , cpda penta bag 450 ml ( 1x10x6 ) , cpda penta bag 450 ml ( 1x10x10 ) , d.w. ( 0tds ) ( 1x5ltr ) , digital tharmameter ( 1 pcs ) , lipase ( for semi auto ) , ggt ( for semi auto ) , hba1c ( for semi auto ) , na+ ( for semi auto ) , k+ ( for semi auto ) , cl ( for semi auto ) , glucometer ( code free ) ( 1x1 ) , blood sugar strip code free ( 1x100 ) , accucheck active ( blood sugar strip ) ( 1x50 ) , glucometer cell ( 1x1 ) , carbon bush for centrifuge machine ( 1x2 ) , grams stain ( 1x500 ml ) , diamond pencil ( 1x1 ) , liquid soap for hand wash ( 1x500 ml ) , scalpal blade 11 to 23no ( 1x100 pcs ) , syringe 20 cc with needle ( 1x25 pcs ) , syringe 50 cc with needle ( 1x25 pcs ) , torch igm elisa ( 1x96 ) , torch igm elisa ( 1x48 ) , torch igg elisa ( 1x96 ) , torch igg elisa ( 1x48 ) , hepttitis a elisa ( 1x96 ) , hepttitis a elisa ( 1x48 ) , thermal printer paper roll ( size 57x25mm ) ( 1x12 ) , anti hav rapid card ( 1x50 ) , anti hev rapid card ( 1x50 ) , hiv elisa ( igg+igm+antibody combo ) ( 1x96 ) , hiv elisa ( igg+igm+antibody combo ) ( 1x48 ) , surgical knife blade 23 no. ( 1x100 ) , clear glass round shape ( 30 ml ) , aluminium screw for 30 ml glass bottle ( 30 ml ) , bath soap , gdw 5% ( glass bottle ) ( 500 ml ) , ns ( glass bottle ) ( 500 ml ) , bio medical waste bag black 50ltr ( 1x100 ) , digital weighing machine cell ( 1x1 ) , pencil cell ( small / medium ) ( 1x1 ) , liss / coombs ( 24x12 ) , diluent ( 1x500 ml ) , abo / rh ( 4x12 ) , abo / d+ reverse ( 24x12 ) , binocular microscope eye piece 10 x ( 1x1 ) , binocular microscope eye piece 5 x ( 1x1 ) , binocular microscope objective lens 10 x ( 1x1 ) , binocular microscope objective lens 40 x ( 1x1 ) , binocular microscope bulb ( 1x1 ) , anti sera ab ( 1x5 ml ) , glass slide size 75mmx25mmx1.35mm ( blue star ) ( 1x50 ) , anti hav elisa igm ( 1x96 ) , hbsag elisa ( 1x96 ) , hcv tridot pack 4th genration ( 1x100 ) , tpha rapid kit ( 1x1 ) , brucella igm elisa ( 1x96 ) , micropore tap 4 ( 1x1 ) , anti human globulin ( ahg ) ( 1x1 ) , biological indicator of autoclabe machine ( 1 roll ) , anti hbs ag ( hepa card ) pack size ( 1x100test ) , ana ( 16 strips ) , japanese encephalitis igm ( 1x96 tests ) , rota virus igm elisa ( 1x96 ) , rotavirus / adenovirus latex agglutination ( 1x100 test ) , salmonella o ag group c for salmonella 5 ml x 1 ( 1 vial ) , brucella igm elisa ( 96 test / kit ) , measles igm ( mu capture ) ( 1x96 tests ) , hsv 2 card test pack size ( 100 test ) , rubber chestbulb for ecg lead ( 1 pcs ) , bio medical waste greenbucket with pedal top 50 lit. ( 1x1 ) , bio medical waste red bucket with pedal top 50 lit. ( 1x1 ) , bio medical waste blue bucket with pedal top 50 lit. ( 1x1 ) , bio medical waste yellow bucket with pedal top 50 lit. ( 1x1 ) , bio medical waste black bucket with pedal top 50 lit. ( 1x1 ) , plastic bag for biomedical waste 25 ltr red ( 1x100 ) , plastic bag for biomedical waste 25 ltr green ( 1x100 ) , plastic bag for biomedical waste 25 ltr yellow ( 1x100 ) , plastic bag for biomedical waste 25 ltr black ( 1x100 ) , plastic bag for biomedical waste 25 ltr blue ( 1x100 ) , plastic bag for biomedical waste 50 ltr red ( 1x100 ) , plastic bag for biomedical waste 50 ltr green ( 1x100 ) , plastic bag for biomedical waste 50 ltr yellow ( 1x100 ) , plastic bag for biomedical waste 50 ltr black ( 1x100 ) , plastic bag for biomedical waste 50 ltr blue ( 1x100 ) , formaldehyde solution ( 1x5 ltr ) , cotton mop ( 1x1 ) , dry mop ( 1x2 ) , d dimer qualitative ( 1x60 ) , d dimer quantitative ( 1x100 ) , il 6 ( 1x100 ) , pro calcitranin ( 1x101 ) , ferritin ( 1x102 ) , hba1c kit ( 1x103 ) , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) ( 1x500 ml ) , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) 1x1 ltr , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) ( 1x5 ltr ) , deoxycholate citrate agar ( 500 gm ) , mac conkey agar ( 500 gm ) , nutrient agar ( 500 gm ) , cled agar ( 500 gm ) , mycological peptone ( 500 gm ) , mannitol motility agar ( 500 gm ) , christian urea agar ( 500 gm ) , triple sugar iron media ( 500 gm ) , simmons citrate agar ( 500 gm ) , kovacs indole reagent ( 500 gm ) , mannitol powder ( 500 gm ) , glucose powder ( 500 gm ) , lactose powder ( 500 gm ) , sucrose powder ( 500 gm ) , hydrogen peroxide 3 / 6% ( 500 ml ) , oxidase reagent 100 gm ( 100 gm ) , mueller hinton agar ( 500 gm ) , potassium di hydrogen phosphate powder 500gm ( 500 gm ) , robertson’s cooked meat broth medium 500 gm ( 500 gm ) , bile salt powder with cholic acid content >= 45.0%, certified, 250 gm ( 250 gm ) , sda with chloramphenicol500 gm ( 500 gm ) , xylose lysine deoxycholate agar ( xld agar ) ( 500 gm ) , crystal violet powder 100 gm / pack ( 500 gm ) , thioglycollate powder 500 gm ( 500 gm ) , iodine crystals 100 / 500 gm ( 500 gm ) , sodiumbicarbonate 500 gm ( 500 gm ) , ammonium oxalate powder 500 gm ( 500 gm ) , potassium permanganate powder 500gm ( 500 gm ) , calcium chloride 100 gm ( 500 gm ) , zeihl neelsen stain kit500 ml with proper cas number, certified ( 2000 ml ) , brain heart infusion broth 500 gm ( 500 gm ) , acetone 500 ml ( 500 gm ) , leishman stainpractical grade for microsopy twin pack 500 ml ( 500 gm ) , leishman stainpractical grade for microsopy 100 gm powder ( 500 gm ) , bile esculin agar 500 gm ( 500 gm ) , selenite f brothpowder ( 100gm ) ( 100 ml ) , grams stain kit ( 2 ltr ) , dermatophyte test agar & supplement ( 500 gm ) , hi chrome agar for candida 100gm ( 500 gm ) , potassium hydroxide 500 gm ( 500 gm ) , sda with chloramphenicol500 gm ( 500 gm ) , sodium chloride ( anhydrous ) 500 gm ( 500 gm ) , india ink or nigrosin 100 gm ( 100 gm ) , lactophenol cotton blue ( 500 gm ) , albert stain 100 ml each a& b ( 100 ml ) , lowenstein jensen powder 500gm ( 500 gm ) , phenol crystals 500 mg ( 500 gm ) , mannitol motility agar 100 gm ( 100 ml ) , of basal medium 500 gm ( 500 gm ) , ferric chloride powder 500 gm ( 500 gm ) , amikacin ( 30mg ) ( 2000 discs ) , amoxyclav ( 30 mcg ) ( 2000 discs ) , ampicillin ( 2mg ) ( 2000 discs ) , azithromycin ( 15mcg ) ( 2000 discs ) , aztreonam ( 30mcg ) ( 2000 discs ) , bacitracin ( 50 discs / vl ) ( 1000 discs ) , bile esculin discs ( 500 discs ) , cefazolin ( cz ) ( 30 mcg ) ( 2000 discs ) , cefipime ( 30mcg ) ( 2000 discs ) , cefixime ( 5mcg ) ( 2000 discs ) , cefoperazone sulbactum ( 75mcg / 30mcg ) ( 2000 discs ) , cefotaxime ( 30 mcg ) ( 2000 discs ) , cefoxitin ( 30 mcg ) ( 2000 discs ) , ceftazidime ( 30mg ) ( 2000 discs ) , ceftazidime / clavulamic acid ( 30 / 10mg ) ( 2000 discs ) , ceftriaxone ( 30mcg ) ( 2000 discs ) , cefuroxime ( 30 mcg ) ( 2000 discs ) , chloramphenicol ( 30mcg ) ( 2000 discs ) , ciprofloxacin ( 5mg ) ( 2000 discs ) , clindamycin 2 mcg ( 2000 discs ) , colistin ( 10mcg ) ( 2000 discs ) , co trimoxazole ( 23 75 / 1.25mg ) ( 2000 discs ) , erythromycin ( 2000 discs ) , gentamicin ( 10mcg ) ( 2000 discs ) , gentamicin ( 120mcg ) ( 2000 discs ) , imipenem ( 10mg ) ( 1000 discs ) , levofloxacin ( 5mcg ) ( 2000 discs ) , linezolid ( 30mg ) ( 2000 discs ) , meropenem ( 10mcg ) ( 1000 discs ) , metronidazole ( 5mg ) ( 2000 discs ) , nalidixic acid ( 30mg ) ( 1000 discs ) , nitrofurantoin ( 300mcg ) ( 2000 discs ) , novobiocin ( 30 mg ) ( 2000 discs ) , onpg discs ( 1000 discs ) , optochin disc ( for s.pnemonioe , , ) ( 1000 discs ) , oxidasediscs. ( 1000 discs ) , ofloxacin ( 5mcg ) ( 1000 discs ) , penicillin g ( 10units ) ( 1000 discs ) , piperacillin ( 100mg ) ( 2000 discs ) , pipera tazobactum ( 100 / 10 mcg ) ( 2000 discs ) , polymyxin b ( 300units ) ( 1000 discs ) , teicoplanin ( 30mcg ) ( 1000 discs ) , tetracycline ( 30mg ) ( 1000 discs ) , ticarcillin clavulanic acid ( 75 / 10 mcg ) ( 2000 discs ) , tobramycin ( 10mcg ) ( 2000 discs ) , vancomycin ( 30mcg ) ( 2000 discs ) , fosfomycin 200 mcg ( 1000 discs ) , cefoxitin + cloxacillin ( 2000 discs ) , tigecycline 15 mcg ( 2000 discs ) , cephazolin ( 30mcg ) ( 2000 discs ) , cinoxacin ( 100mcg ) ( 1000 discs ) , norfloxacin ( 100mcg ) ( 2000 discs ) , ertapenem ( 10mcg ) ( 1000 discs ) , oxacillin ( 10mcg ) ( 1000 discs ) , cefoxitin ( 30mcg ) ( 2000 discs ) , glass petri dish culture, 90mm ( 50 pcs ) , glass slides size 75mm x 25mm x 1.35 mm, 50 / pk ( 500 pcs ) , single cavity glass slide for motility ( 1 pcs ) , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml ; 100 / pk ( 100 pcs ) , mccartney flat bottle :aluminium cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 30 ml; 100 piece / pack ( 100 pcs ) , volumetric conical erlenmeyer flask ( glass ) 50 ml graduated w / stopper, class a, usp certificate, ( 5 pcs ) , volumetric conical flasks, erlenmeyer, narrow mouth, 100 ml ( 5 pcs ) , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a , usp certificate ( 5 pcs ) , graduated laboratory dropping bottle with rubber dispenser fitted250 ml capacity of borosilicate glass ( 5 pcs ) , amber coloured wide mouth graduated glass bottle 500 ml ( 5 pcs ) , glass funnel plain 60 degree angle long stem, size 75mm ( 2 pcs ) , glass beaker borosil 100 ml with spout ( 10 pcs ) , u shaped glass rod ( 2 pcs ) , glass beaker of 2 lt , heavy duty , double graduation metric scale ( 5 pcs ) , glass beaker with spout ( discarding jar ) 1lt ( 5 pcs ) , test tube glass size 12cm x 150 mm ( 50 tubes per pack ) ( 5 pcs ) , measuringpipette with rubber bulb 10 ml ( mohr type ) class b ( 5 pcs ) , measuring cylinder, with class a certificate capacity 1000ml with stopper ( 1 pcs ) , measuring cylinder, with class a certificate ;capacity 250ml with stopper ( 2 pcs ) , slide boxes for students for 100 slides ( 600 slide ) , heavy duty gloves heat resistant , category iii glove, preferably en 407 performance levels ( 4 pairs ) , test tube stand polypropylene 3 tier fortest tubes ( 20 piece ) , paraffin films m rolls 2 inch width 250 feet length ( 5 pack ) , falcon tube ( conical ) polypropylene , usp class vi, max g force of 15, 000xg ;50 ml , 360 piece / pk ( 500 pcs ) , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each ( 300 pcs ) , test tube rack holder 40 50 holes vents plastic centrifugal deck ( 10 pcs ) , universal eto sterile plastic ( pp ) containers ( 30ml ) 100 piece in pack ( 1000 pcs ) , coplin jars pp for keeping slides pack of 12 ( 12 pcs ) , sterile swab with collection vial ( himedia pref. ) 100 piece / pkt ( 500 pcs ) , screw cappedvial 3 ml polypropylene for serum storage ( 2 pcs ) , spatula spoon shaped plastic for chemical dispense ( graduated ) ( 10 piece ) , autoclave bowie dick tape 1 pack of 30 tests, complies to ansi / aami / iso 11140 5:2007 class 2. ( 100 test ) , ph paper strips 1 14 ph range himedia , fisher scientific ( 200 strips ) , forcep stainless steel non corosive surgical grade ( 00 & higher ) ( 3 pcs ) , nichrome straight wire ( 2 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) ( 5 pcs ) , nichrome straight wire ( 3 mm ) embedded in brass rod with heat resistant handle ( preferably himedia ) ( 5 pcs ) , sterile stainless steel surgical blade of 15 nos. ( 500 pcs ) , sterile stainless steel surgical blade of 23 nos.skin friendly cost effective ( 400 pcs ) , steel surgical scalpel blade chisel / handle ( 2 pcs ) , forceps for cover glasses, kuhne type ( 4 pcs ) , glass or diamond marker ( 5 pcs ) , stainless steel tub 25 ltfor glass wash ( 2 pcs ) , utility tray320x260x70mm for transport of samples ( 2 pcs ) , forcep autoclavable, size 12 inch, blunt tip, ss 410 2 nos / pack ( 2 pcs ) , forcep autoclavable, size 8 inch, blunt tip, ss 410 2 nos / pack ( 2 pcs ) , stainless steel forceps, pointed, autoclavable, size 8 inch, ss 410 2 nos / pack ( 1 pcs ) , tongs stainless steel 12 inch for beaker ( borosil ) ( 1 pcs ) , stainless steel forceps, pointed tips and handles 8 inch, 2 no / pack ( 100 pcs ) , test tube washing brushes steel ( pack of 10 ) ( 10 pcs ) , zinc sulphate 100 gm ( 100 gm ) , sodium polyanethol sulphonate ( sigma 1 bottle ) ...

