University of Rajasthan - Rajasthan

34001006 supply of chemicals and glasswares supply of chemicals and glasswares at botany department, uor, jaipur , chemical items : , p – anisaldehyde ( for sterols ) ar, 98% , 1 chloro 2, 4 dinitrobenzene ( cndb ) 97% , 1, 10 phenanthroline, 99% , 1 4 dioxane, hplc grade, 99.9% , 1 butanol extrapure ar, 99% , 1 naphthyl acetate, ar, 99.5% , 1 propanol extrapure ar , 2, 2 diphenyl 1 picrylhydrazyl ( dpph ) , hplc =99.9% , 2, 4, 6 tris ( 2 pyridyl ) s triazine ( tptz ) , 98% , ar, for spectrophotometry , 2, 4 dichlorophenylhydrazine 98% , 5, 5 dithiobis ( 2 nitrobenzoic acid ) ( dtnb ) =98% , abscisic acid cell culture bioreagent, 98.5% , abts 98% hplc , acetic acid, 99% , acetic anhydride extra pure, 99.5% , acetocarmine stain solution extra pure, ar , acetone extrapure, 99% , acetonitrile extrapure ar, 99% , acetylcholinesterase ( electric eel ) , type vi s, lyophilized powder , 292u / mg solid, 394 u / mg protein , acetylthiocholine iodide 98%, tlc , agarose, molecular biology grade , aluminiumcoated silica gel plates 60, f254, 20×20 , aluminum chloride anhydrous for flavonoids, ar, 99% , amido black 10b dye, 80% , ammonia, extrapure 99% , ammonium chloride extrapure ar, 98% , ammonium hydroxide, acs, 28 30% , ammonium oxalate , ammonium persulfate extrapure ar, 99% , ammonium phosphate, reagent grade , ammonium sulphate, reagent grade , anhydrous sodium carbonate, reagent grade, 99.9% , aniline , lab grade, 99.5% , anthrone reagent extrapure ar, 98% , apigenin for synthesis, 96% , ascorbic acid lab grade 99% , azocasein for assay of endoprotease , bacl2, 99.9% , barium hydroxide, 98% , barium nitrate, extrapure 98.5% , barium peroxide, technical grade, 91 92.5% , barium sulphate, extrapure, reagent grade , beef extract, for microbial culture media, technical grade , benedicts solution, lab grade , bisacrylamide, molecular grade, 99% , bismuth iii sub nitrate, 98% , borax, technical grade 99.9% , boric acid extrapure ar, 99.5% , bovine serum albumin for molecular biology, 99% , brain heart infusion broth, for microbiology , brilliant cresyl blue solution, microscopic stain , bromophenol blue, extrapure ar , caffeic acid, =98% hplc , calcium acetate, lab grade , calcium carbonate, 98% lab grade , calcium chloride pure, 90 95% , calcium hypochlorite, 99% pure , camptothecin =90% hplc , carbon tetra chloride extra pure 99% , cdso4 , acs reagent =99% , chloramphenicol, 98% hplc , chlorazole black, technical grade, biological stain , chloroform extrapure, 99% , cobalt ( ii ) chloride hexahydrate extrapure ar, 99% , congo red, indicator grade , coomassie brilliant blue r250, molecular bio grade , copper sulphate pentahydrate, 99% , copper ( ii ) chloride dehydrate, ar , cscl2 optical grade, 99.9% , cuso4 extrapure ar , cyclohexane, acs reagent , czapek yeast autolysate agar ( cya agar ) for fungal culture , dextrose, ar , dichloromethane, hplc grade, 99.99% , dimethyl sulfoxide ( dmso ) , hplc, 99.7% , diphenylamine ( dpa ) , acs, 99% , dipotassium hydrogen phosphate ar , disodium hydrogen phosphate ( na2h po4 ) ar , dragendroff reagent ( for analysis of alkaloids ) acs , dtpa ( diethylene triamine pentaacetate ) , 99%, titration , dtt ( dithiothreitol ) , molecular bio grade , e 64 epoxy monocarboxylic acid, for protease inhibitors application , edta extrapure ar, 99.5% , egg albumin, 98% , erythrosin, 90% , ethanol 99.9% , ethidium bromide solution, mol bio grade , ethyl acetate 99% , ethylene bis ( oxyethylenenitrilo ) tetraacetic acid ( egta ) 99% , etoposide = 98% tlc , fast blue b salt 95% , fehlings solution a, lab grade , ferric chloride ( anhydrous ) ( for tannins ) , ferric chloride hexahydrate ar 97% , folin & ciocalteus phenol reagent ar , formic acid, technical grade 85% , formic acid hydrazide, technical grade 99% , fructose, ar , gallic acid 99% hplc , gelatin powder, lab grade , glacial acetic acid ar 99% , glutathione, pure, pharma grade , glycerol extrapure lr grade , glycine extrapure ar 99.5% , guaiacol , reagent grade, 98% , h2o2, acs, 30% for analysis , h2so4, reagent grade, 99.99% , hcl, reagent , heavy mgo, 98% pharma grade , hexane, 95% for analysis , hydroxylamine hydrochloride ( nh2oh.hcl ) , acs reagent, 98% , i2, laboratory grade , isopropanol, hplc, 99.9% , kcl, ar, 99% , kempferol 97% hplc grade , ki, ar, 99% , lactophenol cotton blue stain , lactose, bacteriological grade , lead acetate, acs, 99% , licl2, 99%, for mol bio , luteolin, analytical standard , malt extract, for microbiology , maltose, =98% cell culture , methanol extrapure ar, 99.8% , mgcl2 extrapure ar, 99% , monosodium phosphate ( nah2po4 ) , =98% acs , mueller hilton agar, for antimicrobial testing , na bezoyl l arginine 4 nitroanilide hydrochloride, =98%, tlc , nacl, ar, 99% , naoh ( pellets ) , lr, 98% , nickel ( ii ) chloride hexahydrate, 99.9%, trace metals basis , ninhydrin, acs reagent , n succinyl l phe p nitroanilide, protease substrate , nutrient agar ( na ) , microbiological grade , nutrient broth, microbiological grade , oatmeal agar, microbiological grade , pefabloc, analytical standard , pepstatin, hplc, =90% , peptone, for microbiology , petroleum ether ( 600 800 ) extrapure ar , ph 4 buffer tablet , ph 7 buffer tablet , ph 9buffer tablet , phenazone solution, technical grade , phenol extra pure 99% ar , phenol red, acs reagent , phenyl methyl sulfonyl fluoride ( pmsf ) , =99% ( t ) , phosphate buffer saline ( pbs ) , phosphoric acid, extrapure ar , plant growth regulator ( auxin ) 2, 4 d , potassium acetate, acs, =99% , potassium mercuric iodide , potato dextrose agar ( pda ) , for microbiology , pyridine, hplc, 99.9% , pyrogallol, analytical standard , quercetin, analytical standard , salicylic acid, acs, =99% , sds, molecular biology, =99% , sitosterol, analytical standard , sodium acetate, mol. bio, 99% , sodium acetate trihydrate, acs, =99% , sodium azide, reagent grade, 99.5% , sodium bicarbonate powder extrapure ar, 99.5% , sodium carbonate anhydrous extrapure ar, 99.9% , sodium citrate, =99% , sodium hypochlorite ( 5% ) , sodium nitrate, acs, =99% , sodium phosphate ( dibasic ) ( disodium hydrogen ortho phosphate ) , sodium phosphate ( monobasic ) ( monosodium dihydrogen ortho phosphate ) , soluble starch , sorbitol, for microbiology , sucrose, ptc, 99.5% , thidiazuron, ptc grade , thionyl chloride, reagent grade, 97% , tin, 99%, reagent grade, powder , tris ( hydroxylmethyl ) aminomethane, acs, 99.8% , tris buffer, molecular grade , tris hcl extrapure ar, 99% , triton x 100, mol. bio.grade , tryptone, mol. bio.grade , tween 20 reagent, mol. bio grade , tween 80 reagent, for cell culture , tyrosine, hplc, 98% , vanillin ( for saponines compounds test ) , wagners reagent, indicator solution for alkaloid , xylene cyanole, mol. bio.grade bioreagent , xylose, 99% hplc , ? mercaptoethanol, mol. bio., 99% , rosmarinic acid, 98%, hplc , iso eugenol, natural fragrance grade, 99% , cm sepharose, mfcd00146478 , deae sepharose, mfcd00146630 , temed, electrophoresis grade , acrylamide, mol.bio , diethylamine, lr grade , casein, , galanthamine , toluene, ar , chrome azurol agar , glutahione reductase , glassware items : , amber reagent bottle narrow mouth with screw cap 50ml ( autoclavable, material: borosilicate glass ) , glass vials 10 ml , 96 well microplate ( 2.0ml ) ( autoclavable, material: pp ) , aluminium foil , amber narrow mouth bottle 500ml ( autoclavable, material: hdpe ) , aspirator bottle with stopcock ( 10 litres ) , aspirator bottle with stopcock ( 20 litres ) , aspirator with stopcock 10l ( autoclavable, material: pp, used for dispensing distilled water ) , aspirator with stopcock 5l ( autoclavable, material: pp, used for dispensing distilled water ) , autoclavable bag 12x24 ( material: pp, temperature resistant ) , autoclavable baskets ( 180×170×160 mm ) , autoclave indicator tape , blotting sheet , bod bottles125ml , bod bottles 300 ml , bod bottles 60ml , boiling test tube stand ( 50 ml ) , burette ( plastic ) ( 100 ml ) , burette stands , c3 single channels variable vol pipette, calibration & accuracy ( 100 1000?l ) , centrifuge tube ( 50ml ) , centrifuge tube conical bottom with screw cap 15ml ( autoclavable, material: pp, graduated ) , centrifuge tube conical bottom with screw cap 50ml ( autoclavable, material: pp, graduated ) , cotton bundle , culture tubes55ml ( 25×150 ) , disposable petri dishes , draining tray ( 400×300×100 mm ) , drying rack ( 30 pegs ) , empty box for micro tips 96 places 100 1000?l ( autoclavable ) , empty box for micro tips 96 places 1 10?l ( autoclavable ) , empty box for micro tips 96 places 20 200?l ( autoclavable ) , falcon tubes, sterile, 15 ml , flask 100 ml , flask 500 ml , flask 1 l , flask 10 ml , flask 50 ml , flat bottom flask narrow mouth 100ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 250ml ( autoclavable, material: borosilicate glass ) , flat bottom flask narrow mouth 500ml ( autoclavable, material: borosilicate glass ) , forceps ( blunt dissecting, 6” ) , funnel size dia. 50mm ( material: glass ) , funnels ( 25mm , glass droppers ( 25 cm ) , glass rod long 1 feet , glass vial ( 10ml ) , ice tray ( 1litre ) , indicator tape for steam autoclave ( 1×500 ) , inoculating loop , lab tray , micro centrifuge tube ( eppendorf tube ) 1.5ml ( autoclavable, material: pp ) , micro centrifuge tube ( eppendorf tube ) 2ml ( autoclavable, material: pp ) , micro tip 100 1000?l ( autoclavable, material: pp ) , micro tip 1 10?l ( autoclavable, material: pp ) , micro tip 20 200?l ( autoclavable, material: pp ) , microscopic glass coverslip ( 18×18 mm ) , microscopic glass coverslip ( 22×50 mm ) , microscopic glass slide ( 76×26×1mm ) , narrow mouth bottle 1000ml ( autoclavable, material: pp ) , narrow mouth bottle 125ml ( autoclavable, material: pp ( polypropylene ) ) , narrow mouth bottle 250ml ( autoclavable, material: pp ) , narrow mouth bottle 500ml ( autoclavable, material: pp ) , paraffin wax 500gm ( for laboratory uses ) , reagent bottles 500ml , round bottom flask250ml , round bottom flask500ml , semi strike raised rim pcr 96×0.2 ml plates ( 96×0.2ml ) , separating funnel 250ml , separating funnel 500ml , slide box ( plain, ground edges, 76×26×1 ) , spare stopcock for aspirator bottle , spatula one end flat and one end spoon ( 8 inch ) , spirit lamp ( ss ) , stand for burette , stand for test tubes , stirring rod length up to 200mm, 16mm×16mm at one end ( autoclavable, material:glass ) , storage glass vial with screw cap 10ml , storage glass vial with screw cap 25ml , storage vial with screw cap 50ml ( material: glass ) , storage vials ( 5 ml ) , syringe filter 0.2?m ( non sterile, 25mm dia. ) , syringe filter 0.45?m ( non sterile, 25mm dia. ) , test tube 100ml 32x200mm , test tube 15ml 15x150mm , test tube 55ml 25x150mm , test tube stand 25 hole for 16mm tube ( autoclavable, aluminum ) , tissue culture plate sterile ( 48 wells ) , tissue roll ( 12 x 75 mm ) , tlc chamber , wash bottle 1000ml ( autoclavable, material: ldpe ) , wash bottle 500ml ( autoclavable, material: ldpe ) , wash plastic bottle500ml , whatman filter paper 1 ( 125mm ) , wide mouth bottle 125ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 250ml ( autoclavable, material: pp, caps included ) , wide mouth bottle 500ml ( autoclavable, material: pp, caps included ) , wide mouth wash bottle 500ml ( autoclavable, material: ldpe ) ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Indian Army - Rajasthan

33447966 bids are invited for orthokal orthodontic stone pkt of 3 kg , 0.018 roth preadjusted edgewise brackets without molar tubes 5 to 5 , transbond kit contains 02 syringe 04 gm and bond 06 ml , light cure orthovita molar band cement contains of 05 syringe , bondable 0.018 mbt upper molar tube double , bondable 0.018 mbt upper molar tube single tube , single side cheek retractors , dentos implant 08 mm 1.3 dia , hyrex screw 09 mm , hyrex screw 11 mm , expansion screw size 11mm , standard universal screw green size 14mm , nitanium palatal expender size 32 , orthdontic tooth brush , orthodontics debonding tungsten carbide bur egg shaped , orthodontics debonding tungsten carbide bur tapered shaped , orthopedic face mask , arch wire ss size 0.016 x 0.022 lower pkt of 10 , arch wire ss size 0.016 x 0.022 upper pkt of 10 , arch wire ss size 0.017 x 0.025 lower pkt of 10 , arch wire niti size 0.012 lower pkt of 10 , arch wire niti size 0.012 upper pkt of 10 , arch wire niti size 0.014 lower pkt of 10 , arch wire niti size 0.014 upper pkt of 10 , arch wire niti size 0.016 lower pkt of 10 , arch wire niti size 0.016 upper pkt of 10 , arch wire niti size 0.016 x 0.022 lower pkt of 10 , arch wire niti size 0.016 x 0.022 upper pkt of 10 , cna mushroom loop 0.16 x 0.22 ss aw size 30 mm pkt of 05 , cna mushroom loop 0.16 x 0.22 ss aw size 32 mm pkt of 05 , cna mushroom loop 0.16 x 0.22 ss aw size 34 mm pkt of 05 , cna mushroom loop 0.16 x 0.22 ss aw size 38 mm pkt of 05 , cna mushroom loop 0.16 x 0.22 ss aw size 40 mm pkt of 05 , cna mushroom loop 0.16 x 0.22 ss aw size 42 mm pkt of 05 , retraction loop t 0.016 x 0.022 ss size 30 , retraction loop t 0.016 x 0.022 ss size 32 , retraction loop t 0.016 x 0.022 ss size 34 , retraction loop t 0.016 x 0.022 ss size 38 , retraction loop t 0.016 x 0.022 ss size 40 , rcs1 0.016 niti arch wire upper pkt of 10 , rcs1 0.016 niti arch wire lower pkt of 10 , rcs1 0.016 x 0.022 niti upper pkt of 10 , rcs1 0.016 x 0.022 niti lower pkt of 10 , copper n...

National Institute Of Ayurveda - Rajasthan

33123875 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux / bd ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux / bd ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux / bd ) 500gm , amikacin ( himedia / sigma / biomerieux / bd ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux / bd ) 1 vial , ampicillin ( himedia / sigma / biomerieux / bd ) 1 vial , aztreonam ( himedia / sigma / biomerieux / bd ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux / bd ) 500 ml , bacitracin ( himedia / sigma / biomerieux / bd ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux / bd ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux / bd ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux / bd ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux / bd ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux / bd ) 50 ml , cefipime ( himedia / sigma / biomerieux / bd ) 1 vial , cefixime ( himedia / sigma / biomerieux / bd ) 1 vial , cefotaxime ( himedia / sigma / biomerieux / bd ) 1 vial , cefoxiti ( himedia / sigma / biomerieux / bd ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux / bd ) 1 vial , ceftazidime ( himedia / sigma / biomerieux / bd ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux / bd ) 1 vial , cefuroxime ( himedia / sigma / biomerieux / bd ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux / bd ) 1 vial , citrate agar ( himedia / sigma / biomerieux / bd ) 500gm , cled agar ( himedia / sigma / biomerieux / bd ) 500gm , clindamycin ( himedia / sigma / biomerieux / bd ) 1 vial , colistin ( himedia / sigma / biomerieux / bd ) 1 vial , coplin jar ( himedia / sigma / biomerieux / bd ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux / bd ) 1 vial , cotton roll ( himedia / sigma / biomerieux / bd ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux / bd ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux / bd ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux / bd ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux / bd ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux / bd ) 5 litr , doxycline ( himedia / sigma / biomerieux / bd ) 1 vial , dpx mount ( himedia / sigma / biomerieux / bd ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux / bd ) 125 ml , erythromycin ( himedia / sigma / biomerieux / bd ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux / bd ) 500 gm , forceps ( himedia / sigma / biomerieux / bd ) 1 pc , fosfomycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin ( himedia / sigma / biomerieux / bd ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux / bd ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux / bd ) 1 strip , giemsa stain ( himedia / sigma / biomerieux / bd ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux / bd ) 5 litr , glass slides ( himedia / sigma / biomerieux / bd ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux / bd ) 500 ml , grams iodine ( himedia / sigma / biomerieux / bd ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux / bd ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux / bd ) 500 ml , imipenem ( himedia / sigma / biomerieux / bd ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux / bd ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux / bd ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux / bd ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux / bd ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux / bd ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux / bd ) 500 ml , levofloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , linezolid ( himedia / sigma / biomerieux / bd ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux / bd ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux / bd ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux / bd ) 1 holder , methanol ( himedia / sigma / biomerieux / bd ) 500 ml , methylene blue ( himedia / sigma / biomerieux / bd ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux / bd ) 125 ml , mrvp media ( himedia / sigma / biomerieux / bd ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux / bd ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux / bd ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux / bd ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux / bd ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux / bd ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux / bd ) 1 vial , norfloxacin ( himedia / sigma / biomerieux / bd ) 1 vial , novabiocin ( himedia / sigma / biomerieux / bd ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux / bd ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux / bd ) 500gm , optochin ( himedia / sigma / biomerieux / bd ) 1 vial , oxidase discs ( himedia / sigma / biomerieux / bd ) 1 vial , penicillin g ( himedia / sigma / biomerieux / bd ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux / bd ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux / bd ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux / bd ) 1 vial , piperacillin ( himedia / sigma / biomerieux / bd ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux / bd ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux / bd ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux / bd ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux / bd ) 100ml , ria vials ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux / bd ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux / bd ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux / bd ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux / bd ) 125 ml , sim media ( himedia / sigma / biomerieux / bd ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux / bd ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux / bd ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux / bd ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux / bd ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux / bd ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux / bd ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux / bd ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux / bd ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux / bd ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux / bd ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux / bd ) 1 vial , tigecycline ( himedia / sigma / biomerieux / bd ) 1 vial , tobramycin ( himedia / sigma / biomerieux / bd ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux / bd ) 500gm , urea agar base ( himedia / sigma / biomerieux / bd ) 500gm , urea solution 40% ( himedia / sigma / biomerieux / bd ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux / bd ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux / bd ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux / bd ) 500 ml , xylene ( himedia / sigma / biomerieux / bd ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux / bd ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

Department Of Local Bodies - Rajasthan

33061945 work01 construction of drain and interlocking tiles work mohamad sharif jhunjhnu house to babu egg house gali, madan ji bagriya house to post main house gali and babu sikariya gali ward no.15 sikar....

Department Of Local Bodies - Rajasthan

33035821 construction of drain and interlocking tiles work mohamad sharif jhunjhnu house to babu egg house gali, madan ji bagriya house to post main house gali and babu sikariya gali ward no.15 sikar....

