Medical Health And Family Welfare - Rajasthan

34202460 purchase of lab reagents medical equipments bundi , items , rbc fluid , wbc fluid , edta solution , n / 10 hcl , sodium citrate 3.8% , eosinophil count fluid , reticulocite fluid , afb stain , heam test , semen diluting fluid , platelete diluting fluid , lesman stain , gimsa stain , immersion oil , distill water , methanol , sodium hypo chloride , jsb stain 1 , jsb stain 2 , glass test tube 3 , glass test tube 4 , neubar chamber , hb meter round , hb meter squre , glass slide , cover glass slip 18 mm , cover glass slip 22 mm , timer electronic , urin container , test tube plastic 3 , test tube plastic 4 , sample collection vials , serum collection vials , k3 edta vials sc , k3 edta vials dc , clot activator sc , clot activator dc , yellow tips , blue tips , dropping bottle , washbottle , test tube stand 32 hole , turnicat belt , hb tube round , hb tube squre , bt ct tubes , test tube brush , tissue paper roll , esr stand ( e 5 ) , esr tube ( no. ) , esr tube ( without no ) , esr cup , syring 2 ml , syring 3 ml , syring 5 ml , niddle 24 no. , niddle 22 no. , hand gloves , triple layer face mask , mask n 95 , cotton , lancet , bp instrument mercuray , bp instrument digital , stetoscope , weight machine analoge , weight machine digital , baby weight machine analoge , baby weight machine digital , paules oximeter , nebuliser machine , stadiometer , height mesuring scale , anti abd , multi strips , uristix , hcg card , hiv rapid card , hbsag card , vdrl card , hcv card , dengu card ns1 combo , dengu card igg / igm , widal card igg / igm , malaria card antigen , rpr test , widal kit , aso kit , rf kit , crp kit , gluco meter , gluco strips , hbsag elisa , hb scale book starter pack , hb scale book strip , blood suger , blood urea , creatinine , billirubin total & direct , sgot ( colorimeter ) , sgot ( analyser ) , sgpt ( colorimeter ) , sgot ( analyser ) , alkaline phos , total protiens & albumin , trigyceride , cholestrol , hdl cholestrol , ldl cholestrol , uric acid , amylase , lipase , ck mb , ck nak , sodium kit , pottasium kit , calcium , chloride , x ray film 12x15 ( manual ) , x ray film 12x12 ( manual ) , x ray film 10x12 ( manual ) , x ray film 8x10 ( manual ) , x ray film 6.5x8.5 ( manual ) , di hl digital x ray film 8x10 fuji / care stream , di hl digital x ray film 10x12 fuji / care stream , di hl digital x ray film 11x14 fuji / care stream , x ray developer 13.5 ltr , x ray developer 9 ltr , x ray fixer 13.5 ltr , x ray fixer 9 ltr , ecg roll 50 mm ( 108 ) , ecg roll 50 mm ( 6108 ) , ecg roll 80 mm , sonogrphy jelly , ecg jelly , sonogrphy roll , printer roll 57x10 mm , digital hb meter cuvette , mindil lmg , abx lyse bio , abx cleaner , minoclair , minotrol 16 ( 2l ) , minotrol 16 ( 2n ) , minotrol 16 ( 2h ) , minocal calibrator , diluent 20 ltr , lyse 1 ltr , clener 1 lyr , microscope , centrifuge machine , slide stand , micropipet variable , slide try , cell counter ( manual ) , lens clining paper , filter paper , spirit 5 ltr , spirit lamp , hiv tridot , bio medical waste bag ( black, yellow, red ) in various size , bio medical waste bin 16 ltr , bio medical waste bin 32 ltr , smear for filaria , test for iodin in salt , water testing by strip method , needle destroyer manual ( hub cutter ) , needle destroyer electric , foetal doppler , vein detection pedatric , vein detection adult , bleching powder , sodium hypo chloride 10% , labour table , pancture proof container 5 ltr , pancture proof container 10 ltr , pancture proof container 15 ltr , mackintose , suction machine , bed side screen with curton , revolving stool 3 legs ss top , thermal fogging sprayer machine for outdoor , foot step , examination table , patients stool , thermometer , muac tape , nursing trolly , ambu bag , artery forceps , needle holder , needle holder , kidney tray , tourniquets , ot table , cbc machine 3 part , ecg machine 3 channel , carbol fuchine ( diacontent above 85% ) ( cdh ) , methyylen blue ( aiacontent above 85% ) , sulfuric acid 5 ltr , phenol pure ( carbolic acid ) , diamond marker , aramin ( o ) , flask 5ltr , parafilm m roll , reagent bottle 1000 ml , reagent bottle 2000 ml , reagent bottle 5000 ml , long droper , absulute alcohal ( ethanol 99.9 ) , basic fuchine 25 gm ( cdh ) , disposal gown...

Medical And Health Services - Rajasthan

33928760 supply of govt. hospital mch wing equipments & furniture weighing scale adult, examination table, foam mattress, iv stand, revolving stool, office table, single channel ecg machine, almirah steel. ...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam sterilization.able to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub types.it should have inbuilt quality control.it should have detection limit 0.5ng / ml / 0.1iu perml.it should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation preferably.it should be based on flow through technology.it must have a long shelf life & only in the form of card not in the form of strips.it should be approved and evaluated by nib.it should be short interpretation time not more than 3 to 5 minutes preferably.it should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per naco.is must have a long shelf life & only in the form of card not in the form of strips.it should be short inter preparation time 3 to 5 minutes preferably.it should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( cat.no.4471250 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( cat.no.4474009 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( cat.no.4474518 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( cat.no.4474519 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( cat.no.4474520 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( cat.no.4474521 ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( cat.no.a35907 ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( cat.no.a63881 ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( cat.no.q32854 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( cat.no.q32855 ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( cat.no.11754250 ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( cat.no.q32856 ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur pipettes.total volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical Health And Family Welfare - Rajasthan

33338089 mnjy xray ecg sonography consunble item supply in govt hospital nathdwara rajsamand mnjy xray ecg sonography consunble item supply in govt hospital nathdwara rajsamand , ultra sonography machine , ultra sonography jelly , sonography film roll sony japan [normal glossy 110 mm x 20 mtr] , x ray machine , x ray developer & fixer with hardnerto make 13.5 ltr. solution , developer & fixer 20 lt. pack for automatice film processer , x ray developer liquied & fixer liquied to make 25 ltr. solution [automatice film processer] , xray lead lead apron [0.5 mm pb] , xray lead lead barrier [2.5 mm pb led] three layar , x ray lead no. 0 to 9per packet , x ray lead no. r & l per packet , x ray film dental[per packet 200] , x ray film size (green base)kodak /fuji [per packets 50] , x ray film size (green base)kodak /fuji [per packets 50] , x ray film size (green base)kodak /fuji [per packets 50] , x ray film size (green base)kodak /fuji [per packets 50] , x ray hanger size (12 x 15 & 8 x 10) , crx ray film(fuji film) [per packets 150] , crx ray film(fuji film) [per packets 150] , crx ray film(fuji film) [per packets 150] , ecg machine , e.c.g.roll , e.c.g.roll , e.c.g.roll , e.c.g.jelly 250gm. , ecg bulb , ecg chest electrodes , disposable electrodes for e.c.g , e.c.g.paper roll for computerised e.c.g.(5 digit)...

Medical And Health Services - Rajasthan

33305597 supply of mnjy x ray, sonography, ecg, ct scan consumable item ultra sonography machine , ultra sonography jelly , sonography film roll , x ray machine x ray developer and fixer with hardener , developer and fixer for solution automatic film processor , x ray lead lead apron lead barrier , x ray lead no 0 to 9 r and l per packet , x ray film dental , x ray film , x ray hanger , cr x ray film , ecg machine ecg roll , ecg jelly ecg bulb , ecg chest electrodes , disposable electrodes for ecg , ecg paper roll for computerized ecg etc ...

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33294149 supply of anaesthesia equipment kit for ot anaesthesia equipment kit for ot , opd , operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268475 supply and installation of resuscitation kit for o.t’s and wards operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268179 supply and installation of miscellaneous items for opd and wards operation theatre table operation theatre light pedestal lights electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33268077 supply and installation of resuscitation kit operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

RAJASTHAN MEDICAL EDUCATION SOCIETY - Rajasthan

33264930 supply and installation of electrosurgical cautery unit ( operation theatre ) operation theatre table operation theatre light pedestal lights _____ electrosurgical cautery unit ( minor ot ) surgical instrument for minor operation sets autoclave wards. r;:ri1on invasive multipara monitors ecg machines defibrillator operation theatre operation theatre table operation theatre ceiling tight pedestal lights electrosurgical cautery unit pulse oximeter general sets including open lurulogical surgery ( 4 for each of ) surgery, diagnostic & operative laparoscope ‘lincluding one high definition with all accessories and hand instruments with c1stoscope& resectoscope video gastroscope and video colonoscope / sipnoidoscope? flexible video broiichoscoje c arm.imayeinlensiiier? ultrasonic rf visualization system for open surgery endotrainer flexible side viewing gastroduodespçforercpr opd x ray viewing box / lobby miscellaneous items for opd &wards suction machines for ots& wards resuscitation kit for o.tis & wards anaesthesia equipment ( kit ) for o.t, electro convulsive therapy ( ect ) machine with ecg & eeg monitoring eeg machine ect machine without monitor lithium anakzer bio feed back bio trainer ps cbolouicaltests_equipments a. ) projective tests b. ) lntelligence tests c. ) personaliy tests djneuro psychological tests * resuscitation kit repetitive trans magnetic stimulator ( rtms ) ....