Medical And Health Services - Rajasthan

29590779 supply of various types test kits , reagents and items equipment hb meter tube ( square ) ( h b meter sahilis ) whatsmans filter paper ( circular ) ( bt manual ) lancet ( bt manual ) iancet ( bt manual ) 1 n / 1o sahilis hcl ( h b meter ) 2 3 4 5 6 capillary tube fine ( bt ct manual ) 7 wbc diluting fluid ( tic manual ) r 8 neubar chamber 9 wbc pipette ( tlc manual ) 10 methanol ( dlc & pbf manual ) 11 methanol ( dic & pbr manual ) 12 field stain ( dic & pbf manual ) 13 field stain ( dic & pbr manual ) 14 glass slides ( dic & pbf manual ) 15 cedar wood oil ( dic & pbf manual ) 16 platelate count fliud ( dic & pbf manual ) 17 petridish ( for moisture ) ( dic & pbf manual ) 18 petridish glass small 19 petrldish glass medium 20 reticulocyte count fliud ( dlc & pbf manual ) & pbf 21 mgg staln ( dic manual ) 22 rapid pap stain ( dic & pbf manual ) 23 leishmans stain ( dtc & pbf manual ) 24 leishmans stain ( dic & pbf manual ) 25 esr stand with marking ( esr manual ) 26 esr ( esr test cup manual ) ( plastic ) 27 esr pipette ( glass ) ( esr manual ) 28 esr pipette with bulb ( disposable autosuck ) ( esr manual ) 29 30 tr sodium citrate 3.8% ( solution ) ( esr manual ) stop watch ( esr manual ) 31 k3 eota tube ( double cap ) cbc 32 [ osinophil diluting fluid 1x ( tec manual ) 33 rbc pipette ( tec manual ) lx 34 urine umin / sugar strie lx ( manual ) 35 container 50 ml capaciiy lx disposable with screw cap to plastic ( urme ____._ aununin / sugar manual ) — 36 multi stix ( urine complete lx manual ) 16 parameter 37 multi stix ( urine complete lx manual ) 12 parameter 38 paper roli 2 thermostat 1 ( urine complete manual ) 39 cover slip ( urine complete 1 manual ) 40 urine pregnancy test strip ( manual ) 41 urine pregnancy test strip ( manual ) 42 urine pregnancy test card ( manual ) 43 urine pregnancy test card ( manual ) 44 45 lugols iodine ( stool lest manual ) i benedict reagent ( common reagent for urine stool manual ) 1 46 3% sulfosalicyllc acid ( common reagent for urine stool manual ) i 47 modified rothras nitropruside ( common reagent for urine stool manual ) i 48 33% acetic acid ( common reagent for urine stool manual ) 49 5% barnum chloride powder ( common 50 fouchetes reagents 1 ( common reagent for urine stool manual ) 51 sulpher powder ( common i reagent for urine stool manual ) 52 hydrogen peroxide ( common reagent for urine stool manual ) 53 benzidine powder ( common reagent for urine stool manual ) 54 semen diluting fluid ( semen analysis manual ) 55 keto diastic ( for urine manual ) 56 hemo spot test for occult blood hemo spot test for occult blood lx 1x 57 58 glass jar ( for staining ) 150ml b 59 glass iar ( for staining ) 250ml 1 60 trop t rapid ( cardic enzyme test ) 1i 1 61 trop l rapid ( cardic enzyme test ) 62 sxy blue cap tube ( for pt inr ) 1 63 trbc fluid ( rbc count manual ) 64 wintrobes tube with pipette ( for pcv manual ) 65 coombs reagent ( abo rh agglutination, slide ) 66 coombs reagent ( abo.rh agglutination, slide ) 67 bovine albumin 22% ( abo. rh aggi utination, sllde ) — i 1igine aibumin 22x ( ago rh aggluunat1on, 5ie ) ? 69 sugarorp 2 enrymatic ( for semi.auto god / pod ) 70 urea berthiot ( ior semi 2 auto urease end point ( liquid ) ) 71 urea kinetic iior semi 5 auto ) 72 creatinine ( jaffe’s for r semiauto.ifl1tial rate ) p 73 sgot for semi auto ( without pridoxal phosphate 1rcc method ) 74 sgpt ror semi auto ( without pridoxal phosphate ircc method ) 7s alkaline phosphate kinetic ( for semi auto, pnpp ) 76? — total protein ( semi auto analyzwer ) 77 albumin ( semi auto analyzwer ) 78 bilirubin total ( for semia uuo, jjendrassik & grof 79 bilirubin direct ( for semia autjeendrasiik & grof uric acid ( for 5eml 1 aulomoflo veal ) 81 calcium ( ror auto, moflo vail ) m 82 ck mb kinetic ( for semi r auto ) r 83 ck nic kinntic ( for 3emi r autw ) r 84 amalyse kinetic ( for 2 5emi auto ) 85 ch&esterol ( for semi 2 auto, enzymflatic ) 86 hdl cholerterol ( for 2 semi auto ) 87 triglycerides enzymatic ( for semi auto ) 88 csf protein fluid ( for csf protein manual ) 90 — code free ( blood sugar strip rapid ) 91 sample cup plastic ( for biochemistry ) 92 hepatitis b ( hbsag ) card hepatitis b ( hbsag ) card 94 hepatmtis b ( hbsag ) card 95 hepatmtis b ( hbsag ) strip 96 hepatmtis b ( hbsag ) strip 97 hepatitis b ( hbsag ) strip 98 hepatitis b ( hbsag ) eusa 3rd generation 99 hepatitis b ( hbsag ) elisa 4th generation 100 vdrl carbon reagent 101 vdrl elisa anti body test 102 vdri rapid strip 103 vdrl rapid strip 104 vdrl rapid strip 1os vorl rpr ( rapid ) kit 1o6 vdrl rpr ( rapid ) kit 107 hiv rapid card trilne 1o8 hiv rapid card triline? 109 hiv rapid tridot 11o hiv rapid tridot 111 hiv rapid combaids 112 hiv elisa 3rd generation 113? — hiv elisa 4 th generation 114 anti hcv anti body rapid card 115 anti hcv anti body rapid card 116 hcv elisa 3 rd generation 117 i4cv elisa 4th generation 118 malaria napid card antigen / ldh 119 malaria rapid card antigen / ldh 120 malaria rapid card antigenhldh 121 malaria elisa pan antigen 122 pan malaria ( rapid pf / pv ) 123 pan m&aria ( rapid pf / pv ) 124 pan malaria ( rapid pf / pv ) 12s wnal test kit ( vials ) ( to, th, ah, bh ) agglutination rgf 126 typhoid 1gm antibody card test 127 aslo kit ( agglutination ) 128 aslo kit |agglutination ) 129 ia. factor kit ( aulutinationqu.litatwi ) ? r.a. factor kit ( aggiutlnatlonquaijtaive ) 131 isb l ( mp test slide method ) 132 is8hh ( mp test slide method ) 133 zn. stain rapid kit ( sputum ( or afb ) 1.34 zn. stain rapid kt ( sputum for afb ) 135 sprit lamp ( sputum for afb staining ) 136 geimsa stain 137 crp ( latex agglutination ) 138 139 crp ( latex agglutination ) dengue rapid antibody ( lgg+lgm ) +antigen ( ns1 ) combo card 140 dengue antibody ( lgg+lgm ) rapid card engue antigen cns1 ) rapid card 142 143 dengue eisa antibody ( 1gm ) dengue tksa antibody ( 1gm ) 144 — dengue euisa antigen ( ns1 ) 145 dengue eusa antigen ( ns1 ) 146 scrub tyhpus rapid card ( antibody gm ) 147 scrub tyhpus lisa ( antibody 1gm ) 148 scrub tyhpus elisa ( antibody lgm ) 149 chlkungunya rapid card ( antibody lgm ) 150 chikungunya elisa ( antibody gm ) chikungunya elisa ( antibody lgm ) 151 152 vtm with swab ( ror swine fiu ) 153 ppe xii ( ior swine flu ) —et 154 transfer blood bag 1* ( without anti coagulant ) 100 ml 155 transfer blood bag lx ( without nnti coagulant ) 50ml — e n 156 blood coliection bag ( cpda single bag ) 3s0 ml 157 biood coliection bag i ( cpoa single bag ) 1oo ml 158 blood coliectimn bag i ( cpoa double bag ) 3so ml 1s9 blood collection bag i ( cpda double bag ) 4so ml e 160 blood coliection bag i ( cpoa tripple uag without sagam ) 4s0 ml 161 blood collection bag ( cpda tnpple bae with sagam ) 450 ml 162? — blood collection bag ( cpda tripple bae with cfl ...i 163 bbod collection bag ( cpda quadriple bag with sagam ) 350 ml 164 blood ( cpda with sa collection quadriple gam ) 450 ml bag165 166 kb medical bucket with waste pedal whlte top 25 lit. ns ( 0.9% ) normial saline 167 test tube rack plastic 1x96 wells 168 soft ball ( exercise ball ) 169 pipette stand plastic 170 antisera stand plastic 171 antisera anti a1 lactin 172 antisera anti h 173 anti a polycolonol ( abor h? agglutination, shde ) 174 anti b polycolono ( abo 1 rh agglutlnation, slide ) 175 anti d polycolonol ( abo 1 rh agglutination, slide ) 176 a.b, d vial ( a8o.rh 1 agllutlnation, sllde ) anti sera 0 monoclonal ( ago rh agglutnnation, slede ) glass test tube 4” glass test tube 3 disposable mask disposable mask mask tripple layer 177 anti sera a monoclonlal ( ago rh aulutination.siide ) ) 178 anti sera b monoclonlal ( ago rh agglutinatlon.slde ) 179 180 181 182 183 184 185 mask n 95u 186 187 dropper pla stic 5 ml micropore tape 1 transparent 188 micropore transparent tape 3” bio medical waste yellow bucket with pedal top 2s lit. 1 189 190 band aid tongue dipresser wooden 191 zipper polythen ( for packing medium size ) 1 1 s 192 printer ribbon dot matrix 193 vaccutainer ( red top ) for biochemistry 5m1 194 bio medical waste green bucket with pedal top 25 lit. • 195 bio medical waste red bucket with pedal top 25 lit. 196 bio medical waste blue bucket with pedal top 25 lit. 197198 o medical waste black bucket with pedal top 25 lit. 199 gel+ciot activater vial with cap qmgfegt oil immerslon lens ( for microscope ) 200 clot activator vial 4m1 el 2o1 plain screw cap tube 5m1 202 203 liquid paraffin ( for microscope ) 204 tourniquet ( buckle type ) 205 touniquiet ( velcro ) 206 rectified spirit 207 phenyl 208 lyzol 209 toilet cleaner 210 acid for washing 211 mop 212 dusting cloth 203 liquid paraffin ( for microscope ) 204 tourniquet ( buckle type ) 205 touniquiet ( velcro ) 206 rectified spirit 207 phenyl 208 lyzol 209 toilet cleaner 210 acid for washing 211 mop 212 dusting cloth 213 puncture proof box 214 b.p. instrument ( mercury ) b.p, instrument dial 215 216 b.p. instrument digital 217 b.p. instrument cuff with cover 218 b.p. instrument . armlet rubber 219 bulb rubber 220 weight machine digital up to 150kg 221 weight machine arroe up to 150 kg 222 postal scale 1kg e4 ’pi?? ‘ 223 tpsstand? 224 beakerglass2somlhl 225 beaker glass 500 ml 226 measuring cylinder 2so ml 227 measuring cylinder 5oo ml 228 measuring cylinder 1 itr 229 slpeer rubber 230 calcium sandoz 100 tablet chewable bucket blue with sieve ( for bo medical waste ) 25 itr 231 232 bucket red with sieve ( for bio medical waste ) 25 ltr micro pipette loul ( fix volume ) 233 234 micro pipette 20ul ( rix volume ) micro pipette soul ( f ix volume ) 136 micro pipette looul ( fix volumel 237 micro pipette sooul ( fix volume ) 238 micro pipette 1oooui ( fix volume ) 239 micro pipette s soul ( variable ) 240 micro pipette 20.200u1 ( variable ) 241 micro pipette 1oo loo0ui ( variable ) 242 paper gloves 243 surgical gloves uatex disposable ( larg ) 244 surgical gloves latex disposable ( medium ) 24s surgical gloves latex disposable ( smsfl ) 246 surgical gloves uatex 6” 248 surgical gioves tatex 7u surgical gloves latex 7.5 1 1 1 25o surgical examinination gloves ( free size ) 251 hand sanitizer ( liquid ) 1. 