Department Of Technical Education - Rajasthan

33031654 n.i.b for new electrician trade and for up gradation of institute 1 . :vicilbtll ulla; alcci i ape 2 combination flier insulated 3 screw driver insulated 4 screw driver insulated 5 electrician screw driver thin stem insulated handle 6 heavy duty screw driver 7 electrician screw driver thin stein insulated handle 8 punch centre r [ 9 knife double bladed electrician i10 neon tester i 11 1 steel rule graduated both in metric and english unit 12 hammer, cross peen with handle l 13 hammer, ball peen with handle 14 pincer 15 c clamp 16 spanner adjustable drop forged. ss 200 mm 100mm 150 min 300 mm blow lamp brass 18 chisel cold 19 firmer chisel 20 allen key 21 grease gun 22 bradawl fully puller with 3 legs 150 inm 300 mm 24 bearing puller ( inside and outside ) 25 pipe vice cast iron with hardened jaw open type l 26 scissors blade. ss 27 scissors blade, ss 28 crimping tool 1.5 sq. mm to 16 sq. mm 29 30 31 wire cutter and stripper mallet hard wood hammer extractor type 16 sq. mm to 95 sq. mm hacksaw frame adjustable 300 mm , fixed 150 mm 33 try square 34 outside calliper 35 j inside calliper 36 divider 37 pliers long nose insulated 38 pliers flat nose insulated 39 pliers round nose insulated 40 tweezers 41 snip straight healy duty 42 snip bent heavy duty 43 d.e.. metric spanner double ended 44 drill hand brace 45 drill s.s. twist block 46 j plane cutters 47 smoothing cutters 48 gauge, wire imperial stainless steel marked in swg 3z mm 49 file flat 50 file half round 5 i file round 52 file flat rough 53 file flat bastard 54 file flat smooth 55 file rasp, half round 56 copper bit soldering iron 57 de soldering gun 58 hand vice 59 table vice 60 oil can 61 contactor & auxiliary contacts 25 amp 2 no 25 amp 2 nc 62 contactor & auxiliary contacts 32 amp 2 no 32 amp 2 nc 63 limit switch 64 rotary switch 65 relay : a. cut out relays b. reverse current c. over current d. under voltage 66 pin type insulators including hardware fitting shackle type insulators including hardware fitting egg type insulators including hardware fitting suspension type insulators including hardware fitting 67 hydrometer 68 hand drill machine 69 portable electric drill machine 70 load bank ( lamp / heater type ) 71 brake test arrangement with two spring balance rating 72 laboratory type induction coil 73 out side micrometer 74 thermometer digital 75 series test lamp 76 knife switch dpdt fitted with fuse terminals 77 knife switch tpdt fitted with fuse terminals 78 miniature circuit breaker 79 earth plate copper 80 earth plate gi 81 eart electrode h primary electrode secondary electrode 82 mccb r1 pt en and prill, .... 1 lel a. / li al mi 1 a a• •jj 84 fuses hrc glass rewire type 85 rheostat sliding type 0 25 ohm, 2 amp 0 300 ohm, 2 amp 0 1 ohm, 10 amp 0 10 ohm, 5 amp 86 capacitors 87 various electronic components 88 various lamps 89 plug socket piano switch lamp holder 90 cables : twisted pair non metallic sheathed cable underground feeder cable ribbon cable metallic sheathed cable multi conductor cable coaxial cable direct buried cable 91 bus bar with brackets 92 rubber mat 93 electrician helmet, 94 rcc pole with accessories ( ms angle iron, c clamp, stay insulator etc. ) and materials 95 i safety belt 96 ohm meter; series type & shunt type portable box type 97 digital multi meter l____ 98 a.c. voltmeter m.i. analog, portable box type housed in bakelite case 99 milli voltmeter center zero analog, portable box type housed in bakelite case 100 ammeter mc analog, portable box type housed in bakelite ° 500 ma 0 5 a case 0 — 25 a 101 a ac ammeter ml analog, box 0 1 ! portable 0 5 a housed in type bakelite case 0 — 25 a 10? kilo wattmeter analog l 103 digital wattmeter 104 a.g. energy meter single phase • 105 a.c. energy meter three phase 106 power factor meter digital 107 frequency meter 108 magnetic flux meter 109 lux meter 110 _i analog type 10000 rpm tachometer ! digital photo sensor type 10000 rpm i 11 iona tester / clamp meter 112 , megver 113 3 point d.c. starter 114 4 point d.c. starter 115 1 wheat stone bridge with galvanometer and battery 116 single phase variable auto transformer 117 phase sequence indicator 118 growler i 119 ac starters: a. resistance type starter b. direct on line starter c. star delta starter manual • d. star delta starter — semi automatic e. star delta starter — fully automatic 1. star delta starter soft starter g. auto transformer type 120 oscilloscope dual trace 121 function generator 122 soldering iron 123 —r temperature controlled soldering iron 124 discrete component trainer 125 linear i.c. trainer 126 digital 1.c. trainer i 27 domestic appliances a. electric induction plate b. electric kettle c. electric iron d. immersion heater, le 0 i ww1 1 114112y @vi 128 oil testing kit 129 inverter with battery 130 voltage stabilizer 131 dc power supply 132 battery charger 133 current transformer 134 potential transformer 135 solar panel with battery 136 d.c. shunt generator with control panel 137 motor generator ( ac to dc ) 138 d.c. compound generator with control panel 139 dc series motor coupled with spring balance load 140 • dc shunt motor 141 dc compound motor with starter and switch 142 motor generator ( dc to ac ) set 143 ac squirrel cage motor with star delta starter and triple pole irc clad switch fuse with mechanical load. 144 ac phase wound slip ring motor with starter switch 145 universal motor with starter / switch 146 synchronous motor with accessories like starter, excitation arrangements. 147 thyristor / 1gbt controlled d.c. motor drive with tacho generat feedback arrangement 148 thyristor / igbt controlled a.c. motor drive with 149 single phase transformer, core type, air cooled 150 three phase transformer, shell type oil cooled with delta / star 151 electrical machine trainer 152 used dc generators series, shunt and compound type for overhauling practice 153 pillar electric drill machine motorized 154 motorized bench grinder 155 a.c. series type motor 156 single phase capacitor motor with starter switch • 157 manual motor coil winding machine 158 ceiling fan coil winding machine 159 primary current injection set 160 stepper motor with digital controller 161 shaded pole motor....

Department Of Training And Technical Education - Rajasthan

32934551 supply of tools and equipment for electrician trade 1 1 small crimpine tools (asc orted) 2 2 rubber matting pliers flat nose insulal 9d 3 3 4 4 pliers round nose insu ated 5 5 firmer chisel 6 6 hammer ball peen 7 7 hammer ball peen 8 8 wire stripper 9 9 file flat io 11 10 11 file flat round file round 12 12 file triangular spanner set of 6 13 13 18x1820x22,2 1x23,24x27,25x2 7,3 0x32 14 14 foot print grip 15 15 safety belt with provision for keeping tools — multi meter 16 16 17 17 hot wire ammeter 18 18 voltmeter m.c. 19 19 ammeter m.l. 20 21 20 ammeter m.l 21 field regulator 31 32 22 22 single phase k.w.h meter analog 23 23 clamp on ammeter 24 24 three phase k.w.h meter analog 25 26 25 three phase k.w.h meter di 26 ups500vawith battery 27 27 dc power supply ita l 28 28 29 30 manual star delta starter 29 semi automatic star delta starter 30 automatic reverse forward starter 31 single phasing preventer 32 soft starter 1ph tachometer digital type 34 34 flux meter 5 hp slip ring induction motor 35 35 with rotor resistance starter 36 36 lux meter 37 37 lead acid battery 75ah 38 38 miniature circuit breaker(mcb) earth leakage circuit breaker (elcb) 40 40 metal clad circuit breaker (mccb) pin type insulators including 41 41 hardware fitting 42 42 shackle type insulators including hardware fitting 43 43 egg type a suspension type insulators including hardware fitting 44 44 thermometer digital 45 45 earth plate 46 46 earth plate 47 47 earth electrode 48 48 mccb 49 elcb 50 50 bus bar with brackets 51 51 safety belt 52 52 a.c. voltmeter m.i. analog, portable box type housed in bakelite case 53 53 mliii voltmeter centre zero analog, portable box type housed in bakelite case 54 54 ammeter mc analog, portable box type housed in bakelite case 55 55 ammeter mc analog, portable box type housed in bakelite case 56 56 ammeter mc analog, portable box type ioused in bakelite case ac ammeter ml, analog, — ac ammeter ml, analog, 58 s8 portable box type ioused in bakelite case 59 59 ac ammeter mi, analog, portable box type ioused in bake(ite case 60 60 digital wattmeter 61 61 tachometer phase sequence indicator 63 63 single phase transformer,core type 64 64 three phase transformer, shell type oil cooled with detta/ star 65 65 manual motor coil winding machine 66 66 ceiling fan coil winding machine i 62 62 ...

Medical College - Rajasthan

32468477 chemicals and glass item on rate contract for one year phenyl hydrogine hydrochloride trichloro acetic acid (tca) nin hydrin thiosemi carbozide sulphuric acid 6 hydrochloric acid 5 50 lit. 7 nitric acid 5 50 lit. 8 glacial acetic acid 5 50 lit. 9 banedicts reagent 5 50 lit. 10 bar ford reg 5 50 lit. 11 sodium hydroxide 500 gm 5 kg 12 ammonia(liq) 500 gm 5 kg 500 ml 5 lit. 13 hydrogen peroxide 14 mercuric sulphate 500 gm 5 kg 15 ammonium sulphate 500 gm 5 kg 16 sodium carbonate(na2co3) 500 gm 5 kg 500 ml 50 lit. 17 formalin 18 19 sulphosalicylic acid 500 gm 5 kg maltose 500 gm 5 kg 20 sodium tungstate 500 gm 5 kg 21 copper sulphate 500 gm 5 kg 22 23 24 glycerine 5 50 lit. a (alpha) naphthol (molischs reagent 100 gm 1 kg. peptone (bdh) 500 gm 5 kg 25 egg albumin powder powder(bdh) 500 gm 5 kg 26 ethanol 500 m1 5 lit. 27 dextose 500 gm 5 kg 28 lactose 500 gm 5 kg 29 fructose 500 gm 5 kg 500 gm 5 kg 30 sucrose 31 carbolic acid 500 gm 5 kg 32 hydrogen peroxide 500 ml 5 lit. 33 ammonia solution 10 50 lit 34 concentrated sulphuric acid 10 50 lit 35 mercuric sulphate 10 5014 36 glacial acetic acid 10 50 lit 37 tipole (for washing slides) 10 50 lit 38 methanol 10 50 lit 39 xylene 10 50 lit dettol liquid paraffin (heavy) 500 gm 2 kg 20 50 lit 500 mg 5 k 500 m 5 lc_ methylene blue pholoxin b propylene glycol lr potasium chloride lr calcium chloride fused lr sodium bi carbonate anhydrous sodium bi hydrogen phosphate 1 500 gm glycose anhydrous 500 gm z:2u22 23limited tender limitedl_chemicals limited tender docx 74 formalin (forivialdihyde 37%) ia 500 ml 75 gention voilet solution lr 500 ml 76 77 leishman stain solution caderwood oil 1000 ml 100 ml 78 clove oil 100 ml 79 cinnamon oil 100 ml glass item . 3t 4 dit wr6d) mnd 44) 31t 4 (err cr) 1 amber dark bottle(125 ml) each ni co marker pen(blue/black) each conical flask (2.5 liter) each 4 beaker (1 liter) each test tube 18x150 . 100 nos f .c, edta vial 100 500 nos 7 slide packets big size 100 500 packets 8 capillary tuve (glass) 10 cm long 100 500 packets 9 hemoglobin stirrer (glass rod 2 mm diameter) 100 200 nos 10 petridishe glass 4 diameter 100 200 nos etc ...

Sardar Patel Medical College - Rajasthan

32449801 supply of necessary items for machine in ent department under mmcsby scheme and mukhymantri nishulk nirogi rajasthan yojana scheme lj 1 2 3 4 . . blade 188351 9hr rad903pkm4 3.5mmrotat bl4de 1884004 tricut 5pk 4mm blade 1884006 rad40 5pk sinus 4mm blade 1884008 radenoid 5pk4mm blade 1i4o16 ra t ( extreme max r • %iaie 17 radia.s 3pk max shius bur 1884i8hs 3pk dcr hi spd 7 4 i .‘10m 11 . ;bur 1882 6ahs 3pk cvi> diamond d ( 25mm eu 1r4soscf eitmr8 cum ne m sm bus1847bacf entmr8 gut fine 4mm std bur 1847b4oscf entmr8 cut fine 3mm std ii th 14 i 16 8 i‘bur 1847b40scf entvw8 cut fine 2mm std bur 1847b40scf entmr8 cut fine 1mm std bur ent mr8 1847cv05sdf dmd fin 0.5mm td bur entmr8 1847b50sdf dmd fine 5mm.std bur entmr8 1 847b50sdf dmd fine 4mm std bur entm 1847b50sdf dmd fine 3mm std bur entmrb 1847b50sdf dmd fine 1’mmstd. bur entmr8 1847b1 58dm dm0 med 1.5mm sm ‘: 19 l. e — eleqi5d 8227412 paired 8cm set rofs electrode 8227468 25pk paired r0148 21 , electrode 8227141 25pk needle 15mm rohs .l ..e pror8225451 5pkprass bipo stnmul rohsr 24li.s w p1obe822s90 3pi incremtimm tiprohs pfn 8225625 3pk incremtstdprass rolls 176ttrayi2pka 28 emêtube 8229307 nim std7mm rohs 29 errsae 29mos nm .msivantage 6.aum id 30 emg tube 8229708 nim trivantage 8.0mm 1d 31 endotrach tube 8229960 5pk6mm emg flex ‘ i 32 endotrach tube 8229965 5pk 6.5mm emg flx h dresaing 400402 2opk smd nasal 8cm long th endotrach iitubeb22997o5pk7mmemg flex a5 ema;m.i 8229975 5pk 7.5mm egg flx bur etc...

Department Of Local Bodies - Rajasthan

32279256 construction of drain and interlocking tiles work mohamad sharif jhunjhnu house to babu egg house gali, madan ji bagriya house to post main house gali and babu sikariya gali ward no.15 sikar....

Department Of Training And Technical Education - Rajasthan

32267828 supply of electrician trade tools and equipments measuring steel tape combination plier insulated 200 rrm ( 40 +2 ) nos. screr.r, driver lnsulated :lmnr x i 5c rnrr. i ) iamond head ( 40 +2 ) nos. 4. screr.vdriver insulated 6mm x 150 rnm ( 40 +2 ) nos. 5. electrician screwdriver thin stem insu lated hand le zlmm x 100 mm ( 10 +2 ) nos. 6. heavv duty screwdriver insu iated 5nrnr x 200 rnm ( 40 +2 ) nos7. h lectrician screwdriver thin stem insu lated hand le 4mnr x 250 rrnr ( 40 +2 ) nos8. punch flentre 9mrr x 150 mnr ( 40 +2 ) nos. 9. knife double bladed electrician i00 mm ( 40 +2 ) nos. 10. neon tester 500 v ( 40 +2 ) nos. lt steel rule graduated both in metric and english lrnit 300 innr u, ith precision of ii4ii, mm ( 40 +2 ) nos. t2. hammer, cross peen with handle 250 glams ( 40 +2 ) nos. b. shop tools & equipment fot 2 1+1 ) units no additional items are required li ) list of tools & accessories 13. hammer. ball peen with handle 500 granrs .i n os. 14. pincer 50 rrrr 4 nos. 15. c clamp 200 nrm and l0 ( ) rnrr 2 nos. each 16. spanner adjustable drop forged, ss 50 mrr & ioomnr 2 nos. each , l ) ] , .., ...; 11, , , , , r blou larnp brass ( lhisel cold 25 nrnr x 100 nlnl chisel tirmer r, ith wooden handle 6 mm x 200 ntnr allen key alloy steel l. 5 l0 mm ( setof 9 ) 0.5 ltr. capacity pull ) puller with 3 legs i 150 nrm & 300nrnr bearing puller linside and otttsjde t scissors blade. ss 150 rrnt 1.5 sq nrtr to 16 sq trtn crinrping lool 16 jq rrlrll to 95 sq rnm wire cutter and stripper iiil rn mallet hard wood 0.ril lill halnmer extractor type 250 grarns hacksaw tranre radjustable l00nrrr fixed 150 2 nos. each try square ll50 nrrl blade outside calliper ., il ] nt .p, inr.t t pd inside calliper i: r sorirts tr oe l 5l rrn spring i pe plicrs long nose insulated 15i rnrn 1 nos. pliers 4 n os llat nose insulated pliers round nose insulated l0ll nm treezers l5c mrn i 4 nos. snip straight and bent heavldut5 250 nirt d.e. metric spanner double ended 6 12 nrrn drill hand brace 0 l00rnm 1 nos. drill s.s. lwist block 2 nrm.5 ntnr and 6 rnrn set of 3 50 nm x 200mm 50 nrnr x 20 { ) mbl gauge. wire imperial stainlees steel wire ( ) atrgl metric maked in swg & mnr l0l ) rrnr lnd cut uilh handle { l nos. file half round l0l rrn lnd cut rvith handle i 4 nos. file round 20ll rn1 llnd cut r, ith handle file llat rough i : ( l lrn . iih handle .1 os. lil ir, irl u ith hrndle file flat smooth l: ir , rlx ith lirndlc file rasp, half round 20il !r1nr bastard rvith handle coppet bit soldering iron. 0.15 kg i leat ;rlor:rl nrrzzle. pvc type. 25itlrrrr 4 nos. de soldering gun plane cutters smoothing cutter file flat , file flat bastard grease gun bradawl pipe vice cast iron with hardened jaw open scissor blade 57. hand vice 50 mm jav, , l nos. 58. table vice 100 mm.jau, t lros. 59. oil can 250 ml i l, jos. 60 contactor & auxiliary contacts 3 phase. 415 vola. 25 amp u.ith 2 nos. each 2noandlnc 6t contactor & auxiliary contacts. 3 phasc. 4 1 5 volt. 32 anrp u, ith 2 l. os. each 2noand2nc 62. limit switch limit switch. l iver opetated 24 i nos. 500v 2 contacts 61, rotary switch 16 r i.140 i nos. 64. relay a. cut out relays b. reverse current c. over current d. [ jnder voltase a. 164. 1.10 i l.jo. each b. r6, 4. 440v c. 16a.4 10v d.360v 440v 65. pin type. shackle type, egg l, pe & suspension type insulators incjuding hardware fittin { r i nos. each 66. llydrometer i nl, s. 61. hand drill machine 0 6 rrrrrr c.rpel it1 i os. 68. portable electric drill machine 0 i2 mrr capacit ) 750rv.2, 10v i no. with chuck and ker 69. load bank ( larnp / heater t pe ) 6 k , . iph r no. 70. brake test arrangement with tu, o sorine balance ratinp 0 ro s ko i , .r. 71 laboratory t ) pe induction coil 1000 w i nos. 72. orrf side micrometer 0 25 nrm least counl 0.01mm 2 nos. 13. thermorneter digital 0c 150 c i no. 14. series test lamp 230v.60w , 1nos. 75. knife switch dpdt fitted with fuse terminals l6 arrp rtr nos. 16 knife switch tpdt fitted with fuse terminals l6 amp / 440 v 4 nos. 77. miniature breaker 16 amp i nos. eadh plate 60cm x 60cm x 3. i5mm copper plate 60cm x 60cru x 6mm gi plate leach 79. earth electrode primary electrode 2 i 00x28x3.25mm secondaq, cu strid 20x5mrn i no. 80. mccb l00a, nps. triple pole i no. 8r. fi.cb and rccb 25arrrps. double pole and 2 5r mps. double pole ian i0 ma i each fuses hrc glass re*ire t1 pe .1 f.ach 83. rheostat ( sliding type ) 0 0 25 ohm. 2 amp 300 ohm. 2 amp i ohm. 10amp l0 ohrn. 5 arnd 0 0 i no. each 84. capacitors various electronic component various lamps rubber mat plug socket piano switch lanrp holder llr v. i a cab les: twisted paii non metal lic sheathed cable underground feeder cable ribbon cable metallic sheathed cable multiconductor cable coaxial cable bus bar rvith brackets irrir cacl l 2x4x l electrician helmet yellorv colour rcc pole with accessories ( ms angle iron.cclamp, stal insulaior etc.t o ill and material. safety belt stanclald qualitl l 2 nos. list of eouidment ohm meter; series type & shunt 5012000 ohrn analog 2 nos. each tvne ooftable box digital multi meter a.c. voltmeter m.l. analog. poftable box type housed in bakelite case illlrlti range 75 v i50v rrl0 600v milli voltmeter centre zero analog. poftable box type housed in bakelite case i00 0 100 mv arrmeter mc analog. pofiable 0 i0 ( ) ria. 0 5 a. 0 25 a box type housed in bakelite case 2l os. each ac ammeter ml. analog. 0 i a. 0 5 a 0 25 a 2 nos. each porrable bor type housed in bakelite case kilo wattmeter analog name of the tools and specification 0 1.5 ikw. pressure coil raring 1.101 r i.10v, current iat ing lia / i 0aanaloge. porrabie t1, pe housecl in llaiiclite case 2 nos. i i digital wattmeter a.c. energy meter a c e*.gy m.t* poner factor meter digital f =, f*r. ) , m.t.t isingte phase. j 0 .l.. 240v l4lilll , vp. .fhrce phase. i 5a ..!40v llqry4ry!. i440v.20a, three pnase portu h le bo tlpe 145 to 5i i l:z f nos. l , ) s. 102. r03. 104. i05. 106. lvagrtetic flur metcr 0 j, , u rc., la : , . __ i u rneler lu.r. n, e ter i ( lj read ( lrrt 0.0 ; _ , rs. , lo 700 ( r lurncns ill . i attcr_v. ] t, ffiejoc ceroooorpm ._ln;__ i t0 { ) c0 rlm tongtester / ctu.pmffi 2 ns : ryanjos 5oov l , i, * 3 point d.c. starter f or 2.5 kw dc r;otoi :. t07. 108. i l 109. i t0. l i 12. i i3. j po int d.c. starrer for 2.5 k l, dc motor j no. i i 4. ] whrt stone bridge r.r ith i galvanotneter and batterv i nos. i 15. single phase variable auto franst ormer cooled ) i 16. phase sequence indicator i phase..ll5 v i nos. 117 . crowler ac starters: a. resistance type slarter b. direct online starter c. star delta starter manual d. star delta stafter semi automatic e. star delta starter fully automatic f. star delta starter soti stafter g. auto transformer type tachometer 9. oscilloscope dual trace 20 mhz i no. 120. function generator 2 to 200 kilz. sine, square triangular 220 v 50 llz. single phase !no. 121 soldering lron temperature controlled soldering l50 , i an. li.l voir discrete component trainer discrete component ( for diode and trarrsislol circuill rr ith 2 itos. regulated pou er !:upplv +5, 5 v.+12.9 12 y linear l.c. lrainer [ . ireal lc. trainer u, ith reglilated pou er slrppll, i .2v i to i5v t } lc socket i6pin and 20 pins with bread boaril ] digital l.c. trainer digital i.c. trainer 7 se, :rren1 d isp lav , and bread board domestic appliances a. 1500 wa11. 2.10v i no. each b. e lectric kerlle b. i 500 ?ttr 2 10 / c. e iectric lron c. automatic 750 . 240 d. immersion heater , d l50f u, a1i. l 10v 126. ie. a.c. ceiling fan and ac c. f, e , .rrr ii0 v table fan 1 . geyser ( storage type ) t. l0 iitrc i g. mixture & grinder h. washing machine serniautomatic i. motor pump set oiltesting kit electric induction plate inverter with battery i kya wirh l2 v barterv lnplrt l2 r, olt dc. outputi no. voltage stabilizer 1ntr vi ac output 110v.i0a dc power supply 0 , 30 v 5 a 12 nos. battery charger i0 potential transformer 4 current transformer i solar panel w ith battery pentium iv computer or latest . ink jet/ laser printer c, shop machinery d.c. shunt generator with control pane motor generator ( ac to dc) d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motor d.c. compound cenerator with control panel includ ing fitted rheostat, voltmeter, ammeter and breaker d.c. compound generator rvith control panel includ ing fi tted rheostat.voltmeter. amrneter ancl breaker. 2.5k r. 220v &3pliase squinel cage irrcluction motor. 5l{p. .140v. uith l contlol panel & tar dclta ] starter i 140. dc series motor coupled with spring balance load 2.5 kw. 220 volts i no. 141 dc sh unt motordc compound motor u,ith !itarter and sw itch l. j l. :r .::/.) i,l1s i ll 143. motor cenerator(dc to ac) set lshnnt motor rating: 5 hp. consisting of shunt motor with 440v ac generator rating : starling cornpen5ator and su itch j phase. .1 rvi::. :. j kva. directll coupled lo ac generalor 4lr(, ll0 volls. 0.8 pl. with exciter and switch board 50rr ,: i:s mounted with regulator, breaker. ammeter, voltmeter fieq uency meter. knile hlade su itch arrd lure. e1g. set cotnplete r.l ith ca:t irorr bed plate. lixing holts. [oundat ion bolt. arrd llexible coupling. lno. 144. ac squirel cage motor with 5 iip.3 i)hase.4l5v.50 hz star delta starter and triple pole ir,rn clad u itch lirc u ith mrchanical lord. i no. t45. ac phase wound slip ring motor 5 ilp440 v.i phase.s0 hz urith stafier su itch i no. 146. universal motor with 2+,.1 v. 50 t{2. 1 iip i no. stafter/s,,,itch 147 . synchronous motor with 3 l)hase. 3 iip. 4rt[)v. 50h2. ] i no. accessories like starter. ercitation ,1 poie aflangemen t.. 148. thyristor /lgbtcontrolled d.c motor drive with tachogenelator feedback arrangement i ii) lno. 149. thyristor/igbt controlled a.c. vryf uor,!r()l .l ?nase. i i o. motor drive with llp r 50. single phase llansfonrer. corc i kva.240141 5 v. 50 hz 3 nos. t1,pe. ail cooled l5t three phase transformer. shell t1pe oil cooled with delta/ star 3 ri va.,ll 5/2,10 v. 50 hz 2 r os. 152. electrical machine trainer diesel cenerator set with changeover switch. over current hreaker and uater/ air cooled with armature. star deita connections ac 3 phase 7.5 i{va. .i: 5 rar;tg v t,, l ,, hi 1,.,, r. ,. ,. insi tirie 154. ljsed dc generators seriesshunt and compound type lor overhau ling practice i i o ilach 155. pillar e lectric drill machine motorized i 2 ll) rnrr (.:rp:ic rt. i i i ;. r 1l:. 44() ,. 1 phae. irrdrrr l;o h4rtor with d(ll starter. bencir tvde 156. motorised bench grinder i hp. 3 phase. 440v with . o doi starter. ifo,,rhie sidc xi.h sn]oot;i and iougir ni;ee i ,vi1ir iool ilase 157 . a.c. selies type motor i tit 140 .50 ilz , nir i 58. single phase capacitor motor with starter switch i hi.2,10 i0 117 159. manual motor coil winding machine with srep arbor no. 160. ceiling tan coil winding machine 250v. i0 i{7:. i q.,. ith spced contr0i o i l6l primary current injection set 220i. i0 l1z. i t!. olrtpirl current 20(r a (nriri) t ir[r iinr er | 62. stepper moror with digital controller ino. t6t. shaded poie motor fractional t ip.2,l0t/.50 llz ,o. d.shonfloorfurnitureandmaterials for2(l+lliilit::trr,;dditrinli .tctns are required 164. working bench l,5.rx 1.21) * x11.75 :rl , :rs. t65. wiring board : n]etcr i :;,elcir^ith0.j llio. incter projectr,rii (,rr lh. top t 66. lnstn rctors table lo. 167. instnrctors chair .. ,)s. 168. metal rack l00cm x i 50crr x..l ictn 169. [ ockers with dralvers 2.5 nr r 1.20 rn r 0. 5 rn { lc dra,r,er*10 tirauer) i lil f.acir l iainee 170. almirah 2. i rn r 1.2[t m x 0.5 nr ] ,lr o. 171 black board/white board lrninirnurn 46 lect, , t fo. 112. fire extinguisher co2 ,./ k( i i n rs. t7 3. fire bucket slselof six) etc ...