Medical And Health Services - Rajasthan

33217094 supply of generic medicines and surgical items under bcmo dausa supply of medicine 1 halothane 2 isoflurane 3 ketamine injection 50 mg / ml 4 propofol injection 10 mg / ml 5 thiopentone injection 0.5 g 6 sevoflurane 7 liquid medical oxygen ( lmo ) 8 lignocaine ointment 5% 9 lignocaine gel ip 2% 10 lignocaine injection 2% 11 lignocaine and adrenaline injection 20mg + 0.01mg 12 lignocaine and dextrose injection 50mg + 75mg per ml 13 bupivacaine hydrochloride in dextrose injection 5mg + 80 mg per ml 14 bupivacaine injection 0.50% 15 atropine sulphate injection 0.6 mg / ml 16 midazolam injection ip 1 mg / ml 17 morphine sulphate injection ip 10 mg / ml 18 tramadol capsule 50 mg 19 tramadol injection 50 mg / ml 20 pentazocine injection 30 mg / ml 21 fentanyl citrate injection 50 mcg / ml 22 fentanyl citrate injection 50 mcg / ml 23 naproxen tablet ip 500 mg 24 naproxen tablet ip 250 mg 25 inj. butorphanol tartrate usp 1mg / ml 1ml size 26 aspirin tablet ip ( gastro resistant ) 150 mg 27 aceclofenac and paracetamol tablet 100 mg + 325 mg 28 diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% 29 diclofenac sodium and paracetamol tablet 50 + 325 mg 30 diclofenac sodium injection for im and iv 25 mg / ml 31 diclofenac sodium tablet 50 mg 32 diclofenac tablet ( sr ) 100 mg 33 etoricoxib tablet 90 mg 34 etoricoxib tablet ip 120 mg 35 ibuprofen and paracetamol tablet 400 mg + 325 mg 36 ibuprofen tablet 200 mg 37 ibuprofen tablet 400 mg 38 ibuprofen oral suspension 100 mg / 5ml 39 indomethacin capsule 25 mg 40 mefenamic acid tablet 500 mg 41 paracetamol drops 150 mg / ml 42 paracetamol syrup ip 125 mg / 5ml 43 paracetamol tablet 500 mg 44 paracetamol injection 150 mg / ml 45 inj diclofenac sodium aqueous 75mg / ml 1ml size, iv & im use 46 paracetamol infusion ip 1% w / v 100ml size 47 tab. ketorolac 10 mg 48 chlorzoxazone, diclofenac sodium & paracetamol tablet 250mg+50mg+325 mg 49 tab baclofen ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 50 tab tizanidine hydrochloride ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 51 allopurinol tablet 100 mg 52 hydroxychloroquine sulphate tablet 200 mg 53 leflunomide phosphate tablet 10 mg 54 leflunomide phosphate tablet 20 mg 55 sulfasalazine delayed release tablet 500 mg 56 betamethasone tablet 0.5 mg 57 betamethasone sodium phosphate injection 4 mg / ml packing size ( filled by bidder ) rate per unit ( without gst ) 3. drugs for gout & rheumatoid arthritis 4. antiallergics & drugs used in anaphylaxis 1. anaesthetics 1.1 general anaesthetics and oxygen 1.2 local anaesthetics .3 pre operative medication 2. analgesic, antipyretic & anti inflammatory drugs 58 dexamethasone injection 8 mg / 2ml 59 dexamethasone tablet 0.5 mg 60 hydrocortisone sodium succinate injection 100 mg base / vial 61 methyl prednisolone sodium succinate for injection 500 mg 62 prednisolone tablet 5 mg 63 prednisolone tablet 10 mg 64 prednisolone tablet 20 mg 65 tab dexamethasone ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 66 adrenaline injection 1 mg / ml 67 chlorpheniramine maleate tablet 4 mg 68 hydroxyzine tablet 25 mg 69 pheniramine injection 22.75 mg / ml 70 promethazine syrup ip 5 mg / 5ml 71 promethazine injection 25 mg / ml 72 promethazine tablet 25 mg 73 anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg / 5ml 74 cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg 75 cetirizine syrup 5 mg / ml 76 levoceitrizine tablet 5mg 77 montelukast 10 mg + levocetrizine 5mg tablet 78 naloxone injection ip 0.4 mg / ml 79 pralidoxime chloride injection 25 mg / ml 80 n acetylcystine injection 200 mg / ml 81 carbamazepine tablet 200 mg 82 carbamazepine tablet ip 100 mg 83 carbamazepine oral suspension usp 100 mg / 5 ml 84 phenobarbitone tablet 30 mg 85 phenobarbitone injection ip 200 mg / ml 86 phenytoin injection 50 mg / ml 87 phenytoin oral suspension 25 mg / ml 88 phenytoin tablet 100 mg 89 pregabalin capsule ip 75 mg 90 sodium valproate ip injection 100 mg / ml 91 sodium valproate tablet 200 mg 92 sodium valproate oral solution ip 200 mg / 5 ml 93 sodium valproate ( gastro resistant ) ip tablet 500 mg 94 clobazam tablet / capsule 5 mg 95 clobazam tablet / capsule 10 mg 96 levetiracetam tablet 500 mg 97 levetiracetam oral solution suspension 100 mg / ml 98 levetiracetam injection 500 mg / 5ml 99 gabapentine tablet / capsule 100 mg 100 gabapentine tablet / capsule 300 mg 101 tab lamotrigine ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) 102 tab divalproex extended release ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 103 tab oxcarbazepine ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 104 tab lacosamide 100 mg ( each film coated tablet contains lacosamide 100 mg ) 105 tab topiramate ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) 106 amikacin injection 100 mg 107 amikacin injection 250 mg 108 amikacin injection 500 mg 109 gentamycin injection 80 mg / 2ml 110 amoxycillin capsule 250 mg 111 amoxycillin capsule 500 mg 112 amoxycillin trihydrate dispersible tablet 125 mg 113 amoxycillin oral suspension ( dry syrup ) 125 mg / 5ml, 114 amoxycillin and cloxacillin capsule 250 mg + 250 mg 115 amoxycillin and potassium clavulanate tabs 500 mg + 125 mg 116 amoxicillin and clavulanic acid injection 600 mg 117 amoxicillin and potassium clavulanate injection 1.2 gm 118 amoxycillin & clavulanic acid syrup 200 mg + 28.5 mg / 5 ml 119 ampicillin capsule 500 mg 120 ampicillin injection ip 500 mg 121 benzathine benzylpenicillin injection ip12 lac units 122 benzathine benzylpenicillin injection 6 lac units 123 cloxacillin sodium injection 500 mg 124 piperacillin and tazobactum for injection 4 gm + 500 mg 125 tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 126 inj piperacillin 2 gm + tazobactom 250mg usp 127 cefepime injection 500 mg 128 cefixime tablet 100 mg 129 cefixime tablet 200 mg 130 cefixime oral susp ( drops ) 25 mg / ml 131 cefoperazone and sulbactum for injection 1 g + 0.5 g 132 cefotaxime injection 1 g 133 cefotaxime injection 250 mg 134 cefpodoxime dispersible tablet 50 mg 135 ceftazidime injection 1 g 136 ceftazidime injection 250 mg 137 ceftazidime injection 500 mg 138 ceftriaxone injection ip 1 g / vial 139 ceftriaxone injection 250 mg 140 ceftriaxone injection ip 500 mg / vial 141 cefuroxime tablet 250 mg 142 cephalexin capsule 250 mg 143 cephalexin capsule ip 500 mg 144 cephalexin oral suspension ( cephalexin dry syrup ) 125 mg / 5ml 145 cephalexin tablet ( dt ) 125 mg 146 inj. ceftriaxone 1 gm + tazobactum 1.25 gm 147 tab.cefadroxil 250 mg 148 tab.cefadroxil 500 mg 149 azithromycin tablet ( dt ) 100 mg 150 azithromycin tablet ip 250 mg 151 azithromycin tablet 500 mg 152 ciprofloxacin injection 200 mg / 100 ml 153 ciprofloxacin tablet 250 mg 154 ciprofloxacin tablet 500 mg 155 levofloxacin tablet 250 mg 156 norfloxacin tablet 400 mg 157 ofloxacin tablet 200 mg 158 ofloxacin suspension 50 mg / 5 ml 159 ofloxacin injection 200mg / 100 ml 160 ofloxacin and ornidazole tablet 200 mg + 500 mg 161 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 162 tab. levofloxacin ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 163 aztreonam injection 500 mg 164 clindamycin capsule 150 mg 165 clindamycin capsule 300 mg 166 co trimoxazole oral suspension 40 mg + 200 mg per 5ml 167 co trimoxazole tablet 40 mg + 200 mg 168 co trimoxazole tablet 160 mg + 800 mg 169 doxycycline capsule 100 mg 170 linezolid tablet ip 600 mg 171 linezolid injection 200 mg / 100 ml 172 meropenem injection 500 mg 173 meropenem injection 1 g 174 nitrofurantoin tablet 100 mg 175 vancomycin injection 500 mg 176 vancomycin for intravenous infusion ip 1 gm 177 aztreonam 1gm injection 178 framycetin sulphate cream 1% 179 framycetin sulphate cream 1%, 180 tab. faropenem sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 181 inj clindamycin phosphate ip 300 mg 182 inj imipenem + cilastatin 500mg / 500mg ip powder for solution 183 inj. polymixin sulphate b usp 5 lac i.u. 184 inj meropenem ip 250 mg 186 metronidazole injection 500 mg / 100 ml 187 metronidazole benzoate oral suspension 100 mg / 5 ml 188 metronidazole tablet 200 mg 189 metronidazole tablet 400 mg 190 tinidazole tablet ip 300 mg ( film coated ) 192 albendazole oral suspension 400 mg / 10 ml 193 albendazole tablet ip 400 mg 194 diethylcarbamazine tablets ip 100 mg 195 clotrimazole cream ip 2% w / w 196 clotrimazole vaginal tablet 500 mg 197 fluconazole tablet 150 mg 198 griseofulvin tablets 125 mg 199 itraconazole capsule 100 mg 200 amphotericin b injection 50 mg 201 inj. liposomol amphotericine b 50 mg 202 inj. voriconazole 200mg / vial 203 tab. terbinafine hydrochloride 250 mg 204 artisunate injection 60 mg ( combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection ) 205 chloroquine phosphate injection 40 mg / ml 206 chloroquine phosphate tablet 250mg ( =155 mg of chloroquine base ) 207 chloroquine phosphate suspension 50 mg / 5ml 208 mefloquine tablet 250 mg 209 primaquine tablet 2.5 mg 210 primaquine tablet 7.5 mg 211 quinine dihydrochloride injection 300 mg / ml 212 quinine sulphate tablet 300 mg 213 act kit containing 3 tablet of artesunate ( each tablet of artesunate 25mg strength ) and 1 tablet of sulphadoxine pyremethamine ( 250 mg+ 12.5 mg ) 214 act kit containing 3 tablet of artesunate ( 50mg each ) and 1tablet of sulphadoxine pyremethamine ( 500+25 ) mg 215 act kit containing 3 tablet of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg 216 act kit containing 3 tablet of artesunate 150 mg and 2 tablet of sulphadoxine pyremethamine ( 500 mg+ 25 mg ) 217 act kit containing 3 tablet of artesunate ( each 200 mg ) and 2 tablet of sulphadoxine pyremethamine ( 750 + 37.5 ) mg each or 3 tablet sulphadoxine pyremethamine ( 500+25 ) mg each 218 artemether + leumefantrine tablet ( 40 mg and 240 mg ) 219 artemether + leumefantrine tablet ( 80 mg and 480 mg ) 220 acyclovir tablet 200 mg 221 acyclovir tablet 800 mg 222 acyclovir suspension 400 mg / 5ml 223 acyclovir injection 250 mg 224 acyclovir injection 500 mg 225 tab. valganciclovir 450 mg 226 tab. entecavir ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 227 inj. ganciclovir sodium 500mg ( lyophilized powder for reconstitution ) 228 azathioprine tablet ip 50 mg 229 bleomycin injection 15 units 230 chlorambucil tablet 5 mg 231 cisplatin injection 50 mg / 50 ml 232 cyclophosphamide injection 200 mg 233 cyclophosphamide injection ip 500 mg 234 cyclosporine capsule usp 50 mg 235 cytarabine injection 100 mg / 5 ml 236 danazol capsule ip 50 mg 237 daunorubicin injection 20 mg 238 doxorubicin injection 50 mg / 25 ml 239 etoposide injection 100 mg / 5 ml 8. anti neoplastic and immuno suppressant drugs 240 fluorouracil injection 250 mg / 5 ml 241 l asparaginase injection 10000 iu 242 leucovorin calcium injection 10 mg / ml 243 melphalan tablet 5 mg 244 mercaptopurine tablet ip 50 mg 245 methotrexate injection 50 mg / 2 ml 246 methotrexate tablet 2.5 mg 247 paclitaxel injection 260 mg 248 paclitaxel injection 100 mg 249 tamoxifen tablet 10 mg 250 vinblastine injection 10 mg / 10 ml 251 vincristine injection 1 mg / ml 252 alpha interferon injection 3 million unit 253 carboplatin injection 150mg 254 carboplatin injection 450mg 255 cisplatin injection 10 mg / 10 ml 256 dacarbazine injection 500 mg 257 filgrastim injection 300mcg / ml 258 gemcitabine injection 200 mg 259 gemcitabine injection 1gm 260 ifosfamide injection 1gm 261 imatinib tablet 400 mg 262 methotrexate tablet ip 10 mg 263 mitomycin c injection 10 mg 264 oxaliplatin injection 50 mg 265 capsule procarbazine hydrochloride usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) 266 inj bendamustine 100 mg 267 tab capecitabine ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 268 tab letrozole usp 2.5 mg ( each film coated tablet contains letrozole usp 2.5 mg ) 269 capsule temozolomide ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) 270 inj. bortezomib 2mg 271 tab abiraterone acetate ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) 272 capsule lomustine ip 40 mg ( each capsule contains lomustine ip 40 mg ) 273 cap thalidomide usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) 274 inj. bevacizumab 400 mg 275 inj. bevacizumab 100 mg 276 tab cyclophosphamide ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) 277 tab gefitinib ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 278 capsule mycophenolate mofetil usp 250 mg ( each capsule conatin mycophenolate mofetil usp 250 mg ) 279 capsule tacrolimus ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 280 tab. mycophenolate sodium 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) 281 tab. bicalutamide usp 50 mg ( each film tablet contains bicalutamide usp 50 mg ) 282 tab. 6 thioguanine usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) 283 inj zoledronic acid ip 4mg / 100ml 100ml size 284 tab dasatinib 100 mg 285 bromocriptine mesylate tablet 2.5 mg 286 levodopa and carbidopa tablet 100 mg + 10 mg 287 levodopa and carbidopa tablet 250 mg + 25mg 288 trihexyphenidyl hydrochloride tablet 2 mg 289 acenocoumarol tablet 2 mg 290 enoxaparin sodium injection 60 mg 291 heparin sodium injection 5000 iu / ml 292 warfarin sod. tablet 5 mg 293 inj. n butyl alcohol 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size 294 ethamsylate injection 250 mg / 2ml 295 tranexamic acid tablet 500 mg 296 vitamin k injection 10 mg / ml 297 tab ethamsylate bp 500 mg ( each uncoated coated tablet contains ethamsylate bp 500 mg ) , 298 feracrylum 1% w / w sterile solution 100 ml 299 inj tranexamic acid ip 100mg / ml 5ml size 300 dried factor viii fraction ( iv use ) 250 iu 301 dried factor viii fraction ( iv use ) 500 iu 302 dried factor viii fraction ( iv use ) 1000 iu 303 factor – ix concentrate 600 iu 304 anti inhibitor coagulation complex [ human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu ] 305 recombinant coagulation factor viia 1 mg 306 recombinant coagulation factor viia 2 mg 307 recombinant f ix 500 iu with diluent 308 3rd generation recombinant f viii 250 iu with diluent 309 3rd generation recombinant f viii 1000 iu with diluent 310 deferasirox tablet 100 mg 311 deferasirox tablet 500 mg 312 deferiprone capsule 250 mg 313 deferiprone capsule 500 mg 314 desferrioxamine injection ( for i.m. inj and i.v., s.c. infusion ) 500 mg 315 rh erythropoetin injection 10000 iu 316 rh erythropoetin injection 2000 iu 317 rh erythropoetin injection 4000 iu 318 human albumin solution 20% 319 hydroxyethyl starch ( 130 / 4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion 320 polygeline 3.5% solution with electrolytes for i.v. infusion 321 adenosine injection 6 mg / 2ml 322 amiodarone tablet 100 mg 323 amiodarone tablet 200 mg 324 amiodarone hydrochloride injection 50 mg / ml 325 verapamil tablets ip 40 mg 326 streptokinase injection 15 lac units 327 urokinase injection 5 lac unit 328 aspirin delayed release tablet ( enteric coated ) 75 mg 329 clopidogrel tablet ip 75 mg 330 clopidogrel and aspirin tablet 75 mg + 75 mg 331 amlodipine tablet ip 2.5 mg 332 amlodipine tablet 5 mg 333 atenolol tablet 50 mg 334 atenolol tablet 25 mg 335 diltiazem tablet 30 mg 336 enalapril maleate tablet 10 mg 337 enalapril maleate tablet 5 mg 338 enalapril maleate tablet 2.5 mg 339 labetalol tablet 100 mg 340 labetalol hydrochloride injection 20 mg / 4ml 341 lisinopril tablet 2.5 mg 342 lisinopril tablet 5 mg 343 lisinopril tablet 10 mg 344 losartan tablet 25 mg 345 losartan tablet 50 mg 346 amlodipine and enalapril maleate tablet 5 mg +5mg 347 losartan potassium & amlodipine tablet 50 mg + 5mg 348 losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg 349 amlodipine and lisinopril tablet 5mg +5 mg 350 amlodipine and atenolol tablet 5 mg +50 mg 351 methyldopa tablet 250 mg 352 metoprolol tablet ip 25 mg 353 metoprolol suscinate tablet ( extended release ) usp 50 mg 354 nifedipine capsule 5 mg 355 nifedipine tablet ( sustained release ) 10 mg 356 prazosin tablet ( extended release ) 2.5 mg 357 propranolol tablet 40 mg 358 ramipril tablet / capsule 2.5 mg 359 telmisartan tablet ip 40 mg 360 tab. clonidine hydrochloride usp 0.1 mg ( each tablet contains clonidine hydrochloride usp 0.1 mg ) 11. cardio vascular drugs 361 tab. sotalol hydrochloride usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 362 inj. esmolol hydrochloride 10mg / ml 10ml size 363 inj. sodium nitroprusside 25mg / ml 2ml size 364 tab. carvedilol 3.125 mg 365 glyceryl trinitrate tablet 2.6 mg 366 isosorbide dinitrate tablet 5 mg 367 isosorbide mononitrate tablet 20 mg 368 nitroglycerin injection 5 mg / ml 369 atorvastatin tablet 10 mg 370 atorvastatin tablet 40 mg 371 fenofibrate capsule 200 mg 372 tab rosuvastatin ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 373 tab rosuvastatin 10 mg 374 digoxin injection 0.25 mg / ml 375 digoxin tablet 0.25 mg 376 dobutamine injection 50 mg / ml 377 dopamine hydrochloride injection 40 mg / ml 378 isoprenaline injection 2mg / ml 379 tab. sacubitril 24 mg and valsartan 26 mg 380 noradrenaline injection 2 mg / ml 381 magnesium sulphate injection ( 50% ) 500 mg / ml 382 chlorhexidine mouthwash bp 0.20% 383 dental gel: choline salicylate + benzalkonium + lignocaine 8.75% 384 desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % 385 gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% 386 metronidazole and chlorhexidine gel 1%+ 0.25% 387 miconazole nitrate cream 2% 388 clotrimazole mouth paint ( clotrimazole 1% w / v ) 1% 389 ketoconazole cream 2% 390 powder clotrimazole 1% w / w 30 gm 391 oint. terbinafine 1%w / w ( 10 gm tube ) 392 beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% 393 clindamycin phosphate gel usp 1% 394 fusidic acid cream 2% 395 neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg 396 olopatadine hydrochloride ophthalmic solution 0.1% w / v usp ( e / d ) 5ml size 397 cream mupirocin usp 2% ( each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base ) 15 gm size 398 betamethasone dipropionate cream 0.05% 399 betamethasone lotion 0.05% 400 clobetasol cream 0.05% 401 acyclovir cream 5% 402 gamma benzene hexachloride lotion ( lindane lotion usp ) 1% 403 permethrin cream 5% 404 permethrin lotion 5% 405 coal tar 6% & salicylic acid 3% onitment 406 glycerin ip 100 ml 407 glycerin ip 400 gm 408 calamine lotion ip 409 compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% 410 tretenoin cream 0.03% 411 anti a blood grouping serum ( anti a monoclonal serum ip ) 412 anti b blood grouping serum 413 anti drh blood grouping serum 414 diatrizoate meglumine and diatrizoate sodium inj usp 60% ( iodine conc. 292 mg / ml ) 60% 415 diatrizoate meglumine and diatrizoate sodium inj usp 76%w / v ( iodine conc. 370 mg / ml ) 76% 416 gadodiamide injection 0.5 mmol / ml 417 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml., 418 iohexol ( non ionic contrast medium in sterile aqueous solution ) 300 mg iodine / ml. 419 multistix test strip 420 vdrl antigen ( with +ve and ve control ) / rpr slide kit 421 cetrimide cream ip 0.50% 422 chlorhexidine gluconate solution 5% 423 compound benzoin tincture ip 424 formaldehyde solution ( 34.5% 38% ) 425 gentian violet topical solution usp 1% 426 glutaraldehyde solution 2% 427 hydrogen peroxide solution 6% 428 lysol ( cresol with soap solution ) ( cresol 50% + soap 50% ) 429 povidone iodine solution 5% 430 povidone iodine solution 5% 431 povidone iodine solution 10% 432 povidone iodine scrub solution / cleansing solution 7.5% w / v povidone iodine 7.5% 433 povidone iodine ointment 5% 434 povidone iodine ointment 5% 435 silver sulphadiazine cream 1% 436 silver sulphadiazine cream ip 1% 437 surgical spirit bp 438 surgical spirit bp 439 acetazolamide tablet 250 mg 440 furosemide tablet 40 mg 441 furosemide injection 10 mg / ml 442 hydrochlorthiazide tablet 12.5 mg 443 hydrochlorthiazide tablet 25 mg 444 mannitol injection 20% 445 spironolactone tablet 25 mg 446 spironolactone tablet 50 mg 447 torsemide tablet 10 mg 448 torsemide injection 10 mg / ml 449 ciprofloxacin and dexamethasone ear drops 0.3% + 0.1% 450 clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops 451 neomycin, polymixin b & hydrocortisone ear drops / otic solution usp ( neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml ) 452 wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil 2% + 2.7% + 5% + 15% 453 antacid tablet 454 antacid liquid 455 omeprazole capsule 20 mg 456 pantoprazole injection 40 mg 457 pantoprazole & domperidone sr capsule 40 mg+ 30 mg 458 ranitidine hcl injection 50 mg / 2ml 459 ranitidine tablet 150 mg 460 ranitidine tablet 300 mg 461 dicyclomine tablet 10 mg 462 dicyclomine injection 10 mg / ml 463 dicyclomine hydrochloride oral solution ip10 mg / 5ml 464 dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml 465 dicyclomine and paracetamol tablet 20mg + 325mg 466 drotaverine tablet 40 mg 467 drotaverine hydrochloride injection 40 mg / 2ml 468 drotaverine & mefenamic acid tablet 80 mg + 250 mg 469 hyoscine butylbromide tablet 10 mg 470 hyoscine butylbromide injection ip 20 mg / ml 471 metoclopramide injection 10 mg / 2ml 472 metoclopramide tablet 10 mg 473 metoclopramide syrup 5 mg / 5ml 474 domperidone tablet 10 mg 475 domperidone oral drops 10 mg / ml 476 domperidone suspension 5 mg / 5ml 16. diuretics 17. drugs for ear ailments 18. gastro intestinal drugs 15. disinfectants & antiseptics 477 ondansetron orally disintegrating md tablet 4 mg 478 ondansetron injection 2 mg / ml 479 tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 480 inj prochlorperazine mesylate 12.5mg / ml 5ml size 481 bisacodyl tablet 5 mg 482 lactic acid bacillus tablet 60 million spores 483 lactulose solution 10gm / 15ml 484 liquid paraffin ip 485 liquid paraffin ip 486 loperamide tablet ip 2 mg 487 ors powder 488 ointment containing : lidocaine 3%, zinc oxide 5% , hydrocortisone 0.25%, allantoin 0.5% 489 sodium phosphates enema bp 490 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 491 ursodeoxycholic acid tablet 300 mg 492 tab. mesalamine usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 493 biphasic isophane insulin injection 30 / 70 ( 30% soluble insulin & 70% isophane insulin ) 40 iu / ml 494 isophane insulin injection 40 iu / ml 495 soluble insulin injection 40 iu / ml 496 glibenclamide tablet 5 mg 497 gliclazide tablets ip 40 mg 498 glimepiride tablet 2 mg 499 glimepiride tablet 1 mg 500 glipizide tablet ip 5 mg 501 metformin tablet 500 mg 502 pioglitazone tablet ip 15 mg 503 metformin hydrochloride sr tablet 1000 mg 504 glipizide and metformin hydrochloride tablet 5 mg + 500 mg 505 glibenclamide and metformin hydrochloride ( sr ) tablet 5 mg + 500 mg 506 metformin hydrochloride ( sr ) and glimepiride tablet 500 mg + 1 mg 507 metformin hydrochloride ( sustained release ) and glimepiride tablet 500 mg + 2 mg 508 glimepiride, pioglitazone and metformin hydrochloride ( sr ) tablet 2mg + 15mg + 500mg 509 gliclazide and metformin tablet 80 mg + 500 mg 510 insulin glargine 100 iu / ml with 15 insulin syringes and needles / cartridge 100 iu / ml with 15 needles and 1 pen per 20 cartridges 511 insulin glargine 100 iu / ml with 30 insulin syringes with needle 512 tenaligliptin tablet 20 mg 513 carboprost tromethamine injection 0.25 mg / ml 514 clomiphene tablet ip 25 mg 515 clomiphene tablet 50 mg 516 conjugated estrogen tablet 0.625 mg 517 dinoprostone cream 0.5 mg 518 ethinyloestradiol tablet ip 50 mcg 519 hydroxyprogesterone injection 250 mg / ml 520 norethisterone tablet 5 mg 521 progesterone injection 200 mg / 2ml 522 medroxyprogesterone acetate tablet ip 10 mg 523 carbimazole tablet 5 mg 524 thyroxine sodium tablet 100 mcg 525 thyroxine sodium tablets ip 50 mcg 526 glucagon injection usp 1 mg / ml 527 octreotide injection 50 mcg / ml human anti d immunoglobulin injection ( im use ) 300 mcg 529 human anti d immunoglobulin 150 mcg 530 human rabies immunoglobulin injection 150 iu / ml 531 rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu 532 rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose 533 rabies antiserum ip ( equine ) ( i.m. / sc use ) 300 units / ml 534 snake venom anti serum ( polyvalent anti snake venom ) lyophillized, 535 normal human intravenous immunoglobulin 5g / 100ml 536 tetanus immunoglobulin 250 iu 537 tetanus vaccine ( adsorbed ) ip 538 diphtheria antitoxin 10, 000 iu 539 inj. hepatitis b immunologlobin ip 100 i.u 540 inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml ( 0.5 gm ) 541 atracurium injection 10 mg / ml 542 glycopyrrolate injection 0.2 mg / ml 543 neostigmine injection ip 0.5 mg / ml 544 neostigmine injection 2.5 mg / 5ml 545 neostigmine tablets ip 15 mg 546 succinylcholine injection 50 mg / ml 547 valethamate bromide injection 8 mg / ml 548 vecuronium bromide for injection 4 mg ( freeze dried ) 549 inj. cis atracurium besylate 2 mg / ml in 5 ml vial 550 fluconazole eye drops 0.3% 551 acyclovir eye ointment ip 3% w / w 5gm size 552 flurbiprofen sodium ophthalmic solution 0.03% 553 betaxolol eye drops 0.50% 554 brimonidine tartrate and timolol eye drops 0.15% + 0.5% 555 phenylephrine hydrochloride ophthalmic solution usp / phenylephrine eye drops bp 5% 556 timolol eye drops 0.50% 557 travoprost ophthalmic solution 0.004% 558 atropine eye ointment 1% 559 atropine sulphate ophthalmic solution usp 1% 560 homatropine eye drops 2% 561 tropicamide eye drops 1% 562 chloramphenicol eye drops 0.05% 563 ciprofloxacin eye drops 0.30% 564 ciprofloxacin ophthalmic ointment 0.30% 565 tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% 566 tobramycin eye drops 0.30% 567 tobramycin ophthalmic ointment 0.30% 568 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 569 chloramphenicol 1% w / w eye ointment ip, 3gm size 570 lidocaine hydrochloride topical solution usp 4% 571 carboxymethylcellulose sodium lubricant eye drops 0.50% 572 hyaluronidase injection 1500 iu 573 hydroxypropylmethyl cellulose solution with prefilled glass syringe with cannula 20 mg / ml 574 isoxsuprine injection 5 mg / ml 575 isoxsuprine tablet 20 mg 576 methylergometrine injection 0.2 mg / ml 577 methylergometrine tablet ip 0.125 mg 578 misoprostol tablet 200 mcg 579 mifepristone tablet 200 mg 580 oxytocin injection 5 iu / ml 581 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) 582 tab cabergoline ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 583 inj human chorionic gonadotropin ip 5000 i.u. 584 leurprolide acetate depot 3.75 mg 585 leurprolide acetate depot 11.25 mg 586 chloridazepoxide tablets ip 10 mg 587 chlorpromazine tablets ip 100 mg 588 chlorpromazine tablets ip 25 mg 589 chlorpromazine tablets ip 50 mg 590 chlorpromazine injection ip 25 mg / ml 591 haloperidol injection 5 mg / ml 592 haloperidol tablet 1.5 mg 593 haloperidol tablet 5 mg 594 olanzapine tablet 5 mg 595 risperidone tablet 2 mg 596 risperidone tablet 1 mg 23. drugs acting on uterus 24. psychotropic drugs 20.3 others 21. neuromuscular blockers & cholinesterase inhibitors 22. ophthalmological preparations 597 trifluperazine tablets ip 5 mg 598 quetiapine tablet ip 50 mg 599 quetiapine tablet ip 25 mg 600 tab. levosulpiride 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 601 amitriptyline tablets ip 25 mg 602 escitalopram tablets ip 10 mg 603 fluoxetine capsule ip 20 mg 604 imipramine tablet 25 mg 605 imipramine tablet 75 mg 606 lithium carbonate tablet 300 mg 607 sertraline tablet 50 mg 608 alprazolam tablet 0.25 mg 609 alprazolam tablet 0.5 mg 610 clonazepam tablet 0.5 mg 611 diazepam injection 10 mg / 2ml 612 diazepam tablet 5 mg 613 lorazepam injection 2 mg / ml 614 tab. lorazepam ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 615 tab. zolpidem 5 mg 616 aminophylline injection 25 mg / ml 617 beclomethasone inhalation 200 mcg / dose 618 budesonide nebulizer suspension 0.25 mg / ml 619 budesonide rotacap 200 mcg 620 ipratropium bromide nebulizer solution 250 mcg / ml 621 ipratropium rotacap 40 mcg 622 salbutamol tablet 4 mg 623 salbutamol inhalation 100 mcg / dose 624 salbutamol nebuliser solution 5 mg / ml 625 salbutamol tablet 2 mg 626 salbutamol syrup ip 2 mg / 5ml 627 terbutaline sulphate tablet ip 2.5 mg 628 theophylline and etophylline injection 50.6mg + 169.4mg 629 theophylline and etophylline tablet 23mg + 77mg 630 theophylline tablet ( sr ) 400 mg 631 formoterol & budesonide rotacap 6 mcg+ 200 mcg 632 tab. acebrophylline 100 mg 633 cough syrup [ each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg ] 634 dextromethorphan hydrobromide syrup 13.5 mg / 5ml 635 cough syrup / expectorant ( ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg 636 saline nasal solution ( drops ) 0.65% 637 xylometazoline nasal drops 0.1% 638 compound sodium lactate injection 639 dextrose injection 25% 640 dextrose injection 10% 641 dextrose injection 5% 642 multiple electrolytes & dextrose injection type i ip ( electrolyte p injection ) 643 multiple electrolytes & dextrose injection type iii ip ( electrolyte m injection ) 644 potassium chloride injection 0.15 gm / ml 645 potassium chloride oral solution usp 500 mg / 5ml 646 sodium chloride and dextrose injection 0.9 % + 5 % 647 sodium chloride injection 648 sodium chloride injection 649 ringer acetate infusion 500 ml 650 sodium chloride 0.45% w / v polypack 500 ml 651 finasteride tablet 5 mg 652 tamsulosin hcl tablet 0.4 mg 653 flavoxate tablet 200 mg 654 tab savelamer carbonate 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 655 tab sodium bicarbonate usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , 656 tab levamisol hydrochloride ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 657 tab.phenazopyridine 5 mg 658 tab. dutasteride 0.5 mg 659 syp. alkylizer 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) 660 betahistine tablet ip 8 mg 661 betahistine tablet ip 16 mg 662 cinnarizine tablet ip 25 mg 663 cinnarizine tablet ip 75 mg 664 ascorbic acid tablet 500 mg 665 calcium gluconate injection 10% 666 calcium & vitamin d3 tablet 500 mg + 250 iu 667 calcium & vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu ) 668 calcitriol capsule 0.25 mcg 669 cholecalciferol granules 60, 000 iu / 1gm 670 ferrous sulphate and folic acid tablet 100 mg + 0.5 mg 671 ferrous sulphate with folic acid tab. ( paediatric ) 20 mg + 0.1 mg 672 folic acid tablet ip 5 mg 673 iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg 674 iron sucrose injection 20 mg / ml usp / bp 20 mg / ml ( for iv use ) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg 675 mecobalamin injection 500 mcg / ml 676 multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg 677 multivitamin tablets nfi formula sugar coated.vit a 2500 iu 678 pyridoxine tablet 10 mg 679 pyridoxine tablet 40 mg 680 thiamine tablet 100 mg 681 vitamin a solution 1 lac iu / ml 682 vitamin b complex tablet nfi ( prophylactic ) 683 vitamin b complex injection nfi 684 zinc sulphate dispersible ip elemental tablet 10 mg 685 methylcobalmin tablet 500 mcg 686 methylcobalmin tablet 1500 mcg 687 vitamin d3 oral solution 60000 iu 688 inj. ferric carboxymaltose 50 mg / ml 10 ml size 689 multi vitamin syrup 690 flunarizine tablet 5 mg 691 black disinfectant fluid ( phenyl ) ( as per schedule o grade iii 692 concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans 693 hameodialysis bicarbonate solution 694 peritonial dialysis solution ip 695 sodium bicarbonate injection ip 7.5% 696 water for injection ip 697 alendronate sodium tablets usp / bp 35 mg 698 mannitol with glycerin injection 10% + 10% 699 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 700 oseltamivir 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 701 oseltamivir 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 702 oseltamivir 30 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 703 oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg / ml. ( each ml contains 12 mg oseltamivir base after reconstitution ) 704 oseltamivir phosphate oral suspension ip 12 mg / ml ( each ml contains : 12 mg oseltamivir after reconstitution 705 vitamin k 1 ( phytomenadione ) 1 mg / 0.5ml injection 28.antivertigo 29. vitamins & minerals 30. miscellaneous drugs 706 intravenous fat emulsion 20% w / v ( pl / tg ratio 0.06 ) 250ml 707 tab pyridostigmine usp 60 mg ( each tablet contains pyridostigmine usp 60 mg ) 708 inj. caffeine citrate usp 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 709 inj. amino acid 10% 100ml size 710 cap. vitamin e 400 mg 711 inj poractant alpha 80 mg / ml in pack of 1.5 ml s. no. name of item 1 absorbable gelatin sponge ip 66, size 80 ( + 10 ) mm x 50 mm x 10 mm should be sterlized. 2 absorbent cotton wool ip 500 gm 3 asepto syringe with transparent bulb sterile, 60 ml 4 blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824 ( part 3 ) :1996 5 disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 6 disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powder free ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) 7 disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered, , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 8 disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powder free ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards ) 9 disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 10 disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powder free ( polymer / silicon coated ) , without tear, properly folded in a paper • free of holes, with acceptable quality level ( aql ) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved ( ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards list of surgicals 11 suction catheter, sterile. size: fg 5 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 12 suction catheter, sterile. size: fg 6 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 13 suction catheter, sterile. size: fg 8 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 14 suction catheter, sterile. size: fg 10 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 15 suction catheter, sterile. size: fg 12 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 16 suction catheter, sterile. size: fg 14 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 17 suction catheter, sterile. size: fg 16 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 18 suction catheter, sterile. size: fg 18 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 19 suction catheter, sterile. size: fg 20 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014 20 suction catheter, sterile. size: fg 22 ( for use in respiratory tract ) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm ( min. ) • should conform to is0 8836:2014, etc. bc machine papcr roll ( mindray ) ( 50x20 ) mnlx ecg machine paper roll jluco metter accon strips blood mixer yellow tips 1000 pkt blue tips 500 pkt d. t. a. vials ( pccrless ) imported lx 10o urine container 25 pkt. 5m1 d. water ( 5 liter ) irine albumin sugar strip lop mlalaria pv / pf antigen ( sd ) irine albumin sugar strip 2p pregnency card 50 test ria vial widal 4x5 ml ( span ) nti a b d 10 x 3 ml ( span ) lot activators ( labtecil ) slide box per slide — leishman stain l0goml dt / bt per ppt ___________ r.iic. diluting fluid ( orange ) 500 ml w.b.c. diluting fluid ( orange ) 500 ml overslip l8mmpcrslip ounting chamber per chamber odium citrate 3.8% 500 ml lest tube 12x75 4 / i0 hcl i litre ythalenei3lue 125 ml esr stand ( 6 tube ) pipette rest tube stand 90 hole dropping bottle 100 ml wash bottle 500 ml tissue paper 100 pkt platelate reagent 100 ml slide stand 50 slide ppette stand ( 3 it ) __.._ ecg jelly 250 g. ilb. tube round ___ sprit 4.5 ltr. ___..._........_... _... sainetiser 50o ml _.__ bp instrument .___ micro.pipette.100 l000ul. ( dragon ) _____ microscope_ ( labomed.lx 300.led ) _____ l00ul ( dragon micro pipette 50 ) ..... dialuent for bc 20, 20ltr _.._ fl lyse 500m1 for mindray _____ probe cleaner_50ml.for mindray _____ d1aluent ( eni2ola i ) for 5130 mindray ._._. diff lyse ( en / 50oml, a4 ) for s13o mindray ____.. li i lyse ( en / ioornl, a4 ) for 513o mindray _.._. probe cleaner 50ml ( m 68 / en ) mindray _____ ‘ ( ray film 8xloin ( drystar ) xray film lox 12 ( drysar ) . 3lucose 6x100 ml lab react .__... holesterol2x50 ml lab react ___ _ friglyceride_2xs0. ( i00_m1 ) lab.react __aiwlulla i ‘n•w total_billinubin.3x100_ml _lab_react ___.__.____. direct_billirubin.3x100eml _lab_react __ lkeline ( pnppyamp ) 2x50 ml labreact ____ uric acid 2x50 ml lab react _ sgot2x50 ml lab react __ sgpt 2x50 ml lab react _ dialuent 2oltr for horiba _ fl_lyse_sooml_for_1 loriba . . probe cleaner 50mnl ____ 4 s2d dialuent ( en / 20l, ai ) for horiba ........._ m 52diff lyse ( en / 500m1, a4 ) fnr horiba .__.......__ m52lh lyse ( en / iooml.a4 ) for [ loriba ._._.__...__ probe cleaner 50ml for horiba x ray film 8xloin ( drystar ) xray film iox 12 ( drystar ) . glucose 6x100 ml horiba holcsterol 2x50 ml horiba rriglyccride 2x50 ( 100 ml ) horiba hdl direct 1x20 ml i loriba urea uv ( lx80 ml+ ( lx20 ml ) horiba dreatinine ( jaffee ) 2x 50 ml horiba lbumin 3x50 ml horiba fotal protein 3x50 ml [ loriba alcium s0xl ml horiba fotal billirubin 3x100 ml horiba direct billirubin 3x 100 ml horiba lkcline ( pnppyamp ) 2x50 ml horiba uric acid 2x50 ml horiba ;got 2x50 ml horiba gpt 2x50 ml horiba...