252 sodium hypo chloride 5% 1: 253 1 ) test tube rack aluminium ( 1x72 wells ) test tube rack aluminium 1 ( lx96wells ) 247 surgical gloves latex 6.sw 1 254 2s5 | test tube rack slide tray 261 disposable needle ii nos 262 disposable needle 24 nos 263 264 laijtea26e nos disposable needle 23 nos 265 disposable syringe 2cc with needle 266 disposable syringe 5cc with needle 267 disposable syringe 10cc with needle 268 blue tips 269 yellow tips ( micro ) 270 tissue paper 274 marker pen fine tip 275 cotton 276 cpda ptnta bag 450 ml 277 cpda penta bag 450 m 278 cpda penta bag 450 ml 279 d.w. ( otds ) 28o digital tharmameter 281 lipase ( for semi auto ) 282 ggt ( for semi auto ) 271 dll. waler 272 giass marking pencil 273 permanent marker pen 274 marker pen fine tip 283 hba1c ( for semi auto ) 284 na. ( for semi auto ) 28s k.. ( for semi auto ) 286 cl ( for semi auto ) 287 glucometer ( code free ) 1 288 blood sugar strp code 1 free 289 ccucheck xtive ( blood 1 sugar strip ) 29o gluconieter cell i 291 carbon bush for 1 centrfuge machine 292 grams stain 293 damnond pencil 294 liquid soap for hand wash 29s scalpal blade it lo 23n0 296 syfln1e 20 cc with needle 297 sihge50ccwiihi1eeael? 300 torch igg [ lisa 301 torch igg [ uisa 302 hepttiti a fisa bag 3o3 hepttitis a elisa 1s48 304 * thefmal printer paper ropi 1x12 (size 57x25mm) 305 anti hav rapid card hi5 306 anti hev rapid card i i 4$ el— i” hiv el$a 1 i (igg.ium.ant)body? i conbo) 1)01 hiv (isa 1 | (igg.igm+anubody combo) ini#e hui1o fin 309 surgkal knife blade 23 no. 310 clear glass round shape 311 aluminium screw for 30 ml glass bottle 312 bath soap 313 gdw 5% (glass bottle) 314 ns(glass bottle) 315 bio.medical waste bag black soitr 316 digital weighing machine cell 317 318 pencil cell (small/medium) iss/coombs . 3i •)2o a aid/rh 4 321 abo/d. reverse 322 binocular microscope eye piece 10x 1 323 binocular microscope eye piece 5 x 1 324 binocular microscope obecteve lens 10 * 1 325 binocular microscope objective lens 40x 1 326 binocular microscope 1 bulb 327 antiseraab • 1 328 glass slide size 1 75mmx2smmil.3smm (blue star) ldiue starj? 329 330 anti hav elisa gm hbsageltsa 4th jj 1’pi4a rapid kil 133 brucella m el’s) biological indicator of autoclabe machine rotavirus/adenlovirus ‘atex agglutination for salmonella s ml x 1 ‘salmonella 0 ag group cliv fosalmonella5mlx1 i !i. iqtcqii aii4r’.,e 343 344 irucella gm (lisa 9 measles 1gm (mu capture) 345 hsv 2cardtestpacksze 346 rubber chest bulb for ecg lead 347 blo medical waste green bucket with pedal top so lit. 348 bio medical waste red lx1 bucket with pedal top so lit. 349 rio medical waste blue lxi bucket with pedal top 50 lit. 350 rio medical waste yellow 1x bucket with pedal top 50 lit. 351 bio medical waste black bucket with pedal top so lit. lx 1 359 plastk bag for biomedical waste 25 itt red 360 plastic bag bor biomedical 1 waste 25 ltr green 361 plastic bag for biomedical 1 waste 2s itt yellow c ? 362 plasric bag lot biomedieal waste 2s lir black 363 plastic bag (or biomedical waste 25 ltr blue u s ? 364 elastic bag lo* biomedical waste so ltr red 365 plastic bag lot biomedical waste 50 ltr green 366 plastic bag lor biomedical waste 50 lr yellow 367 plasric bag b6r biomedical waste so hr black 36$ plastic bag (or biomedical waste so lr blue 369 lormaidehydewiutonl 370 cotton mop 371 dy mop 372 0 dimer qualitative 373 ddimer quantitative —u,, ‘1 382 383 14202 (11%). silvir nitrate solution (0.01% w/v (ecosb4i(uo) deoxycholate citrate apr mac conkey apr nutrient apr 1x) lxi lxi 50 50 5c 374 6 •111 37s pwo calcitranin 376 ferritin 371 • hm1c kit 378 14202 (11%+ s*lver 1x nitrate sotumion (0.o1% w/v) (ecoshieud) 379 h2o2 nitrate (0.o1% (11%)+ sitver souution w/v) (ecoshield 1x 380 1x 381 ei1.—? mannitol motility agar ianumawar? 388 thple sugar iron media —i i 389 simmons citrate agpf 390 kovacs indnle reagent 5( — 391 mannitol powder — — 392 glucose powder 5 393 lactose powder 5 e i 394 sucrose powder e| e t ? 395 hydrogen peroxide 3/6% oxudasereagent1oogm mueller iinton agar — potasslum dl hydrogen phosphate powder 5o0gm robertson’s cooked meat broth medium 500gm 398 399 400 bile salt powder with cholic acid content >= 45.o%, certifled, 250 gm 401 sda with chioramphenicol 500gm 402 xylose lysine deoxycholate agar (xld agar) 403 crystal violet powder 100 gm/pack 404 thloglycollate powder 500 gm 405 iodine crystals 100/500 gm 406 sodium bicarbonate 5oo gm 407 aanmonium oxalate powder s00gm 4o7 amrmoruum oxalate powder 50ogm 408 [ potassiun permanganlite powder 500gm 409 calcium chloride 10ogm 410 zeihi neelsen stabn kit 5o0 ml with proper cas numbers certified 411 412 eram heart infusion broth 500gm acetone 500 ml sda with chloramphenicol ! 50ogm 1’ 413 leishman stain practical grade for microsopy twin pack 500 ml 5c 414 leishman stain practical grade for microsopy 10o gm powder s( 415 bile esculin agar 500gm 54 416 selenite f broth powder( 100gm) 417 grams stain kit 418 dermatophyte test agar & supplement 419 420 hi chrome agar for candida 100gm potassium hydroxide 500 gm 2 5 5 5 421 sodium chloride (anhydroun) s00gm india ink or nigrosin 1o0 gm lactophenol cotton blue albert slain 10o each al b 422 423 424 425 426 lowensteipi jensen powder soeme 427 phenol crystals 5oomg 428 mannitol moldity apr 100gm 429 430 of basal medium 5o0gm ferric chloride powder 500gm 431 ambcin (30mg) 432 amoxyclav (30 mctj 433 ampicilhri (2mg) 434 azfthromyejn( lscncg) 43s aztreonam(3ommng)? 436 iacjtyacin (so disci/vi) 437 ide esculin discs 438 celazo4in (a) (3o mc() 439 cefipnne(3omcij 440 cefi*ime (smcg) 441 cefoperazone. suibactum(7smcglfomncg)? 442 cefota*ime (30 mcg) 443 cefoxitln (30 mcgl — 444 ceftazidimme (30mg) 445 cetaridi /ci, arid (30/lomg) 446 ceftraxone (3omcgl 447 cefuroxime (3o mcgl 448 chloramphenllcol(30mcr) 449 prof1oxacin (smg) 45o clindamycin 2 mcg 451 colistin (lomcg) 452 co tnmoxazole123 75/1.25mg) 453 erythromycinl 4s4 gentamcinl(1omc& 45s gentamicbfl(120mlic8) 456 imipenem (1omg) 57 levolloxacin (5mcg) 49 4s8 linezohd(3omg) 459 meropenem(lomcg) 460 metronidazole(5mg) 461 nalidixic acid (30mg) 462 nitrofurantoln430omcg) 463 novoblocin (3o mg) 464 onpg discs 46s optochin disc por s.pnemonloe ..) 466 oeidase discs. 467 oxacin (smcg) 4 l 468 penicliiin g( lolinits) 469 piperacllin (1oomw)i 470 piperat aaobaatummt0o/1oo meg) 471 po1ymyin.b(30ounits) 472 teicoplanin(3omcg) 473 tetracycline (3omgl 474 ticarcilin clavulanic acid (75/10 meg) 475 tobramycin(iorncg) 476 vancomyin(3omcg) 477 roslomycin 20o meg 478 cefozitin + cloxacilin 479 tigecydirie 1s meg 480 cephazolin(3omcg) l481 canoxacin(loomcl) 1 482 nodioxacin(loomncgj 483 (rtapenem(lomc,j 484 oiacillin(lomcg) 48s cefoxtn(3omcg) 486 glass petri dish culture, 90 mm 487 glass slides size 7smrm x, 25mm x 1.35 mm, 50/pk as* single cavity glass slide lot motabty 489 mccartney bottle w/ aluminium cap with rubber liner, neutral glass, autoclawable, y15n;1a 490 mccartney flat bottle :aluminium cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 30 — ml; 1o0 piece /pack e 491 volumetric conical ertemmeyer flask (glass) 5o ml graduated w/ stopper, cuass a, uisp certificate, ___e__e_ 492 volumetric conical f’asks, £rlenmeyer, narrow mouth, 100 ml 493 volumetric conical s erlenmeyer flask (glass) 5oo ml graduated class a, _____ usp_certificate — graduated (aborator 5 dropping bottle with rubber dispenser fitted 2so ml capacity of borosilicare glass — amber coloured wide s mouth graduated glass bottle 500 ml 496 glass funnel plain 60 degree angle long stem, size 75mm 2 497 glass beaker borosil 100 ml with spout 1 test tube glass size 12cm 5 x 15o mm (50 tubes per pack) 494 495 498 u shaped glass rod 2 s 499 glass beaker of 2 it • heavy duty , double graduation metric scale 500 glass beaker with spout (discarding jar) 1it s 5o1 measuring pipette with s rubber bulb 10 ml (mdir type) class•g 502 5o3 measuring cylinder, with class a certificate capacity 1000ml with stopper 1 504 measuring cylinder, with class a certificate ;capacity 2s0m1 with stopger 2 side box for students for 100 slides so heavy duty glows heat resistant , category ill glove, preferably en 407 _____ performance levels 507 test tube stand polypropylene 3 bet for test tubes 5o8 paraffin films m rolls 2 inch width 250 feet length 509 falcon tube (conical) polypropylene .usp class vi, max g force of 15,00oxg ; 5o ml .360 p.ece/pk — 510 ralron tube (conical) 3 polypropylene 15 ml 1 pack of 30o each 511 test tube rack holder 40 1 .50 holes vents plastic centrifugal deck 512 universal eto sterile 1 ptastic(pp) contalners(30ml) 1o0 ___ pbce.ackr s13 coplin jars pp tor keeping 1 slides pack of 12 514 sterile swab with collection vial ( himedia pre1.) 100 piece/pkt 515 screw capped vial 3ml 2 polypropylene for serum an..uest? 516 spatula spoon shaped 1o plastic for chemical dispense (graduated) fe1a q,qf q lfri;u 517 autoclave bowle dick tape 1 pack oi 30 tests, complies to ansi/aamif? soo 11140 5:2o07 class 2. 1c 518 ph paper strips 1 14 ph range himedia • fisher scientific 2( 519 forcep stainless steel non corosive surgical grade (0o & higher) 3 520 nichrome straight wire (2 mm) embedded in brass himedia) 521 nichrome straight wire (3 mm) embedded in srass rod with heat resistant handle (preferably himedia) 522 sterile stainless steel surgical blade of 15 nos. 523 sterile stainless steel surgical blade of 23 nos.skin friendly cost effective 524 steel surgical scalpel blade chisel/ handle 525 forceps for cover glasses, kuhne type 526 glass or diamond marker 527 stainless steel for glass wash tub 25 it 528 utility tray32ox26ox7ormrm for transport of samples 529 forcep autoclavable, size 12 inch,blunt tip, ss 410 2 nos/pack 2 530 forcep autoclavable, size 8 inch, blunt tip, 55 410 2 nos/pack 2 531 stainless steel forceps, pointed, autoclavable, size 8 inch, s5 410 2 nos/pack 1 532 tones stainless steel 12 inch for beaker (borosil) 1 533 stainless steel forceps, pointed tips and handles 8 inch, 2 no/pack 1c test tube washing 11 brushes steel(pack or 1o) csite1r1ck 2 534 535 i i sodium wlphoflale ...