Department Of Local Bodies - Rajasthan

32231318 construction of drain and interlocking tiles work mohamed sharif jhunjhunu house to baju egg house gali, madan ji bagariya house to post main house gali and babu sikariya gali ward no. 15...

Private Company - Rajasthan

32165032 supply of vegetables, fruits, grocery items, tined food, ice cream, meat, chicken boiler, fish, egg, packing milk, paneer, butter, coal, solid fuel, providing of labour for laundry, housekeeping, security service, courier service, signage printing, scrap, flower, stationery printing....

Medical College - Rajasthan

32091903 supply of reagent and chemical consumable for bio chemistry lab at gmc dungarpur sr.no reagents 1 acetoacetic acid 2 3 acetone (amher color bottle) albumin egg 4 anmmonium sulphate 5 ammonia liquid( nh4oh) (amber color bottle) 6 barium chloride 7 baryta mixture solution 8 benedict’s reagent 9 benedicts uric acid reagent 10 bile salt 11 calcium chloride 12 copper sulphate 13 creatimne 14 dextrose powder 15 fouchets reagent solution 16 glacial acetic acid 17 ilypobromite solution 18 molybdic acid 19 nitric acid 20 orthophosphoric acid 21 phenolphthalein indicator 22 picric acid 23 potassium oxalate 24 silver nitrate 25 sodium citrate(tri) 26 sodium carbonate 27 sodium chloride 28 sodium nitropruside 29 hippuric acid 30 ethereal sulphate 31 sodium tungstate 32 sulphosalicyclic acid 20% 33 sulphur powder 34 urea 35 urease powder 36 uric acid 37 chloride 38 sulphate 39 calcium 40 test tubes 2oml 41 test tubes( plastic riya tube) 42 blue litmus paper 43 ph paper 44 rubber tit for glass pipette s 45 filter paper 46 gloves 47 cuvettes(for colorimeter) 48 dropper 49 dropper tissue paper glucometer strips , digital ph meter , urine dip 10 parameter strips , whatman filter paper , bendine solution etc ...

Medical And Health Services - Rajasthan

32090846 purchase of lab items for b.h.pali supply of steel items steel rod , iron girder , iron wire haris haenatoxyline eosin y tissue cassette , histo wax , dpx mount , egg albumin powder , lithium crbonate absolute alcohol , xyene pure , steel moulds for tissue blocks , hydrocloric acid hcl desktop computer set complet laptop , led for computer multi function printer , secugen hemster pro , usb web camera , ups dual battery , epson fx 890 catridge ...

Medical And Health Services - Rajasthan

32090837 purchase of lab items supply of steel items steel rod , iron girder , iron wire haris haenatoxyline eosin y tissue cassette , histo wax , dpx mount , egg albumin powder , lithium crbonate absolute alcohol , xyene pure , steel moulds for tissue blocks , hydrochloric acid hcl desktop computer set complete laptop , led for computer multi function printer , secugen hemster pro , usb web camera , ups dual battery , epson fx 890 cartridge ...

Dr Sarvepalli Radhakrishnan Rajasthan Ayurved University - Rajasthan

32040953 supply of equipments, articles and chemicals for dept. of pharmacy list of articles/equipments (consumable) 1 dropping bottles 5 2 dropper 100 3 sieves (stainless steel, size 10,20,40,60 meshes) 03 each 4 chopping board 05 5 chopping knife 05 6 burettes 10 7 pipette 10 8 graduated dropping pipette 05 9 graduated conical testing flask 05 10 beakers (50 ml to 1000 ml) 25 11 stand with ring clamp 05 12 distillation apparatus with liebig chamber 02 13 graduated flask round bottom (different size) 10 14 spirit lamp 20 15 weighing box (chemical) 10 16 tripod stand with wire gauge 15 17 temperature thermometer 10 18 leather pad for succussion 05 19 test tube holder 25 20 test tube 200 21 retort with stopper 05 22 desiccator with silica plate 05 23 amber glass bottles (50 & 100 ml) with cork and cap 100 24 pycnometer (specific gravity bottle) 02 25 litmus paper 10 packs 26 filter paper 10 packs list of articles/equipments (other) 27 spatula (stainless steel) 30 28 spatula (wooden handle) 10 29 stop watch (racer) 15 30 botanical slides (medicinal plants slides) a) diatoms (w.m.) b) spirogyra (w.m.) c) stem tip d) aspergillus e) valvox (w.m.) f) rhizhopus sporangium g) penicillium (w.m.) h) yeast (w. m.) i) lichen rons j) mushroom k) spirogyra conju. 01 each 31 hot plate 01 32 laboratory press 02 animal specimens 33 spider (karoliyo) 1 6 25 sign & seal of firms 34 flea (fly) 1 35 snail (gokal gay) 1 36 cockroch 1 37 ant (kidi) 1 38 honey bee (madh makhi) 1 plant specimens 39 alum (fatakadi) 1 40 naphthelin (damar goli) 1 41 red phosphorus (match sticks) 1 42 boric acid 1 43 camphor(kapur) 1 44 salt 1 45 iron 1 46 aluminium 1 47 pencil lead 1 48 copper sulphate powder 1 49 calcium carbaid powder 1 50 hydrocloride acid 1 51 silver nitraite 1 52 barium cloride 1 53 lithium 1 54 glycerin 1 55 formalin 1 56 vinegar 1 57 lemon juice 1 58 copper 1 59 backing soda 1 60 sand 1 61 egg shell 1 62 sea shell 1 63 bryophyllum (elcho) 1 64 male fern (rhizome) 1 65 river fish 1 66 sea salt 1 67 magnet 1 68 x ray 1 69 amoxycillin 1 70 b.c.g. vaccine 1 71 aspirin 1 72 radium 1 73 diazepam 1 74 deriphylin 1 75 gentamysin 1 76 salbutamol 1 77 crab 1 78 dye indigo 1 79 crude rock oil 1 80 sponge 1 81 bili patra 1 82 galo (giloy) 1 83 jelly fish 1 84 animal charcoal 1 7 25 sign & seal of firms list of chemicals 85 hydrochloric acid (hcl) 500 ml. 86 nitric acid (hno3) 500 ml. 87 solu. of potassium bicarbonate 500 ml. 88 concentrated h2so4 500 ml. 89 iodine solution 500 ml. 90 distil water 5 litres 91 naoh solution 500 ml. 92 potassium ferrocyanide 500 ml. 93 agno3 500 ml. 94 cuso4 powder 500 gm. 95 agno3 solution 500 ml. 96 dilute hn03 500 ml. 97 ammonium oxalate solution 500 ml. 98 dilute acetic acid 500 ml. 99 barium chloride solution 500 ml. 100 dilute hcl 500 ml. 101 ammonium chloride solution (nessler’s reagent alkaline k2hgi4) 500 ml. 102 alcohol 1000 ml 103 anhydrous cuso4 500 gm 104 calcium carbide cac2 500 gm 105 salicylic acid/ sodium salicylate 500 ml. 106 potassium hydrogen sulphate (khno3) 500 ml. 107 potassium cupric tartrate 500 gm. 108 mercuric sulphate solution 500 ml. 109 solution of lime 500 ml. 110 chcl3 chloroform 500 ml. 111 phynophathaline solution 500 ml. 112 hydrogen sulphied h2s 500 ml. 113 potassium permagnate solution 500 ml. 114 potassium mercuric iodide 500 ml. 115 k2co3 potassium carbonate 500 ml. 116 calcium hydroxide 500 ml. 117 cupric hydroxyide 500 ml. 118 borax solution 500 ml. 119 carban dissulphide 500 gm. 120 sugar of milk 5 kg. 121 cane sugar 1 kg. 122 globules(size 10, 20, 30, 40, 50, 60) 1 kg each 123 tablets 500 gm 124 oils (almond, sandalwood, olive, sesame, lavender, rosemary, chaulmoogra) 500 ml each 125 paraffin (vaseline) 500gm 126 yellow bee wax 500 gm 127 starch (semisolid) 500 gm 128 sulphur powder ...

Medical Health And Family Welfare - Rajasthan

31958466 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 100 t , aslo 100 t , crp 100 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristix 2 parameter 1 x 100 stp , multistix 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner cbc 3 part , abx minoclear cbc 3 part , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg horiba 20 l , abx lyse bio horiba 1 l , abx cleaner horiba 1 l , minocal calibrator horiba 2.0 ml , minotrol 16 twin pak ( 02l ) horiba 2.5 ml , minotrol 16 twin pack ( 2n ) horiba 2.5 ml , minotrol 16 twin pack ( 2h ) horiba 2.5 ml , minoclair horiba 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin total system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 biosystem , calibration solution c 2 biosystem , fluid pack c 3 biosystem , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 ( human ) 5x5 ml biosystem , control level –ii ( human ) 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuheck , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening , dilucel d cbc 5 part trivitron 20ltr , lycel dsp cbc 5 part trivitron 5 ltr , lyce cbc 5 part trivitron 3 litre , probe cleaner cbc 5 part trivitron 2x50 ml , control ( low, medium and high ) cbc 5 part 3x3 ml , field stain a and b each , truk solution ( glacier acetic acid + methyleneblus ) each , h e stain each , control level 3 ( human ) system pack biosystem , hydro cloric acid solution 100%for rotor washing solution 1x250 ml biosystem , nitric acid solution for rotor washing 1x250 ml biosystem , billuribin direct system pack erba...

General Administration Department - Rajasthan

31943784 supply of kirana items tender tender for kirana items supply at circuit house, jaipur , wheat atta ( aashirvaad ) , multi grain atta ( aashirvaad ) , wheat atta ( laxmi bhog ) , wheat atta ( hari bhog ) , wheat atta ( shakti bhog ) , makka atta ( gangor ) , makka atta ( lakda ji ) , bajra atta ( gangor ) , bajra atta ( lakda ji ) , sonasikka oil , super postman , desi ghee ( saras ) , desi ghee ( milkfood / amul ) , butter ( saras ) , butter ( amul ) , rice basmati ( lal qilla ) , rice basmati ( dawat gold ) , rice basmati ( pari ) , papad ( bikaji ) fny [ kqk@ckrphr , papad ( bikaji ) iklikl , besan ( laxmi bhog ) , besan ( shakti bhog ) , maida ( double talwar delhi ) , suji ( double talwar ) , suji tirupati gold , toor dal regular ( standard wholesale quality ) , toor dal ( tata i shakti ) , urad wash ( standard wholesale quality ) , urad wash ( tata i shakti ) , urad split ( standard wholesale quality ) , urad split ( tata i shakti ) , urad whole ( standard wholesale quality ) , urad whole ( tata i shakti ) , moong chilka ( standard wholesale quality ) , moong chilka ( tata i shakti ) , moong mogar ( standard wholesale quality ) , moong mogar ( tata i shakti ) , moong split ( standard wholesale quality ) , moong split ( tata i shakti ) , red masoor ( standard wholesale quality ) , red masoor ( tata i shakti ) , dal chana ( standard wholesale quality ) , dal chana ( tata i shakti ) , kabuli chana ( standared big size ) , kala chana sabut ( standared big size ) , rajma red ( standared big size ) , chola whole ( standared big size ) , badi mangodi masala marwadi , mangodi sada, jain , sugar ( laxmi brand / barelly ) , sugar ( shagun ) ( 50 kg. bag=5 kg. pack x10 bag ) , gud ( barelly ) , tata salt , saindha namak , kala namak , souf big , souf small ( lucknowi ) , garam masala whole , garam masala powder ( mdh ) , coconut powder ( mangal ) , khus khus ( rani ) , mishri cutting , elaichi choti ( gayatri 8no. ) , catch red chili powder ( 500 gms. ) , mdh red chili powder ( 500 gms. ) , catch dhaniya powder ( 500 gms. ) , mdh dhaniya powder ( 500 gms. ) , catch amchoor powder ( 100 gms. ) , mdh amchoor powder ( 100 gms. ) , catch termeric powder ( 500 gms. ) , mdh termeric powder ( 500 gms. ) , catch chat masala ( 100 gms. ) , mdh chat masala ( 100 gms. ) , catch kassori methi ( 100 gms. ) , mdh kassori methi ( 100 gms. ) , catch chana masala ( 100 gms. ) , mdh chana masala ( 100 gms. ) , catch chicken masala ( 100 gms. ) , mdh chicken masala ( 100 gms. ) , catch meat masala ( 100 gms. ) , mdh meat masala ( 100 gms. ) , catch rajma masala ( 100 gms. ) , mdh rajma masala ( 100 gms. ) , catch kitchen king ( 100 gms. ) , mdh kitchen king ( 100 gms. ) , catch black peeper ( 100 gms. ) , mdh black peeper ( 100 gms. ) , catch white peeper ( 100 gms. ) , mdh white peeper ( 100 gms. ) , catch hing ( 100 gms. ) , mdh hing ( 100 gms. ) , azavayan , catch table salt ( 200 gms. ) , catch table black peeper ( 100 gms. ) , kaju tukdi gokul , kishmish kandhari , pista cutting ( tulsi ) , badam cutting ( mamra ) , rye , melon seeds , kesarcsch , kesaruvjkt , jeera sun brand , red chilly whole , amchoor sabut ( white ) , dhaniya whole , ajeno moto packet , phool makhana ( rajbogh ) , phool makhana ( makhan bog ) , sweet soda , kalongi , dana methi , lemon juice zoom , tatery , imli whole ( without seeds ) , anardana , ruchi nutrela chunks packet , marmlet , jam kissan , maggi noodles , soup packet ( maggi ) , soup packet ( knoor ) , real juice ( dabur ) , real juice ( tropicana ) , mashroom tin mumus , cheese cubeamul ( 8 pc. ) , cheese sliceamul ( 10 pc. ) , cheese spreadamul , bambino vermicili ( druks packet , bambino vermicili ( keytis ) packet , dabur tomato puree tin , frutins tomato puree tin , mohuns corn flakes packet , kellogs corn flakes packet , kellogs musli nuts , kellogs oats , fab india tulsi green tea bag , red lable tea ( tetra pack ) , lipton green label tea ( packet ) , taj tea begs ( packet ) , kissan tomato ketchup , maggi tomato ketchup , red chilly sauce ( shree nath ) , red chilly sauce ( mumus ) , green chilly sauce ( shree nath ) , boondi , nescafe classic coffee ( jar ) , milk powder tetra pack ( amul ) , milk powder tetra pack ( nestle ) , sugar cubes ( daurla ) , sugar free ( small ) natura , pickle mix ( nirlons ) , pickle mix ( shree ) , biscuits ( monaco ) 100gm , biscuits ( good day ) 150gm , biscuits ( dark fantasy / chocofills ) 75gm. , all cold drinks ( pepsi / mirinda / limca / dew ) , all cold drinks ( pepsi / mirinda / limca / dew ) , packaged drinking water ( bislery / kingfisher ) , packaged drinking water ( bislery / kingfisher ) , jelly ( rex ) , curd ( saras / amul ) , frozen peas ( safal ) , frozen peas ( orbit ) , silver foil ( kitchnmat ) , silver foil ( pal ) , clean film ( freshwrap ) , clean film ( oxy ) , super soft double ply ( size 30mmx30mm ) printedpaper napkins ( having circuit house jaipur logo, see sample ) , printed paper tray cover ( size 18lx12w ) ( having circuit house jaipur logo, see sample ) , paper tray cover ( size 16lx12w ) ( having circuit house jaipur logo, see sample ) , custard powder ( wekfield ) , custard powder ( tops ) , corn flour ( wekfield ) , corn flour ( tops ) , fruit cocktail tin ( frutins ) , fruit cocktail tin ( mohuns ) , tooth pick ( twinkle ) , hard board packing box ( 9x9x4¼ ) ( 420 gsm ) , hard board packing box ( 8x6x4¼ ) ( 325 gsm ) , rubber band ( big & small ) parnami , zip lock polythene bag ( 3x4 ) 180 gm. , zip lock polythene bag ( 4x5 ) 200 gm. , zip lock polythene bag ( 5x6 ) 200gm. , bikanery bhujiya 200gm. ( bikaji ) , bikanery bhujiya 200gm. ( haldiram ) , poha ( healthy choice ) , poha ( tounch ) , ground nut ( kachhi ) , sabudana ( saccha moti ) , daliya ( gangaur ) , sarso oil ( engine ) , plastic disposal katori ( standered quality ) , plastic disposal water glass ( standered quality ) , paper disposal coffee cup ( nescoffy ) , paper disposal katori ( standered quality ) , paper disposal water glass ( standered quality ) , packing box plastic ( standered quality ) 1 ltr. , packing box plastic ( standered quality ) 2ltr. , silver foil box ( small ) , silver foil box ( medium ) , silver foil box ( big ) , butter milk ( nkn ) , milk saras ( gold ) , milk saras ( shakti standard ) , milk amul ( gold ) , milk amul ( taza ) , paneer ( saras ) , paneer ( amul ) , bread big with cutting laxmi ) , bread big with cutting ( kallory ) , bread big with cutting ( britennia ) , bread cram , cream white ( amul ) , mawa , egg , mutton , chicken , fish...

Rajasthan University Of Health Science - Rajasthan

31927326 chemicals reagents consumable items for department of pathology chemicals reagents consumable items for department of pathology , electrical items : , anti a ( sera ) , anti b ( sera ) , anti d ( sera ) , sodium metabisulfite , capillary tubes , sprit , g6pd kit ( 12 test ) , ocult blood kit , coombs anti sera , cover slip ( 18x18mm ) , disposable needles ( 24 guage ) , disposable needles ( 22 guage ) , disposable sterile urine container , esr disposable pipette , glass marker pencil , jsb stain i , jsb stain ii , ketone strips , lancets , leishmans stain , micro glass slides , microscope bulb , n / 10 hcl , cedar wood oil , permanent marker thin ( black ) , rapid h & e , reticulocyte fluid , semen diluting fluid , sodium citrate 3.2% , sodium citrate 3.8% , thermal paper ( 110 mm ) , thermal paper ( 80 mm ) , thermal paper ( 57 mm ) , small test tube plastic , small test tube glass , tips ( 100 1000? l ) ( blue ) , tips ( 10 200? l ) ( yellow ) , tissue paper roll , tourniquate ( cloth ) , urine multi strips , urine strips for alb / sug , vacutainer edta vial , vacutainer sodium citrate 3.2 % vial , wbc diluting fluid , new improved neubaur counting chamber having silwar watad 9 mm 2 ruled area , giemsa stain liquid , carbol fuchsin , cover slip ( 22x50 ) , diamond pencil , distilled water , dpx mount , ethanol , filter paper 460x570 mm , methanol , normal saline , papanicolou ready to use kit , hematoxiline powder , glacial acetic acid , aluminium potassium sulphate dodecahydrate , sodium lodate , potassium ferrocyanide , myloproxidase , disposable syringes 2ml , disposable syringes 5ml , disposable syringes 10ml , disposable syringes 20ml , cotton roll , petridish disposable , hand senitizer , dlc counter ( 8 diffrential min ) , acetic acid , acetone , acid fuchsin , acid periodic , activated charcoal , alcian blue , aluminium chloride , aluminium hydroxide , ammonium solution ( liquid ammonia ) , aniline blue , basic fuchsin , benzidine powder , biebrich scarlet , brilliant cresyl blue , carmine powder , celestine blue , chloral hydrate , citric acid , concentrated hcl , congo red , egg albumin flake , eosin yellow stain powder , ferric ammonium sulphate ( ammonium iron sulphate ) , ferric chloride , formalin ( formaldehyde 37 40 % ) , glycerin , glycerol , gold chloride , haematoxyline crystal , hydrochloric acid ar , hydrogen peroxide , light green , malt diastase , mercuric oxide , metanil yellow , methylene blue , microtome blade ( low profile ) , mercuric chloride , neutral red , nitric acid , nuclear fast red , numbering paper , oxalic acid , paraffin wax with ( ceresin 60 62 c ) , peanut oil , phenol , phosphomolybdic acid , phosphotungstic acid , picric acid , plastic ring for block ( white ) , potassium dichromte , potassium hydroxide , potassium metabisulphite , potassium permagnate , propanolol , readymade giemsa stain , rosaniline dye ( for shiff reagent ) , silver nitrate , sodium nitropruside , sodium hydroxide , sodium sulphate , sodium thiosulphate , sudan black b , sulfurous acid , tetrazolium chlorlde , toludine blue , xylene , rapid pap stain kit , disposable gloves sterile , disposable gloves un sterile , non specihe esterase kit , bovine albumin 22%...