Government Medical College - Rajasthan

32938160 supply of lab reagents in bangur hospital pali for the year 2022 23 1 a.p.t.t 3ml j.mitra / arkery / transasia 2 a.s.o. latex with control 100 test aspen / arkery / tulip / expedia 3 absolute alcohol 500 ml ankem / biolab / b.d.h / c.d.h 4 acetotone test powder 100 gr. rankem / biolab / b.d.h / c.d.h 5 acid phosphate kit 8 ml accurex / erba / semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem / biolab / b.d.h / c.d.h 8 albert stain b 500 ml rankem / biolab / b.d.h / c.d.h 9 albumin kit 5x50 ml accurex / erba / semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex / erba / semens 12 amylase liquid stable 6x6 ml accurex / erba / semens 13 anti a monoclonal 10 ml tulip / arkery / ortho / j.mitra 14 anti a1 5 ml tulip / arkery / ortho / j.mitra 15 anti ab 10 ml tulip / arkery / ortho / j.mitra 16 anti b monoclonal 10 ml tulip / arkery / ortho / j.mitra 17 anti d igm monoclonal 10 ml tulip / arkery / ortho / j.mitra 18 anti d rhod igg igm polyclonal 10 ml tulip / arkery / ortho / j.mitra 19 anti h 5 ml tulip / arkery / ortho / j.mitra 20 anti human globin 10 ml tulip / arkery / ortho / j.mitra 21 aptt 3 ml j.mitra / arkery / transasia 22 aqua 4 water 1 ltr accurex / erba / semens 23 barium cloride 10 % 500 ml rankem / biolab / b.d.h / c.d.h 24 beaker glass 100 ml per pcs borosil 25 beaker glass 200 ml per pcs borosil 26 beaker glass 500 ml per pcs borosil 27 bile pigment rapid biolab / microexpree / titan 28 billrubin t&d 4x60 ml accurex / erba / semens / randox 29 bleaching powder 1 kg isi 30 blood bag quardipal sagam per pcs mitra / hll / panpol 31 blood bags 100 ml per pcs mitra / hll / panpol 32 blood bags 350 ml per pcs mitra / hll / panpol 33 blood bags triple sagam per pcs mitra / hll / panpol 34 blood bags weighing machine per pcsisi 35 blood lancet 100 pcs isi 36 bovin albumin 10% 10 ml tulip / arkery / ortho / j.mitra 37 c.k. mb kit 2x8 / 2x2 ml accurex / erba / semens / randox 38 c.k. nac kit 2x8 / 2x2 ml accurex / erba / semens / randox 39 c.r.p. latex with control 100 test arkery / aspen / accurex / expedia / tulip 40 c.r.p. turbilatex 50 ml accurex / erba / horiba 41 c.s.f. chloride 2x50 ml accurex / erba / semens 42 c.s.f. protin 2x50 ml accurex / erba / semens 43 calcium kit 2x50 ml accurex / erba / semens / randox 44 capilary tube 1x100 pcs top tech / merinfield / labtech 45 centifuse machine 16 tube ce certified per pcs remi / appendrop / isi 46 centifuse machine 32 tubece certified per pcs remi / eppendrof / isi 47 centifuse machine 8 tube cecertified per pcsremi / eppendorf / isi 48 chikanguniya elisa kit 96 test j.mitra / s.d. biosensor / novatech 49 chikguniya card igg / igm per card j.mitra / s.d. / meril 50 cholestrol kit 5x20 ml accurex / erba / semens / randox 51 combistix 100 st semens / erba / accurex 52 counting chamber per pcs top tech / merinfield / labtech 53 cover slip english glass 18 mm 200 gr bluestar / borosil / merinfield 54 cover slip english glass 22 mm 200 gr bluestar / borosil / merinfield 55 creatitine kit 4x60 ml accurex / erba / semens 56 cuppling jar per pcs polylab / abdos / labtech 57 deionized water 5 ltr ases / jupiter / vardhmaan 58 dengue duo ns1, igg, igm per card j.mitra / s.d. biosensor / meril 59 dengue elisa igg 96 test j.mitra / s.d. biosensor / meril 60 dengue elisa igm 96 test j.mitra / s.d. biosensor / meril 61 dengue elisa ns1 96 test j.mitra / s.d. biosensor / meril 62 dengue igg / igm rapid card per card j.mitra / s.d. biosensor / meril 63 dengue ns1 rapid card per card j.mitra / s.d. biosensor / meril 64 disposable e.s.r. pippeteper pcs lab tech / top tech / premier plus 65 disposable needle noa. 22 per pcs b.d. / dispovan / nipro 66 disposable syringe 2 cc per pcs b.d. / dispovan / nipro 67 disposable syringe 5 cc per pcs b.d. / dispovan / nipro 68 disposable syringe 10 cc per pcs b.d. / dispovan / nipro 69 distil water 5 ltr ases / jupiter / vardhmaan 70 drabkin solution 1 ltr ases / jupiter / vardhmaan 71 dry bath incubater per pcs isi 72 e.d.t.a. solution 500 ml rankem / biolab / b.d.h / c 73 e.s.r. felling vial per pcs rankem / biolab / b.d.h / c.d.h 74 e 10 stand per kit top tech / lab tech / premier plus 75 eosnophil counting fluid 100 ml rankem / biolab / b.d.h / c.d.h 76 ethnol 95%absolute 500 ml rankem / biolab / b.d.h / c.d.h 77 examination gloves 100 pcs hll / ttk / nulife 78 face mask 3 ply ( sigle pack ) per pcs nulife / mcare / romson 79 field stain a500 ml rankem / biolab / b.d.h / c.d.h 80 field stain b 500 ml rankem / biolab / b.d.h / c.d.h 81 filter paper 13.5 cm 100 leavs whatman / axiva / no1 82 formalline5 ltr rankem / biolab / b.d.h / c.d.h 83 fouchest reagents 125 ml rankem / biolab / b.d.h / c.d.h 84 giemsa stain 500 ml rankem / biolab / b.d.h / c.d.h 85 glucose kit 2x200 ml accurex / erba / semens 86 glass marking pencil ( 1 pcs. ) 87 grams stain kit 500 ml rankem / biolab / b.d.h / c.d.h 88 gulcosign strips per strips gulcosign 89 h.a.v. elisa igg 96 test c.t.k / meril / j.mitra / s.d. 90 h.a.v. igg card 96 test c.t.k / meril / j.mitra / s.d. 91 h.b. meter squre per pcs toptech / premierplus / merinfield 92 h.b. meter round per pcs 93 h.b. pipeete per pcs toptech / premierplus / merinfield 94 h.b. tube squre per pcs toptech / premierplus / merinfield 95 hb 301 micro cuvette per pcs. toptech / premierplus / merinfield 96 h.c.l. n / 10 solution 500 ml rankem / biolab / b.d.h / c.d.h 97 h.c.v. tri dot cardper cardit shouldbe 4th generation. it shouldbe based on flow through technolog it should must have a long shelf life & only in the form of card not in theform of strips.it shouldbe approved and evaluaed by nib .it shouldbe short interpretation time not more than 3 5 minutes.it should have specificity and sensitivity of 100%j.mitra 98 h.c.v.elisa 4 th gen96 test wells coated with synthetic peptide including ns3, ns4, ns5 and core sensitivity should be over 99.8% of whoand nib panels.specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity.should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. j.mitra / meril / g.b.c / erba / 99 h.e.v. elisa igm 96 test meril / j.mitra / s.d. 100 h.e.v. igm card per card meril / j.mitra / s.d. 101 h.i.v. tri dot + ag ( 4th generation ) per cardit should be 4th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / meril / s.d. biosensor 102 h.i.v. tri dot cardper cardit should be 3th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / s.d.biosensor / meril 103 h.i.v. rapid test per card it should be direct sandwitch assay 3rd gen & detection of igm, igg & iga antibodies it should have serum, plasma, whole blood it should be sensitivity >99.50% and specificity 99.00%.it should have sample volume 10ul serum / plasma or 20ul whole blood it should be long shelf life it should be who, nari, nib approved.s.d. biosensor / erba / meril / j.mitra / qualpro / 104 h.i.v.elisa 4th gen it should detect hiv 1, hiv 2, hiv o and antigen p24 simultaneously ( 4th gen ) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. should be compatible with automated as wellas manual elisa.one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel.tmb substrate should be stable ready.j.mitra / meril / erba / s.d. biosensor / g.b.c. tiwan 105 hbsag elisa kit 96 testwells coated with two or more monoclonal anti hbs ( murine and human origin ) .should detect all subtypes e.g. ad, ay, etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. 106 should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels.specificity should be over 99.8%.tmb substrate should be ready to use.must be evaluated and approved by nib.96 test j.mitra / meril / erba / s.d. biosensor / novatech 107 incubator 18x18x18 s.s. per pcs isi 108 j.s.b. 1st stain 500 ml rankem / biolab / b.d.h / c.d.h 109 j.s.b. iindstain 500 mlrankem / biolab / b.d.h / c.d.h 110 ketodiastix50 strips semens / erba / accurex 111 l.d.h. kit accurex / erba / semens / randox 112 lancets per pcs plaza / top tech / s.d. 113 leishmaan stain liqued 500 ml rankem / biolab / b.d.h / c.d.h 114 leishmaan stain powder 500 grrankem / biolab / b.d.h / c.d.h 115 lipase kitaccurex / erba / semens / randox 116 malaria pf / pv ag test per test it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) . infection / cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. j.mitra / s.d. bio sensor / meril / erba / 117 measuring cylinder 50 ml ( glass ) per pcs. 118 measuring cylinder 100 ml ( glass ) per pcs. 119 measuring cylinder 250 ml ( glass ) per pcs. 120 measuring cylinder 500 ml ( glass ) per pcs. 121 measuring cylinder 50 ml ( plastic ) per pcs. 122 measuring cylinder 100 ml ( plastic ) per pcs. 123 measuring cylinder 250 ml ( plastic ) per pcs. 124 methnol5 ltr rankem / biolab / b.d.h / c.d.h 125 methylene blue liquid 500 ml rankem / biolab / b.d.h / c.d.h 126 micro pipeete fix fully autoclavable with 3 years warrenty per pcs tranasia / finepipeete / thermo / durapet 127 micro pipeete variable fully autoclavable with 3 year warranty per pcs tranasia / finepipeete / thermo / durapet 128 micro protin kit accurex / erba / semens 129 micro tips up to 1000 ul 500 pcs gilson / labtech / a.v.dis 130 micro tips up to 200 ul 1000 pcs gilson / labtech / a.v.dis 131 microglass slide isi 50 slide bluestar / borosil / alphachem 132 microscope blub per pcs phillps / osram / bajaj / 133 multi chanal pipeete with 3 years warranty per pcs tranasia / finepipeete / tjermo / durapet 134 multi stix 14 parameter ( dekhaphen ) 100 st semens / transasia / accurex / durai / 135 n 95 mask per pcs romson / 3m / polymed / mrk / 136 nitral gloves 100 pcs romsom / m care / mrk / polymed 137 nitric adid 500 gr rankem / biolab / b.d.h / c.d.h 138 normal sline 500 ml rankem / biolab / b.d.h / c.d.h 139 o2 valve with humidifier per pcs isi 140 occult blood in stool 200 test tulip / accurex / biolab 141 oil immersion 100 ml rankem / biolab / b.d.h / c.d.h 142 ovan 18x18x18 s.s. per pcs isi / remi / 143 p.p.e kit per pcs drdo approved 144 pep stain per kit 145 paper roll 50x20 mtrper roll erba 146 paper roll 57x10 mtr per roll horiba 147 paper roll 57x20 mtr per roll erba 148 pasture pipeete per pcs lab tech / top tech / a.v. consumable 149 phosphrous kit accurex / erba / semens 150 pipeete stand per pcs plaza / top tech / expedia / labsystem 151 platlet diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 152 pregnancy card / hcg device per card acon / aspen / erba / diagnocure 153 r.a. test kit with control 100 test acurex / erba / spinreact / arkrey / biolab 154 r.b.c. diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 155 r.f. turbilatex 50 ml accurex / erba / human / arkrey / biolal 156 r.h. view box per pcs remi / plus / top tech / alpha 157 r.p.r. test 100 test tulip / erba / acurex / human / arkrey 158 rapid pap stain 250 simmer tulip / biolab / himedia 159 recticlusytes count fluid 100 ml rankem / biolab / b.d.h / c.d.h 160 ria tube 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 161 ria vial 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 162 room thermometer per pcs labtech / toptech / a.v. consumable / isi 163 s.g.o.t. kit 5x20 ml accurex / erba / semens / randox 164 s.g.p.t. kit 5x20 ml accurex / erba / semens / randox 165 sample cups from xl300 500 pcs erba / hitachi / top tech 166 screw cap tube 13x100 100 tube labtech / polylab / a.v. cons 167 scrub typhus elisa 96 test novatech / j.mitra / s.d.biosensor / g.b.c 168 seman diluting fluid 100 ml rankem / biolab / b.d.h / c.d.h 169 slide cage per pcs labtech / toptech / a.v.co / k.d 170 slide rack per pcs labtech / toptech / a.vcon / k.d 171 slide stand per pcs labtech / toptech / a.v.co / k.d 172 slide staning rack per pcs labtech / toptech / a.v. / k.d 173 sodium citrate 3.8% 500 ml rankem / biolab / b.d.h / c.d.h 174 sodium hypochloride 8 10 % 5 ltr rankem / biolab / b.d.h / c.d.h 175 stain rack per pcs labtech / toptech / a.v. / k.d 176 stethoscope per pcs litman / isi / 177 sulpher powder 500 gr rankem / biolab / b.d.h / c.d.h 178 surgical gloves 6, 7.5.7 pair m.r.k. / caltex / hll / 179 t.s.h. elisa 96 test j.mitra / erba / suyog / s.d. bio 180 t3 elisa96 test j.mitra / erba / suyog / 181 t4 elisa 96 test j.mitra / erba / suyog / 182 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 183 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 184 test tube brush per pcs labtech / toptech / a.v. / k.d 185 test tube stand 48 hole per pcs 186 test tube stand 96 hole per pcs 187 thermoplastin5 ml j.mitra / erba / arkery 188 timmer watch digital per pcs k.d. / top tech / amron / isi 189 tincher iodine 400 ml 190 tissue paper roll per roll 191 total protin kit 5x50 ml accurex / erba / semens / randox 192 triglycerdies kit 5x20 ml accurex / erba / semens / randox 193 tronicate rubber per pcs 194 troponine i per card alfa / j.mitra / accurex / diagnocure 195 troponine t per card roche 196 tsutsugamuchi card per card j.mitra / s.d. biosensor / athenesedx / 197 tray for slide ( aluminium ) per pcs. 198 typhoid card igg / igm per card j.mitra / diagnocure / s.d. biosensor / 199 urea bertlot kit 2x100 det accurex / erba / semens / randox 200 urea bun5x20 ml accurex / erba / semens 201 uric acid kit 5x20 ml accurex / erba / semens 202 urine continer 50 ml with sticker individually packed per pcs labtech / a.v / top tech 203 uristix glu / ketone / pro 100 st semens / accurex / erba / transasia 204 v.d.r.l. cardper card assay for qualitative detection of all isotype of antibodies ( igm, igg & iga ) against treponema pallidium.it should must have a long shelf life & only in the form of card not in the form of strips.rapid card test in individual pack.it should be nib, naco, nari approvedmeril / s.d. biosensor / accurex / diagnocure 205 v.d.r.l. shaker per pcs remi / penpol / oxford / top tech 206 vacutanier clot, gel activete 13x75 mm 3 to 5ml ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate 207 batch wise sterility , pyrogenicity and toxicity certificate should be givenit should be usfda / europen ce certified. b.d. / 208 vacutanier k2 edta 13x75 mm ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.b.d 209 vacutanier sodium citrate 13x75 mm ( 100 pcs ) for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalatebatch wise sterility , pyrogenicity and toxicity certificate should be givenit should be sfda / europen ce certified. b.d 210 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.per pcs b.d 211 viral transport media 50 vial icmr approved 212 w.b.c. fluid500 ml rankem / biolab / b.d.h / c.d.h 213 water bath per pcs remi / top tech / premier plus 214 widal kit 4x5 ml per kit arkery / becon / tulip 215 xylene 500 ml rankem / biolab / b.d.h / c.d.h 216 z.n. stain 4x50 ml rankem / biolab / b.d.h / c.d.h 217 covid ag card icmr approved test icmr approved 218 covid ab card icmr approved test icmr approved 219 covid elis igg icmr approved 96 test icmr approved 220 hand santizer500 ml icmr approved 221 hand santizer 5ltr icmr approved 222 automatic hand santizer machine pcs icmr approved 223 bandaid round pcs j&j / labtech / hll / mrk 224 cryocentrifuge machine ( 5500i ) blood bag bucket ( green colour ) per pc. 225 disposable needle noa. 26 & 24 per pcs b.d. / dispovan / nipro 226 micro tips stand ( small ) per pcs. 227 micro tips stand ( big ) per pcs. 228 micropopette 10 ul to 100 ulper pcs. tranasia / finepipeete / thermo / durapet 229 micropopette 100 ul to 1000 ulper pcs. tranasia / finepipeete / thermo / durapet 230 isopropyl alcohol solution 70% ( 500 ml ) per pcs. 231 gel card grouping per pcs.j. mitra / sd / bio / biorad 232 gel card cross matchper pcs.j. mitra / sd / bio / biorad 233 chest stand wall modelper pcs. 234 dental hangerper pcs. 235 x ray developer 13.5 ltrper pkt. 236 x ray fixer 13.5 ltr per pkt. 237 u.s.g. jelly 250 grper pcs. 238 e.c.g jelly 250 gr.per pcs. 239 e.c.g roll 8310m 210x20 ml per pcs. 240 eeg electrodeper pcs. 241 eeg pasteper pcs. 242 ecg battery digitalper pcs. 243 ecr battery for 108 tper pcs. 244 ecg beltper pcs. 245 ecg cable for digital per pcs. 246 ecg chest electrode per pcs. 247 ecg clip per pcs. 248 ecg roll for 108 tper pcs. 249 ecg roll for 6108 per pcs. 250 ecg rubber bulb per pcs. 251 ecg trolly per pcs. 252 glysrine 100 mlper bottle 253 lead aprinper pcs. 254 lead divider 7x17 per pcs. 255 tmt jelly 250 ml per pcs. 256 usg jelly 250 gr. per pcs. 257 usg printer roll per pcs. 258 usg tissue paper roll per pcs. 259 x ray cassetts 10x12per pcs. fuji / kodak / jindal 260 x ray cassetts 12x15per pcs. fuji / kodak / jindal 261 x ray cassetts 14x17per pcs. fuji / kodak / jindal 262 x ray cassetts 6.5x8.5 per pcs. fuji / kodak / jindal 263 x ray cassetts 8x10per pcs. fuji / kodak / jindal 264 x ray film 10x12 ( 150 films ) per pkt.fuji / kodak / jindal 265 x ray film 12x15 ( 150 films ) per pkt.fuji / kodak / jindal 266 x ray film 6.5x8.5 ( 150 films ) per pkt. fuji / kodak / jindal 267 x ray film 8x10 ( 150 films ) per pkt. fuji / kodak / jindal 268 x ray hanger 10x12 269 x ray hanger12x15 270 x ray hanger 14x17 271 x ray hanger 6.5x8.5 272 x ray hanger 8x10 273 x ray screen 10x12 fuji / kodak / jindal 274 x ray screen 12x15 fuji / kodak / jindal 275 x ray screen 14x17 fuji / kodak / jindal 276 x ray screen 6.5x8.5 fuji / kodak / jindal 277 x ray screen 8x10 fuji / kodak / jindal 278 ecg machine battery charger 279 x ray fixer 13.5 ltr. 280 tmt electrode 281 tmt report chart 282 x ray film dental 283 x ray film 14x17 284 8 x 10digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 285 10 x 12 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 286 11 x 14 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 287 14 x 17digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 288 dental & occlusal x ray films 57x76 mm fuji / kodak / jindal 289 imaging plate and cassettes ( c.r.system ) 08”x10” fuji / kodak / jindal 290 imaging plate and cassettes ( c.r.system ) 10”x12” fuji / kodak / jindal 291 imaging plate and cassettes ( c.r.system ) 14”x17” fuji / kodak / jindal 292 protactive screen ( mobile ) lead barriar with lead glass window...