Ministry Of Micro Small And Meduim Enterprises - Rajasthan

28950844 enquiry for supply of science lab supply of science lab at msme technology centre bhiwadi , 1.0 burette stand burette stand with clamp and boss head : burette stand steel 7x 5” with clamp with heavy based cast iron & chrome plated 2.0 burette borosil glass burette with teflon cock 50.ml high grade burette class a, white graduation 3.0 beaker borosil glass 3.1 beaker 50ml borosil glass borosilicate glass with level marking beaker 50 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass with level marking beaker very low coefficients of thermal expansion resistant to thermal shoc 3.2 beaker 100ml borosil glass borosilicate glass beaker 100 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 3.3 beaker 250ml borosil glass borosilicate glass beaker 250 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 3.4 beaker 500ml borosil glass borosilicate glass beaker 500 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 3.5 beaker 1000ml borosil glass borosilicate glass beaker 1000 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 4.0 conical flask borosil glass 4.1 conical flask 250ml type: erlenmeyer graduated conical narrow mouth flask capacity ( ml ) : 250 dimension ( mm ) : 85 x 140 neck size: 34 4.2 conical flask 500ml type: erlenmeyer graduated conical narrow mouth flask capacity ( ml ) : 500 neck size: 34 or more 4.3 conical flask 1000ml capacity 1000 milliliters material glass : borosilicate glass with level marking 5.0 measuring pipette gr. 5.1 measuring pipette gr. 25ml 6.0 test tube 6.1 15x125 mm borrosil glass test tube ( bx of 100 pcs ) 6.2 test tube brush 6.3 test tube holder 6.4 test tube stand 7.0 glass bottle ( hitech glass ) narrow mouth 7.1 5 lit : borosilicate glass with level marking 7.2 3 lit : borosilicate glass with level marking 7.3 1 lit: borosilicate glass with level marking 8.0 reagent bottle ( hitech glass ) narrow mouth 8.1 50 ml. : borosilicate glass with level marking 8.2 100 ml. : borosilicate glass with level marking 8.3 250 ml.: borosilicate glass with level marking 9.0 droppered bottle 9.1 droppered bottle 50 ml.: borosilicate glass with level marking 10.0 cylinder measuring glass 10.1 50 ml. : borosilicate glass with level marking 10.2 100 ml.: borosilicate glass with level marking 10.3 500 ml.: borosilicate glass with level marking 11.0 measuring flask 11.1 500 ml. : borosilicate glass with level marking 11.2 1000 ml.: borosilicate glass with level marking 11.3 2000 ml.: borosilicate glass with level marking 12.00 volumetric borrosil glass 12.1 20 ml.: borosilicate glass with level marking 12.2 10 ml.: borosilicate glass with level marking 12.3 5 ml.: borosilicate glass with level marking 13.00 filter paper 13.1 filter paper 1 packet ( 100 piece ) 14.00 water bath 14.1 internal dimensions ( lxwxd ) : 300x250x100 mm or 355x405x100 mm no. of holes : 6 holes of 75 mm dia or 12 holes of 75 mm dia capacity 8 liters. or 15 liters. heating load 1.0 kw or 2.0 kw temperature range from ambient to 100 oc + 1.0oc temperature controller temp. is controlled by a hydraulic thermostat moc inner and outer made of s.s. 304 grade 15.00 referigerator 210 litre standard 15.1 type : single door or double door refrigerator type: top freezer refrigerator defrosting type: direct cool compressor type: digital inverter compressor capacity: 210 l number of doors: 1 or 2 star rating: 3 or above built in stabilizer: yes warranty summary: 1 year on product and 10 years on compressor from oem 16.00 volumetric flask 16.1 100ml ( error limits± ml ) , with screw cap 16.2 200ml ( error limits± ml ) , with screw cap 17.00 pipettes / dropper 17.1 material plastic / pp / glass length available 118mm, 114mm, 80mm, 75mm, 72mm ml 0. 1ml, 0. 2ml, 0. 3ml color transparent 18.0 laboratory hot air oven 18.1 temperature range +5dec c above ambient to 250dec c with a sensitivity of + / 2dec c number of shelves 1 or more nos inner size 350*350*350 mm to 600*900*600 mm rating 1.2 4 kw moc inner stainless steel moc outer mild steel attractively finished in powder coating heating element high grade nichrome wire insulation special grade glass wool tray stainless steel power supply 230 v 1 phase, 50 hz, ac supply optional accessories digital temperature indicator cum controller, air circulating fan assembly, timer range 0 9999 min 19.0 stainless steel magnetic stirrer 2 ltrs s.s top 19.1 material stainless steel capacity 2 liters voltage ac 220 v application : lab plate size 190x190 mm weight 6 kg 20.0 magnetic beads chemistry 20.1 material : tiny ( 20 to 30 nm ) particle of iron oxide 21.0 bunsen burner 21.1 material stainless steel usage laboratory base diameter 12mm automation type semi automatic height 150 mm 22.0 digital balance 22.1 0.01mg cap 500.gm material: stainless steel power source : 220v maximum capacity : 500g readability: 0.01g power requirement: 220 v width 15 cm pan size 80 mm height 18 cm depth 13 cm weight 1 kg 23.0 digital ph meter 23.1 range 0 to 14, temp. 0 to 100`c with combined electrode stand with clamp, dust cover and instruction manual 24.0 wire gauage 24.1 material stainless steel model name / number 1505 shape round finish polish thickness 0.20 1 mm 25.0 sprit lamp 25.1 material stainless steel, size / capacity 125 ml. jointed 26.0 cappilary tube 26.1 material glass size 75 mm ( length ) packaging type box outer diameter 1.5 1.6 mm inner diameter 1.1 1.2 mm 27.0 tripod stand 27.1 tripod material: metal tripod height: 1 feet load capacity : 1 kg shape round 28.0 digital thermometer 28.1 material plastic color white and black both available thermometer type probe with digital features low power consumption, high stability, high accuracy, compact structure, easy operating. accuracy + 1 c / f 29.0 chlorine test kit 29.1 portable chlorine test kit for finding chlorine % free chlorine measurement type colorimetric free chlorine range 0.0 to 2.5 mg / l free chlorine resolution 0.5 mg / l free chlorine number of tests 50 chlorine method dpd weight 176 g ( 6.6 oz. ) 30.0 digital tds meter 30.1 digital tds meter hand held ec range: 0 – 9990 μs; 0 – 9.9 ms tds range: 0 – 5000 ppm ( 0.5 scale ) ; 0 8560 ppm ( 0.7 scale ) temperature range: 1 80 °c; 33 176 °f resolution: 1 μs / ppm; 0.1 ms temp. resolution: 0.1 °c / f accuracy: + / 2% power source: 3 x 1.5v button cell batteries ( lr44 or equivalent is included ) dimensions: 15.3 x 3.2 x 1.8 cm ( 6.0 x 1.3 x 0.7 inches ) weight: 53.9g 31.0 copper calorimeter 31.1 copper calorimeter 75 x 50 mm with felt insulation, outer vessel of 100 x 65 mm size with a plastic lid having holes for thermometer & stirrer. a thermometer holder is fixed to the outer vessel. complete with stirrer. 32.0 funnel 32.1 3 inch dia material type : borosil glass 33.0 glass rod 33.1 150x6mm 34.0 measuring cylinder 34.1 measuring cylinder ( 10ml & 20 ml ) glass 35.0 periodic table chart 35.1 size :140 x 100 cm . language : english. multicolour offset printing.this chart is thermally laminated with 30 micron thick polyester film rendering thechart tear & water resistant. this chart is ideal for putting up on a board or a wall. 36.0 ph paper 36.1 5.9 x 0.8 x 0.006 cm features 1 3 indicates a very acidic substance, 4 6 indicates an acidic substance, 7 indicates neutral, 8 37.0 multicolour polyart synthetic paper laboratory safety for chemistry lab display chart 37.1 size: 70x100 cm. 38.0 copper electrode apparatus for water specification experiment 2 copper electrode of minimum 5 mm diameter, retort stand and clamp to hold electrodes dc power supply, 6 volt light bulb, small, 6 volt, 5 watt leads and crocodile clips 39.0 abels flash point apparatus rated voltage: ac220v±10% 50hz applicable standard: ip 170, iso13736 flash detection: pt100 ignition: gas heating: electric furnace 40.0 redwood viscometer material stainless steel shipping weight 26. 4 lbs ( 12kg ) shipping dimensions 2. 2 cu. ft dimension 23x23x46 cm net weight 12 lbs ( 5. 5kg ) power single phase, 220 240v, 50 / 60hz, 6. 0a or 115v, 12. 0a standard conforms to the specifications of:ip 70. type of bath electrically heated immerssion heater. max working temperature 99 degree c continous working temperature 95 degree c capacity 1 sample at a time heater ss tubular immerssion heater accuracy + / 3 degree c readability + / 0. 5 degree c input power supply 230 v ac, 50 hz, 1 phase with 6 amp current rating. 41.0 bomb calorimeter usage / application laboratory material steel weight minimum: 15 kg temperature uniformity + 2 deg c voltage 220 v packaging type carton box 42.0 chemicals 42.1 h2s04 ( sulphuric ) conc. 42.2 hn03 ( nitric ) conc. 42.3 hcl ( hydrochloric ) conc. 42.4 potassium chromate indicator 42.5 sodium nitrite conc. 42.6 chloroform 42.7 molischs reagent 42.8 fehlings reagent 42.9 benedicts reagent 42.10 tollens reagent 42.11 iodine solution 42.12 castor oil 42.13 sodium hydroxide conc. 42.14 furfural solution 42.15 oxalic acid ( solid ) 42.16 sodiun hydroxide solution 42.17 phenolphthalein indicator 42.18 ammonium ferrous sulphate conc. 42.19 ethanol 42.20 potassium permagnate 42.21 napthalene 42.22 benzoic acid conc. 42.23 acetic acid conc. 42.24 sodium chloride conc. 42.25 distilled water 42.26 dilute sodium hydrogen carbonate 42.27 universal indicator 42.28 standard edta titrant 42.29 dilute calcium carbonate 42.30 eriochrome black t indicator 42.31 buffer solution 42.32 ether 42.33 standard silver nitrate 42.34 potassium hydroxide conc. 42.35 ferrous sulphate conc. 42.36 ferrous ammonium sulphate conc. 42.37 potassium dichromate conc. 42.38 methyl orange indicator conc. 42.39 phenolphthalein indicator conc. b physics lab equipment 43.0 fly wheel ( to determine the moment of intertia ) 43.1 specification: . this apparatus is about 20 cm in dia and 45 mm wide turned and accurately balanced mounted on a horizontal shaft held in ball bearings. . the wheel is marked and a pointer is fixed to the bracket. . the bracket has four holes and can be fixed to the wall. . comprising of carefully machined and balanced cast iron wheel of about 20 cm in dia and 4.4 cm thick, and steel spindle supported on the ball bearings in strong iron brackets. . the sides of the wheel are red or grey painted. . the top of wheel is chrome plated and is marked with a thick red line. . a pointer is fixed to one of the brackets. . diametric hole is drilled in the shaft to take a pin and cord. . the base is provided with four holes so that the apparatus can be fixed on a wall, complete with cord and hook. . without counter . with new counte 44.0 bar pendulum ( compund pendulum ) 44.1 shape: rectangular material :cast iron color :grey thickness : 3mm 45.0 youngs modulus set: 45.1 sample 1 sample 2 material : iron material : brass length : 100cm length : 100cm breadth : 2.5cm breadth : 2.6cm depth : 0.6cm depth : 0.5cm sample 3 material : aluminum length: 100cm breadth: 2.55cm depth: 0.5cm weight: 500g ( 6 nos. ) spherometer main scale : 0 30mm circular scale : 100 divisions least count : 0.01mm dc power supply : 12v mains supply : 230v ±10%, 50hz 46.0 youngs modulus apparatus ( searles pattern ) 46.1 searles horizontal pattern. with two aluminium scales graduated 30 0 30 degrees mounted on pillar supports, two pointers with clamps for attaching to specimen, one each brass and steel rods 5mm diameter, cord and hook for carrying weight, but without weight. 47.0 viscosity apparatus ( stockes law ) 47.1 tube stand 2 base ( cast iron ) : 23 x 15cm rod ( mild steel ) : 110cm cylindrical tube length: 100cm ( approx. ) internal diameter: 3.5cm external diameter: 4.0cm 3 volume : 962cm measurement unit : mains supply 230v ±10%, 50hz adaptor output : 5v dc timer checking time : 5 sec time segments : 3 steel sphere diameter : 0.2cm to 0.5cm density : 7.85gm / cm3 glass beads diameter: 0.35cm to 0.45cm 3 density: 2.5gm / cm 48.0 rising table ( complete ) with capiliary tube clamp & side rode attachment used in expriment : surface tension of liquid by capillary rise method 48.1 capillary tube clamp: the apparatus comprises a metal frame, on which three capillary tubes of 10cm long borosillicate glass and of different internal diameters are clamped with the help of small metal brackets. the 9mm rod is also attached to a metal plate, so that the complete clamp can be held in any stand for determining the surface tension of liquid by capillary rise method. rising table: a machine cast iron table 10cm dia with a stem of 12cm can be lowered or raised to a desired height and can be tightened with a thumb screw. in addition to this coarse movement, fine adjustment is provided by a flush in arrangement. the whole arrangement is fitted on a heavy circular base with three levelling screws. 49.0 traveeling microscope: 49.1 base: iron scale: stainless steel vertical scale main scale : 0 150mm vernier scale : 0 1mm least count : 0.01mm horizontal scale main scale : 0 180mm vernier scale : 0 1mm least count : 0.01mm eyepiece: 10x ( ramsden ) 50.0 searles thermal conductivity ( superior quality ) 18 mm copper rod 50.1 searle’s thermal conductivity apparatus, 04 thermometers, steam boiler, measuring cylinder, constant water level tank, pinch cork, stop watch, rubber tube and hot plate. 51.0 concave mirror 75mm 52.0 k constant spring apparatus 52.1 with spiral spring about 25mm dia & 10cm long on metal base with 250 gm slotted weight metal 53.0 magnetism lab experiment 53.1 types of material of magnet : 1.       alnico 2.       ceramic or ferrite 3.       rare earth magnet ( neodymium ) 53.1 shapes of magnet : 1. bar magnet 2. u shape magnet 3. horse shoe magnet 4. cylindrical magnet 5. ring magnet 6. disc magnet 53.2 magnetic compass 53.3 magnetic field demostrator 53.4 lenzs law demonstrator 53.5 motor assembly coil : no. of turns : 400, inductance ( approx. ) : 2.3mh, max. current : 0.728a 54.00 coulombs law demonstrator 54.1 magnets quantity : 2 nos. length : 4cm type : neodymium balancing : by ir detection scale : 0 14cm adaptor output : 6v dc, 500ma mains supply : 230v ±10%, 50hz dimensions ( mm ) : l 360 x b 255 t 55.0 calibration of voltmeter and ammeter using potentiometer 55.1 technical specifications analog voltmeter: 0 10v analog ammeter: 0 1a potentiometer wire: constantan length: 10m dc supply ( standard ) : 1.0v variable resistance: 3 decade : x0.1o, x1o, x10o voltage ratio factor: 0, 1.5, 15, 30, 150, 300 total resistance: 15 56.0 hysteresis loop tracer 56.1 display: 3½ digit sample type : soft iron, nickle, hard steel length: 39mm diameter: 1.00mm ( approx. ) diameter of pickup coil : 3.21mm mains supply : 230v ±10%, 50hz 57.0 experimentation with rlc resonance 57.1 mains supply: 90 275v, 50 / 60hz generator output: 8vpp frequency ranges: 1khz, 10khz, 60khz voltmeter: 2v 58.0 potentiometer 10 constanan wires potentiometer with jockey sumnica fitted underneateh the wires 58.1 constantan wires of one meter long connected in series, clamped under heavy brass strips and fitted with screws. each block is fitted with a brass terminal which is mounted on 3 / 4” thick laminated board with both side sun mica. the wires are stretched along the both ends of meter scale. supplied complete with pencil jockey 59.0 zener diode kit 59.1 zener diode characteristics apparatus the instrument must be designed to draw the characteristics our of a zener diode in f b and rb provided with supply and two meter ammeter and voltmeter ( 0 5 v ) 60.0 whitwort quick return echanism model the machnismare msde of aluminum and other metallic part 60.1 specification 1. investigation of a revolving crank slider 2. generation and investigation of non uniform stroke movements 3. adjustment of the crank radius at three positions of the connecting rod on the crank disk 4. adjustment of the angle by turning the crank disk 5. measuring the stroke on the cylinder technical data drive disk anodised aluminium ball bearing mounted crank radius 46mm slider radius 55mm driving rod anodised aluminium length: 145mm cylinder / driving rod / frame stroke 0…100mm dimensions and weight lxwxh: 360x280x70mm weight: approx. 2kg 61.0 geneva mechanism 61.1 the mechanism are made of aluminium and other metallic parts 62.0 ackermans steering gear mechanism model the mechanism are made of aluminium and other metallic parts 63.0 foot operated air pump mechanism model 63.1 type of foot pump: steel body pump size : 350 x 105 x 100mm pump size ( with box ) : 355 x 115 x 115 mm pump weight: 2.350 kgs. cylinder inside dimensions : 70 mm dia – 145 mm long max. stroke length: 118 mm max. air volume delivered / stroke: 454 cm3 pressure range : 0 10.6 kg. / cm2 ( 0 to 150 lb / inch2 ) max. error in gauge reading : +0.140 kg / cm2 ( +2lb / inch2 ) 64.0 slider crank mechanism calibrated dial 64.1 ( a ) reciprocating engine mechanism ( b ) oscillating cylinder mechanism ( c ) withworth quick return mechanism a properly constructed model fitted on wooden base board with dial. ( set of 3 ) 65.0 reciprocating engine mechanism model the mechanism are made of aluminium and other metallic parts 66.0 moment of inertia of flywheel ( weight ) 66.1 20cm consists of a mechanism and balanced cast iron wheel having steel spindel supported in ball bearings in strong brackets. the wheel circumference is marked with a horizontal reference line. a diametric hole id drilled in the shaft take a pin and a cord . the base is provided with holes for fixing on the wall. complete with book and cord but without weights 67.0 universal governor apparatus 67.1 drive motor fhp motor, variable speed, with speed controller. use industrial type digital tachometer electricity supply 220 v ac, single phase, 0.5 kw floor space 0.5 x 0.5 m rotating shaft material stainless steel balancing weight 4 nos. of stainless steel with different sized eccentric mass for varying unbalance. 68.0 meacanical break system model mechanical brake system as used in two wheelers is made from original but recondiation parts. complete with operating lever, brake peddle, brake drum and necessary linkage. working of mechanical break can be demosnstrated by pressing the pedal. 69.0 multi plate clutch model 69.1 a property constructed all metallic model mounted on wooden base with handle for lab demonstration 70.0 static & dynamic balancing apparatus 70.1 material stainless steel display analog drive motor fhp motor power 0.5 kw voltage 220 v 71.0 k constant spring apparatus with spiral spring about 25mm dia & 10cm long on metal base with 250 gm slotted weight metal 72.0 newtons law of cooling experiment apparatus 72.1 newton’s law of cooling apparatus that includes a copper calorimeter with a wooden lid having two holes for inserting a thermometer and a stirrer and an open double – walled vessel, two celsius thermometers ( each with least count 0.5 degree c or 0.1degree c ) , a stop clock watch, a clamp stand, two rubber stoppers with holes, strong cotton thread and a beaker of 250 ml 73.0 spherometer 73.1 made of nickel plated brass, stainless steel screw with ratchet stop 25 / 20 / 15 / 10 x 0.01 mm 74.0 verification of triangle and paralleogram law of force 74.1 gravesands apparatus, paper sheet, weight, thread, drawing pins , stainless steel set square 30cm length , protractor 75.0 radius of curvature of a convex and concave mirror using spherometer 75.1 convex surface lens, a big size plane mirror / glass slab size minimum 75x50x18mm 76.0 co efficient of friction between wood and glass using a horizontal board 76.1 a table with frictionless pully fixed at one end, flat plate of glass or brass or zinc, blocks of different materials with a hook, a scale pan, a weight box, set of 50gm slotted weights, spirit level 77.0 law of conservation of mechanical energy 77.1 aluminum track, pulley. mass hanger, meter stick, low friction pasco cart, piece of string, mass set, stop watch 78.0 mercury thermometer 78.1 measuring range −37 to 356 °c ( −35 to 673 °f ) 79.0 acceleration due to gravity using simple pendulum 79.1 retort stand, pendulum bob, thread, meter scale, stop watch 80.0 verify law of reflection from a plane mirror / interface 80.1 drawing board, push pins , white pins, a stand for plane mirror, plane mirror 81.0 verify of refraction ( snells law ) using a glass slab 81.1 drawing board, board pin, rectangular glass slab 82.0 determine focal length and magnifying power of a convex lens 82.1 an optical bench with uprights for holding lens, niddles, index niddles, a thin convex lens, a meter scale and a spirit level 83.0 determine internal resistance of a primary cell using potentiometer & determine emf of two primary cells using potentiometer 83.1 a potentiometer , battery ( or battery eliminator ) , two one way keys, rheostat of low resistance ( about 20 ω ) , galvanometer, high resistance box ( 0 to 1000 ω ) ( 10k ω and 200 ω ) , fractional resistance box, ammeter, voltmeter ( 0 3 v ) , cell ( say leclanche cell ) , a daniel cell 84.0 documentation / manuals 84.1 maintenance manual of 2 sets each ( one hard copy & one soft copy ) 84.2 detailed layout plan 84.3 installation & commissioning instruction 84.4 operating instructions 84.5 circuit diagram...