Medical And Health Services - Rajasthan

31916977 supply of medicine surgical and other items for life line drug store injection syringe drugs capsule , surgical mask , oral suspension , injection table syrup , cream drops , tablet capsule , etc 1c00 oral ani 001 2% glut a rldehyde lot on ‘une r 2qomgy and p aceclotenac 10o mg and paraceiamot 325mg aceclover eye and ear drops 1r107 cerummolytic drops ( wax dissolving ear drops ) paradichlorobenzefle 2 01o. benzoca’ne 2 7 olo , chlorbulol 5 0 / 0. 1r108 ceerizine syrup p 5mgf5 ml / 1r109 cetirizine tab ip 10mg 1.110 cetirizine phenylephrine& parac.etamol tablets cetirizine 5 mg phenylephrine 1 _____ mng & paracetamol 32s mgtab 1.111 cevverix ( cervical canc.cs ) 1.112c chiken pox ( varilx / bovac v ) chlorampheniccl l ) examethas oinbe eye ointment 1.113e . 1.114e 1.115e chlordiazepwde thalts ip 10mg chlorh gulcb’ate solution 5% / 1 1.116i chlorhexidine laouth.iash ip1bp 02 o10. i 1.117o 1.1m18.i 1.1198 chloroquine phosphate suspension ip 5omgi5ml — chloroquine phosphate tab. ip 250mg ( eq to 155 mg of chioroquine base ) ( film chlorphenramne maleate tab ip 4mg 1.120 i chlorprocaine 50mg paraceamr 325 mg ) / 1.122e cho!ecacrferol granules 60.000 pu 1gm — 1m123 [ cinnarizine tablet ip 75 mmgl , 1.124t crmnarizinetabletslp25mg 1.125r ciprofloxacin 0 3 010 and dexamethasone 0 1 o10 ear drops ciprofloxaön and dexamethasone otac suspension usp 1 15 cioroflozacan eye drops 0 3 010 wlv , 1.127f ciprofloxacm opthalimic ointment 03% : 1.128 ciprofioxace1 tablet pp 500 mg film coated , . 1.129d ceprofloxacan tablets ip 25o mg film ...._ coated 1.130d clindamycin capsule pp 300 mg ..‘ 1.131l clindamycin phosphate gel usp 1 o10 1.132h cundamycin+adap1ane cream 1.133 * cunidine1omg 1.134i clobazamn5mg 1 135 clobeasot proponate cream 0 05 o’o 1.136n 1k137n clomifene citrate 50 mg &onazepai 0 5mg 140 1.141 clopidogrel and aspinn tables. çsp.dogrei 75 mg and aspirin 7s mg — clopidogrel tab ip 75mg 1o142d cotnmazole cream ip 2% wiw ., 7 1.143a clotflmazole vaginal tab 500mg .144 coaltar 45+ketaconazole 2% i shwueoo 1k145 co trimoxazole oral suspension ip each 5 ml contains thmethoprwm 40 mg and suphamethoxazole 200 mg 1s146 coug syp dextrometharphen 1.147o cough syrup each 5 ml contains chlorophenliramire maleate ip 3 mg.amnmonium chlonde 13o mg, sodium c.trate 65 mg, menthol 0s mg. syrup onsu .a 1.148 cream eberconazole 1.149 cream itraconazole 1% 1.150o 1.151o cream vit e+sea butter oil critanitone+hydrocortisone 1% cream t139 clonazepam tab ip 1 mg clonazepam tab ip i mg i i orvrml4itlfmf i ( mtilfnl i 10 , 1.152? crotamitone lotion 1.153n cyclopentolate eye drop 1.154p danzolsomg 1.155 deflazacort6mg 1.156z dental gel choline salicylate+benlzalkoflium+ligflocalnle desmide gel 1.157 1.158 desvenl..afaxin 50mg 1.159n oexamethasonetabip0.5mg 1.160 dha drops 1.161 ddico+para+serra 1.162+ diclo+serra 1.163+ diclotenac gel: diclofenac diethylamine 1.16%. methyl salicylate 10%. linseed oil 3%. menthol 5.5% ‘ 1 164 diclofenac sod + paracetamol tablets diclofenac sod 50 mg + paracetamol 325 mg 1.165e diclofenac sodium tab ip 50 mg ( entere coated ) . 1.166d diclofenc supposter 1.167s dlcyctomine and paracetamol tablets dcyc1omnle hydrochioree 20 mg + paracetamol 325 mg tabiets oral solution • bsye rmne tsb ip 10mg — • 1 die thylcarbamazapa tab — digoxn tab ip 025 mmgo t173 diltiazem gel 174 diitiazem tabs ip 30 mg film coated — 1.175 dinoprostone vaginal ____ pessasary_10mg 1:176 dompendofle oral drops 10mg / mi ( 1oml ) 1 177 bompendone suspension 5mg / smi th178 1.179 180 dompendonle tab ip 10mg dorazolatide eye drop doxycycine cap ip 100 mg . doxylamine plus tab ‘w drop anticold folic 2mg?ml v 1.181 1182 1.183 drop iron 1.184 drop mefenemic 1:185 dropvitd dropvitd / 1.185i 1.186 drotaverinle and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250mg 1.187 drotavenne tab 40 mg 1.188 dulcolex suppository 1.189 dulexitine 20 mg 1.190 duolin respules 1.191 ear drop oflox+clotrimazole+beclomet ha s 0 n e 1.192 enalaprii maleate tab 10mg 1.193 enalapnl maleate tab ip 2.5mg 1.194 enalaprii maleate tab ip 5mg 1m195 1 erlotinib 150mg 1.196 escitalopram tab ip 10mg 1 1.197 esmoprazole tab 1.198 e11zolamo.5mg 1.199l etoricoxib 9o mg tab 1 200 etoricoxib tab ip 120mg 1 200 etoricoxib tab ip 120mg 1|201 etoflcoxibtabip6omg 1 202 etoricoxib+thiocolchicoside 4mg 1 203 1u204c famotidine tab ip 20 mg famotidifle tab ip 40 mg 1j205i febustate 80mg femitral plus budesonide ______ 200u400_rotacap!irler? femitral plus fluticasone25oi500 .____ rotacaei1nhaler _____ fenofibrate capsules ip 200 mg th209 fentanyl patch 255omg fenticonazole cream 1 206 1 207 1 208 1 210 i 211 ferrous sulphate with folic acid tab tab. ( paediatric ) each fibn ip containnng dried ferrous sulphate iron and eqivalent to 20mg folic acid ip 100mcg 1 212 ferrous sulphate with folic acid tab each film coated 100 dried ferrous sulphate ip equiv mg acid ip 0.5 l f 1 213 elemental iron and mg flavoxate tablets 200mg — 1 214 fluconazole 200mg 1|215 fluconazole 50mg 1 216 — fluconazole eye drops 03% ip 1 217 i fluconazole tabletslcapsules 150mg ‘ 1 218 fluoxetine cap ip 20 mg 1|219 flupenthixol 1 mg i 220 fiurbiprofern sodium ophthalmic soiution .____ uspoo30 / owiv 1m221 fluromethasone+neomycin eye drop 1222 i iioiie fuic nisal spiay — 1.223 luvoxamine 50mg 1.224 àlic acaa tab ip 5 mg 7’ t225 racort 12 mg form respules . f— 1 226 oracort 400 respuges . / / __ 1 22f iormaldehyde solution ( 34 5 per.r 38 _ per. ) — 1 228 formalin tab framycetin 1%cream r5ale? 1 231 frusemide lit ii s — — i 232 fu, a, e acia cream ps2a gabapantin 1 234j 1 235 gabapantin 300mg abapantin 300tg+mecobalamin 1 236 gamma benzene hexachionde lotions 1% ( lindane_lotion_usp ) 1 237 geftinib25omg 1 238 gemcitabine for inyection 200 mg 1 239 gingikobiloba 1 240 gtlenc’amide and metformin hydrochionde ( sr ) tablets glibenclamide 5 mg. metformin hydrochloride.500_mng ) 1 241 glibenclamide tab ip 5 mg 1 242 gliclazide and metformin tablets ( ghclazide 80 mg and metformin hcl so0mg ) — 1 244 glimepinde tab ip 1mg i 243 ictaz’ae tab ip 4u mg 245 ghmepinde tab ip 2 mg 7 246 glimepiride. p.oglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains ghmepiride 2mg. piogltazone 15 mg, metformin hydrochloride ( sustained release ) 247 glipizide tab ip 5mg 248 glucosamine+dacerun 249 glycerin ip 250 glycerin supplostey — 251 glycopyronium lomg rotacops — — 2521 grisemfulv1n 2a0mg 253 gum palnt ( tannic acid.cetrimide÷zinc chloridelcj_d 254 hmf sachet ( human milk fortifier ) ( d rvrxni irieri ) ? 1.255 1 256 homatropine eye drop hpmc eye ointment hyarochlorthiaziae tab ip 12.5 mg 1 257 1.258 hydrocortisone 1% cream m 1 259 hydroquinone 2% creaw1u 1 260 hydroquinone2%.tretinoin.flu ticasonre oint 1 261 hydroxychloroquine sulphate tablets 200mg 1 262 hydroxyurea 500mg cap 1 263 1 hydroxyzine tab ip 25 mg 1 264 1 265 hyoscine butylbrom, de tab ibu.para suspension — i 268 ibuprofen and paracetamol tablets — tbupofenl 4wm2aetannc 32s m levodopa and carbidopa tab 100 mgand10mg levofloxacin 500mg tab levofloxacin tablets ip 250 mg levosalbutamol+ipratropium bromide respirator solution .|7u 1.303 1.304 1.305 1.306 1.307 lignocaine gel ip 2% 1.308 lignocaine+zinc oxide+steroid gel 1.309 linezolid tablets ip 600mg 1.310 liquid parrafin ip 7 1.311 lisinopriltab2.5mg 1.312 lisinoprii tab ip 5mg 1.313 livamisole 150mg 1.314 ioperamide tab ip 2 mg cream 1.315 lorazepam tab 1.316 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq tç amlopdipine 5mg ) 1.317 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) • 1.318 losartantablp25mg 4 / 1.319 losartan tab ip 50mg .n, , r 1.320 loteprednolol eye drop 1.321 lotion permethrin .322 loxicard spray .323 lsolyte p 10% 1.324 lulicaonazole cream 10gm .32s luliconazole cream 1.326 luliconazole lotion 1.327 lycopene plus cap tablets ip 1.328 med roxyprogesteronle acetate 10mg 1.329 mefloquine tablets ip 250 mg 1.330 metformin hcl ( sustained release ) and glimepiride tab metformnin hcl ( sustained release ) 500mg , glimepiride 1 mg / ‘ 1.331 1.332 metformnin hydrochloride ( sustained release ) and glimepiride tablets ( metforminl hydrochloride ( sustained release ) _5o0_mg, _glimipiride.2mg ) metforminl hydrochloride ( sustained release.tablets_ip_1oo0_mg / 7 1.333s metformin tab lp 500 mg ( fiim coated ) p 1.334 methotrexate tab 1p2.5 j 336 iethylcobalaminei500mgtab 1.337 methyicobalammfle 500mg tab i 338 thyldopa tab ip 250mg fiim coated f ... 339 methylergometrifle tab ip 0.125 mg 1.340 etoclopramide tab ip 10mg release 1.341 metoprolol succinate extended tablets usp 50 mg 1.342 metoprolol tablets ip 25 mg 1.343 metronidazole and norfioxacin suspension 100 mg + 1oo mg per 5m1 1.344 metronidazole tablets ip 400mg ‘v, m 1.345 miconazole nitrate cream 2% 1.346 micronized progestroneoralnegiflal / rectul 2o0mg 1.347 minoxidil 10%336 iethylcobalaminei500mgtab 1.337 methyicobalammfle 500mg tab i 338 thyldopa tab ip 250mg fiim coated f ... 339 methylergometrifle tab ip 0.125 mg 1.340 etoclopramide tab ip 10mg release 1.341 metoprolol succinate extended tablets usp 50 mg 1.342 metoprolol tablets ip 25 mg 1.343 metronidazole and norfioxacin suspension 100 mg + 1oo mg per 5m1 1.344 metronidazole tablets ip 400mg ‘v, m 1.345 miconazole nitrate cream 2% 1.346 micronized progestroneoralnegiflal / rectul 2o0mg 1.347 minoxidil 10%montelukast+levocetrizinle tab moxifloxacin eye drop muttivitamin cap multivitamin drops each ml contains vit a 30oo iu, vit d3 30o iu, vit bi 1mg, riboflavifle phosphate sodium 2mg, 0 panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin lmcg. lysine hcl 1omg mupirocaine 2% cream r.miukmlo, i.’_, 1cmmm —m—mem— — 1.347 minoxidil 10% 1.348 misoprost 600mg 1.349 misoprostol tab 200 mcg 1.350 moisturising soap 1.351 momentasone cream 1.352 momentasone nasal spray nadine 1.353 montelukast +fexofe 1.354 1.355 1.356 1.357 1.358 1.358 1.359 1.360 1mcg, ysiiie nui— •rvir.n mupirocaine 2% cream nabivilol naproxen 500mg 1.361 nasal drop botroclot 1.362 neomycine ointment 1.363 rneomycine powder 1.364 neomycine+bacitracin ointment 1.365 neosporin powder 1.366 neosporin+sulphacetamide oint. 1.367 nephazoline+hpmc+cpm eye drop 1.368 netamycine eye drop 1.369 nicotex patch 7 / 14 / 21 mg 1.370 nifedipine gel 1 371 th 372 ikorandil 5 mg nitrolurantoinl tab ip 100mg — 1 373 norethisterone tab ip 5 mg 1 374 norfloxacin tab ip 400mg film coated , 1.375d ntg 2.6 mg ‘ 1 376 of ) oxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 50o ‘ 1 377 1.378 mg ofloxacin suspension ofloxacin tab ip 200 mg p / 1.379 ofloxacin+betamethasone eye drop 1.380 oint. soframycine olnt.clobetasol+salicylicacid 1.381c / 1.382 oint.traimcclolone , m 1.383 olanzapine tab ip 5 mg 1.384 olanzipine 5mg 1.385 olapatadine +ketqrolac eye drop 1.386 olmesartan 25mg .387 olmesartan 50mg 1.388 omega 3 fatty acid 1.389 omeprazole cap ip 20mg 1.390 omocroptine 1mg 1.391 ondansetron orally disintegrating tablets ip 4mg 1.392 opipramol 5omg 1.393 ormeloxifene 60mg .394 ors powder ip .395 pantoprazole 40mg and domperidofle 30mg sr cap pantoprazole as enteric coated pellets and domperidonle as sr ‘ pellets . 1.396 paracetamol 625 tab reiiet perindoprine permethrin cream 1% 1 396t paracetamol 625 tab 7 . z , “ 1.397 paracetamol drops ( paracetamol syrup ip ) ( each ml contains paracetamol . / 150mg ) 1.398 paracetamol syrup mg / 5m1 ( detail in rc ) 1.399 paracetamol tab ip 500mg 1.400 paracine eye drop 400mg 1.401 pazopanib 1.402 pcm suppostery 1.403 penicilin g 1.404 1 405 ermethrinl cream 5% ilpermethrin lotion 1% permethrin soap l_oi_oacn pilocarpine eye drop 1 411 piogitazone tab ip 15mg 1 412 1 413t 1 414 podophylin 20% resin solution vidine iodi4e 5% 100 ml povidone iodine i0%i100ml sql / % 1 415 povidone iodine gargle a po0 1 432 1 433 1 434 1:435? propracaine eye drop propranolol 10mg propranolol tab ip 40 mg protion powder 200gm 1 436 pyridoxime 1 437 1 438 ramipril 5.metoprolol 50 mg xlg...p , — ramipril tablets ip 2 5 mg 1 439 ranitidne tab ip 150mg film coateci / ranitidine tab ip 300mg film coated’ 1 440 1 441d ranolazine5oomg 1 442 speridone 2mg 1 443 $4evaroxabaun 10mg salicylic acid 17 3%+lactic acid 17.3% cream salicylic acid 3% creaa salicylic acid 6% cream saiine nasal soiution ( diops ) ( sodium — — chloride 0.65o / o ) 1 444 1.445 roflimulast 500mg suvasta1nn 10mg 1.446 osuvastatin 2omg 1c447s rosuvastatin 40mg 1c448a salbutamol inhaler sol. 1.449 salbutamol nebulizer 5mg / ml — 1.450 — 1 451 salbutamol syrup ip 2mg! 5m1 r u t salbutamol tablet ip 4 mg 1.453 1.452 salicylic acid 12% cream 1.454 1.455 1.456 salin nasal chloride 0.b o10 ) 1.457 seerrratiopeptidase 20mg tab — 1.458 serratiopeptidase 10mg tab 1.459 sertaconazole cream 1% 1.460 sertraline tab 50mg — 1.461 shampoo ketaconazole+zpto 1:462o 1.463 1.464 sildinafil 20 mg tab silversulphadiazine cream sitagliptin each 1.465 sodium phosphates enema bp 1oom! contains sodium dihydrogen phosphate dinydrate 1o o10 disodium hydrogen phosphate dodecahydrate 8 sodium valporate 500mg . — ip 200 .— 1.466 1.467 sodium valproate oral solution mg / s ml sodium vaiproate tablet 200 mg ( enteric 1.468 mg / 5 ml 1 468 sodium valproate tablet 200 mg ( enterie coated ) 2% 1.469 solution minoxidil solution minoxidil 5% 1.470 1.471 sorafenib200mg 1.472 pironolactone 50 mg tab lotion 1.473 sunscreen “. 1.474 surgical spirit 10oml 1.475 syp ambroxol+terbutaline+levosal butamol 1.476 1.477 syp artemether+lumefantrine 6ypazithromycin 100mg 1.478 syp cefixime 50mg i79 syp cepodoxime 100mg 1480 syp cep000xime 5ome!ml 14b1 1p cpi+dextro+pienylephrine 1c482 ypdiciominle + pcm 1.483 syp digoxin 1.484 syp erythromycin 1 25mg / 5ml r 1.a8s smp levosalbutsmol imgiaml? — . 1.486 syp mct oil ( medii chaii . triglycenide ) t487 syp mefenamic acid 100mg / 5ml — t488 syp mefenamic acid+pcm 1.489 syp mom plus 1.490 syp nevirapin 1.491 syp ofloxacin / ‘7 1.492 syp ofloxacin oz 1.493 syp phenobarbitone 2omg!500ml 1.494 syp promethazine+pcm 1.495 syp sucralfate 1.496 1.497 1.498 1.499 tacrolimus 0.03%cream tacrolimus 0.1% cream tacrolimus lotion 0.1% tamoxifen 10mg p 1.500 tamsulosin hci tablets 0.4 mg 1.501t telmisartanl tablets ip 40 mg 1.502 temozolovide 10omg 1.503 teneligliptin 20mg 1.504 tenozolomide 200mg 1.505 terbinafine 25omg i i t rhirg mg sodium tablets ip 1 tab’ets ip 5omcg 0. a 1 516 trn, dazole tab ip 500mg ( film coated ) ‘ 1 517 1iotropium 9 / 18 mg rotacaps 1.518 tobramycin and dexamethasofle ophthalmic suspension usp 0.3 o10 ‘ 1.519n +0.1 o / o tobramycine eye ointment 0.3% 7 1.520 tofisopam 50mg 1.521 tooth gel sodium monoflurophosphate+poflasiu mlnitratep 1.522 torsemide tab 10mg ‘—, 1.523 tramadol cap 50 mg 1.524 tramadol+pcm 1 525 tranexamic acd tablets 500 mg ‘ travoprost eye drop — r 1.526 1.527 tretinoin .025%% cream triamcinololone acetomide oral paste 1.528 1.529 triamcinololone acetonide 10mg tab mmm 1.530 triamcinololone acetonide 40mg tab 1.531 trichloroacetic acid 30% 1.532 trlhexiphenidyl 2mg 1.533 1.534 tropica plus eye drop ( tropicamide+phenleriminle ) trypan blue soluation .06% m 1.535 trypsin + cymo trypsin tab trypsin + rutotosade urea lactic acid creai . 1.536 1.537 1.538 ursodeoxycholic acid tablets 300 1.539 vallsartan 100mg 1.540 valsartan 50mg 1j540? valsartan 50mg 1.541 1.542 1.544 1.545 1.546 vericonazol vit co vit e 400 mg vit.a 25000 iu m 1.547o vit.d+e 1 548 vitamin b complex tablet nfl 1 549 ( prophylactic ) bi 2mg b2.2mg b6 05mg niacinamide 25mg calcium pantothenlate 1mg ( with appropriate es ) white soft parrafin liquid velcyclorver 1 gm 1.543 vilaz ( iia0roopsp1 1 550 xyiometfl0 1.551 zinc sulphate 5omg — e 1 552 zoledroflic acid 4 mng inj 1 553 syp caffei1e citrate 1 554 glycerine supposmry — 1 555 fluconazole 200mg tab 1.556 syp sildenafll 1 t nióôvla 1t558 paracnn eye drop 1.559 cyciopentolate eye drop 1 560 prazoxamide eye drop 1.561 syphydroxy2nee 1 562 syp prednisolone 1 563 syp montas l 1 564 syp phenobarbitone 2omg / 500ml 1 565 syp azee 200ml 1 566 diazepam rectal 1.567 diazepam oral syp 1.568 pretermmilk formula 1|569 erythromycine drop 1 570 1 dha syp 1 571 fexoff p 1 572 fexofe nadine tablet 1 573 griseofulvin 125mg tab? / 1 574 syp sodium picosulphate 1.575 tab telma .amlo 7’ 1 576 tab tecua h l 1.577 tab atorva+fenofibrate / apee 1, 2 ( durapore ) abdominal belt alll sizee abdominal drain kit, sterile. having drainage catheter and collection bag ( 2ooo ml ) size 28 ( details in rc ) 2.003 2002 26 g cannul.a 2.004 2 006 2.005 bdomonal belt absorable hemostates ( surgical absorbable gelatin sponge , absorbable surgical suture 112 cir tapercut needle ( heavy ) 40mm length 90 cm absorbable surgical suture ( synlthetic ) afltthacter coated sterilised needled ( braided coated polyglactiflhpolyglycolic acid vialet ) size i 112 circle ct round bodied 4omm.gs needlesuture length 90 cm absorbable surgical suture ( synthetic ) afltibacte with sterilised needled ( braided coated polyglactin / p0iy9iyc0iic acid violet ) size 1 / 0 112 circle ct round bodied 4omm, gs needlesuture length 90 cm absorbable surgical suture ( synlthetic:ster needled ( braided ) coated polyglactinfpolyglycolic acdd / poly ( glyco1ide colias ) s ize3 10 ( 112? cir conventional 25mm length 90 cm ) u ndyed absorbable surgical s utu re ( synthetic ) ste rilised needled ( braided ) coated polyglactin / polyg lycol ic .sn. i l 2025 absorbent cotton woom ip 500 gm 2.026 accepto syringe 2.027 adhesive tape 1” ( durapore ) 2028 adhesive tape 2” ( durapore ) 2.029 adult diaper 2030 ankle binder 2031 arm pouch sling 2032 __ 2.03 s .1olg 2.034 bain 4 2.035 bandage ocm 2.036 bandage i 5cm 2.037 bandaid / 2.038 barbur thred 2.039 bedpan 2.039 bed pan 1 kg 2.040 biopsy container biopsy container 1 / 2 kg, 1 kg 2.041 2.042 bipap mask pipe 2.043 bipap tubingihose 2.044 black google 2.045 2046 2.047 blood administration set blood transfusion set ( details in rc ) blood sugar glucometer with stnp ( sd code free ) sugar strip ( 64765 ) free style blue dye , bone wax sterilised bongic bougie single use , breast pump , buprenophine patch , c arm cover cannula fixer , catheter for urinary drainage cautry plate , cental line double lumen triple single lumen chest tube with trachor ciling drape , clavical brace , c central line triple lumen 2 061 central tine single tumen 1 206e chest tube with trachor 2063 cilingdrape 2064 clavical brace s.m.l 2065 clear sole inj ( rl glass bottle ) t 2 066 clostomy bag!ileostomy bag 2 067 combined spinal epidural kit 2 068 comet spinal needle no 18 / 16 2069 condom catheter 2 070 corrugated drainage sheet au 2 071 sres ( detals_in_rc ) ? corrugated rubber dram crd ) 2072 cpgeel = 2 073 crepe bandage 2 2074 crepe bandage 4 2075 crepe bandage 6 2076 cresant eye blade 2077 cutting burr 2 078 cvp manometer 2079 delivery safety aprin 2o derma film 2 081 diagnostec st.cks for unne sug 2082 b1.ond burr 0 2o83 burr 2 2q84 diamond burr 4 2.085 diamond burr 6 2.086 diamond burr 8 2.087 digital thermameter 2088 dispo needle 16 2.089 dispo needle 18 2.090 eispo needle 22 2.091 dispo needle no. 24* 2.092 dispo needle no. 26 112” 2.093 dispo razor blade disposable ‘o” drape 2.094 2.095 disposable “u” drape 2.096 disposable aprin 2.097 disposable cautry plates 2.098 disposable cpap circuits ‘, nnoot disposable drepping f 2.100 disposable gown 2.101 disposable sheet 2.102 disposable sterile surgical rubber gloves size 6.5 lnches ( details in rc ) ‘ 2.103 disposable sterile surgical rubber gloves size 7 lnches ( details in rc ) 2.104 2.105 disposable sterile surgicam rubber gloves size 7.5 lnches ( detaiis in rc ) disposable sterile surgical rubber gloves size 8 lnches ( details in rc ) ‘, . “ disposable syringes 1 ml bisposable syringes 10 ml osa5eyrilfgeh1? 2.109 disposable syiiiges 20 ml — dispovan 5oml romsons dj stent with guide wire 2.106 2.107 2.108 2.110 2.111 2.112 ‘ 2.113 double lumen binectonsxclamps 2.114 durapore 2.115 dyanoplast4” ( inlch ) new b rn baby 2.116 egg electrode 2.117 egg electrods 2, 118 eliostomy beg stappler with 2 119 2 120 2 121 endo gi cartridge cuff. f” endotracheal tube, size 4 juetais in rc ) endotracheal tube, cuff size 5 — 5 , , # detajis endotracheal tube cuff plain enlarger blade eye blade flexometalic et tube flow regiyaiwa oljtljj 2.144j epicath p1cc line 28fr 2.145t epidural kit 2.146 eusol solution 2.147 eye drape sheet 2.148 eye hand blade 2.149 eye incison blade 2150 face mask, dlsposable ( details in rc ) 2 151 face shild 2.152 feeding tube no.6 2153 fibrin ( ear ) glue ( torseal ) 2 154 finger cot split 2.155 flatus tube 2 156 2 157 2.158 e0garty catheter 2.159 foldabte intra ocular lense with injector 2.160 foley catheter 12.14, 16 2.161 follops ring 2.162 g dress 20 2.163 gdress 10? 2.164 g!dress 15? 2.165 gdress20 2.166 g dress 25 2.167 g dress 30 2.168 gdress5 2.169 gauzethan400gm 2.170 gel foam 2.171 gigli saw 2, 172 glucometer optium h 2.173 green theraband 2.174 grommets of all sizes 2.175 guedel airways 2.176 halothane bp 2, 177 hand sanitizer 500ml 2.178 hfnc catheters 2.179 hi flow mask 2.180 high concentration mask — 2.181 igigh flow nasal canula all colours 2.182 hip u drape 2.183 hivihbsag safe delivery kit 2, 184 hme fllter 2.185 hot water bottle — 2.186 igelall sizes 2.187 i v canula 26 no. 2.188 ivset. 2.189 identification iag of neonaial — _.._._ 2.190 incise drape iodine impregated 2.191 infant feeding tube size 1ofg ( details 2.192 infant feeding tube size 5fg ( details in 2.193 infant feeding tube size 8fg ( details in 2.194 infant feeding tube size: 1ofg, 8fg, 195 infrared thermometer 2 196 insulin syringe ( 40 units ) with ( fixed } 30 197 ben 6640 to is 12s ( e 1 9wltetadin ._ 2 199 iv cannula 26 g 2i20o j r circuit pedia 2.201 jelonet 2|202 johnson buds 3d’s 2 203 k 90 cathetor 2204 ketone strip —— 2.205 knee brace 2.206 knee brase ...s kneecap reecapxl? koratome 2.1 mm eye blade koratome 2 8 mm eye blade 2211 2 212 w labpad tapi hernia i ( er 4cm — 2214 liga clip 200 2 215 ltga clip 300 — liga clip 400 lma all sizes long taper diamond barr longline axillony 45cm longline femoral 75cm 2.207 2 208 2 209 2 210 2.216 2 217 2.218 2219 2 220 2s221 loprescopemeshl5xls 2m222 makintosh rubber sheet 2s223 malecote catheter 2830.32 2|224 marocel 225 mayo vein strippe 2 226 2.227 medicawf&ao1r7l metallic acheostomy tube 30, 32.34 2228 micropore 2l229p miph gun 2 230 moxi flozenie ( vigamox ) 2 231 mucus extractor sterile 2232 2.233 2.234 nasal cannula adult nasal dressing pack nasal oxygen set. twin bore all sizes adult ( details in rc ) 2.235 2.236 nasal oxygen set, twin bore all sizes paediatrics_ ( details_in_rc ) nasal packing 4.5cms 400409 2.237 2.238 2.239 nasal packing 8 cms 400402 nasal packing 8cms airway 400405 nasal prong 2240 nebulization kit 2241 nebulization mask 2.242 nebulizer machine 2.243 neck line 2.244 neonatal urine collecttine .__e_ bag 2.245 neonataldisposable ventilator circuits with dispos humidifier ____ chamber 2246 neotamic enema 2.247 i mask 2.248 non absorbable surgical suture. sterulised needled uonofilament polypropylene blue size 1 ( 112 cir rb heavy 40mm, _______ length 90 cm ) 2.249 non absorbable surgical suture. sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cit reverse cutting, 45 ______ mm needle_length_1o0_cm ) 2.250 non absorbable surgical suture. sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm _______ length 90 cm ) 2.25 1 non absorbable surgical engtn u cii’ ) ? 2.251 non absorbable surgical suture. sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double_arm 2.252 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3i8cir rb 16 mm needle, length.70_cm ) 2.253 non absorbable surgical suture.sterilised needled monofilament polypropylene blue size 7 / 0 ( 3!8cir rb double 8mm needle. length 60 cm ) 2 254 non absorbable surgical suture .sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade 2 255 cuig needle 15mm length 7ocm ) ns 2 ltr glass bottle2 25s orthoroll 50gm 2257 oxygen hood 2 258 oxyqen mask ( adult ) 2259 2l260 oxygen recovery kit 2 261 oxygen regulator 2 262 paper adhesive plaster 1 inch x 9 0 mts twith cutter ) non woven adhesive tape — / 2 263 paper adhesive plaster 2 inch x 9 0 mts with cutter ) non woven adhesive tape 2 264 paper adheswve plaster 3 inch x 9 0 mts ( with cutter ) non woven adhesive tape’ 2265 pencil cautry 2 266 perfusion set ( lnfus’on set ) with airway and needle ( paediatric use ) ( detais in rc ) 1 2 267 perifencal ___ catheter ( pediatrics ) l 2ocm.12fr [ 2 268 picc line 24.26.28 fr plain sheet large 2 269 2 2 270 271 plain sheet spwall? plaster of pares ndajeiocm x 2 7mts 2 272 ___e___ plaster of pans bandage 15cm x 2.7 mts / roll 2 273 plastic transparent sheet 2 2 274 275 plater of pans powder 50 kg polypropylene nonabsorbable synthetic surgical mesh 15 am x 15 cm 2 276 2 277 polypropylene nonabsorbable synthetic surgical mesh 76cm x 15cm or 7n5cm x l5cma 2 278 pouch arm sling — 2 279 povdone iodine scrub solution i cleansing solution 7 5 o / o w / v povidone iodine ( suitable for hand wash ) 2 280 ppe kit 2 281 prmicamhpicc line 28mr 2 28l premicath p1cc line 28fr 2 282j premicatm p1cc lias no a6 and 28 2t2b3 pressure monitoring line 7 high pressure ____ ion linejdetaiisinr ) c — 2284 provox i 2 285 puiso%ymeter 2 286 red rubber catheter size 8 10.12 hir aesi vbtiag adult 1 lt 77s re ervoir bag adult 1 5 lt 1i respirpometer romovac set 14116 no. jf2.292 rubber eiaminaiion glovei.siie medium — ( details in rc ) _________ —— [ 2.293 rubber examinaiion glovessize siail ( details in rc ) r shoes cover ryles tube i nasogastric tube size: io ( details in rc ) ry%es tube i nasognstric tube size: 12 ( details in rc ) tube i nasogastric tube size: 16 [ detads in rc ) yles iube i nasognstric tube size: 18 inrc ) ryles tube i nasogastric tube size:14 l ( details in rc ) 2.300 s.s.g knife ( dawn blade ) skin graft knife blade ( sterile ) & handle ( details in rc ) 2.301 saniiary napiin beitieas ( deiaiis in rc ) — 2.302 sanitary pads belt type ( details ml — 2.303 sanitizer 2.304 spvlon 100 ml 1bg z 2305 scalp vein set ( disposable ) . ( details in rc ) 2.306 scaln vein set ( disposabie ) size 20e ( details ifl rc ) 2.307 scalp vein set ( disposable ) size 22e . ( details in rc ) 2.308 scalp vein set ( disposable ) size 24 g ( details in rc ) immobilizer 7’ 7 7 2.309 shoulder eye blade 2.310 side port 2.311 silk suture 40&30 with cutier 2.312 silling dress 2.313 2.323 steriie cathhteter, single use, for urinary drainage ( foley balloon catheter ) , 2 waysizel8 ( detalls in rc ) 2314 skin stapler 6 / / 2.315 skin traction set diclofenac — 2.316 slow diclofenac tablets bp i sodium extended release tablets usp 100 mg ( sustained release ) y diclofenac prolonged.release.tablet.ip.10omg 2.317 sono jelly 2.318 spinal needle all sizes 2.319 stapes piston size 2.320 0.6mm ( teflon ) stayfree pad 2.321 sterile catheter for urinary drainage ( foley balloon catheter ) , 2 way, size 10 ( details in rc ) 2 322 sterile catheter for urinary drainage ( foley balloon catheter ) . 2 way, size 18 ( detailsiinc ) c ) 2 324 1 sterde disposable ( single use ) teflon! ptfe iv. cannula without port size 24g ______ ( details in rc ) 2.325 sterile disposable ( single use ) tefloniptfe l.v cannula with integrated 3 way stop cock size 16g sterile disposable perfusion set with airway and needle ( adult use ) ( details in rc ) steriie disposable spinal neeale for single use. 22g x 3 112 inch ( details in rc ) 1 rncahie sninal needle for 2326 sterile disposable ( single use ) teflon!ptfe iv. cannula with integrated 3 way stop cocksize 20 g ( details in rc ) 2.327 sterile disposable ( single use ) teflon!ptfe iv. cannula with integrated 3 way stop cock.size 22g ( details in rc ) 2.328 sterile disposable ( single usetefion i ptfe l.v. cannula with integrated 3 way 2.329 stop cock. ) size 18g ( details in rc ) sterile disposable infusion set wiih microdrip ( lv. ) ( details in rc ) 2330 2.331 ‘ .r 1 2.332 steriie disposable spinal needie for single use. 2sg x 3 112 inch ( details in _______rc ) 2.333 sterile gauze 2.334 sterile hypodermic syringe with needie attached, 22g, single use 10 l ml ( deeails in ec ) 2.335 sterile hypodermic syringe rith needie attached, 22g. single use 20 ml ( details in rc ) 2.336 sieriie hypodermic syringe wiah needle attached. 24g. single use 2 ml ( details inrc ) 2.337 sierile hypodemmic syringe with needie attached, 24g. single use 5 mi ( details inrc ) 338 sterile swab .339 sterilited umbilical cotion tage widih 3 _ mm. length_75.cm ( details.in_rc ) 2340 sieruium 500 ml 2s341 stokinet 1.5m’8 2.343 streptakiflase injection 15 lac uniis 2.344 tylet 2.345 ucciflyichoiinm i. ip 50 mg / mi ( iv use ) 2.346 scction catheier, steriie, size: f g 10? — ( details in rt ) iu.. . 2 347 suction catheter, sterile size: f gs12: ( details in rc ) — 2.348 suction catheter, steriie. size: f g 14 jdetails in rc ) — 2 349 suction catheter, steriie size: f ( 3 16 jdetails in rc ) / 2 350 suction caiheter, sterile. size: f ( 3 18 jdeta its in rc ) 351 suction cathmter, stenile. size: f ( 3 20 ( details in rcj suction catheter. sterile size: f ( 322? — jdetads in rc ) 2.367 suti pan 2.365. surgical surgical cap disposable ( for ons ) ( details in rc surgical cap, disposable ( for nurses ) tails in rc ) ( details in rc surgical mask 2368 suture 1oo ( ethylene ) 2.369nirsuture 8 0 ( ethylene ) suture needies curved 1 / 2 cirele round bod, assorted siee 11 1 s ( details in rc ) suture needies curved 1 / 2 circle round body assorted size 1c5gdetails in rc ) suture needles curved 112 circle round body assorted siee 16 20 ( details inrc ) suture needies curved 1i2 circle round body assorted size 6 1o ( details in rc ) — suture needles curved and cutting 1 / 2 circle cuig size 6 1o ( details in rc ) suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) suture needles cunved and cutting 1 / 2 circle size 16 20 ( details in rc ) suture needles curved and cutting size 1 5 ( details in rc ) 2.370 2.371 2.372 2373 2.374 2.375 2.376 2.377 n 95 2.378 swine flu mask 2.379 tpiece 2.380 t tube 10 no. 2381 ttube 12nos 2 382 t tube 14 no. 2.382? ttube14nno.? 2 383 tegaderm 2 384 three way adaptor 2 385 thumb spica 2386 2.387 thumb support torp.porpseptoplast ( splints ) f .tieiiàmy tube ( pvc ) , cuffed aii sizes ( detals n rc ) t390 tracheostomy tube, piain all _____ _ sizes ( details in rc ) urine collecting bag for new born ipaediatnc urine collection bag, capacity looml ( details in rc ) _____ee____ 2.389 , tracheostomy tube ( portex with cuff 7.7.5.8 ) 2.391 trop t kit 2.392 tungestonburrroto8 2.393 turp set 2 394 umbilical catheter for new born, all sizes ( details in rc ) 2.395’ umbilical cord clamp ( details in rc ) g / 2.396 , tijmblical catheter all size , 2.397 underwater seal drain 2.398 universal sholderimmulizer 2.399 upt kit 2.400 iuuit1i iljeldii iini r’%ejd 2.401 urine collecting bag, disposable 2000 ml ( details in rc ) 2.402 urine container sterile 2.403 urine ketone test strip 2.404 urine pot 2.405 uroflow meter 2.406 vaccumesucction tube 2.407 vaporizer machine 2.408 vein 0 line 10 cm 2.409 vein 0 line 150 cm 2.410 ventilator circuit 2.411 zommed grommet 2.412 octopus three way 2.413 octopus two way 2.414 dettol 200ml soap liquid 2 414 dettol 200ml soap liquid __e_ handwash 2n415 leaderflex long line 2.416 bionectar 2417 ventilator circuit pedia with heat wire 2.418 c pap bubble circuit 2419 humedified high flow nasal cannula circuit 2420 hhfnc optiflow red — hhfnc optiflow yellow 2.421 2422 hhfnc opt1flow blue 2 423 ecg electrode infant pedl 2.424 suction connection tube mask) (non mask) i 2437 nrbm pedia(non rebreathing mask) 2 438 oropharyngeai. airway 2 439 hme filter bacterial 2 440 hme filter viral 2441 kangaro care sling bag soflene adhesije tape 2.442 2443 intercostal drainage tube 24no 2.444 intercostal dralnage tube 28n0. 2445 intercostal drainage bag cannula fixator flexometalic et tube 6 to 7.5 cuffed 2446 2 447 2 448 mls et tube 5,5 5 cuffed 2 449 maggile forcap 2450 neb t kit2450 neb t kt 2451 close suction set 2.452 north pole et tube 6 to85 cuffed 2453 south pole et tube 6 to 8.5 cuffed 2454 proceal lma 3.0 2.455 proceal lma4.0 2456 proceal lma5 0 2457 classic lma 1 to 5 no 2 458 pop bandage 6inch 2 459 2 460 2 461 pop bandage 4 inch synthehc cast bandage 4 inch synthetic cast bandage 5 inch 2.462 synthetic cast bandage 3 inch 2.463 softroll 4 inch 2.472 skin traction kit kid skin traction kit dunlop 2.464p sofftroll 6 inch 2.465r compressed cotton roll for plaster 4 inch 2.466 compressed cotton roi for plaster 6 inch 2.467 iodine impregnated incise drape small around 1510 2468 iodine impregnated incise drape medium around 2020d 2,469 — iodine imppregnatedincise drape large 20 30 2.470 iodine impregnate incise drape around 30r40d 2.471 skin traction set adults 2.473 — 2.486 glucometer caresens 2.487 glucometer caresens strip 2.488 glucometer accu sure 2.489 glucometer accu sure strip 2.490 bp instrument 2.491 laproscopewarsher 1omm,5mm ports 2.492 0 miph stapler ipom mesh — nitrpous regulator — eto gas regulatorr — eto packing roll 10cm eto packing roii 20cm eto packing roll 30cm 2.493 2.494 2.495 2.496 2.497 2.498 — amino acid bagtorparentral nutrition(parentral vein urobag with 2.502 forgat’i’ catheter sô1enseatprobe1aproscopic atable for eticon device ic probe(compatable for eticon device 5mm 1.aproscopic brii 3.000 3. 5 fluorouracic inj 25oigi5ml? — 3.002 cetyicystine solubon usp (injection) 200 mglml 3.003 actrpid intravenous intusionl ip 250mg pcyciovir intravenous in,usiofl adenosanle 6mg/2ml inj. adrenaline injection ipimgiml 3008 i klamine in:i albumi 20% alpha beta artether inj amnikaon mnl ip 10omga imip250mge amikacrn in ip 500 mg — yliinle inj ii iinovmn 100ml 3.010 10% .011 iinovein 250 3.018 amsodarone hydrochloride inj 50 mglml 3.019 amoxicillin and potassium clavulanate injipl.2gm 3.020 amoxiciflin arid potassium clavulanic ip inj 600mg 3.021 amphoteriricin b 50mg 3.022 ampicillin injection ip 500 mg 3023 aq.diclofenac sodium inj(dynapar aq) 3024 ..‘ atesunate injection 60 mg (i.m. i.v.use) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injedtion ip 5 dio wlv (iml ampoule),sodium chloride injection ip — 3.025 i i 0.9oio wlv (5ml ampoule) artracil 2.5 ml inj 3.033 1bieomycin 15 unit lnj. 3.026 arv 3.027 atropine sulphate injection ip 0.6 mg /ml (sciimiiv use) 3.028 betamethasone sod phoslnj ip 4mg/mi 3029 bhcg 10000 iu inj. 3.030 bhcg 2000 iu lnlj. 3.031 b hcg 5000 iu lnj 3.032 biphasic isophane insulin inj 1p (30 % soluble insulin and 70 % isophane insulin) inj. 40 iu/ml(r dna origin) 3.034 botroclot inj j 3.035 botrophase inj. 3.038 3039 3.040 3.041 3.042 3.043 3.044 3.045 3.046 3.047 — 3048 3 049 ,, — ..i . li . • bupivacaine lnj ip 05% butadol 1 ml inj. caffeine citrate inj calcium gluconate inj ip 10% (iv use) carbolic acid 50oml bottle carboplatin 15omg carboplatin 450mg carboplatin injection 150 mg carboplatin injection 450 mg — carboprost tromethamine injection each ml contains carboprost 0.25 mg/mi carpinol inj cefipime 250mg cefoperazone and sulbactum for inj (cefoperazone sodium eq.to nnurei .w ifvnun n — n a — i —. ‘ gentamycin injection pp 8orngi2ml (im/ iv use) ______________ _____ glargin gluteraldehyde solution 2% 3.111 3.112 3.113 3.114 giycopyrrolate + neostrogeminllfli usp 0.2 mg/ml / . , 3.115 3.116 glycopyrrolate inj usp 0.2 mg/mi i.__ loperidol 3.117 hepann sodium inj ip 5000 lu/mi (im!iv use) ,—‘ 3.118 hepatitis a (havanx i biovac a) 3.119c hepatitis b iml 3 120 hepatitis b immunoglotonhis 100 iu 3 121 hepatitis b(hbig) 3.122 heplock / 3 123 human albumin inj 100ml human anti d immunogiobulin lnjection v —u— ,,ha — .1• 3.124 f 3141 solyte p 500 glass bomtle 3.142 isoprenafine injection ip 2mg i ml 3:143 kcl 3.144 ketamine lnj ip 50 mg!ml l 3.145 tabntalol hci lnj ip 2omgi4ml / v3.146 lantus insuiin 3.147 l.asparaginlase lnj 10000 iu 3.148 leucovarin 15mg 3.149 levitiracetams 3.150 levo bupivacaine 3.151 levofloxacin iooml 3.152 lignocaine and adrenaline lnj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.o1 mg ____.__ 3139k iso p forte 10% 3.140 isolyte p 10% v / 3.154 lignocaifle hcl 2% ltij. 3.155 linazolid 300ml 3.156 3.157 lorazepalm 3.158 lorazepam inj 2mg 3.159e lox +adr inj 3.160 lox4%topical 3.161 lox spray 3.162 loxicard 2 °%injd 3.163 loxicardr2%50rml? isolyte p 10% magnesium sulphate lnj 50mg/mi (5o% wfv) — 31 3 165 3.166 mannitohnjip2o%w/v100ml 2 o 3.167 mannitol with glycerin injection 10 olo+ lultiple electrolytes and dextrose injection type iii ip elecaroylte m chon(iv mv1 inj 3188 myoril(thiocolchicosi t189 n.s 045% 500ml nai.oxone litroglycerin lrij 5 mmgi ml 180 1 mixtard igiii0mrl1fli 3182 mmr (tersivac) ni 3 184 mucus extractor sterie(detalts in multiple electrolytes ant dextrose injection type i ip (electnolyte p ii noradrenalinle injection 3 193 pgnoprazoe1nfj 40 mg raminiwiz75m9mi? 3216 hf_nobarbionem 3217 phenytoir injecliol’ somg!mi 18 pilocarpineinli 3219 piperacalln • tazobactum for injection usp 4gm+50on’ pneumococcai (syflfloflxjprevflav) polidoconol pemetrexed 10omg 220 3 221 3223 pralidoxime chloride injection ip 2s 3224 prochlorperazone 5mg 225 piogeiterone lnj 200 mgi 2m1? — 3 226 promethazifle lnj ip 25mg/mi 3 227 propofol ivnj ip 10 mg/mi 3228 ouinine dihydrochloride inj 300 mgi mtc r mm___ 3 229 r 1 500 ml glass 3230 3231 rabies vaccine human ip 2.5 iu ranitdne hcl injection ip 50mgrmio 3232 ringer aceiate injs50omi (giass bottiej 3233 ringer lactate 500ml(rl) 3.234 rituximab 100mg inj 3235 rituxiv: h 32s ropvaca;necñs % 20 ml — — pcm injection injection inj d 15 etc ...