Medical And Health Services - Rajasthan

32936627 supply of lab reagents in bangur hospital pali for the year 2022 23 1 a.p.t.t 3ml j.mitra / arkery / transasia 2 a.s.o. latex with control 100 test aspen / arkery / tulip / expedia 3 absolute alcohol 500 ml ankem / biolab / b.d.h / c.d.h 4 acetotone test powder 100 gr. rankem / biolab / b.d.h / c.d.h 5 acid phosphate kit 8 ml accurex / erba / semens 6 adult weight machine up to 180 kg per pcs isi 7 albert stain a 500 ml rankem / biolab / b.d.h / c.d.h 8 albert stain b 500 ml rankem / biolab / b.d.h / c.d.h 9 albumin kit 5x50 ml accurex / erba / semens 10 alcoholic swab per pcs isi 11 alk. phosphate kit 5x20 ml accurex / erba / semens 12 amylase liquid stable 6x6 ml accurex / erba / semens 13 anti a monoclonal 10 ml tulip / arkery / ortho / j.mitra 14 anti a1 5 ml tulip / arkery / ortho / j.mitra 15 anti ab 10 ml tulip / arkery / ortho / j.mitra 16 anti b monoclonal 10 ml tulip / arkery / ortho / j.mitra 17 anti d igm monoclonal 10 ml tulip / arkery / ortho / j.mitra 18 anti d rhod igg igm polyclonal 10 ml tulip / arkery / ortho / j.mitra 19 anti h 5 ml tulip / arkery / ortho / j.mitra 20 anti human globin 10 ml tulip / arkery / ortho / j.mitra 21 aptt 3 ml j.mitra / arkery / transasia 22 aqua 4 water 1 ltr accurex / erba / semens 23 barium cloride 10 % 500 ml rankem / biolab / b.d.h / c.d.h 24 beaker glass 100 ml per pcs borosil 25 beaker glass 200 ml per pcs borosil 26 beaker glass 500 ml per pcs borosil 27 bile pigment rapid biolab / microexpree / titan 28 billrubin t&d 4x60 ml accurex / erba / semens / randox 29 bleaching powder 1 kg isi 30 blood bag quardipal sagam per pcs mitra / hll / panpol 31 blood bags 100 ml per pcs mitra / hll / panpol 32 blood bags 350 ml per pcs mitra / hll / panpol 33 blood bags triple sagam per pcs mitra / hll / panpol 34 blood bags weighing machine per pcsisi 35 blood lancet 100 pcs isi 36 bovin albumin 10% 10 ml tulip / arkery / ortho / j.mitra 37 c.k. mb kit 2x8 / 2x2 ml accurex / erba / semens / randox 38 c.k. nac kit 2x8 / 2x2 ml accurex / erba / semens / randox 39 c.r.p. latex with control 100 test arkery / aspen / accurex / expedia / tulip 40 c.r.p. turbilatex 50 ml accurex / erba / horiba 41 c.s.f. chloride 2x50 ml accurex / erba / semens 42 c.s.f. protin 2x50 ml accurex / erba / semens 43 calcium kit 2x50 ml accurex / erba / semens / randox 44 capilary tube 1x100 pcs top tech / merinfield / labtech 45 centifuse machine 16 tube ce certified per pcs remi / appendrop / isi 46 centifuse machine 32 tubece certified per pcs remi / eppendrof / isi 47 centifuse machine 8 tube cecertified per pcsremi / eppendorf / isi 48 chikanguniya elisa kit 96 test j.mitra / s.d. biosensor / novatech 49 chikguniya card igg / igm per card j.mitra / s.d. / meril 50 cholestrol kit 5x20 ml accurex / erba / semens / randox 51 combistix 100 st semens / erba / accurex 52 counting chamber per pcs top tech / merinfield / labtech 53 cover slip english glass 18 mm 200 gr bluestar / borosil / merinfield 54 cover slip english glass 22 mm 200 gr bluestar / borosil / merinfield 55 creatitine kit 4x60 ml accurex / erba / semens 56 cuppling jar per pcs polylab / abdos / labtech 57 deionized water 5 ltr ases / jupiter / vardhmaan 58 dengue duo ns1, igg, igm per card j.mitra / s.d. biosensor / meril 59 dengue elisa igg 96 test j.mitra / s.d. biosensor / meril 60 dengue elisa igm 96 test j.mitra / s.d. biosensor / meril 61 dengue elisa ns1 96 test j.mitra / s.d. biosensor / meril 62 dengue igg / igm rapid card per card j.mitra / s.d. biosensor / meril 63 dengue ns1 rapid card per card j.mitra / s.d. biosensor / meril 64 disposable e.s.r. pippeteper pcs lab tech / top tech / premier plus 65 disposable needle noa. 22 per pcs b.d. / dispovan / nipro 66 disposable syringe 2 cc per pcs b.d. / dispovan / nipro 67 disposable syringe 5 cc per pcs b.d. / dispovan / nipro 68 disposable syringe 10 cc per pcs b.d. / dispovan / nipro 69 distil water 5 ltr ases / jupiter / vardhmaan 70 drabkin solution 1 ltr ases / jupiter / vardhmaan 71 dry bath incubater per pcs isi 72 e.d.t.a. solution 500 ml rankem / biolab / b.d.h / c 73 e.s.r. felling vial per pcs rankem / biolab / b.d.h / c.d.h 74 e 10 stand per kit top tech / lab tech / premier plus 75 eosnophil counting fluid 100 ml rankem / biolab / b.d.h / c.d.h 76 ethnol 95%absolute 500 ml rankem / biolab / b.d.h / c.d.h 77 examination gloves 100 pcs hll / ttk / nulife 78 face mask 3 ply ( sigle pack ) per pcs nulife / mcare / romson 79 field stain a500 ml rankem / biolab / b.d.h / c.d.h 80 field stain b 500 ml rankem / biolab / b.d.h / c.d.h 81 filter paper 13.5 cm 100 leavs whatman / axiva / no1 82 formalline5 ltr rankem / biolab / b.d.h / c.d.h 83 fouchest reagents 125 ml rankem / biolab / b.d.h / c.d.h 84 giemsa stain 500 ml rankem / biolab / b.d.h / c.d.h 85 glucose kit 2x200 ml accurex / erba / semens 86 glass marking pencil ( 1 pcs. ) 87 grams stain kit 500 ml rankem / biolab / b.d.h / c.d.h 88 gulcosign strips per strips gulcosign 89 h.a.v. elisa igg 96 test c.t.k / meril / j.mitra / s.d. 90 h.a.v. igg card 96 test c.t.k / meril / j.mitra / s.d. 91 h.b. meter squre per pcs toptech / premierplus / merinfield 92 h.b. meter round per pcs 93 h.b. pipeete per pcs toptech / premierplus / merinfield 94 h.b. tube squre per pcs toptech / premierplus / merinfield 95 hb 301 micro cuvette per pcs. toptech / premierplus / merinfield 96 h.c.l. n / 10 solution 500 ml rankem / biolab / b.d.h / c.d.h 97 h.c.v. tri dot cardper cardit shouldbe 4th generation. it shouldbe based on flow through technolog it should must have a long shelf life & only in the form of card not in theform of strips.it shouldbe approved and evaluaed by nib .it shouldbe short interpretation time not more than 3 5 minutes.it should have specificity and sensitivity of 100%j.mitra 98 h.c.v.elisa 4 th gen96 test wells coated with synthetic peptide including ns3, ns4, ns5 and core sensitivity should be over 99.8% of whoand nib panels.specificity should be over 99.8%. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity.should be compatible with automated as well as manual elisa.a tmb substrate should be ready to use must be evaluated and approved by nib. j.mitra / meril / g.b.c / erba / 99 h.e.v. elisa igm 96 test meril / j.mitra / s.d. 100 h.e.v. igm card per card meril / j.mitra / s.d. 101 h.i.v. tri dot + ag ( 4th generation ) per cardit should be 4th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / meril / s.d. biosensor 102 h.i.v. tri dot cardper cardit should be 3th generation.it should be based on flow through technolog with dual detectionssystem. ( synthetic peptide & recombinent ) .it should be able for the dection of hiv 1 and hiv 2 separately as per naco. it should must have a long shelf life & only in the form of card not in the form of strips.it should be short interprepation time 3 to 5 minutes.it should be approved and evaluaed by nib , nari and who ( naco ) . j.mitra / s.d.biosensor / meril 103 h.i.v. rapid test per card it should be direct sandwitch assay 3rd gen & detection of igm, igg & iga antibodies it should have serum, plasma, whole blood it should be sensitivity >99.50% and specificity 99.00%.it should have sample volume 10ul serum / plasma or 20ul whole blood it should be long shelf life it should be who, nari, nib approved.s.d. biosensor / erba / meril / j.mitra / qualpro / 104 h.i.v.elisa 4th gen it should detect hiv 1, hiv 2, hiv o and antigen p24 simultaneously ( 4th gen ) based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. should be compatible with automated as wellas manual elisa.one step procedure with specificity of 99% and sensitivity should be over 99.9% of who and nib panel.tmb substrate should be stable ready.j.mitra / meril / erba / s.d. biosensor / g.b.c. tiwan 105 hbsag elisa kit 96 testwells coated with two or more monoclonal anti hbs ( murine and human origin ) .should detect all subtypes e.g. ad, ay, etc and variants and mutants. based on ag+ab sandwich assay streptavidin biotin technology for enhanced sensitivity andspecificity. 106 should be compatible with automated as well manual elisa technique. sensitivity should be over 99.9% of who and nib panels.specificity should be over 99.8%.tmb substrate should be ready to use.must be evaluated and approved by nib.96 test j.mitra / meril / erba / s.d. biosensor / novatech 107 incubator 18x18x18 s.s. per pcs isi 108 j.s.b. 1st stain 500 ml rankem / biolab / b.d.h / c.d.h 109 j.s.b. iindstain 500 mlrankem / biolab / b.d.h / c.d.h 110 ketodiastix50 strips semens / erba / accurex 111 l.d.h. kit accurex / erba / semens / randox 112 lancets per pcs plaza / top tech / s.d. 113 leishmaan stain liqued 500 ml rankem / biolab / b.d.h / c.d.h 114 leishmaan stain powder 500 grrankem / biolab / b.d.h / c.d.h 115 lipase kitaccurex / erba / semens / randox 116 malaria pf / pv ag test per test it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) . infection / cases at 50 parasite per ul of blood and higher at higher parasite density. it should be who approved. it should have sample volume not more than 3ul. j.mitra / s.d. bio sensor / meril / erba / 117 measuring cylinder 50 ml ( glass ) per pcs. 118 measuring cylinder 100 ml ( glass ) per pcs. 119 measuring cylinder 250 ml ( glass ) per pcs. 120 measuring cylinder 500 ml ( glass ) per pcs. 121 measuring cylinder 50 ml ( plastic ) per pcs. 122 measuring cylinder 100 ml ( plastic ) per pcs. 123 measuring cylinder 250 ml ( plastic ) per pcs. 124 methnol5 ltr rankem / biolab / b.d.h / c.d.h 125 methylene blue liquid 500 ml rankem / biolab / b.d.h / c.d.h 126 micro pipeete fix fully autoclavable with 3 years warrenty per pcs tranasia / finepipeete / thermo / durapet 127 micro pipeete variable fully autoclavable with 3 year warranty per pcs tranasia / finepipeete / thermo / durapet 128 micro protin kit accurex / erba / semens 129 micro tips up to 1000 ul 500 pcs gilson / labtech / a.v.dis 130 micro tips up to 200 ul 1000 pcs gilson / labtech / a.v.dis 131 microglass slide isi 50 slide bluestar / borosil / alphachem 132 microscope blub per pcs phillps / osram / bajaj / 133 multi chanal pipeete with 3 years warranty per pcs tranasia / finepipeete / tjermo / durapet 134 multi stix 14 parameter ( dekhaphen ) 100 st semens / transasia / accurex / durai / 135 n 95 mask per pcs romson / 3m / polymed / mrk / 136 nitral gloves 100 pcs romsom / m care / mrk / polymed 137 nitric adid 500 gr rankem / biolab / b.d.h / c.d.h 138 normal sline 500 ml rankem / biolab / b.d.h / c.d.h 139 o2 valve with humidifier per pcs isi 140 occult blood in stool 200 test tulip / accurex / biolab 141 oil immersion 100 ml rankem / biolab / b.d.h / c.d.h 142 ovan 18x18x18 s.s. per pcs isi / remi / 143 p.p.e kit per pcs drdo approved 144 pep stain per kit 145 paper roll 50x20 mtrper roll erba 146 paper roll 57x10 mtr per roll horiba 147 paper roll 57x20 mtr per roll erba 148 pasture pipeete per pcs lab tech / top tech / a.v. consumable 149 phosphrous kit accurex / erba / semens 150 pipeete stand per pcs plaza / top tech / expedia / labsystem 151 platlet diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 152 pregnancy card / hcg device per card acon / aspen / erba / diagnocure 153 r.a. test kit with control 100 test acurex / erba / spinreact / arkrey / biolab 154 r.b.c. diluting fluid 500 ml rankem / biolab / b.d.h / c.d.h 155 r.f. turbilatex 50 ml accurex / erba / human / arkrey / biolal 156 r.h. view box per pcs remi / plus / top tech / alpha 157 r.p.r. test 100 test tulip / erba / acurex / human / arkrey 158 rapid pap stain 250 simmer tulip / biolab / himedia 159 recticlusytes count fluid 100 ml rankem / biolab / b.d.h / c.d.h 160 ria tube 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 161 ria vial 12x100 mm 100 pcs labtech / toptech / a.v. consumable / polylab 162 room thermometer per pcs labtech / toptech / a.v. consumable / isi 163 s.g.o.t. kit 5x20 ml accurex / erba / semens / randox 164 s.g.p.t. kit 5x20 ml accurex / erba / semens / randox 165 sample cups from xl300 500 pcs erba / hitachi / top tech 166 screw cap tube 13x100 100 tube labtech / polylab / a.v. cons 167 scrub typhus elisa 96 test novatech / j.mitra / s.d.biosensor / g.b.c 168 seman diluting fluid 100 ml rankem / biolab / b.d.h / c.d.h 169 slide cage per pcs labtech / toptech / a.v.co / k.d 170 slide rack per pcs labtech / toptech / a.vcon / k.d 171 slide stand per pcs labtech / toptech / a.v.co / k.d 172 slide staning rack per pcs labtech / toptech / a.v. / k.d 173 sodium citrate 3.8% 500 ml rankem / biolab / b.d.h / c.d.h 174 sodium hypochloride 8 10 % 5 ltr rankem / biolab / b.d.h / c.d.h 175 stain rack per pcs labtech / toptech / a.v. / k.d 176 stethoscope per pcs litman / isi / 177 sulpher powder 500 gr rankem / biolab / b.d.h / c.d.h 178 surgical gloves 6, 7.5.7 pair m.r.k. / caltex / hll / 179 t.s.h. elisa 96 test j.mitra / erba / suyog / s.d. bio 180 t3 elisa96 test j.mitra / erba / suyog / 181 t4 elisa 96 test j.mitra / erba / suyog / 182 test tube borosil 12x100 mm with ring 100 pcs borosilicate glass 183 test tube borosil 12x75mm with ring 100 pcs borosilcate glass 184 test tube brush per pcs labtech / toptech / a.v. / k.d 185 test tube stand 48 hole per pcs 186 test tube stand 96 hole per pcs 187 thermoplastin5 ml j.mitra / erba / arkery 188 timmer watch digital per pcs k.d. / top tech / amron / isi 189 tincher iodine 400 ml 190 tissue paper roll per roll 191 total protin kit 5x50 ml accurex / erba / semens / randox 192 triglycerdies kit 5x20 ml accurex / erba / semens / randox 193 tronicate rubber per pcs 194 troponine i per card alfa / j.mitra / accurex / diagnocure 195 troponine t per card roche 196 tsutsugamuchi card per card j.mitra / s.d. biosensor / athenesedx / 197 tray for slide ( aluminium ) per pcs. 198 typhoid card igg / igm per card j.mitra / diagnocure / s.d. biosensor / 199 urea bertlot kit 2x100 det accurex / erba / semens / randox 200 urea bun5x20 ml accurex / erba / semens 201 uric acid kit 5x20 ml accurex / erba / semens 202 urine continer 50 ml with sticker individually packed per pcs labtech / a.v / top tech 203 uristix glu / ketone / pro 100 st semens / accurex / erba / transasia 204 v.d.r.l. cardper card assay for qualitative detection of all isotype of antibodies ( igm, igg & iga ) against treponema pallidium.it should must have a long shelf life & only in the form of card not in the form of strips.rapid card test in individual pack.it should be nib, naco, nari approvedmeril / s.d. biosensor / accurex / diagnocure 205 v.d.r.l. shaker per pcs remi / penpol / oxford / top tech 206 vacutanier clot, gel activete 13x75 mm 3 to 5ml ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate 207 batch wise sterility , pyrogenicity and toxicity certificate should be givenit should be usfda / europen ce certified. b.d. / 208 vacutanier k2 edta 13x75 mm ( 100 pcs ) it should be made of clear latex free polyethylene terephthalate batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.b.d 209 vacutanier sodium citrate 13x75 mm ( 100 pcs ) for coagulation test with sodium citrate 3.2% it should be made of clear latex free polyethylene terephthalatebatch wise sterility , pyrogenicity and toxicity certificate should be givenit should be sfda / europen ce certified. b.d 210 disposable vacuated blood collection multi sample needle 22gx1 inch batch wise sterility , pyrogenicity and toxicity certificate should be given it should be usfda / europen ce certified.per pcs b.d 211 viral transport media 50 vial icmr approved 212 w.b.c. fluid500 ml rankem / biolab / b.d.h / c.d.h 213 water bath per pcs remi / top tech / premier plus 214 widal kit 4x5 ml per kit arkery / becon / tulip 215 xylene 500 ml rankem / biolab / b.d.h / c.d.h 216 z.n. stain 4x50 ml rankem / biolab / b.d.h / c.d.h 217 covid ag card icmr approved test icmr approved 218 covid ab card icmr approved test icmr approved 219 covid elis igg icmr approved 96 test icmr approved 220 hand santizer500 ml icmr approved 221 hand santizer 5ltr icmr approved 222 automatic hand santizer machine pcs icmr approved 223 bandaid round pcs j&j / labtech / hll / mrk 224 cryocentrifuge machine ( 5500i ) blood bag bucket ( green colour ) per pc. 225 disposable needle noa. 26 & 24 per pcs b.d. / dispovan / nipro 226 micro tips stand ( small ) per pcs. 227 micro tips stand ( big ) per pcs. 228 micropopette 10 ul to 100 ulper pcs. tranasia / finepipeete / thermo / durapet 229 micropopette 100 ul to 1000 ulper pcs. tranasia / finepipeete / thermo / durapet 230 isopropyl alcohol solution 70% ( 500 ml ) per pcs. 231 gel card grouping per pcs.j. mitra / sd / bio / biorad 232 gel card cross matchper pcs.j. mitra / sd / bio / biorad 233 chest stand wall modelper pcs. 234 dental hangerper pcs. 235 x ray developer 13.5 ltrper pkt. 236 x ray fixer 13.5 ltr per pkt. 237 u.s.g. jelly 250 grper pcs. 238 e.c.g jelly 250 gr.per pcs. 239 e.c.g roll 8310m 210x20 ml per pcs. 240 eeg electrodeper pcs. 241 eeg pasteper pcs. 242 ecg battery digitalper pcs. 243 ecr battery for 108 tper pcs. 244 ecg beltper pcs. 245 ecg cable for digital per pcs. 246 ecg chest electrode per pcs. 247 ecg clip per pcs. 248 ecg roll for 108 tper pcs. 249 ecg roll for 6108 per pcs. 250 ecg rubber bulb per pcs. 251 ecg trolly per pcs. 252 glysrine 100 mlper bottle 253 lead aprinper pcs. 254 lead divider 7x17 per pcs. 255 tmt jelly 250 ml per pcs. 256 usg jelly 250 gr. per pcs. 257 usg printer roll per pcs. 258 usg tissue paper roll per pcs. 259 x ray cassetts 10x12per pcs. fuji / kodak / jindal 260 x ray cassetts 12x15per pcs. fuji / kodak / jindal 261 x ray cassetts 14x17per pcs. fuji / kodak / jindal 262 x ray cassetts 6.5x8.5 per pcs. fuji / kodak / jindal 263 x ray cassetts 8x10per pcs. fuji / kodak / jindal 264 x ray film 10x12 ( 150 films ) per pkt.fuji / kodak / jindal 265 x ray film 12x15 ( 150 films ) per pkt.fuji / kodak / jindal 266 x ray film 6.5x8.5 ( 150 films ) per pkt. fuji / kodak / jindal 267 x ray film 8x10 ( 150 films ) per pkt. fuji / kodak / jindal 268 x ray hanger 10x12 269 x ray hanger12x15 270 x ray hanger 14x17 271 x ray hanger 6.5x8.5 272 x ray hanger 8x10 273 x ray screen 10x12 fuji / kodak / jindal 274 x ray screen 12x15 fuji / kodak / jindal 275 x ray screen 14x17 fuji / kodak / jindal 276 x ray screen 6.5x8.5 fuji / kodak / jindal 277 x ray screen 8x10 fuji / kodak / jindal 278 ecg machine battery charger 279 x ray fixer 13.5 ltr. 280 tmt electrode 281 tmt report chart 282 x ray film dental 283 x ray film 14x17 284 8 x 10digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 285 10 x 12 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 286 11 x 14 digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 287 14 x 17digital x ray film ( 150 films ) per pkt. fuji / kodak / jindal 288 dental & occlusal x ray films 57x76 mm fuji / kodak / jindal 289 imaging plate and cassettes ( c.r.system ) 08”x10” fuji / kodak / jindal 290 imaging plate and cassettes ( c.r.system ) 10”x12” fuji / kodak / jindal 291 imaging plate and cassettes ( c.r.system ) 14”x17” fuji / kodak / jindal 292 protactive screen ( mobile ) lead barrier with lead glass window etc...