Medical And Health Services - Rajasthan

28583610 supply of lab regents blood sugar kit i blood sugar kit 2 bioodngar kit 1i, 71 / 3 blood sugarjçit 4 blood urea kit 5 blood urea 6 blood urea kit kinetie ‘‘ 7 urea end point 8 s. creatnine ri 2 60 ml . r2 60 ml 9 s. creatnine ri 2w50 ml 10 s. creatnine 1u1 s. bilirubine ( t ) 12 s. bilirubin d & t 13 s. bilirubine ( t ) 14 s. bilirubine t&d r1r2 60 ml, r2 2 60nl0i 15 s.bilirubine t&d 16 soot 17 soot 18 soot 19 sopt 20 sgpt 21 sgpt 22 s. alk. phosphate s. alk. phosphate 24 s. alk. phosphate 25 total protein 26 total protein 27 total protein 28 s. alburnim . 29 s. albunum 30 !s.albumin 31 s.calciumlrl 1’50ml, r2 1w50ml, 32 s. calcium 33 s.calcium 34 s.cknacri 2 8m1j, r22 2ml? 35 s. ck nac 36 jck mb ickmb jsldh ri 48 ml, r2 1d8 ml s. ldh 37 38 39 40 amy1ase 41 s. amylase 42 s.amylase s. uric acid 44 s. uric acid 45 s. uricacid 46 s.uric acid 47 s. t. cholesterol 48 s.t. cholesterol 49 s.t. cholesterol 50 s. trigly ceride 51 s. trigly ceride 52 s. trigly_ceride 53 54 s.hdl dirrect hdl 55 s.hdl direct 56 s.hdl 57 ldl cholestrol 58 ldl ciiolestrol csf dilution fluid plueural dilution fluid acetic dilution fluid semen dilution fluid 63 urine strip for alb & sugar ( uristix ) ___...... 64 urine strip for sugar& ketone ( ketodiastic ) 65 multistripi 0 para for accurex urine analyser ( exnress 1 0 66 urine strip 4 para ( alb .sugar. ph, sp. gravity ) 67 pregnancy test card 68 69 sulphur powder exam id qgk 1 / .7 . : i f ‘ ‘ v i ; i ‘ _r—ij i edta powder 70 71 72 73 74 75 76 nitric acid glacial acetic acid eosino dilution fluid ligeul iodine for stool anti abd set anti d ( igg & 1gun ) total rbc dilution flu 59 60 61 62 77 78 79 field stain i p field stain ii platelest dilution fluid fouchest reagent 80 81 liesman stain 82 tissue paper roll 83 filter paper 0 no. 84 4pcard ( antigen ) 85 dengue card antigen ( day i ) nsi lgg 1gm 86 vdrl strip 87 jsb i stain _______________________ 88 jsb ii stain 89 liquid parafine oil 90 crpkit 91 ra kit 92 aslo kit 93 widal 94 bovine album 22% 95 hiv tridols 96 esr tube glass 97 hb meter squer 98 hb meter round __________ 99 hb tube round 100 hbpipate 101 distilled water 102 n / iohcl ____. i 103 glass.slide ....... 104 jriya vial 105 urine container with label ( non sterilized 30 ml 106 tips stand for yellow tips 107 tips stand blue tips 108 lron esr stand 6 tube capicity 109 throm bo span is 110 test tube glass ......................_ 111 test tube glass 112 measuring pipalte glasss iml 113 measuring pipalte glasss 2ml 114 measuring pipalte glasss 5ml 115 measuring pipalte glasss 10 ml 1n16 hbsag card ___._ 117 sodium citrate vial for pt test 118 mearing flask 250 ml 1l19 mearingflask500ml 120 mearing flasic 1 lit — 121 glass funnel !122 glass beaker 50m1 . 123 glass beaker loomi 124 tlc dilution 125 3.l%sodiumcitrat 126 for ceff steel 127 combs sera 128 cbc vial mixer 129 1hb tube squar 30 svrnye needle distoryed maschine thermal paper 50mm2o mtr thermal paper 1 10mm!20 mtr alluminium test tube stand 4w8 holl 34 esr tube for esrite esr stand newbarchamber 36 urine container with label ( sterilized ) 50 ml cover glass 138 coverslip 39 bt ci capiliry tube 140 esrite esr stand droper bottle plastic 60ml 142 wash bottle plastic 250ml 143 wash bottel plastic 500 ml 144 blue tips 145 yello tips 146 slide box plastic ( big size ) 147 slide box plastic ( small size ) 148 kidney tnlplastic? 149 lalluminum test tube stand 3 8 holl 150 lalluminum tast tube_stand 34 holl .._______d 1 5 i4biood sgear strip:for glucometer ______ _______ 152 biochemistry reagent for rendox fully auto analyser 153 blood uria kit birthload method gram stain ____ ______ giemsa stain with fixative 156 sodium hypocloride solution 5% 157 .htvsd card 158 micro pipet veriable 159 micro pipet veñable 160 micro pipet veriable 161 stop watch 162 tunicate belt_ 163 disposable esr tube ( 1to 20o mm. ) 164 disposable serum vial 165 lense cleaning paper 166_dengu kit for alisa mathed ns1 167 dengu kit for alisa mathed igg 168 dengu kit for alisa mathed 1gm 154 155 169 anti ab vial 170 centrifuse machine [ r 8cdx ] 171 centrifuse machine 172 rotator machine 173 j.s.b. first stain 174 j.s.b. second stain 175 sterile disposable needle no 22 176 sterile disposable needle no 23 177 sterile disposable needle no24 178 sterile disposable needle no 26 179 dispovan 5ml syringe 180 edta k3 non vccum blood collection tube 1 to 4 ml with tray paking iiot act1vator non vccum blood coulection tube 1 to 4nml with tray paking 182 fioride non vccui blood collection tube 1 to 4 ml with.tray.paking . 183 citrate 3.2 % non vccum blood collection tube 1 to 4 ml with tray paking citrate 3.8 % non vccum blood collection tube 1 to 4 ml with tray paking 18s lithium iepiarin non vicum biood collection tube 1 to 4 ml with tray pa king sodium heptarin non vccum blood collection tube 1 186_to4 ml with tray paking e___ e____4 187 gel non vccom blood collection tube 1 to 4 ml with tray paking edta k3 vccum blood collection tube 1 to 4 ml with 188 tray pak e 189 edra ( 3 vccum blood coulection tube 5 to 6 ml with tray pa king .. i i r li clot activa i or vccum bloul ) liolltc i ion i tjbe 1 to 4 ml with tray pa king clot activator vccum blood collection tube 5 to 6 ml 191 with tray paking floride vccum blood collection tube 1 to 4 ml with tray paking floride vccum blood collection tube 5 to 6 ml with tray pa king i c? i ‘j i_i _ .1. i s.d —y micg 196 paking • i • i • i i :•lf — wav i . l.if 197 gel vccum blood collection tube 5 to 6 ml uthium heptarin vccum blood coliection tube 1 to 4 198 ml with tray paking s.i i mni i i o•in”mnimmmniiv wlvmi 1.1 ls%. 1.1 5..%j l j rmt. rrv m = ... , v —;_ r. ( lg s.m l? with tray paking / / ( 1y .g needleforvaccumetube 7, o iron baul for prothombin test 7 2..: . cuvet for prothrombine test ‘ 199 200 201 202 • . , 203 denguens1elisatest 1lm1 ‘1•., . 204 dengue igg euisa test •, i ‘ 205 dengue 1gm elisa test 5” / 206 hbsag elisa test 207 hb test strip for hemocue hb 301 190 192 193 194 with tray pakine 195 citrate 3.8 % vccum blood coluection tube 1 to 4 ml cc:ranf4o 208 cleaning solution 209 de ionised water 210 stool container 211 typhimdotrapidtest 212 t3 for elisa reader 213 t4 for elisa reader 214 tsh for elisa reader 215 wash solution for elisa reader . 216 typhoid test repid test kit 217 haem test for occult blood kit for stool etc...

Medical And Health Services - Rajasthan

28360367 supply of lab reagents. abx cleaner, abx lysbio, abx minidill, abx minitrol, abx minoclair, albumin kit, alkaline phosphate kit , anti adb blood group set, beaker glass, beaker plastic, billirubin kit, blue tips for micro pipatte, capppilary tube, chemisol, cholestrol kit, cover glass, creatinine kit, disposable urine, disposable needle, disposablle needle, disposable test tube plast, distilled water, disposable esr pippette, dropping bottle, edta powder, esr cup, filter paper, glass pipattes, glass slides packet, glucose kit, hb pipette, hb tube toptech, hdl cholestrol kit, hiv 44th generation rapid test, hydrochloric acid, k3 edta double cap, lancet, lugul iodine, marker pencil, micro pipette, urine strips 10 parameter, pcv tubes, printer paper horiba, rubber bulb , sd cheek , sgot, sgpt kit, sodium citrate, sodium floride, sodium hypoclorite, hand rub solution , test tube glass, test tube stand, total protien kit, triglycerides kit, uera kit, urine pragnancy card, urine strips for albumin sugar, urine strips 4 parameter, vdrl card, widal kit, yellow tips for micropipettes, esr vial, black tips, tsh , psa, hb1 cad, mp canti card...