Medical And Health Services - Rajasthan

31913247 supply of chemicals reagents consumable items for department of pathology anti b ( sera ) anti d ( sera ) sodium metabisulfite capillary tubes _ g6pd kit ( 12 tests ) ocutt blood kit coombs anti sera cover slip ( 18x18mm ) .__ dxposible nediles ( 24cuage ) disposible neoiues ( 22guage ) disposibue sterile urine comawer_ esr_oispoxable pipette glass marker pencil jsb stain i jsb stain ii ketone strips — — 1.ancets leishman’s stain micro glass slides microscope bulb cedar wood oil anti a ( sera ) ie thmnea? 26 ridh&e 27 reticulocyte stain semen diluting rluid 29 sodium citrate 3.2% 30 sodium citrate 3.8x 31 thermnlparllomm? 32 thermal paper 8o mm 33 thermalpaper57mm — 34 small test tube plastic small test tube glass 36. tips ( 1o04o0o11l ) 37 tips ( 10 2ooi.l ) 38 tissue paper roll — 39 torniguate ( cloth ) 4o urine multi sttips 41 urine strips for alt 42 vacutainer edta vial _ 43 vacutainer sodium citrate 3.2 % vial 44 wbc diluting fluid 45 new improved neubaur counting chamber having silver coated 9 mm 2 ruled area giemsa stain liquid carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.......__.__._ e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid ._________________!carbol fucihsin _______._ _______._____ cover slip ( 22xso ) _______..__. diamond pencil __________..__. ? distilled water _._._________.___.. dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi.. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid !carbol fucihsin cover slip ( 22xso ) diamond pencil distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lomi. e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid _!carbol fucihsin _ cover slip ( 22xso ) diamond pencil . ? distilled water . dpx mount ethanol .. a filter paper 460x570 mm methanol normal saline aluminium potassium sulphate 59 dodecehydrate 60 sodium lodate j 61 potassium ferrocyanide 62 myeioperoxidase l 63 disposable syringes 2ml l 64 disposable syringes sm1 rl65 disposable syringes lo e66 jjdispnsable syrrnges 20m1 [ _ 67 j cotton roll 1_.68.jpetrid!ipspu!! [ 69 jjmrnd seritiser 48 49 50 51 53 54 55 56 papanicolou ready to use kit 57 hematoxiline powder 58 glacial acetic acid hand sanitizer i ., 7o dic counter ( 8ditfrential miii ) fl acetk acid 72 acetone 73 acid fuschifl 74 acid periodic 75 activated charcoal 76 alicine blue 77 akjminftumchlo 78 mumoumhydx!h 7 ammoniun solution tliouid ammonlia 80 aniline blue 81 basic fuchsinl 82 benzidinle powder 83 biebrich scarlet — 84 brilliant cresyl blue 85 carmine power 86 celestine blue 87 chloral hvdrate 88 citric acid concentrated hcl 91 egg albumin flake 92 eosin yellow stain powder ferric ammonium sulphate ( ammonium 93 iron sulphate ) 94 ferric chloride gold chloride haematoxyline crystal hydrochloric acid ar hydrogen peroxide light green malt diastase mercuric oxide metanil yellow murcuri chloride 109 neutral red 110 nitric acid 111 nuclear fast red 112 numbering paper . 113 oxalic acid ______ _ 114 paraffin wax with ( ceresin 60 62 c ) ______ 115 peanut oil i 103 104 105 106 107 methylene blue _______ microtome blade ( low profile ) 108 9s rorman ( forrnaidehyde3 , _. _ congo red 89 90 fl6 e ? 117 phosphomolybuc acid 118 phosphotuflgstic acid .._________ i19. picric acid 120 plastic ring for block (white) 121 potassium oichromte 122 potassium hydroxi — 123 potassium metabisulphit 124 potassium permagnate 12s propaflolol — 126 readymade giemsanstanf 127 rosanilinle dye (for shiff reagent) 128 silver nitrate 135 tetrazollum chlorlde 136 toludine blue 137 xylene — 138 139 rapid pap stain kit disposable gloves sterile 140 disposable gloves unsteriliged 141 non speciheesterase kit 142 bovine albumin_22% 129 sodium nitropruside 13o sodium hydroxide 131 sodium sulphate — 132. sodium thiosuiphate 133 sudan black b 134 sulfurous acid_ ...

Medical And Health Services - Rajasthan

31874581 lab regents kits & other item hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Medical Health And Family Welfare - Rajasthan