Medical And Health Services - Rajasthan

32923785 supply of furniture and equipment auction sale of unserviceable scrap condemned tools furniture scrap items mira big 2 almira smalu 3 cooler 4 ecg machine 5 fowler bad 6 fowler bad 7 honda genrator 1000k 8 invetor 2kva 9 invetor 2kva 10 pressor cooker 11 succtnon machine 12 videocon colour tv 13 videocon vcp 14 stead bad 15 singal drum autoclav 16 spotught 17 bp instrument 18 labour table 19 opration table 3 fold 20 instrument troly 21 |instument cabinate 22 battery dry 23 water moter 24 dressing troly 25 dressing troly 26 dressing troly 27 desepting forceed with tooth 28 desepting forceed non tooth 29 sinus forcep 30 pedicus forcep 31 stragiht artray forcep 32 curved artray forcep 33 forcep lower third moller 34 forcep upper third moller 35 chik retractor 36 shop scissor 37 scissor straight 38 plaster scissor 39 plaster sher 40 scissor opration 41 plaster bander 42 plaster saw 43 forcep ear 44 hook retrakor 45 laringo scoop pediatric 46 toung deprassur 47 laringo scoop adult 48 needle holder 49 prob with director 50 walkman spoone 51 bp handle no .3 52 bp handle no.4 53 nesal speculam 54 speculam veganal 55 mask anaesthia 56 sucction machine foot ope. 57 cathetar pros tate 58 weight scale child 59 vaginal sound steel 60 d&c set 61 dresssing box 62 diagnostisc set 3 specilum rectangle 64 utrus dilator set 65 spoonge forcep 66 foetal stethoscop 67 tubectomy set 68 disinfectal airsol 69 forcep sponge 70 scisssor mayostaight 71 scissor curved 72 scissor sharp 6 inch 73 scissor blunt 8ingh 74 tray instrument with covver 75 aryery forcep locked 76 sharp otenive 77 moller forcep child 78 dental elevator 79 fings forcep 80 artery forcep curved 81 scissor straight 7inch 82 catract knife 83 endotrachial metal convetor 84 dressing drum 9*9 85 laryngeer mirror 86 lacrycal prope 87 dressing drum 88 trail frame 89 suction matchine tip 90 stethoscope 91 dressing dum 92 mortal pastal 93 salb for pilo marking wire 4 emergency light 95 water filter r.0 96 therma meter case 97 buket ss with cover 98 bucket iron 99 ultra violet lamp with stand 100 flex board iron 101 electric sterlizer 102 |1.v stand iron 103 lift of patient stracher 104 foot step ss 105 8ad side looker 107 foot ste ss top dousle step 106 bad side screen 108 steel trunk medium sze 09 tetra element 110 celling fan 111 esr stand 112 iron conductor 113 wall lock 114 bagona brass 115 charoo brass 116 chamcha big iron 117 ei urinal female 118 el kidney tray 119 el tray square 120 e tray with cover 121 instrument tray 122 el jug 123 el bowel 124 |head light 125 |infant laryngo scope 126 baby balence hangar type 127 wash basin stand 128 bed pan 129 examintion couch (table) 130 backn rest 131 hight massuring stand 32 ktj 133 kit g 134 kittl 3 | s25 |140 28 21700 20 141 store |store store store store 11 264 15 144 2018 2018 2018 2018 2018 1 15 145 15 146 1997 1985 290 236 |10 147 148 |1985 1997 1997 185 7.5 store 148 |2018 2018 2018 2018 2018 store store store el 12 148 149 1989 1985 et 12 149 150 1985 1997 store store e steel 10 151 900 152 steel el store store store store store store store store store store store store |store store |2000 1997 1997 l.15 |2020 36 2017 6 153 lastic 2017 10 21 10 2015 2015 155 175 680 steel iron steel steel 1991 1996 10 161 1989 215 2019 162 |10 163 |1990 1990 850 2020 iro 2650 2020 15 l64 165 |iron 1997 290 20 167 172 172 iron 115 2020 15 2020 2020 steel |1994 1200 steel 1994 1200 |2020 fahti |173 steel 1994 1200 173 steel steel steel 1994 |1200 2020 135 kit e 136 kit f 137 kit d box 1 138 kitd 8ox 2 139 kiti_ 140 kittk 141 kit h 142 kit m box 1 143 kitm box 2 144 kittn 145 ort kit 146 scissor brass handle 147 dustbin 148 lock 149 dustbin bucket 150 chair cello 151 scssor gauge cutting 152 jkhau pipi_ 153 folding table 154 table comounding 155 |magetic chair 156 revolving stool 157 office table sanmica top 158 office chairi 159 cain sheet chair 160 tube light 161 cello chair 162 coolar 163 gluco meter 64 electric needle destroyer 65 tube lightpatri_ 166 change over 167 men panal 168 insulettar & ncb box 169 |changover samll 170 old vaiyar sweetich bord dunlop metress metress with water proof cover foam 27 2007 13230 2018 10 foam 12 2006 6240 2018 store 33 2 tyre ambulance tube ambulance 5 mva syring mouth gage midwifery kit box rt t| store rt e store 2021 nt ea ¥store at e store 2007 a th nstore 2007 t e store rt e store nt et store t e store 3 rubber 4 2001 11180 2011 43 4 rubber 2001 490 2011 43 plastic 2016 2235 49 6 rubber 1997 12 2017 74 88 1997 1987 1997 7 pop 20 8 family planning set pop 48 92 6 tuble inhilation set |10 vein stripele set 11 paper weight thermameter clinical plastic 108 rubber rubber 9 1 2007 1993 252 2010 120 glass 1985 16 2015 126 a ta store 127 225 4.25 1902 2977.3 2015 1985 1985 plastic 15 12 13 lacto meter 14 glass syring 5ml glass syring 10ml 16 galipot 250ml 17 shield rubber stamp tray wooden 20 rubber bag 21 suchana patt b0ard 22 ice cape 23 hot water bottel 24 aprian plastic 25 calias pad 26 suchana patt board 27 annesthisea face mask 28 syring ag 1ml 29 syring ag 2ml 30 chloroscop stool chair 33 table metress cotton 35 pillowo 36 pillowo cover bad sheet at store t e store ge store g store rt e store at *| store rt e store t b store tt e store t store t e store ar t store an e |store trra eta |store art b store art store 2021 ea store a *store r | store t hstore rt e store 2021arta st store 2021 ar e | store store 480 2019 2021 plastic 2002 164 rubber 2002 92 171 glass 2003 1500 2010 187 glass plastic wooden wooden 500 450 2003 1800 2010 187 2014 900 2020 194 200 2020 2020 1997 875 32 10 1987 2000 200 wooden 2020 200 cotton cotton cotton cotton cotton cotton cotton cotton cotton 1997 2001 2006 2006 20065 2006 250 8595 201 2021 2021 2021 2021 34 62 5208 202 200 2274 203 400 204 37 napkin towel blanket 2000 1311 26472 3000 38 57 2021 205 2006 2021 206 39 40 apprne oration green 41 patient gown 42 cotton white apprain 43 dari big size 44 dari small size 45 jam red blue 46 duster gray draw sheet 48 parda cloth mask geen 50 cap green 51 green cloth cotton kakhi 53 towal big 54 pocha 55 table wooden 56 opration table chair 58 chair cain sheet 59 wooden stool 60 protective apron wooden 1997 2006 2006 2006 2005 2009 1997 1997 36 2020 store store 15 237 plastic 370 2020 tt 6 month t56 month 276 61 protective gloves plastic plastic 228 2020 2020 store 62 protective boots 63 utility gloves 64 ice pack plastic 65 277 278 280 170 730 store rubber 20 480 2020 store tt 6 month plastic paper paper pastic glass plastic plastic wooden 100 1200 2021 store fprtt near vision chart 66 distance vision chart 67 blue rod 68 syringe glass2 ml 69 soap disc plastic 70 waspar farsh plastic 71 hospitl time board inj.buvicain 150 inj.ketamin inj.thio penpone sodium inj. pancuroniun bromied 5 inj. succinyl cholne 6 tab aciclovir200mg tab arv drug 8 endo treaccaltubes etc ...

Medical And Health Services - Rajasthan

32750421 procurement through gem x ray machine • automated hematology analyser 5 part, high vacuum suction machine for medical purposes , icu bed with cardiac monitor , ecg machine • truenat with rtpcr with extraction, laryngoscope, refrigerator, x ray ilm processing tank, bp apparatus table model, infrared lamp theraphy, opthalmoscope, labour and examination table ...

Sawai Man Singh Medical College - Rajasthan

32672805 tender for supply of disposable items for laboratory blood bank tender for supply of disposable items for laboratory blood bank , disposable plastic tips white ( round ) 300 micro ltr , tips round1 ml blue , disposable plastic test tubes with cap ( srew cap ) , disposable plastic test tubes without cap , band aid ( water proof ) , glass test tube ( 12 x 100 mm ) ( plain ) , capillary tubes for b.t.& c.t ( 1x100 pcs. ) , elisa printer roll ( 57 mm x 30 meter roll , e.s r pipette ( disposable plastic ) , double blood bags cpd sagm 350ml / 450 ml , triple blood bags cpd sagm350 ml / 450 ml , quadruple blood bags cpd sagm ( top & top ) 350ml / 450 ml , quadruple blood bags cpd sagm ( top & bottom ) 350 ml / 450 ml , filter paper , tissue paper white colour , lanset , glass slide , glass marking pencil , sponge rubber ball , plastic dropper 1 ml , urine container with cap made ofpollypropylene grade r 120 mlk , plastic beaker 250 ml , torniquates , elisa washer bottle 2 ltr. , disposable polly thene gloves , disopsable plasite tips 200 microltr. , cover slip ( 22x22 mm ) pack of 10 gm , evacuated blood collection ( plastic ) tube with spary dried k2 edta 5.4mg for 03 ml haematology estimations with hemogard closure ( 1x100 ) , evacuated blood collection ( plastic ) tube with 3.2 %buffered sodium crtrate forcoagulation studies 2.7 mland tube in tube technology sealed from the top to avoid citrate leaakage from the top with hemogard closure ( 1x100 ) , evacuated blood collectiontube ( plastic ) for serum ( with silica clot activater ) , evacuated blood collection ( plastic ) tube with powdered sodium fluoride+na2 edta for glacose estimation 02 ml, from plasma with hemogard closure ( 1x100 ) , evacuated tube needle holder ( 1x100 ) , printer roll for coagulation analyzer, 105mm , printer roll for cell counter 52mmx30 mtr , printer roll for urine analyzer 57 mmx 30 mm , evacuated needle 22 gauze with safety shiled ( 1x100 ) , peaditric cup , ecg roll for bionat ecg machine , ecg roll for medicaid ecg machine , hi techi cup...

Rajasthan Medical Services Corporation Limited - Rajasthan

32588710 supply of items for primary trauma centres on turnkey model i ecg machine 12 channe 2 a type nitros oxide cylinder mild steel artery tbrceps eriles cur. ed on flat box joint 3 12 inches artery forceps eriles cur ed on flat box joint 4 15 inches artery forceps eriles cur ., ed on flat box joint 5 6 inches artery forceps eriles cursed on flat box joint 6 8 inches 7 artery forceps eriles stmght box joint 6 inches 8 bed side locker 9 bed side screen bipap mask ventilator ell cushioned face 10 mask bone cutting drilling & eaming system — cctv canera sarveilia, system ( sarveiliance camera set 16 camreras. 1 dvr setjledtv ) 12 13 dressing drum electrical suction machi e 15 examination table [ 18jicubed ilii 14 16 17 fowler bed with mattresses & cushion fracture table icu bed ilu isea instrument tray with lea d made with think 19 gange s.s. sheet size to’ *8n 20 instrument trolley 21 kidney tray.s.s._si 0’ 22 medicine cabinet 23 mini laparotomy set 24 multi para monitor 25 patient attendant bench with mattress 26 patient stretcher trolley 27 revolving stool 28 sonography color doplei system 29 split air conditioner 2.0 ton 30 strelizer forceps cheatle pattern 10 inches 31 vaceum cleaner ( wet & dry ) 32 wheel chair...

Medical College - Rajasthan

32554279 procurement of consumables accessories for schiller make ventilator neumovent graphnet ts / multipara monitor / pluse oximeter / ecg machine 1 reusable adult patient circuit . 2 reusable pediatric patient circuit 3 reusable neonatal patient circuit 4 disposable adult patient circuit 5 disposable pediatric patient circuit without water trap 6 disposable neonatal patient circuit with 2 water trap 7 disposable pediatric patient circuit with 2 water trap b disposable adult patient circuit with 2 water trap disposable neonatal patient circuit with heating wire 1 water _ _ trap_and__dispp_humidifier_chamber 10 disposable pediatric patient circuit wmth heating wire 1 water trap and dispo humidifier chamber 11 disposable adult patient circuit wth heating wire, 1 water trap and dispp humidifier chamber 12 aeroneb ultrasonic nebulizer model aeroneb pro 13 pneumatic nebumization kit disposable ( includes t piece ) _ flexicare for 5nos. 14 neonatal test lung ( 3oml ) local 15 neonatal test lung ( 3oml ) imported 16 adult test lung local ( l000ml ) 17 pediatric silicon test lung ( 500m1 ) imported 18 adult test uung 10oo ml silicon with plastic flap 19 reusable expiratory filter 2o reusable inspiratory filter 21 disposable bacteria filters 22 disposable hme rilters adult 23 disposable hme filters pediatric 24 disposable hme filters neonatal 2s non invasive mask, small, disposable ) pneumocare 26 non invasive mask, med disposable pneumocare 27 non invasive mask, large disposable pneumocare 28 non lnvdeive mask, small, ( re useable ) pneumocare 29 non invasive mask, med ( re useable ) pneumocare 3o non invasive mask, large, ( re useable ) pneumocare 31 trolley with compressor mount indigineous tecrp 32 trolley without compressor mount? tecme ‘o‘. * 33 hmported trolley ( without compressor mounting ) tecme 34 imported trolley with compressor mounting tecme 35 trolley with compressor mount indigineous mek 36 air hose 37 oxygen hose 38 articulating support arm indigenous 39 single stageoxvgen regulator ( preset 4 bar ) 40 double stageoxygen regulator ( upreset 4 bar ) 41 etco2 sensor 42 reusable adult pediatnc adaptor — 43 reusable neonatal adaptor 44 disposable adult pediatric adaptor 45 disposable neonatal adaptor 46 li ion battery 11.1v 5.2ah ( 6 ceul ) . units sl.no. 47 expiratory valve 48 expiratory valve diaphgram 49 afd30 02d air filter 50 proximal flow sensor ( .1o units ) 51 silicone patient circuit plug ror initial calibration...

Sms Medical College - Rajasthan

32364837 supply of spare parts of ecg machine pddu hospital jaipur tit 2 battery 3 clamp electrode per set 4 bulb electrode per set 5 palient cable 6 ecg main card 7 key pad 8 printer 9 paper roll per roll lo on/off switch ii jelly 12 ejector knob 13 ejector guide 14 3v battery 15 changer 16 ecg top cover 17 charger ...

Rajasthan Rajya Vidhyut Utpadan Nigam Limited - Rajasthan

32279692 requirement of medical equipment for ambulance rj 28 pa 1937 of csctpp, chhabra canvas stretcher folding type 1 2 blood pressure monitor led 1 3 stethoscope t 4 cervical collar 1 e first aid box t 6 portable glucometer with strips pack 7 7 nebulizer 7 8 suction machine portable / electrical t i pulse oximeter 1 10 oxygen cylinder with keys ( type b ) 1 11 ecg machine 1 12 rescue splints & bandages pack 1 13 dressing kit 1 14 gloves ( pack of 100 ) l 15 syringe & needle 7 t6 cold pack 2 17 blanket 2 18 bedsheet 5 19 tourniquet 2 20 ambu bags pack 1 21 oxygen regulator with mask kit...