Ministry Of Micro Small And Meduim Enterprises - Rajasthan

27858597 enquiry for science lab science lab required at msme technology centre bhiwadi 1.0 burette stand burette stand with clamp and boss head : burette stand steel 7x 5” with clamp with heavy based cast iron & chrome plated 4 2.0 burette borosil glass 10 burette with teflon cock 50.ml high grade burette class a, white graduation 10 3.0 beaker borosil glass 3.1 beaker 50ml borosil glass borosilicate glass with level marking beaker 50 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass with level marking beaker very low coefficients of thermal expansion resistant to thermal shoc 10 3.2 beaker 100ml borosil glass borosilicate glass beaker 100 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 5 3.3 beaker 250ml borosil glass borosilicate glass beaker 250 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 4 3.4 beaker 500ml borosil glass borosilicate glass beaker 500 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 2 3.5 beaker 1000ml borosil glass borosilicate glass beaker 1000 ml laboratory glassware and labware beakers low form with spout graduated borosilicate glass beaker very low coefficients of thermal expansion resistant to thermal shoc 2 4.0 conical flask borosil glass 4.1 conical flask 250ml type: erlenmeyer graduated conical narrow mouth flask capacity ( ml ) : 250 dimension ( mm ) : 85 x 140 neck size: 34 10 4.2 conical flask 500ml type: erlenmeyer graduated conical narrow mouth flask capacity ( ml ) : 500 neck size: 34 or more 10 4.3 conical flask 1000ml capacity 1000 milliliters material glass : borosilicate glass with level marking 10 5.0 measuring pipette gr. 10 5.1 measuring pipette gr. 25ml 10 6.0 test tube 6.1 15x125 mm borrosil glass 2 test tube ( bx of 100 pcs ) 6.2 test tube brush 10 6.3 test tube holder 12 6.4 test tube stand 4 7.0 glass bottle ( hitech glass ) narrow mouth 7.1 5 lit : borosilicate glass with level marking 2 7.2 3 lit : borosilicate glass with level marking 3 7.3 1 lit: borosilicate glass with level marking 5 8.0 reagent bottle ( hitech glass ) narrow mouth 8.1 50 ml. : borosilicate glass with level marking 1 8.2 100 ml. : borosilicate glass with level marking 5 8.3 250 ml.: borosilicate glass with level marking 4 9.0 droppered bottle 9.1 droppered bottle 50 ml.: borosilicate glass with level marking 5 10.0 cylinder measuring glass 10.1 50 ml. : borosilicate glass with level marking 5 10.2 100 ml.: borosilicate glass with level marking 5 10.3 500 ml.: borosilicate glass with level marking 5 11.0 measuring flask 11.1 500 ml. : borosilicate glass with level marking 2 11.2 1000 ml.: borosilicate glass with level marking 2 11.3 2000 ml.: borosilicate glass with level marking 1 12.00 volumetric borrosil glass 12.1 20 ml.: borosilicate glass with level marking 10 12.2 10 ml.: borosilicate glass with level marking 25 12.3 5 ml.: borosilicate glass with level marking 10 13.00 filter paper 13.1 filter paper 1 packet ( 100 piece ) 2 14.00 water bath 14.1 internal dimensions ( lxwxd ) : 300x250x100 mm or 355x405x100 mm no. of holes : 6 holes of 75 mm dia or 12 holes of 75 mm dia capacity 8 liters. or 15 liters. heating load 1.0 kw or 2.0 kw temperature range from ambient to 100 oc + 1.0oc temperature controller temp. is controlled by a hydraulic thermostat moc inner and outer made of s.s. 304 grade 1 15.00 referigerator 210 litre standard 15.1 type : single door or double door refrigerator type: top freezer refrigerator defrosting type: direct cool compressor type: digital inverter compressor capacity: 210 l number of doors: 1 or 2 star rating: 3 or above built in stabilizer: yes warranty summary: 1 year on product and 10 years on compressor from oem 1 16.00 volumetric flask 16.1 250ml ( error limits± ml ) , with screw cap 2 16.2 500ml ( error limits± ml ) , with screw cap 2 17.00 pipettes / dropper 17.1 material plastic / pp / glass length available 118mm, 114mm, 80mm, 75mm, 72mm ml 0. 1ml, 0. 2ml, 0. 3ml color transparent 1 18.0 laboratory hot air oven 18.1 temperature range +5dec c above ambient to 250dec c with a sensitivity of + / 2dec c number of shelves 1 or more nos inner size 350*350*350 mm to 600*900*600 mm rating 1.2 4 kw moc inner stainless steel moc outer mild steel attractively finished in powder coating heating element high grade nichrome wire insulation special grade glass wool tray stainless steel power supply 230 v 1 phase, 50 hz, ac supply optional accessories digital temperature indicator cum controller, air circulating fan assembly, timer range 0 9999 min 1 19.0 stainless steel magnetic stirrer 2 ltrs s.s top 1 19.1 material stainless steel capacity 2 liters voltage ac 220 v application : lab plate size 190x190 mm weight 6 kg 1 20.0 magnetic beads chemistry 2 20.1 material : tiny ( 20 to 30 nm ) particle of iron oxide 2 21.0 bunsen burner 3 21.1 material stainless steel usage laboratory base diameter 12mm automation type semi automatic height 150 mm 3 22.0 digital balance 22.1 0.01mg cap 500.gm material: stainless steel power source : 220v maximum capacity : 500g readability: 0.01g power requirement: 220 v width 15 cm pan size 80 mm height 18 cm depth 13 cm weight 1 kg 1 23.0 digital ph meter 23.1 range 0 to 14, temp. 0 to 100`c with combined electrode stand with clamp, dust cover and instruction manual 2 24.0 wire gauage 24.1 material stainless steel model name / number 1505 shape round finish polish thickness 0.20 1 mm 4 25.0 sprit lamp 25.1 material stainless steel, size / capacity 125 ml. jointed 6 26.0 cappilary tube 26.1 material glass size 75 mm ( length ) packaging type box outer diameter 1.5 1.6 mm inner diameter 1.1 1.2 mm 1 box 27.0 tripod stand 3 27.1 tripod material: metal tripod height: 1 feet load capacity : 1 kg shape round 3 28.0 digital thermometer 2 28.1 material plastic color white and black both available thermometer type probe with digital features low power consumption, high stability, high accuracy, compact structure, easy operating. accuracy + 1 c / f 2 29.0 chlorine test kit 1 29.1 portable chlorine test kit for finding chlorine % free chlorine measurement type colorimetric free chlorine range 0.0 to 2.5 mg / l free chlorine resolution 0.5 mg / l free chlorine number of tests 50 chlorine method dpd weight 176 g ( 6.6 oz. ) 1 30.0 digital tds meter 1 30.1 digital tds meter hand held ec range: 0 – 9990 μs; 0 – 9.9 ms tds range: 0 – 5000 ppm ( 0.5 scale ) ; 0 8560 ppm ( 0.7 scale ) temperature range: 1 80 °c; 33 176 °f resolution: 1 μs / ppm; 0.1 ms temp. resolution: 0.1 °c / f accuracy: + / 2% power source: 3 x 1.5v button cell batteries ( lr44 or equivalent is included ) dimensions: 15.3 x 3.2 x 1.8 cm ( 6.0 x 1.3 x 0.7 inches ) weight: 53.9g 1 31.0 copper calorimeter 2 31.1 copper calorimeter 75 x 50 mm with felt insulation, outer vessel of 100 x 65 mm size with a plastic lid having holes for thermometer & stirrer. a thermometer holder is fixed to the outer vessel. complete with stirrer. 2 32.0 funnel 4 32.1 3 inch dia material type : borosil glass 4 33.0 glass rod 33.1 150x6mm 20 34.0 measuring cylinder 34.1 measuring cylinder ( 10ml & 20 ml ) glass 5 35.0 periodic table chart 35.1 size :140 x 100 cm . language : english. multicolour offset printing.this chart is thermally laminated with 30 micron thick polyester film rendering thechart tear & water resistant. this chart is ideal for putting up on a board or a wall. 1 36.0 ph paper 36.1 5.9 x 0.8 x 0.006 cm features 1 3 indicates a very acidic substance, 4 6 indicates an acidic substance, 7 indicates neutral, 8 10 37.0 multicolour polyart synthetic paper laboratory safety for chemistry lab display chart 37.1 size: 70x100 cm. 1 38.0 chemicals 38.1 h2s04 ( sulphuric ) 500ml 38.2 hn03 ( nitric ) 500ml 38.3 hcl ( hydrochloric ) 500ml 38.4 mercuric sulfate 500gm 38.5 sodium nitrite 500ml 38.6 chloroform 500ml 38.7 molischs reagent 500ml 38.8 fehlings reagent 500ml 38.9 benedicts reagent 100ml 38.10 tollens reagent 100ml 38.11 iodine solution 500gm 38.12 copper sulfate 500gm 38.13 sodium hydroxide 100gm 38.14 furfural solution 500gm 38.15 oxalic acid ( solid ) 500gm 38.16 sodiun hydroxide solution 500ml 38.17 phenolphthalein indicator 125ml 38.18 ammonium ferrous sulphate 500ml 38.19 ethanol 500ml 38.20 potassium permagnate 500ml 38.21 napthalene 500ml 38.22 benzoic acid 500ml 38.23 acetic acid 500ml 38.24 sodium chloride 500ml 38.25 distilled water 5.ltr 38.26 sodium hydrogen carbonate 500gm 38.27 universal indicator 500ml 38.28 edta sol. 500ml 38.29 calcium carbonate 500gm 38.30 eriochrome black t indicator 25gm 38.31 buffer solution 500ml 38.32 diethyl ether 500ml 38.33 potassium hydroxide 500gm...

Medical And Health Services - Rajasthan

27684427 supply of lab regents and chemicals / biomedical west materials. biochemistry items: 1 glucose kit liquid perkit 2 blood urea liqr.iid perkit 3 creatinine liquid perkit 4 biluribin liquid perkit 5 sgot liquid perkit 6 sgpt liquid perkit 7 alk. phasptase liquid perkit 8 total protien liquid perkit i colestrol liquid perkit 10 trigelsrides ( tg ) liqu id perkit 11 hdl liquid perkit 12 vldl liquid perkit 13 glucometer strip perpcs 14 plain tube perpkt , ia s. calcium test perkit 16 s. ck nac perkit 17 s, ck mb perkit 1b s. ldh perkit 19 s. uric acid perkit 20 s. amy lase perkit 21 tips yellow ( 1 50 mc ltr. ) perpkt 22 tips blue ( 1 ml. ) perpkt 23 plastic tube rack per pcs 24 micro pipptte stand per pcs 25 fouschest reagent perpcs 26 occult blood card perkit 27 barium chloride per pkt 28 sulphur powder perpkt 29 benidict solution perbottle 30 leshimen stand perbottle 31 wash bottle per pcs 32 dropping bottle perpcs 33 glass beaker per pcs 34 oillmmersion per bottle 35 accu check ( glucometer cell ) perpcs 36 totalalbumin per pcs 37 micro pipptte i 10 micro liter ( variable ) per pcs ti 5 50 micro liter ( variable ) perpcs 4 tii 10 100 micro liter ( variable ) per pcs lv 100 1000 micro liter ( variable ) per pcs v 500 micro liter ( fix ) perpcs vi | 1000 micro liter ( fix ) per pcs...

Medical And Health Services - Rajasthan

27682171 supply of lab regents and chemicals / biomedical best materials. biochemistry items: 1 glucose kit liquid perkit 2 blood urea liqr.iid perkit 3 creatinine liquid perkit 4 biluribin liquid perkit 5 sgot liquid perkit 6 sgpt liquid perkit 7 alk. phasptase liquid perkit 8 total protien liquid perkit i colestrol liquid perkit 10 trigelsrides ( tg ) liqu id perkit 11 hdl liquid perkit 12 vldl liquid perkit 13 glucometer strip perpcs 14 plain tube perpkt , ia s. calcium test perkit 16 s. ck nac perkit 17 s, ck mb perkit 1b s. ldh perkit 19 s. uric acid perkit 20 s. amy lase perkit 21 tips yellow ( 1 50 mc ltr. ) perpkt 22 tips blue ( 1 ml. ) perpkt 23 plastic tube rack per pcs 24 micro pipptte stand per pcs 25 fouschest reagent perpcs 26 occult blood card perkit 27 barium chloride per pkt 28 sulphur powder perpkt 29 benidict solution perbottle 30 leshimen stand perbottle 31 wash bottle per pcs 32 dropping bottle perpcs 33 glass beaker per pcs 34 oillmmersion per bottle 35 accu check ( glucometer cell ) perpcs 36 totalalbumin per pcs 37 micro pipptte i 10 micro liter ( variable ) per pcs ti 5 50 micro liter ( variable ) perpcs 4 tii 10 100 micro liter ( variable ) per pcs lv 100 1000 micro liter ( variable ) per pcs v 500 micro liter ( fix ) perpcs vi | 1000 micro liter ( fix ) per pcs...

Medical And Health Services - Rajasthan

27589708 bid for lab reagents and equipments. preg. card mankind, multi uritix, blood group reagent, esr tube disposable, sample vial with clotapplicator, k 3 vial double carp, sugar kit, widal test kit, glass slide, cover slip, urea test kit, erba sgot test kit, erba sgpt test kit, sarum alkaline phosphatase test kit, lancet, bilrubin test kit erba, creatinine test kit, cholesterol test kit, vdrl test kit, hbsag test kit / card, analyzer cleaner solution, hdl cholesterol direct mathod, tri licride test kit, mp card sd antigen, dengue card j mitra, total protien, utistix, gluco strip / one touch, hb pipette, leishman stain, rbc diluting fluid, wbc diluting fuid, auto pipette tips 100 to 1000 ul blue, sodium citrate , n / 10 hcl , xyiene , urine container, sprit, test tube without cat, touriquet, distilled water , jsb , capillary tube, hemoglobin strip, hb scale strip, analyzer printer roll, filter paper, serum allvumin kit, marker pencil, paramanent marker, liqued hand wash, abxlyse bio, abxcleaner , minoclair, minidil lmg, albumin kit, vldl kit, hydro chloric acid solutoin, cader wood oil, face mask, sharp container, glassware conatainer, glass beaker, x ray film, developer, fixer, ...