31871865 laboratory reagent kits and other materials laboratory reagent kits and other materials , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 500gm , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , reagan lwe medium himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler medium base himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 500gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific 500gm , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific 300 , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 500 , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , metaloop sl himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , mbl esbl himedia / bd / oxoid / thermo fisher scientific , esbl multi himedia / bd / oxoid / thermo fisher scientific , steam indicator tape himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 38x200mm, 50 / pk himedia / bd / oxoid / thermo fisher scientific , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific , plasticine himedia / bd / oxoid / thermo fisher scientific , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 500ml , ‘sq’ potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500gm , ‘sq’ hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific , ‘sq’ charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500gm , spore strips ( 25 strips / pack ) himedia / bd / oxoid / thermo fisher scientific , sterile membrane syringe filters all size himedia / bd / oxoid / thermo fisher scientific , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 2 lts. , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 2 lts. , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 2 lts. , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 2 lts. , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 2 lts. , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2 lts. , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , 120 ml capacity glass bottle with alluminium cap himedia / bd / oxoid / thermo fisher scientific , felix tube himedia / bd / oxoid / thermo fisher scientific , dreyers tube himedia / bd / oxoid / thermo fisher scientific , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , alluminium racks 4*12 all size tubes himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , metal loops holder himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap.12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tubewithout rim, glass cap. 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific , antibiotics himedia / bd / oxoid / thermo fisher scientific , bacitracin disc 10 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , bile esculin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , novobiocin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , optochin disc, ( 50 discs / vl ) himedia / bd / oxoid / thermo fisher scientific , ampicillin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ampicillin / sulbactam ( 10 / 10 mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amikacin disc30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , amoxycillin+ clavulanic acid ( 20 / 10 mcg ) ( amoxyclav 30mcg ) , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , aztreonam disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , azithromycin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefixime disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftazidime + clavulanic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cetriaxone disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalexin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefachlor disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefamadmandole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefazoline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefdinir disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefmetazole disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefonicid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoparazone disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefotetan disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefprozil disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ceftizoxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefuroxime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephalothine disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cephotaxime ( cefotaxime ) disc 30 mcg, 5x100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromicine disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc 2 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , colistin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , co trimoxazole disc 25 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , furazolidonedisc 50 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , kannamimycine disc 30 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefepime disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , chloramphenicol disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ciprofloxacin disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefoxitin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cotrimoxazole disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , doxycyline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , erythromycin disc 15 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , gentamycin disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , imipenam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , linezolid disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , levofloxacine disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , lomefloxacine disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , methicilline disc 5 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mezlocilline disc 5 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , mecillinam disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenem disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nitrofurantoin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nafcilin disc 1 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , netilmicin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , norfloxacin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , oxacilline disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ofloxacin disc , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , penicilline g disc 10 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin disc 100 mcg, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , piperacillin tazobactum disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , quinupristine – dalfopristin disc 15 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , sulfisoxazole disc 300 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline disc 75 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , ticarcilline + clavulanic acid disc 85 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , teicoplanin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tetracycline disc 30 mcg , 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , tobramycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , vancomycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , meropenam disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , cefpodoxime, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clarithromycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , clindamycin disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , polymyxin b 300 units disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , nalidixic acid disc, 5 x 100 disc himedia / bd / oxoid / thermo fisher scientific , swabs cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific maximum pack size , wooden applicator sticks himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, polystyrene shaft, cotton tip individually himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, wooden shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , plain swab in round tube, polystyrene shaft, cotton tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, plain media, polystyrene shaft, himedia / bd / oxoid / thermo fisher scientific maximum pack size , viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , amies transport swab, charcoal media, polystyrene himedia / bd / oxoid / thermo fisher scientific maximum pack size , shaft, viscose tip himedia / bd / oxoid / thermo fisher scientific maximum pack size , environmental swabs himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax foam tip sampling swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , enviromax pre moistened samplig swab sterile himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 4ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , esk 10ml neutralising buffer swab himedia / bd / oxoid / thermo fisher scientific maximum pack size , petri dishes loops and spreaders himedia / bd / oxoid / thermo fisher scientific , 90mm triple vent himedia / bd / oxoid / thermo fisher scientific , 55mm triple vent himedia / bd / oxoid / thermo fisher scientific , contact plate 65 x 16mm himedia / bd / oxoid / thermo fisher scientific , 120mm x 120mm square, vented himedia / bd / oxoid / thermo fisher scientific , 140mm triple vent himedia / bd / oxoid / thermo fisher scientific , 1ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 10ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 5ul shortie loop himedia / bd / oxoid / thermo fisher scientific , 1ul loop packs himedia / bd / oxoid / thermo fisher scientific , 10ul loop packs himedia / bd / oxoid / thermo fisher scientific , l shaped spreaders in packs himedia / bd / oxoid / thermo fisher scientific , blue spreaders in packs himedia / bd / oxoid / thermo fisher scientific , ‘u’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘f’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , ‘v’ well microtitration plate himedia / bd / oxoid / thermo fisher scientific , lid for microtitre plates himedia / bd / oxoid / thermo fisher scientific , large containers ( 24 hour urine ) and sweetie jars himedia / bd / oxoid / thermo fisher scientific , 2 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 2.5 litre 24 hour urine collection, labelled himedia / bd / oxoid / thermo fisher scientific , 2.7 litre graduated pe container himedia / bd / oxoid / thermo fisher scientific , 5 litre 24 hour urine container himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, small himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, small pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap, large pet himedia / bd / oxoid / thermo fisher scientific , sweet jar with cap & label, large himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 250ml snap top bucket and lid himedia / bd / oxoid / thermo fisher scientific , 500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 1000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 2500ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 5000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 10000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , 20000ml snap top bucket himedia / bd / oxoid / thermo fisher scientific , containers himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with plain label himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, with boric acid himedia / bd / oxoid / thermo fisher scientific , 7ml bijou container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with label flow seal himedia / bd / oxoid / thermo fisher scientific , 30ml universal, plain label himedia / bd / oxoid / thermo fisher scientific , 30ml universal with spoon, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, no label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, printed label himedia / bd / oxoid / thermo fisher scientific , 30ml universal, with boric acid, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, no label himedia / bd / oxoid / thermo fisher scientific , 60ml clear plastic cap, with printed label himedia / bd / oxoid / thermo fisher scientific , 60ml container blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml container dark blue p / p screw cap plain label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, no label himedia / bd / oxoid / thermo fisher scientific , 60ml plastic cap container, plain label himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 60ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 100ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 125ml container dark blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container blue, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container natural, screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 125ml container screw cap with spoon, plain label himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 150ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 160ml container with spoon himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 200ml container blue p / p screw cap, plain label himedia / bd / oxoid / thermo fisher scientific , 200ml container natural p / p screw cap, no label himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, printed label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, no label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 250ml metal cap container, plain label, tray wrapped himedia / bd / oxoid / thermo fisher scientific , 200ml container, no label himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp himedia / bd / oxoid / thermo fisher scientific , 30ml dippa sampler with handle pp / pp blue himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 100ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp himedia / bd / oxoid / thermo fisher scientific , 250ml dippa sampler with handle ps / pp blue himedia / bd / oxoid / thermo fisher scientific , 500ml sodium thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 1000ml sodium, thiosulphate bottle himedia / bd / oxoid / thermo fisher scientific , 500ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 1000ml sample bottle plain label himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container with thiosulphate himedia / bd / oxoid / thermo fisher scientific , 500ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , 1000ml wide mouth container himedia / bd / oxoid / thermo fisher scientific , test tubes polystyrene and polypropylene himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 70 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 150 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 55 x 11mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 12mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 75 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 13mm, round bottom himedia / bd / oxoid / thermo fisher scientific , 100 x 16mm, round bottom himedia / bd / oxoid / thermo fisher scientific , cap to fit 11mm diameter tube himedia / bd / oxoid / thermo fisher scientific , cap to fit 12mm diameter tube himedia / bd / oxoid / thermo fisher scientific , plug tight cap to fit 13mm diameter tube himedia / bd / oxoid / thermo fisher scientific , re caps to fit 13mm tube himedia / bd / oxoid / thermo fisher scientific , 13mm hanging vacutainer insert flat bottom. himedia / bd / oxoid / thermo fisher scientific , 12ml conical base himedia / bd / oxoid / thermo fisher scientific , 16 x 100 conical tube himedia / bd / oxoid / thermo fisher scientific , centrifuge tubes himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap ( racked ) himedia / bd / oxoid / thermo fisher scientific , 15ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 15ml conical with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap himedia / bd / oxoid / thermo fisher scientific , 50ml graduated with screw cap ( self standing ) himedia / bd / oxoid / thermo fisher scientific , 4.5ml pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile pack himedia / bd / oxoid / thermo fisher scientific , 1ml pasteur, plastic graduated sterile ind. wrap. himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile ind. wrap himedia / bd / oxoid / thermo fisher scientific , 5ml pasteur pipette, graduated himedia / bd / oxoid / thermo fisher scientific , 7ml pasteur pipette, jumbo himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur, plastic graduated sterile pack of 20 200062 500 pe s himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette 210002 500 pe ns himedia / bd / oxoid / thermo fisher scientific , 1.0ml micro fine tip, pasteur pipette 210003 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3.0ml micro tip, pasteur pipette 210004 250 pe ns himedia / bd / oxoid / thermo fisher scientific , 2.5ml pasteur pipette 210006 400 pe ns himedia / bd / oxoid / thermo fisher scientific , 3ml fine tip, pasteur pipette, ind. wrapped himedia / bd / oxoid / thermo fisher scientific , 1ml micro tip pasteur pipette himedia / bd / oxoid / thermo fisher scientific , 3ml pasteur pipette, peel pack himedia / bd / oxoid / thermo fisher scientific , serological pipettes himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 1ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 2ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 5ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , 10ml. open end, bulk wrap himedia / bd / oxoid / thermo fisher scientific , 25ml. taper jet, single wrap himedia / bd / oxoid / thermo fisher scientific , pipette tips himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul eppendorf ( racked ) himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , yellow pipette tip 5 200ul ( racked ) 199620 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul himedia / bd / oxoid / thermo fisher scientific , blue pipette tip 100 1000ul ( racked ) 10 x 96 pp ns himedia / bd / oxoid / thermo fisher scientific , white slim pipette tip 5 200ul himedia / bd / oxoid / thermo fisher scientific , blue slim line tip 200 1000ul himedia / bd / oxoid / thermo fisher scientific , white macro pipette tip 5000ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , white micro crystal tip 0.5 10ul himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml himedia / bd / oxoid / thermo fisher scientific , natural pipette tip 1000 5000ml universal himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables gloves cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , powder free / small ( 6 7 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / medium ( 7 8 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free / large ( 8 9 ) latex ns himedia / bd / oxoid / thermo fisher scientific , powder free, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, small ( 6 7 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, medium ( 7 8 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , powder free, easy stretch, white, large ( 8 9 ) nitrile ns himedia / bd / oxoid / thermo fisher scientific , plastic bags / zip lock bags himedia / bd / oxoid / thermo fisher scientific , 55 x 55 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 60 x 80 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 70 x 100 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 80 x 120 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 100 x 150 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 110 x 110 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 120 x 180 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 150 x 220 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 200 x 300 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 250 x 330 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , 300 x 400 x 0.05mm himedia / bd / oxoid / thermo fisher scientific , microcentrifuge tubes himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 0.5ml himedia / bd / oxoid / thermo fisher scientific , microtube 1.2ml ( strips of 8 ) himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml clear himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml flat top himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml twist lock himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml yellow himedia / bd / oxoid / thermo fisher scientific , microtube 1.5ml green himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml himedia / bd / oxoid / thermo fisher scientific , microtube 2.0ml flat cap himedia / bd / oxoid / thermo fisher scientific , screw cap microtubes and cryovials himedia / bd / oxoid / thermo fisher scientific , 2ml skirted microtube without cap himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, natural himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, white himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, orange himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, red himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, blue himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, green himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, yellow himedia / bd / oxoid / thermo fisher scientific , screw cap with o ring, black himedia / bd / oxoid / thermo fisher scientific , 1.2ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 2.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , 5.0ml cryovial storage to 190 c himedia / bd / oxoid / thermo fisher scientific , essential microbiology consumables himedia / bd / oxoid / thermo fisher scientific , scoops and weigh boats cat. ref. case qty material sterility himedia / bd / oxoid / thermo fisher scientific , 5ml white diamond, 41 x 41 x 8mm himedia / bd / oxoid / thermo fisher scientific , 30ml white diamond, 89 x 89 x 25mm himedia / bd / oxoid / thermo fisher scientific , 100ml white diamond, 140 x 140 x 22mm himedia / bd / oxoid / thermo fisher scientific , 10ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 25ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , 100ml measuring scoop himedia / bd / oxoid / thermo fisher scientific , microscope slides and cover slips himedia / bd / oxoid / thermo fisher scientific , white superfrost slides blue superfrost slides himedia / bd / oxoid / thermo fisher scientific , plain slide cut edge himedia / bd / oxoid / thermo fisher scientific , plain slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide ground edge twin frosted slide ground edge himedia / bd / oxoid / thermo fisher scientific , twin frosted slide cetiglass pure glass 76x26x1mm himedia / bd / oxoid / thermo fisher scientific , cover slip 18x18 himedia / bd / oxoid / thermo fisher scientific , cover slip 20x20 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x22 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 22x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x24 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x50 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x32 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x36 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x40 himedia / bd / oxoid / thermo fisher scientific , cover slip 24x60 himedia / bd / oxoid / thermo fisher scientific , slide mailer himedia / bd / oxoid / thermo fisher scientific , slide box 25 himedia / bd / oxoid / thermo fisher scientific , slide box 50 himedia / bd / oxoid / thermo fisher scientific , slide box 100 himedia / bd / oxoid / thermo fisher scientific , autoclave bags and paper products himedia / bd / oxoid / thermo fisher scientific , autoclave bags 310 x 660mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 400 x 700mm, high temp. himedia / bd / oxoid / thermo fisher scientific , autoclave bags 600 x 780mm, high temp. himedia / bd / oxoid / thermo fisher scientific , yellow clinical waste bags 30 x 39 himedia / bd / oxoid / thermo fisher scientific , ethylene oxide gas tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , dry heat ( pou pinel ) tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , autoclave tape 19mm x 50m himedia / bd / oxoid / thermo fisher scientific , specimen bag, 5½? x 6? x 8½? himedia / bd / oxoid / thermo fisher scientific , specimen bag, printed biohazard himedia / bd / oxoid / thermo fisher scientific , absorbent benchcoat 50cm x 50 meters himedia / bd / oxoid / thermo fisher scientific , 10 inch hygiene rolls 2 ply, white himedia / bd / oxoid / thermo fisher scientific , c fold 1 ply, green himedia / bd / oxoid / thermo fisher scientific , medical wipes 2 ply, white himedia / bd / oxoid / thermo fisher scientific , post lip paper / slide blotting paper himedia / bd / oxoid / thermo fisher scientific , absorbent bench paper sheets himedia / bd / oxoid / thermo fisher scientific , filter paper 50x50cm himedia / bd / oxoid / thermo fisher scientific , alkaline saline peptone water ( aspw ) himedia / bd / oxoid / thermo fisher scientific 500gm , alternative thioglycollate medium ( nih thioglycollate broth ) ( thioglycollate broth, alternative ) himedia / bd / oxoid / thermo fisher scientific 500gm , amies transport medium w / charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , agar medium m ( triple sugar, iron agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , columbia blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , cooked meat medium ( revised as cooked m medium ) ( r.c.medium ) himedia / bd / oxoid / thermo fisher scientific 500gm , hoyle medium base himedia / bd / oxoid / thermo fisher scientific 500gm , potassium tellurite 3.5% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , loeffler serum medium base with supplements himedia / bd / oxoid / thermo fisher scientific 500gm , horse serum donor herd gamma irradiated sterile filtered himedia / bd / oxoid / thermo fisher scientific 100ml , macconkey hiveg™ agar w / cv, nacl, 0.003% nr and 1.5% agar himedia / bd / oxoid / thermo fisher scientific 500gm , mycoplasma agar base ( pplo agar base ) himedia / bd / oxoid / thermo fisher scientific 100gm , mycoplasma enrichment supplement himedia / bd / oxoid / thermo fisher scientific , nutrient broth w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar w / 1% peptone himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar, 1.5% himedia / bd / oxoid / thermo fisher scientific 500gm , peptone water himedia / bd / oxoid / thermo fisher scientific 500gm , pyrazinamidase agar himedia / bd / oxoid / thermo fisher scientific 500gm , selenite f broth ( twin pack ) medium 11 ( in accordance with ip 2007 ) himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium w / o methylene blue with charcoal himedia / bd / oxoid / thermo fisher scientific 500gm , tellurite blood agar base himedia / bd / oxoid / thermo fisher scientific 500gm , haemoglobin powder himedia / bd / oxoid / thermo fisher scientific 100gm , vitamino growth supplement ( twin pack ) himedia / bd / oxoid / thermo fisher scientific , potassium tellurite 1% ( 1 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , transport charcoal medium himedia / bd / oxoid / thermo fisher scientific 500gm , transport liquid medium himedia / bd / oxoid / thermo fisher scientific 500gm , stuart transport medium ( transport medium, stuart ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , field’s tryptic digest broth ( tryptic digest broth ) himedia / bd / oxoid / thermo fisher scientific 500gm , tryptone tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , tinsdale agar base himedia / bd / oxoid / thermo fisher scientific 500gm , diphtheria virulence supplement ( part a & b ) himedia / bd / oxoid / thermo fisher scientific 500gm , lugol’s iodine himedia / bd / oxoid / thermo fisher scientific 500ml , grams iodine, stabilized himedia / bd / oxoid / thermo fisher scientific 500ml , methylene blue ( aqueous ) himedia / bd / oxoid / thermo fisher scientific 500ml , safranin, 0.5% w / v himedia / bd / oxoid / thermo fisher scientific 500ml , gram’s crystal violet himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain a himedia / bd / oxoid / thermo fisher scientific 500ml , albert’s stain b himedia / bd / oxoid / thermo fisher scientific 500ml , grams decolourizer himedia / bd / oxoid / thermo fisher scientific 2x500ml , labolene neutral ph himedia / bd / oxoid / thermo fisher scientific 500 ml , dpx mountant ( for microscopy ) himedia / bd / oxoid / thermo fisher scientific 250 ml , potassium hydroxide pellets himedia / bd / oxoid / thermo fisher scientific 500 gm , hydrogen peroxide solution 30% w / v ( 100 volumes ) himedia / bd / oxoid / thermo fisher scientific 500 ml , charcoal powder activated 250 mb himedia / bd / oxoid / thermo fisher scientific 500 gm , kline concavity slides 8 concavities thickness : 3 mm, size : 75 x 56 mm himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium capneutral glass, autoclavable. himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific 1x100 no , makarthy tube, aluminium cap with silicon rubber gasket, flat bottomvol. : 20ml, dim. : f 28x85mm, 1.0 1.2mm, thick wall himedia / bd / oxoid / thermo fisher scientific 1x100 no , nylon syring filter 13 mm pore size 0.2?m sterile himedia / bd / oxoid / thermo fisher scientific 100x1 no , cellulose nitrate membrane with hydrophobic edge, sterile, diameter: 47mm, pore size: 0.45?, individually packed himedia / bd / oxoid / thermo fisher scientific 100x1 no , metal loops holder himedia / bd / oxoid / thermo fisher scientific 1x8 no , metaloop sl himedia / bd / oxoid / thermo fisher scientific 1x8 no , steam indicator tape himedia / bd / oxoid / thermo fisher scientific 1 no , geobacillus stearothermophilus himedia / bd / oxoid / thermo fisher scientific 1x25 no , bottles, reagent, graduated with screw cap and pouring ring, 100ml himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap. 250ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, size, 100x17 himedia / bd / oxoid / thermo fisher scientific , test tube racks double tire ss ø 13mm x 48 holes ( 4 x 12 ) himedia / bd / oxoid / thermo fisher scientific , blotting papers sheet 46x57cm himedia / bd / oxoid / thermo fisher scientific sheet , pointed foceps 6 / 4 himedia / bd / oxoid / thermo fisher scientific , magnifying glass / hand lens dia 3 himedia / bd / oxoid / thermo fisher scientific , glycerol broth 16% v / v himedia / bd / oxoid / thermo fisher scientific 500ml , table lamp himedia / bd / oxoid / thermo fisher scientific , sterile swabs himedia / bd / oxoid / thermo fisher scientific 1x500 no , cled agar medium himedia / bd / oxoid / thermo fisher scientific 500gm , autoclavable glass bottles with alluminium caps himedia / bd / oxoid / thermo fisher scientific 120 ml capacity , autoclavable rubber gloves himedia / bd / oxoid / thermo fisher scientific , all size test tube brush himedia / bd / oxoid / thermo fisher scientific , anaerobic system mark v himedia / bd / oxoid / thermo fisher scientific , triclogel in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , steriswift™ disinfectant wipes size: 7” x 7” himedia / bd / oxoid / thermo fisher scientific , bactrex™ plus himedia / bd / oxoid / thermo fisher scientific , wash bottle; capacity500ml himedia / bd / oxoid / thermo fisher scientific , cystine tellurite agar base himedia / bd / oxoid / thermo fisher scientific 500gm , bovine serum albumin himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ latex test kit himedia / bd / oxoid / thermo fisher scientific , potassium tellurite, hi lr™ himedia / bd / oxoid / thermo fisher scientific 100gm , hiculture™ transport swabs w / amies medium ( b ) himedia / bd / oxoid / thermo fisher scientific 1x50nos , hiculture™ transport swabs w / dey engley neutralizing broth himedia / bd / oxoid / thermo fisher scientific 1x50nos , anaero box – s transparent unbreakable polycarbonate box, size : 19.8cms x 13.7cms x 9cms, capacity : 2.5 litre, accessories required but not provided. anaerogas pack 1.5 litre ( le002f ) 1 no & anaero indicator tablet ( le065 ) . himedia / bd / oxoid / thermo fisher scientific 1 no , thumb press dispensing dropper / pasteur pipettes, sterile total volume upto 3 ml, available in individual sterile pack. himedia / bd / oxoid / thermo fisher scientific , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 90 mm, diameter x 15 mm. himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab himedia / bd / oxoid / thermo fisher scientific , sterile pure viscose swab himedia / bd / oxoid / thermo fisher scientific , spray bottles 500ml himedia / bd / oxoid / thermo fisher scientific , microtips racks box of all size himedia / bd / oxoid / thermo fisher scientific , macconkey agar w / o cv w / 0.15% bile salt himedia / bd / oxoid / thermo fisher scientific 500gm , nutrient agar himedia / bd / oxoid / thermo fisher scientific 500gm , ss agar ( salmonella shigella agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , mueller hinton agar himedia / bd / oxoid / thermo fisher scientific 500gm , cary blair medium base ( transport medium w / o charcoal ) himedia / bd / oxoid / thermo fisher scientific 500gm , triple sugar iron agar himedia / bd / oxoid / thermo fisher scientific 500gm , mannitol salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , urea agar base ( christensen ) ( autoclavable ) himedia / bd / oxoid / thermo fisher scientific 500gm , simmons citrate agar himedia / bd / oxoid / thermo fisher scientific 500gm , bile salt agar himedia / bd / oxoid / thermo fisher scientific 500gm , xylose lysine deoxycholate agar ( xld agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , tcbs agar himedia / bd / oxoid / thermo fisher scientific 500gm , deoxycholate citrate agar ( agar medium j ) himedia / bd / oxoid / thermo fisher scientific 500gm , brain heart infusion broth himedia / bd / oxoid / thermo fisher scientific 500gm , peptone, bacteriological himedia / bd / oxoid / thermo fisher scientific 500gm , sorbitol agar ( macconkey sorbitol agar ) himedia / bd / oxoid / thermo fisher scientific 500gm , sabouraud dextrose agar himedia / bd / oxoid / thermo fisher scientific 500gm , glucose broth himedia / bd / oxoid / thermo fisher scientific 500gm , tryptic soya agar himedia / bd / oxoid / thermo fisher scientific 500gm , bordet gengou agar base with supllements himedia / bd / oxoid / thermo fisher scientific 500gm , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100ml , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100ml , ‘sq’ acetone himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific , gram stains kit himedia / bd / oxoid / thermo fisher scientific , albert`s metachromatic stains kit himedia / bd / oxoid / thermo fisher scientific , ‘sq’ phenol ( carbolic acid ) himedia / bd / oxoid / thermo fisher scientific , spirit himedia / bd / oxoid / thermo fisher scientific 5 lts , ethanol, absolute himedia / bd / oxoid / thermo fisher scientific 5 lts , antibiotics disc positive himedia / bd / oxoid / thermo fisher scientific , antibiotics disc negative himedia / bd / oxoid / thermo fisher scientific , metaloop ss 4* fixed nichrome loop embedded in ss rod with heat resistant handle, with 4 mm diameter, calibrated to 0.01ml. himedia / bd / oxoid / thermo fisher scientific , nicrome wire ( resistance wire ) 100gm himedia / bd / oxoid / thermo fisher scientific , spirit lamp himedia / bd / oxoid / thermo fisher scientific , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , aluminium foil himedia / bd / oxoid / thermo fisher scientific , plain slides himedia / bd / oxoid / thermo fisher scientific pkt , cover slip size 18mm round himedia / bd / oxoid / thermo fisher scientific pkt , grooves glass slides himedia / bd / oxoid / thermo fisher scientific , bhi supplemented w / 0.05% spsä himedia / bd / oxoid / thermo fisher scientific , conical flask erlenmeyer cap.500ml himedia / bd / oxoid / thermo fisher scientific , petri dish culture, s line size, 80x15 himedia / bd / oxoid / thermo fisher scientific pair , glass measuring cylinder, cap. 250ml himedia / bd / oxoid / thermo fisher scientific , glass measuring cylinder, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 12x75mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 15x125mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , test tube with rim size 18x150mm, 100 / pk himedia / bd / oxoid / thermo fisher scientific , surgical gloves, 100 / pk himedia / bd / oxoid / thermo fisher scientific , micro tips 10 100?l, 1000 / pk, yellow himedia / bd / oxoid / thermo fisher scientific , micro tips 100 1000?l, 500 / pk, blue himedia / bd / oxoid / thermo fisher scientific , plastic beaker 500 ml, pvc himedia / bd / oxoid / thermo fisher scientific , glass beaker, cap. 500ml himedia / bd / oxoid / thermo fisher scientific , sterile disposable petri plates* polystyrene, optically clear size : 100 mm diameter x 15 mm, individually packed. himedia / bd / oxoid / thermo fisher scientific 1x100 no , labolene neutral ph ( soap solution ) , for glassware washing himedia / bd / oxoid / thermo fisher scientific 500 ml , phindicator papers full range ( ph 1.0 to 14.0 ) himedia / bd / oxoid / thermo fisher scientific 10 bks , distill water himedia / bd / oxoid / thermo fisher scientific 10 lit , micropipette 100* capacity : 10 to 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 1000* capacity : 100 to 1000 ?l himedia / bd / oxoid / thermo fisher scientific , micropipette 10 capacity : 0.5 to 10 ?l himedia / bd / oxoid / thermo fisher scientific , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) himedia / bd / oxoid / thermo fisher scientific , disposable masks himedia / bd / oxoid / thermo fisher scientific , bloting paper himedia / bd / oxoid / thermo fisher scientific , filter paper size 12.5cm circule himedia / bd / oxoid / thermo fisher scientific pkt , serological test for typhoid himedia / bd / oxoid / thermo fisher scientific , zn acid fast stains himedia / bd / oxoid / thermo fisher scientific , ‘sq’ sulphuric acid himedia / bd / oxoid / thermo fisher scientific 500 ml , giemsa’s stain himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ formaldehyde solution 37 41% w / v himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hypochlorite solution ( available chlorine 4% w / v approx. ) himedia / bd / oxoid / thermo fisher scientific 5 lit , funnels, plain , size 50mm himedia / bd / oxoid / thermo fisher scientific , funnels, plain , size 75mm himedia / bd / oxoid / thermo fisher scientific , pestle & mortar himedia / bd / oxoid / thermo fisher scientific , ‘sq’ acetic acid glacial himedia / bd / oxoid / thermo fisher scientific 500 ml , methylene blue aqueous stain solution himedia / bd / oxoid / thermo fisher scientific 500 ml , staining rods / staining tray / slide tray himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( o ) antigen himedia / bd / oxoid / thermo fisher scientific , salmonella polyvalent somatic ( h ) antigen himedia / bd / oxoid / thermo fisher scientific , test tubes stand, pvc himedia / bd / oxoid / thermo fisher scientific , glassware for measuring himedia / bd / oxoid / thermo fisher scientific , forceps 5 himedia / bd / oxoid / thermo fisher scientific , tranport container himedia / bd / oxoid / thermo fisher scientific , hidispotm bag 10* clear, transparent autoclavable disposable bag, size : 10” ( h ) x 6” ( b ) , maximum weight holding capacity: 0.5 kg, multiple packing of 50 bags, recommended for disposal of pathological / clinical or contaminated material and also for sterilization of glasswares or plasticwares. himedia / bd / oxoid / thermo fisher scientific 1x500no , thermometer room himedia / bd / oxoid / thermo fisher scientific , lable book with sticker himedia / bd / oxoid / thermo fisher scientific pkt , cotton roll 500gm himedia / bd / oxoid / thermo fisher scientific roll , diamond marker pens himedia / bd / oxoid / thermo fisher scientific , marker himedia / bd / oxoid / thermo fisher scientific , mccartney bottle w / aluminium cap, neutral glass, autoclavable. ( 100 pc ) himedia / bd / oxoid / thermo fisher scientific 1x100 no , durham tubes neutral glass, autoclavable; length : 25mm 27mm, diameter : 6 7mm. himedia / bd / oxoid / thermo fisher scientific 1x100 no , ‘sq’ liquid paraffin ( light ) himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ liquid paraffin ( heavy ) himedia / bd / oxoid / thermo fisher scientific 500 ml , test tube brush himedia / bd / oxoid / thermo fisher scientific , bottle brush himedia / bd / oxoid / thermo fisher scientific , triclogel* in 100 ml bottle himedia / bd / oxoid / thermo fisher scientific , mrvp test reagent himedia / bd / oxoid / thermo fisher scientific , beef extract powder bacteriological mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , brilliant green stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , bromo cresol green indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , bromo cresol purple indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo phenol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , bromo thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , carbol fuchsin, practical grade himedia / bd / oxoid / thermo fisher scientific 100 gm , carmine staining powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ chloroform himedia / bd / oxoid / thermo fisher scientific 2.5 lit , cresol red indicator powder himedia / bd / oxoid / thermo fisher scientific 5 gm , ‘sq’ m cresol himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ diethyl ether himedia / bd / oxoid / thermo fisher scientific 2.5 lit , eosin yellow staining powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , eosin stain solution ( 2% w / v ) himedia / bd / oxoid / thermo fisher scientific 125 ml , fuchsin acid staining powder ( acid fuchsin ) himedia / bd / oxoid / thermo fisher scientific 5 gm , fuchsin basic staining powder ( basic fuchsin ) himedia / bd / oxoid / thermo fisher scientific 25 gm , gentian violet powder himedia / bd / oxoid / thermo fisher scientific 25 gm , giemsa’s staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , gram’s iodine stain solution himedia / bd / oxoid / thermo fisher scientific 125 ml , ‘sq’ iodine resublimed himedia / bd / oxoid / thermo fisher scientific 100 gm , litmus blue indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , litmus red indicator papers himedia / bd / oxoid / thermo fisher scientific 10 bks , malachite green staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ mannitol himedia / bd / oxoid / thermo fisher scientific 500 gm , nessler’s reagent ( for ammonia ) himedia / bd / oxoid / thermo fisher scientific 100 ml , leishman’s stain powder himedia / bd / oxoid / thermo fisher scientific 25 gm , phenol red indicator powder ( water soluble ) himedia / bd / oxoid / thermo fisher scientific 25 gm , phenolphthalein indicator powder himedia / bd / oxoid / thermo fisher scientific 100 gm , phenolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125ml , phosphotungstic acid ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ potassium iodide himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ potassium oxalate monohydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ iso propyl alcohol ( propan 2 ol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , safranine staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , sodium chloride exclar himedia / bd / oxoid / thermo fisher scientific 500 gm , ‘sq’ sodium hydroxide flakes himedia / bd / oxoid / thermo fisher scientific 500 gm , thymol blue indicator powder himedia / bd / oxoid / thermo fisher scientific 25 gm , thymol blue indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , thymolphthalein indicator solution himedia / bd / oxoid / thermo fisher scientific 125 ml , tryptone ( bacteriological ) mediaid himedia / bd / oxoid / thermo fisher scientific 500 gm , wright’s stain, hi cert himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ xylene sulphur free himedia / bd / oxoid / thermo fisher scientific 500 ml , ‘sq’ zinc sulphate heptahydrate himedia / bd / oxoid / thermo fisher scientific 500 gm , methylene blue staining powder himedia / bd / oxoid / thermo fisher scientific 25 gm , ‘sq’ hydrochloric acid himedia / bd / oxoid / thermo fisher scientific 2.5 lit , ‘sq’ amyl alcohol ( iso amyl alcohol ) himedia / bd / oxoid / thermo fisher scientific 2.5 lit , n, n, n’, n’ tetramethyl p phenylenediamine dihydrochloride himedia / bd / oxoid / thermo fisher scientific 5 gm , p dimethyl amino benzaldehyde ( ehrlich’s reagent ) ‘excelar’ himedia / bd / oxoid / thermo fisher scientific 100 gm , kovacs’ indole reagent himedia / bd / oxoid / thermo fisher scientific 100 ml , hidispotm bag 10* himedia / bd / oxoid / thermo fisher scientific 250 no. , gordon mcleod reagent ( oxidase reagent ) himedia / bd / oxoid / thermo fisher scientific 100 ml , micropippete multichannel ( 8 channel ) variable, range 10 100 ?l himedia / bd / oxoid / thermo fisher scientific , micropippete multichannel ( 8 channel ) variable, range 30 300 ?l himedia / bd / oxoid / thermo fisher scientific , digital balance cap. 300gm, readability .01gm himedia / bd / oxoid / thermo fisher scientific , hot plate round 7.5 with energy regulator himedia / bd / oxoid / thermo fisher scientific , beakers pvc, cap. 1000ml, 4 / pk himedia / bd / oxoid / thermo fisher scientific , digital ph meter with electrode himedia / bd / oxoid / thermo fisher scientific , urea 40% ( 5 ml per vial ) himedia / bd / oxoid / thermo fisher scientific , calcium chloride anhydrous, hi ar™ himedia / bd / oxoid / thermo fisher scientific , h2s test medium ( water testing kit ) himedia / bd / oxoid / thermo fisher scientific , sterile cotton swab w / wooden stick, w / wooden stick, size : 150 mm x 2.5 mm, individually packed. ( 1x500no ) himedia / bd / oxoid / thermo fisher scientific , drinking water test kit ( pack of 100 tests ) himedia / bd / oxoid / thermo fisher scientific , salmonella species test kit ( pack of 5 tests ) himedia / bd / oxoid / thermo fisher scientific , dreyers tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , felix tubes, borosilicate glass, 100 / pk himedia / bd / oxoid / thermo fisher scientific , shigella antisera himedia / bd / oxoid / thermo fisher scientific , salmonella antisera himedia / bd / oxoid / thermo fisher scientific , vibrio antisera himedia / bd / oxoid / thermo fisher scientific , slides ( 76mmx26mmx0.95mm ) himedia / bd / oxoid / thermo fisher scientific , cover slip ( 18x18 mm ) himedia / bd / oxoid / thermo fisher scientific , loop holder himedia / bd / oxoid / thermo fisher scientific , loop ( 1 microlitre ) himedia / bd / oxoid / thermo fisher scientific , loop ( 10 microlitre ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with tube ) himedia / bd / oxoid / thermo fisher scientific , swab sticks ( with wooden stick ) himedia / bd / oxoid / thermo fisher scientific , straight wire himedia / bd / oxoid / thermo fisher scientific , borosil petri plates ( 100 mm ) himedia / bd / oxoid / thermo fisher scientific , test tubes ( 12x100 mm ) glass tubes himedia / bd / oxoid / thermo fisher scientific , sterile wide mouth containers ( 50 ml capacity ) uricol himedia / bd / oxoid / thermo fisher scientific , blotting paper himedia / bd / oxoid / thermo fisher scientific , 0.5 mcfarland standards himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , hiassorted™ biochemical test kit himedia / bd / oxoid / thermo fisher scientific , hivibrio™ identification kit himedia / bd / oxoid / thermo fisher scientific , hisalmonella™ identification kit himedia / bd / oxoid / thermo fisher scientific , himotility™ biochemical kit for salmonella himedia / bd / oxoid / thermo fisher scientific , nasco sampling bag himedia / bd / oxoid / thermo fisher scientific , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above test tubes 15 ml , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , burette borosilicate 50 ml , burette stands , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , petridishes, 15 x 90 mm borosilicate , universal bottles, 28 ml , mccartney bottles, 28 ml , funnels glass, diameter 100 mm, stem 50 mm , buchner flasks, 1 liter , beakers, borosilicate / pyrex, 1000 ml , beakers, borosilicate / pyrex, 500 ml , beakers, borosilicate / pyrex, 250 ml , beakers, borosilicate / pyrex, 2000 ml , conical flasks ( erlenmeyer ) , pyrex 100 ml , conical flasks ( erlenmeyer ) , pyrex 500 ml , conical flasks ( erlenmeyer ) , pyrex 1000 ml , conical flasks ( erlenmeyer ) , pyrex 2000 ml , volumetric flasks, grade a, 500 ml , volumetric flasks, grade a, 250 ml , volumetric flasks, grade a, 10 ml , pipettes, 1ml with 0.1 ml graduations grade a , pipettes, 2 ml with 0.1 ml graduations grade a , pipettes, 5 ml with 0.5 graduations grade a , pipettes, 10 ml with 1 ml graduations grade a , glass bottles with polypropylene ( autoclavable ) screw caps, 500 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 1000 ml , glass bottles with polypropylene ( autoclavable ) screw caps, 2000 ml , durham tubes 50 x 7.5 mm , cotton wool non absorbent , brilliant green broth , macconkey broth , eosin methylene blue , lactose broth , durham tubes 20x 7.5 mm , cotton wool non absorbent , measuring cylinders graduated, 10 ml , measuring cylinders graduated, 100ml , measuring cylinders graduated, 500 ml , measuring cylinders graduated, 1000 ml , test tubes without rim borosilicate, 15 x 150 mm , micro pipettes, 1ml with 0.1 ml graduations grade a , micro pipettes, 2 ml with 0.1 ml graduations grade a , micro pipettes, 5 ml with 0.5 graduations grade a , micro pipettes, 10 ml with 1 ml graduations grade a , test tubes without rim borosilicate, 25 x 150 mm , autoclavable caps for above test tubes , test tubes without rim borosilicate, 15 x 150 mm , autoclavable caps for above for all siz test tubes , test tubes without rim borosilicate, 12 x 150 mm , autoclavable caps for above test tubes , test tubes stand aluminium 12x4 holesrack , micropipette 100* capacity : 10 to 100 ?l , micropipette 1000* capacity : 100 to 1000 ?l , micropipette 10 capacity : 0.5 to 10 ?l , ?pet autoclavable micropipette 8 channel ( 20 200 ?l ) , temperature sensor digital , graduated glass pippetes from 0.10 ml to 25 ml capacity , petri plates warmer , co2 incubator , bod incubator , candle jar , mc intosh anaerobic jar with pellets , microbiology spillage kit , nitrile gloves , horse serum donor herd gamma irradiated sterile filtered , rabbit serum , supplements with tellurite , egg yolk tellurite emulsion , mc farland standard set , sodium hydroxide standard solution , silver nitrate solution , wright’s stain , geimsa stain , eosin , india ink , picric acid saturated / aqueous , lactophenol cotton blue , lactophenol picric acid , mayers mucicarmine stain , digital colony counter , hand lens with light , anaero bos system , anaerobic system with accessories , automatic loop sterilizer , coplin jar , tricogel hand sterilizer , parafilm , pasteur pippets plastic thumb dispensor , microtips racks box of all size , microtips 0.5 10 microlitre , microtips 1.0 20 microlitre , microtips 200 microlitre , microtips1000 microlitre , autoclavable micropippets 0.5 10 microlitre , autoclavable micropippets 5 50 microlitre , autoclavable micropippets 100 1000 microlitre , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 0.5 10 microlitre 08 channels , autoclavable micropippets 5 50 microlitre 08 channels , autoclavable micropippets 20 200 microlitre 08 channels , autoclavable petri platespolycarbonate, clear, transparent and unbreakable, size : 100 mm , borosil petri plates size : 100 mm , widal tube conical bottom , widal tube round bottom , water analysis kit spring clamp , water analysis kit with aceessories , test tube holder , test tube rack , test tube round bottom with caps 10ml , test tube stand alluminium / plastic 24 h , test tube stand alluminium / plastic 36 h , sulphuric acid 5 lts. , hydrocloric acid 5 lts. , glycerol , glycerine , glacial acetic acid , glacial acetate , serum vial sample storage box and stand 1*96 , serum vial sample tube with cap 2 ml capacity , antibiotics included in the who list of essential drugs , ampicillin , chloramphenicol , co trimoxazole ( sulfamethoxazole trimethoprim ) , erythromycin , gentamicin , nitrofurantoin , oxacillin , benzylpenicillin , piperacillin , sulfonamide , tetracycline ( or doxycycline ) , trimethoprim , reserved antibiotics , amikacin , ceftriaxone , cefuroxime , cefalotin , ciprofloxacin or other fluoquinolones , clindamycin , nalidixic acid , tobramycin , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stains , schaeffer & fulton’s spore stain a , schaeffer & fulton’s spore stain b , andrade’s indicator , bromocresol green indicator , bromocresol purple indicator , bromophenol blue indicator , bromothymol blue indicator , methyl orange indicator , methyl red indicator , neutral red indicator , phenolphthalein, 0.1% , w / v , phenol red indicator , thymol blue indicator , thymolphthalein indicator , universal indicator , mixed indicator solution ( 25x ) , capsule stains , capsule stains , methylene blue ( aqueous ) , nigrosin stain, 10% , w / v , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , fluorescent stains kit for mycobateria , phenolic auramine , potassium permanganate , dengue ns1 elisa , dengue igm elisa , hepatitis a igm elisa , hepatitis e igm elisa , scrub typhus igm elisa , chikungunya igm elisa , japanese encephalitis igm elisa , measles igm elisa , bordetella pertussis igm elisa , torch igm elisa , typhi dot igm elisa , diphtheria igm elisa , diphtheria igg elisa , leptospira igm elisa , torch igm rdt card , typhi dot igm rdt card , scrub typhus igm rdt card , chikungunya igm rdt card , leptospira igm rdt card , malaria ag / ab rdt card , filariasis igm rdt card , hbsag igm rdt card , hcv igm rdt card , brucellosis standard agglutination test igm latex agglutination test , rk39 kala azar igm rdt card , bacterial meningitis latex agglutination test igm latex agglutination test , salmonella: polyvalent o specific o group: 9, 12 ( d ) and vi specific o group: 4, 5 ( b ) specific h: d, i , shigella: polyvalent flexneri, polyvalent boydii, polyvalent dysenteriae, sonnei specific: anti shigella dysenteriae 1 ( shiga ) , vibrio cholerae: polyvalent 0:1 specific: ogawa, inaba , neisseria meningitidis: polyvalent and group specific: a, b, c , haemophilus influenzae: type b , ysc vkbzve , b.sugar god / pod 10 x 500 ml erba , b.urea ( berthelot ) 2 x 50 ml erba , s. cretinine ( kinetic ) 2 x 50 ml erba , s.bilirubin t&d 2 x 100 ml erba , sgot ( kinetic ) 20 x 50 ml erba , sgpt ( kinetic ) 20 x 50 ml erba , colestrol 2 x 50 ml erba , widal 4 x 5 ml , ra 50 t , aslo 50 t , crp 50 t , vdrl ( rp strip ) 1 x 100 stp , hb sag card 1 x 50 card , hcv 1 x 40 card , hiv rapid 1 x 40 card , hiv tri dot 1 x 100 t , anti a 1 x 10 ml , anti b 1 x 10 ml , anti d igg+igm monocolan 1 x 10 ml , anti ab 1 x 10 ml , weak d ( du ) 1 x 10 ml , ahg 1 x 10 ml , anti a1 1 x 10 ml , seurm bovine albumin 1 x 10 ml , uristi x s parameter 1 x 100 stp , multisti x 1 x 100 stp , coomb sera vail 1x10 ml , n / 10 hcl 1 x 500 mm , sodium citrate 3.8% 1 x 500 ml , lesmen stain 1 x 250 ml , lesmen powder 1 x 25 gm , tlc flude 1 x 500 ml , ceder wood oil 1 x 50 ml , pregnancy test rapid kit 1 x 100 card , jsb stain a 1 x 500 ml , jsb stain b 1 x 500 ml , sodium hypocloride 5 ltr can , xylene 1 x 500 ml , semen diluting fluid 100 ml , cpdbeg 350 ml , cpd beg 100 ml , distil water 1 x 5 ltr , micro tips 2 200 ul 1 x 1000 , micro tips 5 1000 ul 1 x 1000 , cover slip per pkt. , glass slide 1 x 50 , edta vail with screw cap ( k2 ) 1 x 100 , sodium cicrate tube for blood collection 1 x 100 , plane vail with screw cap 1 x 100 , urine collection container 1 x 100 , urine centrifugal vail 1 x 100 , esr tube glass each , state fax tube glass each , glass tube 10 ml each , tissue paper each , ph paper each , blood cell counter peutra 60 ct reageuts, chemicals, & vaccume tubes each , abx diluent , abx alphalyse , abx basolyse , abx eosinofix , abx cleaner , abx minoclear , edta vaccum tube for pentra 60 ct , blood cell counter 3part abx micros es60 reagent & chemical , abx minidil lmg 20 l , abx lyse bio 1 l , abx cleaner 1 l , minocal calibrator 2.0 ml , minotrol 16 twin pak ( 02l ) 2.5 ml , minotrol 16 twin pack ( 2n ) 2.5 ml , minotrol 16 twin pack ( 2h ) 2.5 ml , minoclair 0.5 ml , paper roll for abx micro es 60 , reagents for elisa reader , hiv elisa 1 x 100 t , hbs ag elisa 1 x 100 t , hcv alisa 1 x 100 t , vtm kit 1 x 50 tube , anti d igg + igm , tournicate , rubber ball for blood donner , tharmograph paper for , papper roll for sami auto analizer transasia , papper roll sami auto analizer gyro , papper roll automatic fully esr analizer transasia , projection lamp 6v20w for microscope each , fully auto analyzer model erbaxl 300 reageuts, chemicals & disposables system pack , albumin system pack erba , amylase system pack erba , bilirubin t&d system pack erba , urea system pack erba , cholestrol system pack erba , alkaline phosphate system pack erba , glucose system pack erba , s. creatinine system pack erba , calcium system pack erba , total protein system pack erba , triglyceride system pack erba , hdl cholestrol direct system pack erba , sgot system pack erba , sgpt system pack erba , chloride system pack erba , uric acid system pack erba , ck system pack erba , ckmb system pack erba , sample cup system pack erba , ggt system pack erba , ldl cholestrol with calibrator system pack erba , ldhp system pack erba , microprotein system pack erba , phosporus system pack erba , x l multical system pack erba , x l wash system pack erba , blood gas analizer regants regants phox plusl nova biomedical , calibration solution c 1 , calibration solution c 2 , fluid pack c 3 , fully automated biochemisty analayzer model biosystem a25 reagent chemical & disposal , amylase direct system pack biosystem , amylase pancreatin system pack biosystem , adenosine deaminase ( ada ) system pack biosystem , alanine aminotransferase ( alt / gpt ) system pack biosystem , albumin system pack biosystem , alkaline phosphatase ( alp ) amp system pack biosystem , alkaline phosphatase ( alp ) dea system pack biosystem , aspantate aminotransferase ( ast / got ) system pack biosystem , bilrubin ( direct ) system pack biosystem , bilrubin ( total ) system pack biosystem , calcum arsenazo system pack biosystem , cabon diooxide system pack biosystem , cholesterol system pack biosystem , cholesterol hdl direct system pack biosystem , cholesterol ldl direct system pack biosystem , crecatinine kinase ck system pack biosystem , creatinine kinase mb ( ck , mb ) system pack biosystem , creatinine system pack biosystem , glutamyl transferase ( y gt ) system pack biosystem , glucose system pack biosystem , iron ferrozine system pack biosystem , lactate dehydrogenase ldh system pack biosystem , lipase system pack biosystem , magnesium system pack biosystem , phosphorus system pack biosystem , protein total system pack biosystem , protein ( urine / csf ) system pack biosystem , total bile acid system pack biosystem , triglycerides system pack biosystem , urea / bun vv system pack biosystem , uric acid system pack biosystem , sample cup 1x1000 biosystem , washing solution 500 ml biosystem , r washing solution 500 ml biosystem , rotor 10x120 biosystem , conc. system liquid 1000 ml biosystem , halogen uv p lamp 1 unit biosystem , control level 1 5x5 ml biosystem , control level –ii 5x5 ml biosystem , calibrator 5x5 ml biosystem , urine analyzer strip , gluco strip sd cheek code 21 , gluco strip accuchek , gluco strip dr. marpirn , semi auto analizer regents , hemoglobino meter micro cuvette , edta vial k 3 double cap , fully auto analyser sample cube , micropipettes1 10 microliter each , micropipettes2 20 microliter each , micropipettes10 100 microliter each , micropipettes20 200 microliter each , micropipettes100 1000 microliter each , micropipettes fix10 microliter each , micropipettes fix 50 microliter each , micropipettes fix100 microliter each , micropipettes fix200 microliter each , micropipettes fix500 microliter each , westergreen stand , westergreen esr tube each , dengue test kit rapid igm / ns1 , chikungunia test , elisa for scrub typhus , igm & ns1 elisa for dengue , igm elisa for chikungunia , igm elisa for hepatitis a , igm elisa for hepatitis e , igm elisa for scrub typhus , igm elisa for japanese enaphalitis , typhl dot for typhoid , igm elisa for leptospirosis , t pal salution 5 ltr , trop – t test , printed paper for cbc5 part , printed paper for cbc3 part , seman diluent fluid 100 ml , fruity 200ml , hemotoxilin 500 ml , eosine 500ml , xyline 500 ml , acetone 500 ml , ethyle alchole 500 ml , dpx500 ml , cover slipe ( large size ) , geimsa stain 250 ml , coupline jar for slide stening...