Medical Health And Family Welfare - Rajasthan

32266168 mukhya mantri ne shulk jach yojana ke tahat prayogshala, blood bank, sonography, exray department me upayog hetu vibhinn prakar ke test kits, reagents avm any samgari apurty karya year 22 23 mg hospital bhilwara mukhya mantri ne shulk jach yojana ke tahat prayogshala, blood bank, sonography, exray department me upayog hetu vibhinn prakar ke test kits, reagents avm any samgari apurty karya year 22 23 mg hospital bhilwara , hb meter tube ( square ) ( h b meter sahilis ) ( 1x1 tube ) , whatsmans filter paper ( circular ) ( bt manual ) ( 1x100 pcs ) , lancet ( bt manual ) ( 1x200 pcs ) , capillary tube fine ( bt ct manual ) ( 1x100 tube ) , neubar chamber ( tlc manual ) ( 1x1 unit ) , methanol ( dlc & pbf manual ) ( 1x2.5 ltr ) , methanol ( dlc & pbf manual ) ( 1x500 mlf ) , field stain ( dlc & pbf manual ) ( 1x500 ml a+1x500 ml b ( a+b ) kit ) , field stain ( dlc & pbf manual ) ( 1 kit ) , cedar wood oil ( dlc & pbf manual ) ( 1x500 ml ) , platelate count fliud ( dlc & pbf manual ) ( 1x100 ml ) , petridish ( for moisture ) ( dlc & pbf manual ) ( 1*1 pcs ) , petridish glass medium ( 1x1 ) , reticulocytecount fliud ( dlc & pbf manual ) ( 1x100 ml ) , mgg stain ( dlc & pbf manual ) ( 1 kit ) , leishmansstain ( dlc & pbf manual ) ( 1 kit ) , esr stand with marking ( esrmanual ) ( 1x1 pcs ) , esr test cup ( plastic ) ( esrmanual ) ( 1x500 cup pkt ) , esr pipette ( glass ) ( esrmanual ) ( 1x5 pipette ) , esr pipette with bulb ( disposable autosuck ) ( esr manual ) ( 1x100 pipette ) , tri sodium citrate 3.8% ( solution ) ( esr manual ) ( 1x500 ml ) , stop watch ( esr manual ) ( 1x1 pcs ) , eosinophil diluting fluid ( tec manual ) ( 1x125 ml ) , paper roll 2 thermostat ( urine complete manual ) ( 1x1 roll ) ( 1x1 roll ) , lugols iodine ( stool test manual ) ( 1x125 ml ) , modified rothras nitropruside ( common reagent for urine stool manual ) ( 1x250 gm ) , 33% acetic acid ( common reagent for urine stool manual ) ( 1x500 ml ) , 5% barrium chloride powder ( common reagent for urine stool manual ) ( 1x500 gm ) , fouchetes reagents ( common reagent for urine stool manual ) ( 1x125 ml ) , sulpher powder ( common reagent for urine stool manual ) ( 1x400 gm ) , hydrogen peroxide ( common reagent for urine stool manual ) ( 1x400 ml ) , benzidine powder ( common reagent for urine stool manual ) ( 1x25 gm ) , semen diluting fluid ( semen analysis manual ) ( 1x100 ml ) , keto diastic ( for urine manual ) ( 1x50 ) , hemo spot test for occult blood ( 1x100 ) , glass jar ( for staining ) 250ml ( 1x1 ) , trop t rapid ( cardic enzyme test ) ( 1x1 ) , trbc fluid ( rbc count manual ) ( 1x100 ml ) , coombs reagent ( abo rh agglutination, slide ) ( 1x5 ml ) , coombs reagent ( abo rh agglutination, slide ) ( 1x10 ml ) , urea berthlot ( for semi auto urease end point ( liquid ) ( 2x100 ml ) , urea kinetic ( for semi auto ) ( liquid ) ( 5x20 ml ) ( 5x20 ml ) , sgot for semi auto ( without pridoxal phosphate ifcc method ) ( liquid form mono vial ) ( 5x20 ml ) , sgpt for semi auto ( without pridoxal phosphate ifcc method ) ( liquid form mono vial ) ( 5x20 ml ) , alkaline phosphate kinetic ( for semi auto, pnpp ) ( liquid form mono vial ) ( 12x5 ml ) , total protein ( semi auto analyzwer ) ( liquid ) ( 2x50 ml ) , albumin ( semi auto analyzwer ) ( liquid ) ( 2x50 ml ) , bilirubin total ( for semi auto, jendrassik & grof ( liquid ) ( 1x200 ml ) , bilirubin direct ( for semi auto, jendrassik & grof ( liquid ) ( 1x200 ml ) , uric acid ( for semi auto, mono vial ) ( liquid form mono vial ) ( 1x50 ) , calcium ( for semi auto, mono vail ) ( liquid form mono vial ) ( 1x50 ml ) , ck mb kinetic ( for semi auto ) ( liquid form mono vial ) ( r1 2x8 mlr2 2x1 ml ) , ck nac kinetic ( for semi auto ) ( liquid ) ( r1 2x8 mlr2 2x1 ml ) , amalyse kinetic ( for semi auto ) ( liquid form mono vial ) ( 2x20 ml ) , cholesterol ( for semi auto, enzymatic ) ( liquid ) ( 2x50 ml ) , hdl cholesterol ( for semi auto ) ( liquid ) ( 2x20 ml ) , triglycerides enzymatic ( for semi auto ) ( liquid ) ( 1x50 ml x4 ) , csf protein fluid ( for csf protein manual ) ( liquid ) ( 1x100 ml ) , hepatitis b ( hbsag ) strip ( 1x50 ) , hepatitis b ( hbsag ) strip ( 1x100 ) , hepatitis b ( hbsag ) elisa 4th generation ( 1x96 ) , vdrl elisa anti body test ( 1*96 ) , vdrl rpr ( rapid ) kit ( 1x50tests ) , vdrl rpr ( rapid ) kit ( 1x100 test ) , hiv rapid combaids ( 1x48 ) , hcv elisa 4thgeneration ( 1x96 ) , aslo kit ( agglutination ) ( 1x50 ) , aslo kit ( agglutination ) ( 1x100 ) , r.a. factor kit ( agglutination, qualitative ) ( 1x50 ) , r.a. factor kit ( agglutination, qualitative ) ( 1x100 ) , jsb i ( mp test slide method ) ( 1x500 ml ) , jsb ii ( mp test slide method ) ( 1x500 ml ) , sprit lamp ( sputum for afb staining ) ( 1x1 ) , crp ( latex agglutination ) ( 1x50 ) , dengue elisa antigen ( ns1 ) ( 1x96 ) , scrub tyhpus elisa ( antibody igm ) ( 1x96 ) , scrub tyhpus elisa ( antibody igm ) ( 1x48 ) , chikungunya elisa ( antibody igm ) ( 1x48 ) , transfer blood bag ( without anti coagulant ) 100 ml ( 1x10x10 ) , transfer blood bag ( without anti coagulant ) 50 ml ( 1x10x5 ) , bio medical waste white bucket with pedal top 25 lit. ( 1x1 ) , ns ( 0.9% ) normal saline ( 1x500 ml ) , test tube rack plastic 1x96 wells ( 1x1 ) , pipette stand plastic ( 1x1 ) , antisera stand plastic ( 1x1 ) , anti a polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , anti b polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , anti d polycolonol ( abo rh agglutination, slide ) ( 1x10 ml ) , dropper plastic 5 ml ( 1x100 ) , micropore transparent tape 1 ( 1x1 ) , micropore transparent tape 3 ( 1x1 ) , band aid ( 1x100 ) , printer ribbon dot matrix ( 1x10 ) , clot activator vial 3ml ( 1 *100 ) , plain test tube screw cap5ml ( 1x100 ) , liquid paraffin ( for microscope ) ( 1x500 ml ) , tourniquet ( buckle type ) ( 1x1 ) , rectified spirit ( 1x500 ml ) , phenyl ( 1x5 ltr ) , mop ( 1x1 ) , dusting cloth ( 1x1 ) , b.p. instrument ( mercury ) ( 1x1 ) , b.p. instrument cuff with cover ( 1x1 ) , weight machine arroe up to 150 kg ( 1x1 ) , tips stand ( 1x1 ) , beaker glass 250 ml ( 1x1 ) , beaker glass 500 ml ( 1x1 ) , measuring cylinder 250 ml ( 1x1 ) , measuring cylinder 500 ml ( 1x1 ) , measuring cylinder 1 ltr ( 1x1 ) , slipeer rubber ( 1x1 ) , micro pipette 5 50ul ( variable ) ( 1x1 ) , paper gloves ( 1x100 ) , surgical examinination gloves ( free size ) ( 1x100 ) , test tube rack plastic ( 1x48 wells ) ( 1x1 ) , test tube rack plastic ( 1x96 wells ) ( 1x1 ) , test tube rack plastic ( 1x24 wells ) ( 1x1 ) , slide tray aluminium for 20 slides ) ( 1x1 ) , slide tray aluminium for 24 slides ( 1x1 ) , disposable needle 22 nos ( 1x100 ) , disposable needle 24 nos ( 1x100 ) , disposable needle 26 nos ( 1x100 ) , disposable syringe 10cc with needle ( 1x50 ) , blue tips ( 1x500 ) , d.i. water ( 1x5 ltr ) , glass marking pencil ( 1x10 ) , permanent marker pen ( 1x1 ) , marker pen fine tip ( 1x1 ) , cotton ( 1x500 gm ) , cpda penta bag 450 ml ( 1x1x1 ) , d.w. ( 0tds ) ( 1x5ltr ) , lipase ( for semi auto ) ( liquid form mono vial ) , ggt ( for semi auto ) ( liquid form mono vial ) , hba1c ( for semi auto ) ( liquid ) , na+ ( for semi auto ) ( liquid form mono vial ) , k+ ( for semi auto ) ( liquid form mono vial ) , cl ( for semi auto ) ( liquid form mono vial ) , accucheck active ( blood sugar strip ) ( 1x50 ) , glucometer cell ( 1x1 ) , carbon bush for centrifuge machine ( 1x2 ) , scalpal blade 11 to 23no ( 1x100 pcs ) , syringe 20 cc with needle ( 1x25 pcs ) , syringe 50 cc with needle ( 1x25 pcs ) , torch igm elisa ( 1x96 ) , torch igg elisa ( 1x96 ) , hepttitis a elisa ( 1x96 ) , hepttitis a elisa ( 1x48 ) , thermal printer paper roll ( size 57x25mm ) ( 1x12 ) , anti hav rapid card ( 1x50 ) , anti hev rapid card ( 1x50 ) , hiv elisa ( igg+igm+antibody combo ) ( 1x96 ) , hiv elisa ( igg+igm+antibody combo ) ( 1x48 ) , surgical knife blade 23 no. ( 1x100 ) , clear glass round shape ( 1x1 ) , aluminium screw for 30 ml glass bottle ( 30 ml ) , bath soap80gm , gdw 5% ( glass bottle ) ( 500 ml ) , gns ( glass bottle ) ( 500 ml ) , digital weighing machine cell ( 1x1 ) , pencil cell ( small / medium ) ( 1x1 ) , liss / coombs ( 24x12 ) , diluent ( 1x500 ml ) , glass slide size 75mmx25mmx1.35mm ( blue star ) ( 1x50 ) , tpha rapid kit ( 1x1 ) , micropore tap 4 ( 1x1 ) , anti human globulin ( ahg ) ( 1x1 ) , biological indicator of autoclabe machine ( 1 roll ) , ana ( 16 strips ) , japanese encephalitis igm ( 1x96 tests ) , rota virus igm elisa ( 1x96 ) , rotavirus / adenovirus latex agglutination ( 1x100 test ) , brucella igm elisa ( 96 test / kit ) , measles igm ( mu capture ) ( 1x96 tests ) , rubber chestbulb for ecg lead ( 1 pcs ) , cotton mop ( 1x1 ) , dry mop ( 1x2 ) , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) ( 1x500 ml ) , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) ( 1x1 ltr ) , h2o2 ( 11% ) + silver nitrate solution ( 0.01% w / v ) ( ecoshield ) ( 1x5 ltr ) , mannitol motility agar ( 500 gm ) , kovacs indole reagent ( 500 ml ) , mannitol powder ( 500 gm ) , glucose powder ( 500 gm ) , lactose powder ( 500 gm ) , sucrose powder ( 500 gm ) , hydrogen peroxide 3 / 6% ( 500 ml ) , oxidase disc ( 50 disc ) , potassium di hydrogen phosphate powder 500gm ( 500 gm ) , robertson’s cooked meat broth medium 500 gm ( 500 gm ) , bile salt powder with cholic acid content >= 45.0%, certified, ( 250 gm ) , crystal violet powder 100 gm / pack ( 100 gm ) , thioglycollate powder 500 gm ( 500 gm ) , iodine crystals ( 100 gm ) , sodiumbicarbonate 500 gm ( 500 gm ) , calcium chloride 100 gm ( 500 gm ) , zeihl neelsen stain kit500 ml with proper cas number, certified ( 500 ml ) , acetone 500 ml ( 501 ml ) , leishman stainpractical grade for microsopy twin pack 500 ml ( 502 ml ) , leishman stainpractical grade for microsopy 100 gm powder ( 100 gm ) , bile esculin agar 500 gm ( 500 gm ) , sda with chloramphenicol500 gm ( 500 gm ) , lowenstein jensen powder 500gm ( 500 gm ) , phenol crystals 500 mg ( 500 mg ) , mannitol motility agar 100 gm ( 100 gm ) , ferric chloride powder 500 gm ( 500 gm ) , cefoxitin + cloxacillin ( 2000 discs ) , glass slides size 75mm x 25mm x 1.35 mm, 50 / pk ( 50 pcs ) , mccartney bottle w / aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml ; 100 / pk ( 100 pcs ) , mccartney flat bottle :aluminium cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 30 ml; 100 piece / pack ( 100 pcs ) , volumetric conical erlenmeyer flask ( glass ) 50 ml graduated w / stopper, class a, usp certificate, ( 5 pcs ) , volumetric conical flasks, erlenmeyer, narrow mouth, 100 ml ( 5 pcs ) , volumetric conical erlenmeyer flask ( glass ) 500 ml graduated class a , usp certificate ( 5 pcs ) , test tube glass size 12cm x 150 mm ( 50 tubes per pack ) ( 5 pcs ) , measuringpipette with rubber bulb 10 ml ( mohr type ) class b ( 5 pcs ) , falcon tube ( conical ) polypropylene 15 ml 1 pack of 300 each ( 300 pcs ) , screw cappedvial 3 ml polypropylene for serum storage ( 2 pcs ) , ph paper strips 1 14 ph range himedia , fisher scientific ( 200 strips ) , stainless steel forceps, pointed tips and handles 8 inch, 2 no / pack , test tube washing brushes steel ( pack of 10 ) ( 10 pcs ) , zinc sulphate 100gm ( 100 gm ) , s. magnisium for semi auto analyzer ( liquid form mono vial ) , s. acid phospsphataze semi auto analyzer ( liquid form mono vial ) , s. phosphorus semi auto analyzer ( liquid form mono vial ) , red top vaccutainer 2.5 ml ( clot activater ) ( total volume 5 ml ) ( 1x100 ) , x ray fixer ( 20 ltr making ) , x ray developer ( 20 ltr making ) , digital x ray film size 8x10 ( 125 film per kit ) , digital x ray film size 10x12 ( ) ( 125 film per kit ) , digital x ray film size 11x14 ( ( 125 film per kit ) , x ray fixer ( 13.5 ltr making ) , x ray developer ( 13.5 ltr making ) , ecg machine charger , sonography soni paper roll , sonography jelly , dental x ray fixer ( 1 ltr ) , dental x ray developer ( 1 ltr ) , ra factor quantative ( for semi auto ) ( 1x25 test ) , aslo kit quantative ( for semi auto ) ( 1x25 test ) , crp quantative ( for semi auto ) ( 1x25 test ) , rapid thypi ( igg+igm card ) ( 1x50 test ) ...

Medical And Health Services - Rajasthan

32210879 supply of test kits , reagents other items for laboratory , blood bank sonography x ray department 1. hb meter tube (square) (h b meter sahilis) 2. 3. whatsmans filter paper (circular) (bt manual lancet(bt manual) capillary tube fine (bt ct manual) 4. 5. neubar chamber (tic manual) 6. methanol (dic & pbf mantal) 7. methanol (dic & pbf maneal) 8. field stain (dic & pbf manual) 9. field stain (dlc & pbf manual) 10. cedar wood oil (dlc & pbf manual) 11. platelate count fluid (dtc & pbf manual) 12. petridish (for moisture ) (dtc & pbf manual) 13. petridish glass medium i reticulocyte count fluid (dtc & pbf manual) 14. 16. leishmans stain (dic & pbf manual) 17. esr stand wth marking (esr manual) 18. esr test cup (plastic) (esr manual) 19. esr pipette (glass) (esr manual) — 20. esr pipette with bulb (disposable autosuck) (esr manual) 21. tr sodium citrate 3.8% (solution) (esr manual) 22. stop watch (esr manual) 23. eosinophil diluting fluid (tec manual) 24. paper roll 2w thermostat (urine complete_manual) 25. lugols iodine (stool test manual) modified roiliras nitroprusid (common reagent for urine stool manual) 33% acetic acid (common reagent for urine stool manual) 5% barrum chloride powder (common reagent for urine stool manual) _____________ fouchetes reagents (common reagent for urine stool manual) ::. 28. 29. 30. sulpher powder (common reagent for urine stool manual) 31. hydrogen peroxide (common reagent for urine stool manual) 32. benzidine powder (common 33. reagent for urine stool manual) semen diluting fluid (semen analysis manual) keto diastic (for urine manual) 34. 35. hemo spot test for occult blood 36. glass jar (for staining) 250ml 37. trop t rapid (cardic enzyme test) 38. trbc fluid (rbc count manual) 39. coombs reagent (abo rh agglutination,slide) 40. coombs reagent (abo rh agglutination,slide) 41. urea berthlot (for semi auto urease end point (liquid) 42. urea kinetic (for semia aut)(lliquid 43. sgot for semi auto (without pridoxal phosphate ifcc method)(liquid form mono vial) 44. sgpt for 5emi auto (without pridoxal phosphate ifcc method)(liquid form mono vial) 45. alkaline phosphate kinetic (for semi auto, pnpp)(liquid form mono vial) 46. total protein (semi auto analyzwerflliquid) 47. albumin (semi auto analyzwer)(liquid) bilirubin total direct uric acid (for seml auto,mono so. vial)(liquid form mono vial) calcium (for semi auto,mono 51 vail)(liquid form mono vial) 52. ck.mb kinetic (for 5emi atto(iiiqudd form mono vial) 53. ck nac xinetic (for semi atto(ilqquid 54. amalyse kinetic (for semi uuoo(lliuuid form mono vial) 55. cholesterol (for semi auto,nnymaati)(lliquid 56. hdl cholesterol (for semi auto(iliquid 57. triglycerides enzymatic (for semi auto)(liquid) 58. csf protein fluid (for csf protein manual)(liquid) 59. 60. 61. 62. 63. hepatitis b(hbsag) strip hepatitis b (hbsag) strip hepatitis b (hbsag) elisa 4th generation vdrl elisa anti body test vdrl rpr( rapid) kit 65. hiv rapid combaids 66. hcv elisa 4th generation 67. a5lo kit (agg’utination) 68. aslo kit (agglutination) 69. r.a. factor kit ___ (agglutination.qualitative) — 70, r.a. factor kit _____ (agglutination.qualitative) 71. jsb l (mp test slide method) 72. jsb ll (mp test slide method) 73. sprit lamp (sputum for mb staining) 74. crp (latex agglutination) 7s. dengue elisa antigen (ns1) 76. scrub tyhpus elisa (antibody i gm) 77. scrub tyhpus [lisa (antibody gm) 78. chikungunya [lisa (antibody 1gm) •0 79. transfer blood bag (without anti coagulant) 10o ml — 80. transfer blood bag (without anti coagulant).so ml 81. bio medical waste white bucket with pedal top 25 lit. ns(0.9%) normal saline test tube rack plastic 1x96 wells 82. 83. 84. pipette stand plastic 85. antisera stand plastic 86. anti a polycolonol (abc rh agglutinatiorn,slide) 87. — anti b polycolonol (abc rh agglutination.slide) 88. — anti d polycolonol (abo rh agglutination,slide) 89. dropper plastic 5 ml 90. micropore transparent tape 1 91. micropore transparent tape 3” 92. band aid 93. printer ribbon dot matrix 94. clot activator vial 3m1 95. plain test tube screw cap sml 96. liquid paraffin (for microscope) 97. tourniquet (buckle type) 98. rectified spirit 99. phenyl 100j mop 1014 dusting cloth 102. b.p. instrument (mercury) 103. b.p. instrument cuff with cover 104. weight machine arroe up to 1s0 kg 105.1 teps stand 106. beaker glass 250 ml 107. beaker glass 500 ml 108. measuring cylinder 250 ml 109. measuring cylinder 50o ml 110. measuring cylinder 1 ltr 111 slipeer rubber 112 micro pipette 5 soul (variable) 113 paper gloves l__________ surgical examinination gloves (free size) 114 115 test tube rack plastic (1x48 wells) 116. test tube rack plastic (1x96 wells) 117 test tube rack plastic (1x24 weus) 118 slide tray aluminium for 20 slides 119 slide tray aluminium for 24 slides 120 disposable needle 22 nos 121 disposable needle 24 nos 122 disposable needte 26 nos 123 disposable syringe 10cc with needle 124. blue tips 125 di. water 126 glass marking pencil 127 permanent marker pen 128. marker pen fine tip 129j cotton 130. cpda penta bag 450 ml 131. d.w.(otds) 132 lipase (for semi auto)(liquid form mono vial) — 133. ggt (for semi auto)(liquid form mono vial) 134. 135. ________ hba1c (for semi autol(liquid) na+ (for semi auto)(liquid form mono vial) 136. k+ (for semi auto)(hquid form mono vial) 137. cl (for semi.auto)(liquid form mono vial) 138. accucheck active (blood sugar strip 139. glucometer cell 140 carbon bush for centrifuge machine 141. scalpal blade 11 to 23no 142.1 syringe 2o cc with needle 143 — 5yringe 50 cc with needle 144. m torch lgmelisa 145 — torch lgg elisa 146, — 147, — hepttitis_a_ehsa hepttitis a elisa thermal printer paper roll — 149. 150. anti hav rapid card anti hev rapid card 151. hiv elisa (lgg.igm.antibody combo) 152 hiv elisa (lgg.lgm+antibody combo) 153 surgical knife blade 23 no. 154 clear glass round shape aluminium screw for 3o ml glass bottle 155 156. bath soap 80gm 157. gdw 5% (glass bottle) 158 gns (glass bottle) 159 digital we.ghing machine cell 160 pencil cell (small/medium) 161 liss/coombs 162 diluent 163 glass slide size 75mmx25mmx1.3smm (blue star) 164. tpha rapid kit 165. micropore tap 4 166. anti human globulin (ahg) 167. biological indicator of autoclabe machine 168. ana 169. japanese encephalitis lgm 170. rota virus lgm elisa 171 rotavirus/adenovirus latex agglutination 172. brucella lgm elisa 173. measles lgm (mu capture) 174. rubber chest bulb for ecg lead 175. cotton mop 176 dry mop 177 h202 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) 178. m h202 (11%)+ silver nitrate solution (0.01% w/v) (ecoshield) —179. h202 (11%)+ silver nitrate sotution (0.01% w/v) (ecoshield) 18o. mannitol.motihty agar 181 kovscs indolereagenlt 182 mannitolmpowder ____________ 183 glucose powder 184 lactose powder 185 sucrose powder 1s6 hydrogen peroride 3/6% 187 oxidase disc ______ ____ 188 potassium di hydrogen _______ phospbate powder 500gm 189 robertsons cooked meat broth _______ medium_5o0gm 190 bile salt powder with cholic acid content >= 45.0%, certified, 250 ________ gm 191 crystal violet powder 100 ________ gm/pack 192 thioglycollate powder 500 gm 193 iodine crystals 194 sodium bicarbonate 5oc gm 195 calcium chloride 100 gm 196 zeihl neelsen stain kit 500 ml 197. acetone 500 ml 198. leishman stain practical grade for microsopy twin pack 500 ml 199. leishman stain practical grade for microsopy 100 gm powder 200. bile esculin agar 500 gm 201. 5da with chloramphenicol 500 gm 202 lowenstein jensen powder 500gm 203. phenol crystals 500 mg 204. mannitol motility agar 100gm ferric chloride powder 500 gm 205. 206. cefoxitin + cloxacillin 207. glass slides size 75mm x 25mm x_1.35_mm,_50/pk 208. mccartney bottle w/ aluminium cap with rubber liner, neutral glass, autoclavable, capacity 15 ml: 100/pk 209 mccartney flat bottle :aluminjum cap with bromo butyl rubber liner, neutral glass, autoclavable, capacity 3o ml; 10o piece /pack volumetric conical erlenmeyer flask (glass) so ml nraduated w/ stopper, class a,usp certificate, 216. screw capped vial 3 ml polypropylene for serum storage 210. 211. voumetric conical flasks, erlenmeyer, narrow mouth, 10o ml 212. volumetric conical erlenmeyer flask (glass) 50o ml graduated class a, usp certificate 213 test tube glass size 12cm x 150 mm (so tubes per pack) 214 measuring pipette with rubber bulb 10 ml (mohr type) class b 215. falcon tube (conical) polypropylene 15 ml 1 pack of 300 each . ,., i ? 217. ph paper strips 1 14 ph range _____e himedia , risher scientific 218. 5tainless steel forceps, pointed tips and handles 8 inch, 2 ______ no/pack 219. test tube washing brushes steel(pack of 10) 220. zinc sulphate 100gm 221 5. magnisium for semi auto _____ analvze riliquid form mono vial) 222. 5. acid phosp5phataze semi auto analyzer(liquid form mono vial) 223 s. phosphorus semi auto ______ analyzer(iiquid form mono vial) 224. red top vaccutainer 2.5 ml (clot activater) (total volume 5 ml) 225. x ray fixer 226. x ray developer 227 digital x ray film size 8x10 (z40 230 x ray fixer 231. x ray developer ecg machine charger 232. 233 5onography soni paper roll 234. sonography jelly 235. dental x ray fixer 236. dental x ray developer 237. ra factor quuantative (for seml auto) 238. aslo kit quantative (for 5emi auto) 239. crp quantative (for semi auto) 240. rapid thypi (igg+igm card) ...