Medical Education Department - Rajasthan

27553868 rate contract for lab kits chemical items pathology lab at srg hospital, jhlawar absolute alcolol 99.5% ( 2.5 ltr ) , acetone ar ( 2.5 ltr. ) , acid fuchsian 500 gm, activated charcoal 500gm, alcian blue 500 gm, ammonium chloride anhydrous ( 500gm ) , ammonium pattasium alum 500gm, ammonium solution ( 25% ) 500ml, ammonium sulphate 500 gm, b.t.c.t. cappillry tube 1 x100, barium chloride 500gm, basic fuchsin 500 gm, beaker glass 1 ltr., beaker glass 250ml, beaker glass 500ml, benedicts reagent 500ml, biebrich scarlet 500 gm, brilliant cresyl blue 520ml, buffer tablets, ph: 6.8 7.0, buffer tablets, ph: 4.0 8.0, carbol fuschsin ( strong ) , 500 ml, carmine stain, 25gm, cedarwood oil ( colour less ) , 125ml, conc. hcl, 2.5 liter, congo red, 100gm, conical flask glass, 2 ltr., conical flask glass, 100ml, conical flask glass , 250ml, coplin’s jars ( vertical ) plastic, each, crystal violet, 500 gm, coag control n+p, 12x2x1 ml, d.p.x. mountant, 250ml, dekaphane uristix, 100, dextrose anhydrous, 500 gm, dropper plastic, 1 ml, dropper plastic, 2 ml, dropper plastic, 3 ml, dropping bottle, 250ml, edta powder, 100gm, egg albumin flacks, 500gm, eosin 2%, 125 ml, eosinophil diluting fluid, 150 ml, esr tube ( westergreens ) , 2ml, ethanol absolute, 500ml, ferric ammonium sulphate, 500gm, field stain a, 500ml, field stain b, 500ml, filter paper ( watmans ) , each, formaldehyde ( 37 40% ) , 25 30 lit., formaline, 5 ltr., formic acid 90%, 2.5 liter, fouchets reagent, 125ml / 100ml, funnel, 6”, funnel 4”, giemsa’s powder 100gm, glacial acetic acid 2.5 liter, glass piptte with bulb 5ml, glass piptte with bulb 1ml, glass slide box size 75x25x1.35 1 x 50 nos, glycerin 2.5 lit., haem test for ocult blood in stool 200 test, hematoxylene 5 gm, iso propyl alcohol 2.5 ltr., jsb i stain 500ml, jsb ii stain 500ml, keto diastix 100, labolene 5ltr., leishaman’s stain kit / cytochrome 500ml, light magnesium carbonate 500 gm, lithium carbonate 500gm, lugol’s iodine 100ml, magnesium sulphate 500 gm, measuring cylinder glass 100ml, measuring cylinder glass 500ml, mercuric oxide red 500 gm., mercuric oxide yellow 500 gm., metanil yellow 500gm, methyene blue 125ml, micro albumin strips – 1x25, n / 10 hcl 500 ml, neoplastine ci plus – 2 6x2 ml, paraffin wax 1 k.g., phosphotungstic acid 100gm, platelet diluting fluid 500ml, polylysene 100ml, potasium metabisulphite 500 gm, potassium acetate 500 gm, potassium chloride 500 gm, potassium iodide 100gm, rbc diluting fluid 500ml, reagent bottle 125ml / 60ml / 250 ml / 500 ml, reagent dropping bottle 100ml, seman diluting fluid 520ml, silicon gun with silicon 1 gun & 2 tubes, silver nitrate 25gm, sod. hypochlorite 5ltr., sodium aceate trihydrate ar ( 500gm ) , sodium biacarbonate 500 gm, sodium metabisulphide ( 500gm ) , sodium thiosulphate 500 gm., sta cacl2 0.25 m 24x15 ml, sta cuvettes 150x4 cuv., sta steel balls 1850 balls, staining jar trough glass for 10 slides each, sulphuric acid 2.5 lit., test tube glass 12x75, test tube plastic 12x75, test tube glass 12 x 100, test tube plastic 12 x 100, thrombin time test kit 12x2 ml, thymol 500 gm, toludine blue 125ml, trisodium citrate 500 gm, trisodium citrate dehydrate purified 500gm, triss ( hydroxymethyl methylamine ) 500gm, tween 20 ( polyoxyethylene sorbitan monolaurate ) 500ml, wbc diluting fluid 500ml, xylene ( sulfur free ) ar 2.5 ltr., ready to use antibodies ( dilutional ) er1 kit each, ready to use antibodies ( dilutional ) pr1 kit each, ready to use antibodies ( dilutional ) her 2 neu 1 kit each, peroxidase staining test kit 1 kit each, ihc detection kit 1 kit each, absolute ethanol ( 99.9% ) 500ml, xylene lr ( sulphur free ) 2.5lt, acetone 2.5 lt, formaldehyde solution ( 37 40 % w / v ) 50 lt, lithium carbonate ( li2co3=73.89 ) 250 gm, d.p.x. mountant 250 ml, egg albumin flakes 500 gm, surgical blade 22 no. pro core 100, microtome blade hp 35 coated 34° / 75 mm 1x50, diamond pencil, watmans filter paper 125 mm, paraffin wax with ceresin 2 kg, glycerine 2.5 lt, methanol, lugols iodine, light green 25 gm, aluminium sulphate al2 ( so4 ) 3.16h2o 500 gm, periodic acid 25 grm, aluminium hydroxide 500 grm, aluminium chloride anhydrous 500 gm, potassium ferrocyanide 500 grm, nuclear fast red 1gm, koh ( potassium hydroxide ) 500 gm, oxalic acid 500 gm, bouins luid 1lt, saturated picric acid 100 ml, glacial acetic acid 500ml, methanamine 500gm, hydrogen peroxide 30% 500ml, hemotoxylin stain 25gm, eosin 2% w / v 125ml, potassium dihydrogen phosphate.2h20 500gm, naphthol as bs phosphate 500mg, fast blue bb salt 25gm, neutral red ( aqueous sol. ) 500ml, naphthol as&d chloroacetate 250ml, glycerol 2.5lt, nn dmethly formamide 500ml, phosphate buffer 500gm, toluidine 25gm, potassium permanganate powder 500gm, gold chloride 1gm, ferric chloride 500gm, sodium hydroxide 500gm, borax powder 500gm, ferric chloride 500gm, sodium dihydrogen phosphate 500gm, sodium chloride 500gm, hexamethelene tetramine 500ml, chromic acid 500gm, kh2po4 ( monobasic ) 500gm, alpha naphthyl acetate 10gm, fast garnet gbc salt 1gm, non specific esterase kit for leukemia pack size 1, myeloperoxidase stain kit for leukemia pack size 1, benzidine dihydrochloride 1gm, znso4.7h2o 500gm, sodium acetate trihydrate 500gm, pap stain kit 250 tests / kit, disposable microtome blade 80 mmx14 mmx0.35 mm pack of 50, ( a ) . gopd kit quantitative 12test, ( b ) . g6pd qualitative 12test, microscope bulb ( low voltage halogen lamp & led ) , drabkins solution 500ml, bone marrow needle ( jamshidi & sahlas ) , fructose test reagent ( for semen ) 100ml, new methylene blue ( for reticulocyte count ) 5gm, csf diluting fluid reagent 100ml, buffer tablet ( ph 4.0, 6.0 &7.5 ) , haem test for occult blood in stool 200 test, fdp 60 test, d dimer 60 test, bone marrow aspiration needle ( 16 g. & 50mm ) pack size 1, peanut oil 5lt, k2 edta vial duble cap non vacmmum, pt 3.2% vial duble cap non vacmmum, polyl lysine 100ml, ready to use antibodies ( dilutional ) er1 kit each 12ml, ready to use antibodies ( dilutional ) pr1 kit each 12ml, ready to use antibodies ( dilutional ) her2 neu 1 kit each 12ml, ihc detection kit 1 kit each 15 kit, trisodium citrate dehyrate purified ( 500 gm ) 500gm, tween 20 ) polyoxyethylene sorbitan monolaurate 500 gm, triss ( hydroxymethyl methylamine 500 gm ) , disodium hydrogen phosphate 500gm, sodium dihydrogen phosphate 500gm, edta powder 500gm, copper sulphate powder 1x10 ml, syringe 5 ml & 3 ml, cover slip 22x22 mm, 22x50 mm, dropper plastic 1x500, normal saline, sample edta vial duble cap non vacmmum ( k3, ) , sample plain vial duble cap non vacmmum ( red top ) , glass slide, conical flask ( 250 ml & 500 ml ) borosil, test tubes ( 7 inches & 10 inches ) borosil, electronic weighing machine, measuring glass cylinder 500 ml borosil, measuring glass beaker 50 ml, 100 ml & 500 ml borosil, glass stirring rod, test tube stand 48 hole plastic, test tube stand 96 hole plastic, periodic acid 100grm, basic fuschin, sodium metabisulphite, hcl, activated charcoal, martius yellow, phosphotungstic acid, brilliant crystral scarlet, glacial acetic acid 500gm, acetic acid 1%, 1% aquaeous potassium ferrocyanide 500gm, 2% hcl, 0.5% neutral red 500ml, silver nitrate 10%, conc. ammonia, 3% sodium hydroxide 500gm, 1% potassium permanganate 500gm, 1% oxalic acid 500gm, 2.5 % iron alum, 0.2% gold chloride 1 gm, 5% sod. thiosulphate, congo red, carbol fuschin, h2so4 5%, h2s04 20%, methylene blue ( aqueous ) 125ml, giemsa stain 10x500ml, leishman stain 500ml, leishman powder 50gm, retic stain 25ml, pas stain ( ready to use ) pa 25gm schiff reagent 125ml, sudan black kit, ph meter / litmus papers ( basic and acidic ) , cedar wood oil 100ml, semen diluting fluid 100ml, wbc diluting fluid 500ml, csf diluting fluid 100ml, microscope lens cleaner 100ml, thymol crystal 100gm, sodium citrate 500ml, filter paper ( watmanns ) packet, westergrens pippet tube, wintrobe tube tube, neubauer chamber, sahlis hemoglobinometer set 5, benedicts reagent 500ml, microalbumin strips ( urine ) 100 strips per box, esr card 10000 per card, sulphosalicylic acid 500ml, conc. acetic acid 500ml, liquid ammonia 500ml, potassium ferrocyanide 500gm, conc. hcl 500ml, heys sulphur sulphur sublimate powder 500gm, sodium nitroprusside powder, h202, fouchets reagent, benzidine solution, barium chloride, trichloroacetic acid, ehrlich reagent, chloroform, sodium acetate, butenol, ferric chloride, eosin niagresin, tourniquet, spinal needle, wooden & plastic slide storage box, puncture proof box, glass marking pencil, couplins jar, picric acid 500gm, citric acid 500gm, esbachs albuminometer, urine container 30ml, urinometer, pipettes 5 50ul tips – yellow 100 1000ul blue 20ul fix, dextrose 500gm, sodium nitrite 500gm, methylene blue chloride 50gm, anhydrous dipotassium hydrogen phosphate 500gm, anhydrous potassium dihydrogen phosphate 500gm, sodium dithionate 500gm, saponin 100gm, glass measuring beaker 50ml, glass measuring beaker 100ml, glass measuring beaker 500ml, measuring cylinder 200ml, glass stir rod, carmine 100gm, alcian blue 8gx, acetic acid 3% solution, aluminium sulphate al2 ( so4 ) 3.18h20 500gm, oil red o, p.t. vial 1x100, k2 edta vial 1x100, k3 edta vial 1x100, c.k. prest test kit, tissue paper roll, pregnancy test kit etc...