Indian Army - Rajasthan

31765467 supply of eggs fresh at rms dholpur military station period from 01 may 2022 to 31 mar 2023 supply of eggs fresh at rms dholpur military station period from 01 may 2022 to 31 mar 2023 , egg fresh ( hen ) => limited...

National Institute Of Ayurveda - Rajasthan

31740943 rate contract for consumables, reagent chemicals and stains rate contract for consumables, reagent chemicals and stains , acetone ( himedia / sigma / biomerieux ) 500 ml , aliquot / eppendorf tube1.5 ml ( himedia / sigma / biomerieux ) 1 pack ( 200 aliquot ) , alternative thioglycollate medium ( himedia / sigma / biomerieux ) 500gm , amikacin ( himedia / sigma / biomerieux ) 1 vial , amoxytclav acid ( himedia / sigma / biomerieux ) 1 vial , ampicillin ( himedia / sigma / biomerieux ) 1 vial , aztreonam ( himedia / sigma / biomerieux ) 1 vial , bacillocid extra ( himedia / sigma / biomerieux ) 500 ml , bacitracin ( himedia / sigma / biomerieux ) 1 vial , bile esculin agar ( himedia / sigma / biomerieux ) 500gm , brain heart infusion ( bhi ) broth ( himedia / sigma / biomerieux ) 500gm , candida albicans 10231 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , candida krusei 14243 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , capillary tube ( himedia / sigma / biomerieux ) 1 pc , carbol fuschin strong ( himedia / sigma / biomerieux ) 500 ml , cedar wood oil ( himedia / sigma / biomerieux ) 50 ml , cefipime ( himedia / sigma / biomerieux ) 1 vial , cefixime ( himedia / sigma / biomerieux ) 1 vial , cefotaxime ( himedia / sigma / biomerieux ) 1 vial , cefoxiti ( himedia / sigma / biomerieux ) 1 vial , cefta + clav. acid ( himedia / sigma / biomerieux ) 1 vial , ceftazidime ( himedia / sigma / biomerieux ) 1 vial , ceftriaxone ( himedia / sigma / biomerieux ) 1 vial , cefuroxime ( himedia / sigma / biomerieux ) 1 vial , ciprofloxcin ( himedia / sigma / biomerieux ) 1 vial , citrate agar ( himedia / sigma / biomerieux ) 500gm , cled agar ( himedia / sigma / biomerieux ) 500gm , clindamycin ( himedia / sigma / biomerieux ) 1 vial , colistin ( himedia / sigma / biomerieux ) 1 vial , coplin jar ( himedia / sigma / biomerieux ) 1 jar , co trimoxazole ( himedia / sigma / biomerieux ) 1 vial , cotton roll ( himedia / sigma / biomerieux ) 1 roll ( 500 gm ) , coverslip 18 x 18 mm ( himedia / sigma / biomerieux ) 10 gm , coverslip 22 x 50 mm ( himedia / sigma / biomerieux ) 10gm , dis. petri plates 100mm ( himedia / sigma / biomerieux ) 1 box ( 500 plate ) , distilled water for microbiology ( himedia / sigma / biomerieux ) 5 litr , distilled water ordinary ( himedia / sigma / biomerieux ) 5 litr , doxycline ( himedia / sigma / biomerieux ) 1 vial , dpx mount ( himedia / sigma / biomerieux ) 250 ml , enterococcus faecalis 29212 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , eosin stain 2% ( himedia / sigma / biomerieux ) 125 ml , erythromycin ( himedia / sigma / biomerieux ) 1 vial , escheichia coli 25922 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , ferric chloride ( himedia / sigma / biomerieux ) 500 gm , forceps ( himedia / sigma / biomerieux ) 1 pc , fosfomycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin ( himedia / sigma / biomerieux ) 1 vial , gentamycin high level ( himedia / sigma / biomerieux ) 1 vial , geobacillus stearothermophilus strip ( himedia / sigma / biomerieux ) 1 strip , giemsa stain ( himedia / sigma / biomerieux ) 125 ml , glacial acetic acid ( himedia / sigma / biomerieux ) 5 litr , glass slides ( himedia / sigma / biomerieux ) 1 slide box ( 50 slides ) , gram crystal voilet ( himedia / sigma / biomerieux ) 500 ml , grams iodine ( himedia / sigma / biomerieux ) 500 ml , heamatoxylin ( himedia / sigma / biomerieux ) 125 ml , hydrogen peroxide 30% ( himedia / sigma / biomerieux ) 500 ml , imipenem ( himedia / sigma / biomerieux ) 1 vial , iso propyl alcohol 70% ( himedia / sigma / biomerieux ) 500 ml , iso propyl alcohol ( himedia / sigma / biomerieux ) 500 ml , klebsiella pneumoniae 700603 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , koh 20% ( himedia / sigma / biomerieux ) 500 ml , kovacs indole reagent ( himedia / sigma / biomerieux ) 125 ml , latex gloves 6.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , latex gloves 7.5 ( himedia / sigma / biomerieux ) 1 box ( 100 pairs ) , leishman stain ( himedia / sigma / biomerieux ) 500 ml , levofloxacin ( himedia / sigma / biomerieux ) 1 vial , linezolid ( himedia / sigma / biomerieux ) 1 vial , mac cartney bottle 30ml w / aluminium cap ( himedia / sigma / biomerieux ) 1 bottle , mac conkey agar ( himedia / sigma / biomerieux ) 500gm , metal loop holder ch 4 ( himedia / sigma / biomerieux ) 1 holder , methanol ( himedia / sigma / biomerieux ) 500 ml , methylene blue ( himedia / sigma / biomerieux ) 500 ml , methylene red indicator ( himedia / sigma / biomerieux ) 125 ml , mrvp media ( himedia / sigma / biomerieux ) 500gm , mueller hinton agar ( himedia / sigma / biomerieux ) 500 gm , multipurpose stand ( himedia / sigma / biomerieux ) 1 pcs , neubauer chamber counting ( himedia / sigma / biomerieux ) 1 pc , nihcrome loop ( d 4 ) diameter = 4mm ( himedia / sigma / biomerieux ) 1 loop , nihcrome loop d 1 ) diameter = 1.3mm ( himedia / sigma / biomerieux ) 1 loop , nitrofurantoin ( himedia / sigma / biomerieux ) 1 vial , norfloxacin ( himedia / sigma / biomerieux ) 1 vial , novabiocin ( himedia / sigma / biomerieux ) 1 vial , number 1 filter paper ( himedia / sigma / biomerieux ) 1 pkt , nutrient agar ( himedia / sigma / biomerieux ) 500gm , optochin ( himedia / sigma / biomerieux ) 1 vial , oxidase discs ( himedia / sigma / biomerieux ) 1 vial , penicillin g ( himedia / sigma / biomerieux ) 1 vial , phenylalanine agar ( himedia / sigma / biomerieux ) 500gm , ph litmus paper 2 to 10.5 ( himedia / sigma / biomerieux ) 1 pkt , pipera + tazo ( himedia / sigma / biomerieux ) 1 vial , piperacillin ( himedia / sigma / biomerieux ) 1 vial , pipette tips 1000 microlitre ( himedia / sigma / biomerieux ) 1000 nos , pipette tips 200 microlitre ( himedia / sigma / biomerieux ) 1000 nos , plastic bottle dropper ( himedia / sigma / biomerieux ) 1 bottle , polymyxin b ( himedia / sigma / biomerieux ) 1 vial , proteus vulgaris 49132 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , pseudomonas aeruginosa atcc 27853 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , reticulocyte count stain ( himedia / sigma / biomerieux ) 100ml , ria vials ( himedia / sigma / biomerieux ) 1 pack ( 100 vials ) , sabouraud dextrose agar ( himedia / sigma / biomerieux ) 500gm , safranine 0.5% ( himedia / sigma / biomerieux ) 500 ml , salmonella entrica 51812 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , selenite broth f ( himedia / sigma / biomerieux ) 100gm , semen diluting fluid ( himedia / sigma / biomerieux ) 125 ml , sim media ( himedia / sigma / biomerieux ) 500gm , slide staining rack cage ( himedia / sigma / biomerieux ) 1 rack cage , slide staining stand rod ( himedia / sigma / biomerieux ) 1 pcs , sodium hydroxide pellete ( himedia / sigma / biomerieux ) 500 gm , sodium hypochlorite 10 % ( himedia / sigma / biomerieux ) 500 ml , staphylococcus aureus 25923 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus epidermidis 12228 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus pyogenes 19615 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , staphylococcus saprophyticus baa 750 ( himedia / sigma / biomerieux ) 1 pkt ( 2 sticks ) , steam indicator tape ( himedia / sigma / biomerieux ) 1 roll , sterile cotton swab sticks ( himedia / sigma / biomerieux ) 1 pack ( 100 swab ) , sterile test tube with screw cap ( himedia / sigma / biomerieux ) 1 box ( 100 tubes ) , sterile urine container ( himedia / sigma / biomerieux ) 1pack ( 500 container ) , test tube stand ( himedia / sigma / biomerieux ) 1 stand , ticar + clav acid ( himedia / sigma / biomerieux ) 1 vial , tigecycline ( himedia / sigma / biomerieux ) 1 vial , tobramycin ( himedia / sigma / biomerieux ) 1 vial , triple suagr iron agar ( himedia / sigma / biomerieux ) 500gm , urea agar base ( himedia / sigma / biomerieux ) 500gm , urea solution 40% ( himedia / sigma / biomerieux ) 1 vl ( 5 ml ) , vancomycin ( himedia / sigma / biomerieux ) 1 vial , wash bottle 500ml ( himedia / sigma / biomerieux ) 1 bottle , wbc diluting fluid ( himedia / sigma / biomerieux ) 500 ml , xylene ( himedia / sigma / biomerieux ) 500 ml , xylose lysine deoxcycholate ( xld ) agar ( himedia / sigma / biomerieux ) 500 gm , dextrose ( anhydrous ) ( 500 gm ) , egg albumin flakes ( 500gm ) , liquid ammonia ( 500 ml ) , lancet ( 1 box ) ...

The Lalit - Rajasthan

31647659 supply of inndiann frunits & vegetables, english vegetables & imported fruits, chinese food & mushroom, milk & dairy products, poultry chicken, egg, mutton, fresh seafood, frozen seafood, meat cold cuts, imported cheese & indian cheese, indian grocery & provisions, imported grocery & provisions, frozen peas & corn, charcoal & firewood, fuel gel, candles, fresh flowers, industrial salt, garbage & butchery bags, general stationery, printing stationery, ice creams, chemicals, cleaning & general supply, paper supply and dry garbage disposal....