Government Medical College Hospital - Rajasthan

27552531 rate contract for supply of laboratory kits chemical items , phathology at srg hospital jhalawar. 1 1 pathology 2 2 absolute alcolol 99.5% ( 2.5 ltr ) 1 nos 3 3 acetone ar ( 2.5 ltr. ) 1 nos 4 4 acid fuchsian 500 gm 1 nos 5 5 activated charcoal 500gm 1 nos 6 6 alcian blue 500 gm 1 nos 7 7 ammonium chloride anhydrous ( 500gm ) 1 nos 8 8 ammonium pattasium alum 500gm 1 nos 9 9 ammonium solution ( 25% ) 500ml 1 nos 10 10 ammonium sulphate 500 gm 1 nos 11 11 b.t.c.t. cappillry tube 1 x100 1 nos 12 12 barium chloride 500gm 1 nos 13 13 basic fuchsin 500 gm 1 nos 14 14 beaker glass 1 ltr. 1 nos 15 15 beaker glass 250ml 1 nos 16 16 beaker glass 500ml 1 nos 17 17 benedicts reagent 500ml 1 nos 18 18 biebrich scarlet 500 gm 1 nos 19 19 brilliant cresyl blue 520ml 1 nos 20 20 buffer tablets, ph: 6.8 7.0 1 nos 21 21 buffer tablets, ph: 4.0 8.0 1 nos 22 22 carbol fuschsin ( strong ) , 500 ml 1 nos 23 23 carmine stain, 25gm 1 nos 24 24 cedarwood oil ( colour less ) , 125ml 1 nos 25 25 conc. hcl, 2.5 liter 1 nos 26 26 congo red, 100gm 1 nos 27 27 conical flask glass, 2 ltr. 1 nos 28 28 conical flask glass, 100ml 1 nos 29 29 conical flask glass , 250ml 1 nos 30 30 coplin’s jars ( vertical ) plastic, each 1 nos 31 31 crystal violet, 500 gm 1 nos 32 32 coag control n+p, 12x2x1 ml 1 nos 33 33 d.p.x. mountant, 250ml 1 nos 34 34 dekaphane uristix, 100 1 nos 35 35 dextrose anhydrous, 500 gm 1 nos 36 36 dropper plastic, 1 ml 1 nos 37 37 dropper plastic, 2 ml 1 nos 38 38 dropper plastic, 3 ml 1 nos 39 39 dropping bottle, 250ml 1 nos 40 40 edta powder, 100gm 1 nos 41 41 egg albumin flacks, 500gm 1 nos 42 42 eosin 2%, 125 ml 1 nos 43 43 eosinophil diluting fluid, 150 ml 1 nos 44 44 esr tube ( westergreens ) , 2ml 1 nos 45 45 ethanol absolute, 500ml 1 nos 46 46 ferric ammonium sulphate, 500gm 1 nos 47 47 field stain a, 500ml 1 nos 48 48 field stain b, 500ml 1 nos 49 49 filter paper ( watmans ) , each 1 nos 50 50 formaldehyde ( 37 40% ) , 25 30 lit. 1 nos 51 51 formaline, 5 ltr. 1 nos 52 52 formic acid 90%, 2.5 liter 1 nos 53 53 fouchets reagent, 125ml / 100ml 1 nos 54 54 funnel, 6” 1 nos 55 55 funnel 4” 1 nos 56 56 giemsa’s powder 100gm 1 nos 57 57 glacial acetic acid 2.5 liter 1 nos 58 58 glass piptte with bulb 5ml 1 nos 59 59 glass piptte with bulb 1ml 1 nos 60 60 glass slide box size 75x25x1.35 1 x 50 nos 1 nos 61 61 glycerin 2.5 lit. 1 nos 62 62 haem test for ocult blood in stool 200 test 1 nos 63 63 hematoxylene 5 gm 1 nos 64 64 iso propyl alcohol 2.5 ltr. 1 nos 65 65 jsb i stain 500ml 1 nos 66 66 jsb ii stain 500ml 1 nos 67 67 keto diastix 100 1 nos 68 68 labolene 5ltr. 1 nos 69 69 leishaman’s stain kit / cytochrome 500ml 1 nos 70 70 light magnesium carbonate 500 gm 1 nos 71 71 lithium carbonate 500gm 1 nos 72 72 lugol’s iodine 100ml 1 nos 73 73 magnesium sulphate 500 gm 1 nos 74 74 measuring cylinder glass 100ml 1 nos 75 75 measuring cylinder glass 500ml 1 nos 76 76 mercuric oxide red 500 gm. 1 nos 77 77 mercuric oxide yellow 500 gm. 1 nos 78 78 metanil yellow 500gm 1 nos 79 79 methyene blue 125ml 1 nos 80 80 micro albumin strips – 1x25 1 nos 81 81 n / 10 hcl 500 ml 1 nos 82 82 neoplastine ci plus – 2 6x2 ml 1 nos 83 83 paraffin wax 1 k.g. 1 nos 84 84 phosphotungstic acid 100gm 1 nos 85 85 platelet diluting fluid 500ml 1 nos 86 86 polylysene 100ml 1 nos 87 87 potasium metabisulphite 500 gm 1 nos 88 88 potassium acetate 500 gm 1 nos 89 89 potassium chloride 500 gm 1 nos 90 90 potassium iodide 100gm 1 nos 91 91 rbc diluting fluid 500ml 1 nos 92 92 reagent bottle 125ml / 60ml / 250 ml / 500 ml 1 nos 93 93 reagent dropping bottle 100ml 1 nos 94 94 seman diluting fluid 520ml 1 nos 95 95 silicon gun with silicon 1 gun & 2 tubes 1 nos 96 96 silver nitrate 25gm 1 nos 97 97 sod. hypochlorite 5ltr. 1 nos 98 98 sodium aceate trihydrate ar ( 500gm ) 1 nos 99 99 sodium biacarbonate 500 gm 1 nos 100 100 sodium metabisulphide ( 500gm ) 1 nos 101 101 sodium thiosulphate 500 gm. 1 nos 102 102 sta cacl2 0.25 m 24x15 ml 1 nos 103 103 sta cuvettes 150x4 cuv. 1 nos 104 104 sta steel balls 1850 balls 1 nos 105 105 staining jar trough glass for 10 slides each 1 nos 106 106 sulphuric acid 2.5 lit. 1 nos 107 107 test tube glass 12x75 1 nos 108 108 test tube plastic 12x75 1 nos 109 109 test tube glass 12 x 100 1 nos 110 110 test tube plastic 12 x 100 1 nos 111 111 thrombin time test kit 12x2 ml 1 nos 112 112 thymol 500 gm 1 nos 113 113 toludine blue 125ml 1 nos 114 114 trisodium citrate 500 gm 1 nos 115 115 trisodium citrate dehydrate purified 500gm 1 nos 116 116 triss ( hydroxymethyl methylamine ) 500gm 1 nos 117 117 tween 20 ( polyoxyethylene sorbitan monolaurate ) 500ml 1 nos 118 118 wbc diluting fluid 500ml 1 nos 119 119 xylene ( sulfur free ) ar 2.5 ltr. 1 nos 120 120 ready to use antibodies ( dilutional ) er1 kit each 1 nos 121 121 ready to use antibodies ( dilutional ) pr1 kit each 1 nos 122 122 ready to use antibodies ( dilutional ) her 2 neu 1 kit each 1 nos 123 123 peroxidase staining test kit 1 kit each 1 nos 124 124 ihc detection kit 1 kit each 1 nos 125 125 absolute ethanol ( 99.9% ) 500ml 1 nos 126 126 xylene lr ( sulphur free ) 2.5lt 1 nos 127 127 acetone 2.5 lt 1 nos 128 128 formaldehyde solution ( 37 40 % w / v ) 50 lt 1 nos 129 129 lithium carbonate ( li2co3=73.89 ) 250 gm 1 nos 130 130 d.p.x. mountant 250 ml 1 nos 131 131 egg albumin flakes 500 gm 1 nos 132 132 surgical blade 22 no. pro core 100 1 nos 133 133 microtome blade hp 35 coated 34° / 75 mm 1x50 1 nos 134 134 diamond pencil 1 nos 135 135 watmans filter paper 125 mm 1 nos 136 136 paraffin wax with ceresin 2 kg 1 nos 137 137 glycerine 2.5 lt 1 nos 138 138 methanol 1 nos 139 139 lugols iodine 1 nos 140 140 light green 25 gm 1 nos 141 141 aluminium sulphate al2 ( so4 ) 3.16h2o 500 gm 1 nos 142 142 periodic acid 25 grm 1 nos 143 143 aluminium hydroxide 500 grm 1 nos 144 144 aluminium chloride anhydrous 500 gm 1 nos 145 145 potassium ferrocyanide 500 grm 1 nos 146 146 nuclear fast red 1gm 1 nos 147 147 koh ( potassium hydroxide ) 500 gm 1 nos 148 148 oxalic acid 500 gm 1 nos 149 149 bouins luid 1lt 1 nos 150 150 saturated picric acid 100 ml 1 nos 151 151 glacial acetic acid 500ml 1 nos 152 152 methanamine 500gm 1 nos 153 153 hydrogen peroxide 30% 500ml 1 nos 154 154 hemotoxylin stain 25gm 1 nos 155 155 eosin 2% w / v 125ml 1 nos 156 156 potassium dihydrogen phosphate.2h20 500gm 1 nos 157 157 naphthol as bs phosphate 500mg 1 nos 158 158 fast blue bb salt 25gm 1 nos 159 159 neutral red ( aqueous sol. ) 500ml 1 nos 160 160 naphthol as&d chloroacetate 250ml 1 nos 161 161 glycerol 2.5lt 1 nos 162 162 nn dmethly formamide 500ml 1 nos 163 163 phosphate buffer 500gm 1 nos 164 164 toluidine 25gm 1 nos 165 165 potassium permanganate powder 500gm 1 nos 166 166 gold chloride 1gm 1 nos 167 167 ferric chloride 500gm 1 nos 168 168 sodium hydroxide 500gm 1 nos 169 169 borax powder 500gm 1 nos 170 170 ferric chloride 500gm 1 nos 171 171 sodium dihydrogen phosphate 500gm 1 nos 172 172 sodium chloride 500gm 1 nos 173 173 hexamethelene tetramine 500ml 1 nos 174 174 chromic acid 500gm 1 nos 175 175 kh2po4 ( monobasic ) 500gm 1 nos 176 176 alpha naphthyl acetate 10gm 1 nos 177 177 fast garnet gbc salt 1gm 1 nos 178 178 non specific esterase kit for leukemia pack size 1 1 nos 179 179 myeloperoxidase stain kit for leukemia pack size 1 1 nos 180 180 benzidine dihydrochloride 1gm 1 nos 181 181 znso4.7h2o 500gm 1 nos 182 182 sodium acetate trihydrate 500gm 1 nos 183 183 pap stain kit 250 tests / kit 1 nos 184 184 disposable microtome blade 80 mmx14 mmx0.35 mm pack of 50 1 nos 185 185 ( a ) . gopd kit quantitative 12test 1 nos 186 186 ( b ) . g6pd qualitative 12test 1 nos 187 187 microscope bulb ( low voltage halogen lamp & led ) 1 nos 188 188 drabkins solution 500ml 1 nos 189 189 bone marrow needle ( jamshidi & sahlas ) 1 nos 190 190 fructose test reagent ( for semen ) 100ml 1 nos 191 191 new methylene blue ( for reticulocyte count ) 5gm 1 nos 192 192 csf diluting fluid reagent 100ml 1 nos 193 193 buffer tablet ( ph 4.0, 6.0 &7.5 ) 1 nos 194 194 haem test for occult blood in stool 200 test 1 nos 195 195 fdp 60 test 1 nos 196 196 d dimer 60 test 1 nos 197 197 bone marrow aspiration needle ( 16 g. & 50mm ) pack size 1 1 nos 198 198 peanut oil 5lt 1 nos 199 199 k2 edta vial duble cap non vacmmum 1 nos 200 200 pt 3.2% vial duble cap non vacmmum 1 nos 201 201 polyl lysine 100ml 1 nos 202 202 ready to use antibodies ( dilutional ) er1 kit each 12ml 1 nos 203 203 ready to use antibodies ( dilutional ) pr1 kit each 12ml 1 nos 204 204 ready to use antibodies ( dilutional ) her2 neu 1 kit each 12ml 1 nos 205 205 ihc detection kit 1 kit each 15 kit 1 nos 206 206 trisodium citrate dehyrate purified ( 500 gm ) 500gm 1 nos 207 207 tween 20 ) polyoxyethylene sorbitan monolaurate 500 gm 1 nos 208 208 triss ( hydroxymethyl methylamine 500 gm ) 1 nos 209 209 disodium hydrogen phosphate 500gm 1 nos 210 210 sodium dihydrogen phosphate 500gm 1 nos 211 211 edta powder 500gm 1 nos 212 212 copper sulphate powder 1x10 ml 1 nos 213 213 syringe 5 ml & 3 ml 1 nos 214 214 cover slip 22x22 mm, 22x50 mm 1 nos 215 215 dropper plastic 1x500 1 nos 216 216 normal saline 1 nos 217 217 sample edta vial duble cap non vacmmum ( k3, ) 1 nos 218 218 sample plain vial duble cap non vacmmum ( red top ) 1 nos 219 219 glass slide 1 nos 220 220 conical flask ( 250 ml & 500 ml ) borosil 1 nos 221 221 test tubes ( 7 inches & 10 inches ) borosil 1 nos 222 222 electronic weighing machine 1 nos 223 223 measuring glass cylinder 500 ml borosil 1 nos 224 224 measuring glass beaker 50 ml, 100 ml & 500 ml borosil 1 nos 225 225 glass stirring rod 1 nos 226 226 test tube stand 48 hole plastic 1 nos 227 227 test tube stand 96 hole plastic 1 nos 228 228 periodic acid 100grm 1 nos 229 229 basic fuschin 1 nos 230 230 sodium metabisulphite 1 nos 231 231 hcl 1 nos 232 232 activated charcoal 1 nos 233 233 martius yellow 1 nos 234 234 phosphotungstic acid 1 nos 235 235 brilliant crystral scarlet 1 nos 236 236 glacial acetic acid 500gm 1 nos 237 237 acetic acid 1% 1 nos 238 238 1% aquaeous potassium ferrocyanide 500gm 1 nos 239 239 2% hcl 1 nos 240 240 0.5% neutral red 500ml 1 nos 241 241 silver nitrate 10% 1 nos 242 242 conc. ammonia 1 nos 243 243 3% sodium hydroxide 500gm 1 nos 244 244 1% potassium permanganate 500gm 1 nos 245 245 1% oxalic acid 500gm 1 nos 246 246 2.5 % iron alum 1 nos 247 247 0.2% gold chloride 1 gm 1 nos 248 248 5% sod. thiosulphate 1 nos 249 249 congo red 1 nos 250 250 carbol fuschin 1 nos 251 251 h2so4 5% 1 nos 252 252 h2s04 20% 1 nos 253 253 methylene blue ( aqueous ) 125ml 1 nos 254 254 giemsa stain 10x500ml 1 nos 255 255 leishman stain 500ml 1 nos 256 256 leishman powder 50gm 1 nos 257 257 retic stain 25ml 1 nos 258 258 pas stain ( ready to use ) pa 25gm schiff reagent 125ml 1 nos 259 259 sudan black kit 1 nos 260 260 ph meter / litmus papers ( basic and acidic ) 1 nos 261 261 cedar wood oil 100ml 1 nos 262 262 semen diluting fluid 100ml 1 nos 263 263 wbc diluting fluid 500ml 1 nos 264 264 csf diluting fluid 100ml 1 nos 265 265 microscope lens cleaner 100ml 1 nos 266 266 thymol crystal 100gm 1 nos 267 267 sodium citrate 500ml 1 nos 268 268 filter paper ( watmanns ) packet 1 nos 269 269 westergrens pippet tube 1 nos 270 270 wintrobe tube tube 1 nos 271 271 neubauer chamber 1 nos 272 272 sahlis hemoglobinometer set 5 1 nos 273 273 benedicts reagent 500ml 1 nos 274 274 microalbumin strips ( urine ) 100 strips per box 1 nos 275 275 esr card 10000 per card 1 nos 276 276 sulphosalicylic acid 500ml 1 nos 277 277 conc. acetic acid 500ml 1 nos 278 278 liquid ammonia 500ml 1 nos 279 279 potassium ferrocyanide 500gm 1 nos 280 280 conc. hcl 500ml 1 nos 281 281 heys sulphur sulphur sublimate powder 500gm 1 nos 282 282 sodium nitroprusside powder 1 nos 283 283 h202 1 nos 284 284 fouchets reagent 1 nos 285 285 benzidine solution 1 nos 286 286 barium chloride 1 nos 287 287 trichloroacetic acid 1 nos 288 288 ehrlich reagent 1 nos 289 289 chloroform 1 nos 290 290 sodium acetate 1 nos 291 291 butenol 1 nos 292 292 ferric chloride 1 nos 293 293 eosin niagresin 1 nos 294 294 tourniquet 1 nos 295 295 spinal needle 1 nos 296 296 wooden & plastic slide storage box 1 nos 297 297 puncture proof box 1 nos 298 298 glass marking pencil 1 nos 299 299 couplins jar 1 nos 300 300 picric acid 500gm 1 nos 301 301 citric acid 500gm 1 nos 302 302 esbachs albuminometer 1 nos 303 303 urine container 30ml 1 nos 304 304 urinometer 1 nos 305 305 pipettes 5 50ul tips – yellow 100 1000ul blue 20ul fix 1 nos 306 306 dextrose 500gm 1 nos 307 307 sodium nitrite 500gm 1 nos 308 308 methylene blue chloride 50gm 1 nos 309 309 anhydrous dipotassium hydrogen phosphate 500gm 1 nos 310 310 anhydrous potassium dihydrogen phosphate 500gm 1 nos 311 311 sodium dithionate 500gm 1 nos 312 312 saponin 100gm 1 nos 313 313 glass measuring beaker 50ml 1 nos 314 314 glass measuring beaker 100ml 1 nos 315 315 glass measuring beaker 500ml 1 nos 316 316 measuring cylinder 200ml 1 nos 317 317 glass stir rod 1 nos 318 318 carmine 100gm 1 nos 319 319 alcian blue 8gx 1 nos 320 320 acetic acid 3% solution 1 nos 321 321 aluminium sulphate al2 ( so4 ) 3.18h20 500gm 1 nos 322 322 oil red o 1 nos 323 323 p.t. vial 1x100 1 nos 324 324 k2 edta vial 1x100 1 nos 325 325 k3 edta vial 1x100 1 nos 326 326 c.k. prest test kit 1 nos 327 327 tissue paper roll 1 nos 328 328 pregnancy test kit 1 nos...