Medical And Health Services - Rajasthan

32145199 supply of medicine injection , syrup , capsule , tablet , syringe eye and ear drops etc x ray film film dental developer and fixer , hanger 1 antiabd 2 — al3x minidi ) 3 abx lyscbio 4 ai3x cleaner al3x minoclair 6 aik phosphate 7 e.d.t.a vial k3 8 hiv kit tridot jaimitra 9 husag kit 10 pregnancy card 11 glass slide 12 tips big blue 13 tips small 14 widal 15 urin alb / sugar stip 16 urea test 17 needle 22 no 18 cbc printer roll 19 tissue paper roll 20 sgot&sgpt 21 bit &bid . fl jsb15tandjsb2 23 glucose 24 serum crealtinive 25 distil water 26 vdrl 27 total pratien kit 28 b cholestrol 29 trigly cired test urine contener 31 capillary tube 32 multistrip 33 albumin esr plastic tube s h.b tube square . 36 syringe 2cc sprite iso propyl all , 38 cotton roll 39 gloves 40 test tube 12x100 mm ‘42 test tube 12x75 mm n / 10hcl n cover strip 44 test tube wase broush 45 perafin oil dengue kit mp card plain vial etc 46 ecg roll 47 ecg gelly 48 tonikitbalte 49 anti human glopling 50 hb meter digital dengue kit mp card plain vial halothane , isoflurane , ketamine injection 50 mg/ml , propofol injection 10 mg/ml , thiopentone injection 0.5 g , sevoflurane , liquid medical oxygen (lmo) , local anaesthetics lignocaineointment 5% , lignocaine gelip 2% , lignocaine injection 2% , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , pre operative medication atropine sulphate injection0.6 mg/ml , midazolam injection ip 1 mg/ml , analgesic, antipyretic & anti inflammatory drugs opioid analgesics morphine sulphate injection ip 10 mg/ml , tramadol capsule 50 mg , tramadol injection 50 mg/ml , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , fentanyl citrate injection50 mcg/ml , naproxen tablet ip 500 mg , naproxen tablet ip 250 mg , inj. butorphanol tartrate usp 1mg/ml 1ml size , non steroidal anti inflammatory drugs & antipyretics aspirintablet ip (gastro resistant) 150 mg , aceclofenac and paracetamol tablet 100 mg + 325 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg/ml , diclofenac sodium tablet 50 mg , diclofenac tablet (sr) 100 mg , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ibuprofen oral suspension 100 mg/5ml , indomethacin capsule 25 mg , mefenamic acid tablet 500 mg , paracetamoldrops 150 mg/ml , paracetamolsyrup ip 125 mg/5ml , paracetamoltablet 500 mg , paracetamol injection 150 mg/ml , inj diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , paracetamol infusion ip 1% w/v 100ml size , tab. ketorolac 10 mg , muscle relaxants chlorzoxazone,diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , tab baclofen ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) , tab tizanidine hydrochloride ip 2 mg (each uncoated tablet containstizanidine hydrochloride ip 2 mg) , drugs for gout & rheumatoid arthritis allopurinol tablet 100 mg , hydroxychloroquine sulphatetablet 200 mg , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , sulfasalazine delayed release tablet 500 mg , antiallergics & drugs used in anaphylaxis corticosteroids betamethasone tablet 0.5 mg , betamethasone sodiumphosphate injection 4 mg/ml , dexamethasoneinjection 8 mg/2ml , dexamethasone tablet 0.5 mg , hydrocortisone sodium succinate injection 100 mg base / vial , methyl prednisolone sodium succinate for injection 500 mg , prednisolone tablet 5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , tab dexamethasone ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) , antihistaminics & drugs used in anaphylaxis adrenaline injection 1 mg/ml , chlorpheniramine maleate tablet 4 mg , hydroxyzine tablet 25 mg , pheniramine injection 22.75 mg/ml , promethazinesyrup ip 5 mg/ 5ml , promethazine injection 25 mg/ml , promethazine tablet 25 mg , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml , cetirizine,phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetirizine syrup 5 mg/ml , levoceitrizine tablet 5mg , montelukast 10 mg + levocetrizine 5mg tablet , antidotes and other substances used inpoisoning naloxone injection ip 0.4 mg/ml , pralidoxime chloride injection 25 mg/ml , n acetylcystine injection 200 mg/ml , anti epileptic drugs carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg/5 ml , phenobarbitone tablet 30 mg , phenobarbitone injection ip 200 mg/ml , phenytoin injection 50 mg/ml , phenytoin oral suspension 25 mg/ml , phenytoin tablet 100 mg , pregabalin capsule ip 75 mg , sodium valproate ipinjection 100 mg/ml , sodium valproatetablet 200 mg , sodium valproate oral solution ip 200 mg/ 5 ml , sodium valproate(gastro resistant) ip tablet 500 mg , clobazam tablet/capsule 5 mg , clobazam tablet/capsule 10 mg , levetiracetam tablet 500 mg , levetiracetam oral solution suspension 100 mg/ml , levetiracetam injection 500 mg/5ml , gabapentine tablet/capsule 100 mg , gabapentine tablet/capsule 300 mg , tab lamotrigine ip50 mg (eachsustained releasetablet contains lamotrigineip 50 mg) , tab divalproex extended release ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) , tab oxcarbazepine ip150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) , tab lacosamide 100 mg (each film coated tablet contains lacosamide 100 mg) , tab topiramate ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) , anti infective drugs antibacterials aminoglycosides amikacininjection100 mg , amikacin injection250 mg , amikacininjection 500 mg , gentamycin injection 80 mg/2ml , betalactam penicillins amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin trihydrate dispersible tablet 125 mg , amoxycillin oral suspension (dry syrup) 125 mg/5ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , benzathine benzylpenicillin injection ip12 lac units , benzathine benzylpenicillin injection 6 lac units , cloxacillin sodium injection 500 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , inj piperacillin 2 gm + tazobactom 250mg usp , cephalosporins cefepime injection500 mg , cefixime tablet 100 mg , cefixime tablet 200 mg , cefixime oral susp (drops) 25 mg/ml , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection ip 1 g/vial , ceftriaxone injection 250 mg , ceftriaxone injection ip 500 mg/vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup) 125 mg/ 5ml , cephalexin tablet (dt) 125 mg , inj. ceftriaxone 1 gm + tazobactum 125 mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , macrolides azithromycin tablet (dt) 100 mg , azithromycin tablet ip 250 mg , azithromycin tablet 500 mg , quinolones ciprofloxacin injection 200 mg/ 100 ml , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , levofloxacin tablet250 mg , norfloxacintablet 400 mg , ofloxacin tablet 200 mg , ofloxacin suspension 50 mg/5 ml , ofloxacin injection 200mg / 100 ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin oral suspension ip(each 5ml contains ofloxacin ip 100 mg) 30 ml size , tab. levofloxacin ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) , other anti bacterials aztreonam injection 500 mg , clindamycincapsule 150 mg , clindamycin capsule 300 mg , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet40 mg + 200 mg , co trimoxazole tablet160 mg + 800 mg , doxycycline capsule 100 mg , linezolid tablet ip 600 mg , linezolid injection 200 mg/100 ml , meropenem injection 500 mg , meropenem injection 1 g , nitrofurantoin tablet 100 mg , vancomycin injection 500 mg , vancomycin for intravenous infusion ip 1 gm , aztreonam 1gm injection , framycetin sulphate cream 1% , framycetin sulphate cream 1% , tab. faropenem sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg/500mg ip powder for solution , inj. polymixin sulphate b usp 5 lac i.u. , inj meropenem ip 250 mg , inj colistimethate ip 1m iu powder for solution , anti amoebic metronidazoleinjection 500 mg/ 100 ml , metronidazole benzoate oral suspension 100 mg/ 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , tinidazole tablet ip 300 mg (film coated) , tinidazole tablet ip 500 mg (film coated) , anthelmintics albendazole oral suspension 400 mg/ 10 ml , albendazole tablet ip 400 mg , diethylcarbamazine tablets ip 100 mg , anti fungals clotrimazole cream ip 2% w/w , clotrimazole vaginal tablet 500 mg , fluconazole tablet 150 mg , griseofulvin tablets 125 mg , itraconazole capsule 100 mg , amphotericin b injection 50 mg , inj. liposomol amphotericine b 50 mg , inj. voriconazole200mg/vial , tab. terbinafine hydrochloride 250 mg , anti malarials artisunate injection 60 mg (combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection) , chloroquine phosphate injection 40 mg/ml , chloroquine phosphate tablet 250mg (=155 mg of chloroquine base) , chloroquine phosphate suspension 50 mg/ 5ml , mefloquine tablet250 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , quinine dihydrochlorideinjection 300 mg/ml , quinine sulphate tablet 300 mg , act kit containing 3 tablet of artesunate (each tablet of artesunate 25mg strength) and 1 tablet of sulphadoxine pyremethamine (250 mg+ 12.5 mg) , act kit containing 3 tablet of artesunate (50mg each) and 1tablet of sulphadoxine pyremethamine (500+25) mg , act kit containing 3 tablet of artesunate (100 mg each) and 1 tablet of sulphadoxine pyremethamine (750 + 37.5) mg , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine (500 mg+ 25 mg) , act kit containing 3 tablet of artesunate (each 200 mg) and 2 tablet of sulphadoxine pyremethamine (750 + 37.5) mg each or 3 tablet sulphadoxine pyremethamine (500+25) mg each , artemether + leumefantrine tablet (40 mg and 240 mg) , artemether + leumefantrine tablet (80 mg and 480 mg) , anti viral acyclovir tablet200 mg , acyclovir tablet 800 mg , acyclovir suspension400 mg/ 5ml , acyclovir injection250 mg , acyclovir injection500 mg , tab. valganciclovir 450 mg , tab. entecavir ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) , inj. ganciclovir sodium 500mg (lyophilized powder for reconstitution) , anti neoplastic and immuno suppressant drugs azathioprine tablet ip 50 mg , bleomycin injection15 units , chlorambucil tablet 5 mg , cisplatin injection 50 mg/ 50 ml , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg/5 ml , danazol capsule ip 50 mg , daunorubicininjection 20 mg , doxorubicin injection50 mg/ 25 ml , etoposide injection 100 mg/ 5 ml , fluorouracil injection 250 mg/ 5 ml , l asparaginase injection 10000 iu , leucovorin calcium injection 10 mg/ml , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , methotrexate injection 50 mg/2 ml , methotrexate tablet 2.5 mg , paclitaxel injection 260 mg , paclitaxel injection 100 mg , tamoxifen tablet 10 mg , vinblastineinjection 10 mg/10 ml , vincristineinjection 1 mg/ml , alpha interferon injection 3 million unit , carboplatin injection 150mg , carboplatin injection 450mg , cisplatin injection 10 mg/10 ml , dacarbazine injection 500 mg , filgrastim injection 300mcg/ml , gemcitabine injection 200 mg , gemcitabine injection 1gm , ifosfamide injection 1gm , imatinib tablet 400 mg , methotrexate tablet ip 10 mg , mitomycin c injection 10 mg , oxaliplatin injection 50 mg , capsuleprocarbazine hydrochloride usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) , injbendamustine 100 mg , tab capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) , tab letrozole usp2.5 mg (each film coated tablet containsletrozole usp2.5 mg) , capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) , inj. bortezomib 2mg , tab abiraterone acetate ip 250 mg(each uncoated tablet contains abiraterone acetate ip 250 mg) , capsule lomustine ip 40 mg(each capsule contains lomustine ip 40 mg) , cap thalidomide usp 100 mg(each hard gelatin capsule contains thalidomide usp 100 mg) , inj. bevacizumab 400 mg , inj. bevacizumab 100 mg , tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) , tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) , capsule mycophenolate mofetil usp 250 mg (each capsule conatin mycophenolate mofetil usp 250 mg) , capsule tacrolimus ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) , tab. mycophenolate sodium 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) , tab. bicalutamide usp 50 mg(each film tablet contains bicalutamide usp 50 mg) , tab. 6 thioguanine usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) , inj zoledronic acid ip 4mg vial , tab dasatinib 100 mg , anti parkinsonism drugs bromocriptine mesylate tablet2.5 mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , trihexyphenidyl hydrochloride tablet 2 mg , drugs affecting blood anticoagulant acenocoumarol tablet 2 mg , enoxaparin sodium injection 60 mg , heparin sodium injection 5000 iu/ml , warfarin sod. tablet 5 mg , inj. n butyl alcohol 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size , haemostatic ethamsylate injection 250 mg/ 2ml , tranexamic acid tablet 500 mg , vitamin k injection10 mg/ml , tab ethamsylate bp 500 mg (each uncoated coated tablet contains ethamsylate bp 500 mg) , feracrylum 1% w/w sterile solution 100 ml , inj tranexamic acid ip 100mg/ml 5ml size , drugs used in haemophilia dried factor viii fraction (iv use) 250 iu , dried factor viii fraction (iv use) 500 iu , dried factor viii fraction (iv use) 1000 iu , factor – ix concentrate 600 iu , anti inhibitor coagulation complex[human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu] , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , drugs used in thalassaemia deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , desferrioxamine injection (for i.m. inj and i.v., s.c. infusion) 500 mg , erythropoetins rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , plasma expanders humanalbumin solution 20% , hydroxyethyl starch (130/4) 6% w/vwith sodium chloride 0.9% w/v intravenous infusion , polygeline 3.5% solution with electrolytes for i.v. infusion , cardio vascular drugs antiarrhythmic adenosine injection6 mg/2ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg/ml , verapamil tablets ip 40 mg , thrombolytic streptokinase injection 15 lac units , urokinase injection 5 lac unit , antiplatelet aspirin delayed release tablet(enteric coated) 75 mg , clopidogrel tablet ip 75 mg , clopidogrel and aspirin tablet 75 mg +75 mg , antihypertensive amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , atenolol tablet 50 mg , atenolol tablet 25 mg , diltiazem tablet 30 mg , enalapril maleate tablet 10 mg , enalapril maleate tablet 5 mg , enalapril maleate tablet 2.5 mg , labetalol tablet 100 mg , labetalol hydrochloride injection 20 mg/ 4ml , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lisinopril tablet 10 mg , losartan tablet 25 mg , losartan tablet 50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine and atenolol tablet 5 mg +50 mg , methyldopa tablet 250 mg , metoprolol tablet ip 25 mg , metoprolol suscinate tablet (extended release) usp 50 mg , nifedipine capsule 5 mg , nifedipine tablet (sustained release) 10 mg , prazosin tablet (extended release) 2.5 mg , propranolol tablet 40 mg , ramipril tablet / capsule 2.5 mg , telmisartan tablet ip 40 mg , tab. clonidine hydrochloride usp 0.1 mg (each tablet contains clonidine hydrochloride usp 0.1 mg) , tab. sotalol hydrochloride usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) , inj. esmolol hydrochloride 10mg/ml 10ml size , inj. sodium nitroprusside25mg/ml2ml size , tab. carvedilol 3.125 mg , antianginal glyceryl trinitrate tablet 2.6 mg , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , nitroglycerininjection 5 mg/ml , lipid lowering atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , fenofibrate capsule 200 mg , tab rosuvastatin ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) , tab rosuvastatin 10 mg , drugs used in heart failure digoxin injection 0.25 mg/ml , digoxin tablet 0.25 mg , dobutamineinjection 50 mg/ml , dopamine hydrochloride injection40 mg/ml , isoprenaline injection 2mg / ml , tab. sacubitril 24 mg and valsartan 26 mg , miscellaneous noradrenaline injection 2 mg/ml , magnesium sulphate injection(50% ) 500 mg/ml , dental drugs chlorhexidine mouthwash bp 0.20% , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , metronidazole and chlorhexidine gel 1%+ 0.25% , dermatological drugs antifungal miconazole nitrate cream2% , clotrimazole mouth paint (clotrimazole 1% w/v) 1% , ketoconazole cream 2% , powder clotrimazole 1% w/w 30 gm , oint. terbinafine 1%w/w (10 gm tube) , anti infective beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , clindamycin phosphate gel usp 1% , fusidic acid cream2% , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , olopatadine hydrochloride ophthalmic solution 0.1% w/v usp (e/d) 5ml size , cream mupirocin usp 2% (each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base) 15 gm size , topical steroids betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , clobetasol cream 0.05% , antiviral acyclovir cream 5% , scabicides & pediculocides gamma benzene hexachloride lotion(lindane lotion usp) 1% , permethrin cream 5% , permethrinlotion 5% , coal tar 6% & salicylic acid 3% onitment , others glycerin ip 100 ml , glycerin ip 400 gm , calamine lotion ip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , tretenoin cream 0.03% , reagents & diagnostic agents blood grouping anti a blood grouping serum (anti a monoclonal serum ip) , anti b blood grouping serum , anti drh blood grouping serum , dyes & contrast media diatrizoate meglumine and diatrizoate sodium inj usp60% (iodine conc.292 mg/ml) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w/v (iodine conc.370 mg/ml)76% , gadodiamide injection0.5 mmol/ml , iohexol usp (solution for injection) non ionic contrastmedium in sterile aqueous solution 350 mg iodine/ml. , iohexol ( non ionic contrastmedium in sterile aqueous solution) 300 mg iodine/ml. , diagnostic multistix test strip , vdrl antigen (with +ve and ve control) / rpr slide kit , disinfectants & antiseptics cetrimide cream ip 0.50% , chlorhexidine gluconate solution 5% , compoundbenzoin tinctureip , formaldehyde solution (34.5% 38%) , gentian violet topical solution usp 1% , glutaraldehyde solution 2% , hydrogen peroxide solution 6% , lysol(cresol with soap solution) (cresol 50% + soap 50%) , povidone iodine solution5% , povidone iodine solution5% , povidone iodine solution10% , povidone iodine scrub solution / cleansing solution 7.5%w/v povidone iodine 7.5% , povidone iodine ointment 5% , povidone iodine ointment 5% , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , surgical spirit bp , surgical spirit bp , diuretics acetazolamide tablet 250 mg , furosemide tablet 40 mg , furosemide injection 10 mg/ml , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , mannitol injection 20% , spironolactone tablet 25 mg , spironolactone tablet 50 mg , torsemide tablet 10 mg , torsemide injection10 mg/ml , drugs for ear ailments ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , neomycin, polymixin b & hydrocortisone ear drops/otic solution usp (neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml) , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , gastro intestinal drugs antacid antacid tablet , antacidliquid , anti ulcer omeprazole capsule 20 mg , pantoprazole injection 40 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , ranitidine hcl injection 50 mg/2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , abdominal colic & antispasmodic dicyclominetablet 10 mg , dicyclomineinjection 10 mg/ml , dicyclomine hydrochloride oral solution ip10 mg/5ml , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine and paracetamol tablet 20mg + 325mg , drotaverine tablet 40 mg , drotaverine hydrochloride injection 40 mg/2ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , hyoscine butylbromide tablet 10 mg , hyoscine butylbromide injection ip 20 mg/ml , antiemetic metoclopramide injection 10 mg/2ml , metoclopramide tablet 10 mg , metoclopramide syrup 5 mg/ 5ml , domperidone tablet 10 mg , domperidone oral drops 10 mg/ ml , domperidone suspension 5 mg/ 5ml , ondansetron orally disintegrating md tablet4 mg , ondansetron injection 2 mg/ml , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg (each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg) , inj prochlorperazine mesylate 12.5mg/ml 5ml size , drugs for constipation, diarrhoea, piles bisacodyl tablet 5 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm/15ml , liquid paraffin ip , liquid paraffin ip , loperamide tablet ip 2 mg , ors powder , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , sodium phosphates enema bp , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) , drugs for gall stones ursodeoxycholic acid tablet 300 mg , drugs for ulcerative colitis tab. mesalamine usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) , hormones, other endocrine drugs antidiabetics biphasic isophane insulin injection30 / 70 (30% soluble insulin &70% isophane insulin) 40 iu / ml , isophane insulin injection40 iu / ml , soluble insulin injection 40 iu / ml , glibenclamide tablet 5 mg , gliclazide tablets ip 40 mg , glimepiride tablet 2 mg , glimepiride tablet 1 mg , glipizide tablet ip 5 mg , metformin tablet 500 mg , pioglitazone tablet ip 15 mg , metformin hydrochloride sr tablet 1000 mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glibenclamide and metformin hydrochloride (sr) tablet 5 mg + 500 mg , metformin hydrochloride (sr) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride (sustained release) and glimepiride tablet500 mg + 2 mg , glimepiride, pioglitazone and metformin hydrochloride (sr) tablet2mg + 15mg + 500mg , gliclazideand metformin tablet 80 mg + 500 mg , insulin glargine 100 iu/ml with 15 insulin syringes and needles/cartridge 100 iu/ml with 15 needles and 1 pen per 20 cartridges , insulin glargine100 iu/mlwith 30 insulin syringes with needle , tenaligliptin tablet 20 mg , female hormonal preparations carboprosttromethamine injection0.25 mg/ml , clomiphene tablet ip 25 mg , clomiphene tablet 50 mg , conjugated estrogen tablet 0.625 mg , dinoprostone cream0.5 mg , ethinyloestradiol tablet ip 50 mcg , hydroxyprogesterone injection 250 mg/ml , norethisterone tablet 5 mg , progesteroneinjection 200 mg /2ml , medroxyprogesterone acetate tablet ip 10 mg , thyroid & anti thyroid carbimazole tablet 5 mg , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , others glucagon injection usp 1 mg/ml , octreotide injection 50 mcg/ml , immunologicals anti d immunoglobulin human anti d immunoglobulin injection (im use) 300 mcg , human anti d immunoglobulin 150 mcg , anti rabies & anti snake venum human rabies immunoglobulin injection 150 iu/ml , rabies vaccine human (cell culture) (intradermal)2.5 iu , rabies vaccine human (cell culture) (intramuscular) 2.5 iu/ dose , rabies antiserum ip (equine) (i.m./sc use) 300 units / ml , snake venom anti serum(polyvalent anti snake venom) lyophillized , others normal human intravenous immunoglobulin 5g/100ml , tetanus immunoglobulin 250iu , tetanus vaccine(adsorbed) ip , diphtheria antitoxin 10,000 iu , inj. hepatitis b immunologlobin ip 200 i.u , inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml(0.5 gm) , neuromuscular blockers& cholinesteraseinhibitors atracurium injection 10 mg/ml , glycopyrrolate injection 0.2 mg/ml , neostigmine injection ip 0.5 mg/ml , neostigmine injection 2.5 mg/5ml , neostigmine tablets ip 15 mg , succinylcholine injection 50 mg/ml , valethamate bromide injection 8 mg/ml , vecuronium bromide for injection 4 mg (freeze dried) , inj. cis atracurium besylate 2 mg/ml in 5 ml vial , ophthalmological preparations anti fungal fluconazole eye drops0.3% , acyclovir eye ointment ip 3% w/w 5gm size , anti inflammatory flurbiprofen sodium ophthalmic solution 0.03% , anti glaucoma betaxolol eye drops 0.50% , brimonidine tartrate and timolol eye drops0.15% + 0.5% , phenylephrine hydrochloride ophthalmic solution usp/ phenylephrine eye drops bp 5% , timolol eye drops 0.50% , travoprost ophthalmic solution 0.004% , pupillary dialators/constrictors atropine eye ointment 1% , atropine sulphate ophthalmic solution usp 1% , homatropine eye drops 2% , tropicamide eye drops 1% , antibiotic chloramphenicol eye drops 0.05% , ciprofloxacin eye drops0.30% , ciprofloxacin ophthalmic ointment 0.30% , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , eye drop moxifloxacin0.5% w/v ophthalmic solutionip 5ml size , chloramphenicol 1% w/w eye ointment ip, 3gm size , local anaesthetic lidocaine hydrochloride topical solution usp 4% , others carboxymethylcellulose sodium lubricant eyedrops 0.50% , hyaluronidase injection 1500 iu , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg/ml , drugs acting on uterus isoxsuprine injection 5 mg/ml , isoxsuprine tablet 20 mg , methylergometrine injection 0.2 mg/ml , methylergometrine tablet ip 0.125 mg , misoprostol tablet 200 mcg , mifepristone tablet200 mg , oxytocin injection 5 iu/ml , natural micronisedprogesteron soft gelatin capsule 200 mg (each soft gelatin capsule containsprogesteron ip 200 mg) , tab cabergoline ip 0.5mg(each uncoated coated tablet contains cabergoline ip 0.5mg) , inj human chorionic gonadotropin ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , psychotropic drugs anti psychotics chloridazepoxide tablets ip 10 mg , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip 25 mg , chlorpromazinetablets ip50 mg , chlorpromazineinjection ip 25 mg/ml , haloperidol injection 5 mg/ml , haloperidol tablet 1.5 mg , haloperidol tablet5 mg , olanzapine tablet5 mg , risperidone tablet2 mg , risperidone tablet 1 mg , trifluperazine tablets ip5 mg , quetiapine tablet ip 50 mg , quetiapine tablet ip 25 mg , tab. levosulpiride 25 mg (each uncoated tablet contains levosulpiride 25 mg) , anti depressants amitriptyline tablets ip 25 mg , escitalopram tablets ip10 mg , fluoxetine capsule ip 20 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , lithium carbonate tablet 300 mg , sertraline tablet 50 mg , sedatives & tranquilizers alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , clonazepam tablet 0.5 mg , diazepam injection10 mg/ 2ml , diazepam tablet 5 mg , lorazepam injection2 mg/ml , tab. lorazepam ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) , tab. zolpidem 5 mg , drugs acting on the respiratory tract anti asthmatic aminophylline injection25 mg/ml , beclomethasone inhalation 200 mcg/ dose , budesonide nebulizer suspension0.25 mg/ml , budesonide rotacap 200 mcg , ipratropium bromide nebulizer solution 250 mcg/ml , ipratropium rotacap40 mcg , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg/ dose , salbutamol nebuliser solution 5 mg/ml , salbutamol tablet 2 mg , salbutamol syrup ip 2 mg/5ml , terbutaline sulphate tablet ip 2.5 mg , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet(sr) 400 mg , formoterol & budesoniderotacap 6 mcg+ 200 mcg , tab. acebrophylline 100 mg , antitussives cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] , dextromethorphan hydrobromide syrup 13.5 mg/ 5ml , cough syrup/ expectorant(ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , local decongestant saline nasal solution(drops)0.65% , xylometazolinenasal drops 0.1% , solutions correcting water, electrolyte & acid base disturbance compound sodium lactate injection , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , multiple electrolytes & dextrose injection type iip (electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip (electrolyte m injection) , potassium chloride injection0.15 gm/ml , potassium chloride oral solution usp500 mg/ 5ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , ringer acetate infusion 500 ml , sodium chloride 0.45% w/v polypack 500 ml , drugs for urology finasteride tablet 5 mg , tamsulosinhcltablet 0.4 mg , flavoxate tablet 200 mg , tab savelamer carbonate 400 mg (each film coated tablet containssavelamer carbonate 400 mg) , tab sodium bicarbonate usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) , tab levamisol hydrochloride ip 50 mg (each uncoated tablet conatinlevamisol hydrochloride ip 50 mg) , tab.phenazopyridine 5 mg , tab. dutasteride 0.5 mg , syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate) , antivertigo betahistine tabletip 8 mg , betahistine tablet ip 16 mg , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , vitamins & minerals ascorbic acid tablet 500 mg , calcium gluconate injection 10% , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension (each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu) , calcitriol capsule0.25 mcg , cholecalciferol granules 60,000 iu /1gm , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab.(paediatric) 20 mg + 0.1 mg , folic acidtablet ip 5 mg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , mecobalamin injection 500 mcg/ml , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , pyridoxine tablet 10 mg , pyridoxine tablet40 mg , thiamine tablet 100 mg , vitamin a solution 1 lac iu/ml , vitamin b complex tablet nfi (prophylactic) , vitamin b complex injectionnfi , zinc sulphate dispersible ip elemental tablet 10 mg , methylcobalmin tablet 500 mcg , methylcobalmin tablet 1500 mcg , vitamin d3 oral solution 60000 iu , inj. ferric carboxymaltose 50 mg/ml 10 ml size , multi vitamin syrup , miscellaneous drugs flunarizine tablet 5 mg , black disinfectant fluid (phenyl) (as per schedule o grade iii , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , hameodialysis bicarbonate solution , peritonial dialysis solution ip , sodium bicarbonate injection ip 7.5% , water for injection ip , alendronate sodium tablets usp/bp 35 mg , mannitolwith glycerin injection 10% + 10% , surfactant for intratrecheal instillation(natural bovine lung surfactant) , oseltamivir 75 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir 45 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 30 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg/ml. (each ml contains 12 mg oseltamivir base after reconstitution) , oseltamivir phosphate oral suspension ip 12 mg/ml (each ml contains : 12 mg oseltamivir after reconstitution , vitamin k 1 (phytomenadione) 1 mg/0.5ml injection , intravenous fat emulsion 20% w/v (pl/tg ratio 0.06) 250ml , tab pyridostigmine usp 60 mg (each tablet contains pyridostigmine usp 60 mg ) , inj. caffeine citrate usp 20mg/ml(equivalent to 10 mg caffeine base/ml) 3ml size , inj. amino acid 10% 100ml size , cap. vitamin e 400 mg , inj poractant alpha 80 mg/ml in pack of 1.5 ml , absorbable gelatin sponge ip 66, size 80(+ 10) mm x 50 mm x 10 mm should be sterlized. , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824(part 3):1996 , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered,,without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic •shouldconform to is 13422 •isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards , suction catheter, sterile. size: fg 5 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 6 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 8(for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 10 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 12 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 14 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 16 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 18(for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 20 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 22 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 8 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is 11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size10 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size16 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size18 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size20 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size22 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 •color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 24 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , infant feeding tube size:10fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:8fg, length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:5fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , sterile disposable perfusion set with airway and needle (adult use) • for gravity feed only • sharp and easy piercing spike with air vent • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • self sealing latex bulb which will also act as an port for extra medication • efficient roller clamp to control and adjust the fluid rate • 21 g needle • should conform to is 12655 4 standard , sterile disposable perfusion set (infusion set) with airway and needle(paediatric use) • burette type measured volume chamber of 100 ml • drop size of approx 60 drops per ml • injection port,latexfree, for intermittent medication. • floating auto shut off valve (latex free) in burette. • soft and kink resistant pvc tubing. • roller controller for flow control • tube length 150 cm • 23g needle • should conform to iso 8536 5 , sterile disposable infusion set with microdrip (i.v.) • microdrip infusion set with drop size reduced to approx 60 drops per ml • sharp and easy piercing spike • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the fluid rate • should conform to is 12655 4 standard , insulin syringe ( 40 units) with (fixed) 30 g needle shall conform to is 12227 , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 16g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable (single use teflon / ptfe i.v. cannula with integrated 3 way stop cock.)size 18g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable (single use) teflon/ ptfe i.v. cannula without port.size 24g • suitable for paediatric & neonatal use • should be packed in transparent, single blister pack. • should conform to is 10555 standard , mucus extractor sterile • clear transparent container • antibacterial filter • soft, kink resistant pvc tubing • tube size 10 fg; length 40 cm (min.) • capacity 25 ml , nasal oxygen cannula (set), twin bore (accessory for compressed air breathing)all sizes (adult) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , nasal oxygen cannula (set), twin bore (accessory for compressed air breathing)all sizes (pediatrics) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , paper adhesive plaster 1 x 9.0 mts (with cutter) non woven adhesive tape,hypoallergic,should have some stretch bonding , paper adhesive plaster 2 x 9.0 mts (with cutter) non woven adhesive tape hypoallergic, should have some stretch bonding , paper adhesive plaster 3 x 9.0 mts (with cutter)non woven adhesive tape hypoallergic, should have some stretch bonding , plaster of paris bandages15cm x 2.7mts / roll should conform to schedulef(ii) of drug and cosmetic act 1940 , plaster of paris bandages 10cm x 2.7mts / roll should conform to schedulef(ii) of drug and cosmetic act 1940 , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:10 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:12 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:14 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:16 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:18 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , scalp vein set (disposable):size 18g •butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritanttube • sterile , scalp vein set (disposable):size 20g • butterfly shaped wings for easy handling and attachment with skin. colour coded •needle should be bevelled, siliconised and should ensure atraumatic cannulation •female luer fitting at one end •soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set (disposable):size 22g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set (disposable):size 24g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , sterile hypodermic syringe with needle attached, 24g, single use 2 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container , sterile hypodermic syringe with needle attached, 24g, single use 5 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 10 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 20 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , surgical blade sterile, size 11 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 15 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 22 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , suture needles curved 1/2 circle round body assorted size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle cutting size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , sterile disposable spinal needle for single use 22g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , sterile disposable spinal needle for single use 25g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , urine collecting bag, disposable 2000 ml • transparent sheet • kink resistant flexible tubing not less than 90 cm in length • should have non return valve • top drainage outlet • graduated bag • moulded handle for easy handling , double j stent, sterile, both ends open size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, both ends open, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , endotracheal tube, plain size 2.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain with radio opaque line, sterile, single use size 6mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 6.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, cuffed size 4mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 4.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 9 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , tracheostomy tube (pvc), plain, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line , tracheostomy tube (pvc), cuffed, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line • balloon with non return valve , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 24) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 28) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 32) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , corrugateddrainage sheet, sterile, multichannel, with radio opaque line, single use all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.5 cmx 15 cm soft to feel fast edges,slightly stretchbonding. , polypropylene nonabsorbable synthetic surgical mesh 15 cmx 15 cm soft to feel fast edges,slightly stretchbonding. , sterilised umbilical cotton tape width 3 mm, length 75 cm should conform to schedulef(iii) of drug and cosmetic act 1940 , bone wax sterilised , temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; straight cutting60 mm ,breakaway , skin graft knife blade (sterile) (disposable ) skin grafting knife blade (sterile) made of carbon steel or stainless steel material 158 mm long individually wrapped in wrapper corrosion inhibitor paper in single packet,.in packs of 10. the edge must be sharp enough to cut the skin in a single shave and should snugly fit in the handle should conform to is 3759. 2. skin grafting knife handle (watson modification of humby’s knife ) stainless steel, ce certified, in which the blade specified in (a) above should fit snugly. should conform to 7980 1976. , k wire, length 375 mm; 1mm length of wire should be mentioned with specification. should conformto is 8261 , k wire,length 375 mm;1.6mm • length of wire should be mentioned with specification. • should conformto is 8261 , k wire, length 375 mm; size 1.8mm • length of wire should be mentioned with specification. •should conformto is 8261 , face mask, disposable • should be manufactured from non woven poly prop fabric • should be 3 ply construction • should have high bacterial filtration efficiency • should be heat sealed to keep 3 layers together • standard size 17.5 x9 cm • color green/blue • there should be a string each at all four corners,length of string should be 40cm • nose clip should be there •no elastic band. , surgical cap, disposable (for surgeons) • should be manufactured from non woven fabric. • strip for tying the cap stitched on the back for proper grip on the forhead. • green colour • ultrasonically stitched • air permeable/breathable • should retain skin and hair particle. • strip for tying the cap , surgical cap, disposable ( for nurses) • should be manufactured from non wovenfabric • blue / green colour • round upon wearing, with elastic •air permeable / breathable •should retain skin and hair particles , foldable intra ocular lense with injector (size + 11 d to +17.5 d) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics (5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , foldable intra ocular lense with injector (size + 18 d to + 24 d) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , foldable intra ocular lense with injector (size + 24.5 d to + 28.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 24.5 d to + 28.5 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 11 d to +17.5 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 18 d to + 24 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowdered,without tear,properly folded in a paper • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowder free,without tear,properly folded in a paper • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small. should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large should conform to is 15354 , pressure monitoring line / high pressure extension line • suitable for high pressure monitoring and for connection between syringe infusion pump and patient • male luer lock at one end and female luer lock at other end ; should fit all standard equipment. luer lock connectors should provide secure fitting. • pressure upto 800 psi • length 200 cm • sterile , urine collecting bag for new born /paediatric urine collection bag, capacity 100ml • should have suitability for both male and female patients • should be provided withadhesive for fixation and good grip with minimal risk of allergy and injury • capacity 100 ml • sterile , umbilical catheter (for new born) all sizes • radio opaque line • with female flexible mount • colour coded connector • open tip should be soft, rounded, atraumatic • length 40 cm , umbilical cord clamp • suitable for clamping umbilical cord of new born • security lock to prevent accidental opening after clamping • grooved clamping area , absorbable oxidizedregenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 16 fg , close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter18 fg , t – tube for common bile duct drainage • kehr’s t tube made from medical grade pvc, and siliconized • smooth, kink resistant • radio opaque line throughout the length • sterile • length 20 x 60 cm • size 10 to 18 fg , bone cement with antibiotics,fast and slow setting , general specificaition for s 99 (a) and s 99(b) sanitary napkins (for menstrual hygiene) specifications: sanitary napkin, beltless 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc. 3. back strip – a back strip for sticking the sanitary napkin onto the underwear should be there using good quality adhesive material. 4. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section total pad length 210 +_ 10 230 +_ 10 width60 to 75 70 to 85 thickness8 +_ 2 5. weight : not more than 10 gm . . instructionfor usage should be mentioned on every packet , sanitary napkin, belttype 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc 3. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section pad length220 +_ 10 width70 +_ 5 thickness 17 +_ 3 4.weight : 12 +_ 3 gm 5.pack – six napkins in a pack. 6.elastic belt with loops shall be provided in each pack. 7.absorbency: the napkin should be able to absorb not less than 30 ml of normal saline or coloured water or test fluid when poured on to the centre of the napkin at the rate of 15 ml per minute. .instruction for usage should be mentioned on every packet. , belt less sanitary napkin with wings 1. covering (absorbing top sheet corrector)–good quality knitted sleeve or non woven fabric of rash free,non irritant and soft to touch material which has sufficient porosity to permit the assembled napkin to meet absorbency requirements.the napkins shall have a non absorbent barrier on one side with adhesive covered by a differently identifiable paper 2.overall length(mm)230 ± 5 3.core length220 mm± 10 4.fluff core/padlength220 mm± 10 5. over all width with wings160mm+_5 6.fluff core/padlength70 mm± 5 7.thickness of a single pad9 10mm 8.weight of a single pad : 8 10 gm 9.pack six napkins in a pack. 10type. belt less sanitary napkin withwings 11.minimum absorbency: 50ml 12.ph value of absorbent material6 8.5 b. disposable individual pouch or wrapper for each sanitary napkin(as per ministry of environment,forest and climate change dated 08.04.2016) pouch/wrapper specifications : 1. pouch/wrapper should be of the size of sanitary napkin being supplied. 2. it should have adhesive to seal the sanitary napkins within. 3. pouch/wrapper should not be transparent. note : instructions for use of disposable pouch/wrapper mst be written in hindi on disposable pouch/wrapper. blrseky fd;s gq;s lsusvjh usifdu dks eksm dj disposable pouch/wrapper esa mkys ,oa disposable pouch/wrapper dks xksan yxh iv~vh ls cun dj lqjf{kr rjhds ls dwmsnku esa mkysaa , oxygen mask (adult) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. , oxygen mask (paediatric) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc materialwith comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. • mask connector 4m , sterile catheter, single use, for urinary drainage(foley baloon catheter), 2 way, size 14 • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for a traumatic intubation • symmetrical foley balloon • balloon capacity 30+ 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and ballon capacity should be mentioned as per is 11497 • specification for b,c,d,e,f,g should be mentioned as per is 11497 , nelaton catheter size 14 fg distal end is close and proximal end has female colour code connector • soft, kink resistant medical grade pvc tube • length:40 cm • individually packed in poly and sterile , ecg electrode •reliable trace, •high conductivity,• easy to handle , surgical blade sterile, size 23 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction duringmovement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , urethral catheter90 (fg 14), made up of medical grade pvc , urethral catheter91 (fg 10), made up of medical grade pvc , vaccum suction set, 2.5 meter length, •suction handle with suctiontube •sterile,• pyrogenic free, •latex free,• single use , epidural minipack 18g, 90 mm,metal stylet for single use only, •sterile, •epidural catheter 20g, l 90 cm, •6 lateral holes closedend, •borst adapter •epidural catheter flat filter 0.2 micro meter •thread assist guide•lor (loss of resistance) plastic syringe 6 ml , vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no.22double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv.) , vascular catheter with metal guide no.18 double lumen size 45 cm(longline iv.) , vascular catheter with metal guide no.20 double lumen size45 cm (longline iv.) , vascular catheter with metal guide no. 22 double lumen size 45cm (longline iv.) , 3 waystop cock ,non pyrogenic & single use,should be leak proof, with smooth movements , 3 waystop cock with extension tube(vein o line) size 10cm (non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 50cm (non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 100cm(non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 150 cm(non pyrogenic & single use) , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) • graduated bag, • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp1m x 10cm adhesive material should have good quality sticking property, non allergic , sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g ·should be packed in transparent single blister pack · should confirm to is 10555 standard ·(neonatal iv cannula size 26) , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for ventilator without vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for ventilator without vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for bipap with vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for bipap with vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) paediatric ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads in small size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear ·should be single use with bronchoscopy and co2 &o2 port with chin support ·non allergic, leak proof, contour should be maintained , nebulization mask adult , nebulization mask paediatric , chemotherapy port &non coring needles(adult) · valved catheter need only saline flush, catheter with intermediate size port with small septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 8fr with silicon material with peel apart percutaneous introducer system. ·chemo port huber needle 20g and 22g. , chemotherapy port &non coring needles(pediatric) · valved catheter need only saline flush, catheter with intermediate size power port with large septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 6fr with silicon material with peel apart percutaneous introducer system · .chemo port huber needle 20g and 22g. , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (3/8 cir rb needle 40mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (l/2 cir rb needle 20mm length 76 cm)3/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)2/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 40mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (3/8 rb needle 30mm length 76 cm)2/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (1/2 cir rb needle 45 mm length 100 cm)1 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 26mm, length 76 cm)3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) ½ cir rb needle 20mm length 70 cm 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle 30mm length 90 cm 2/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir rb needle 30mm length75 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir tapercut needle (heavy) 35 40mm length 75 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) ½ cir rb needle40mm length 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) (1/2 cir conventional 25mm length 90 cm)undyed 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)(1/2 cir rb needle 20mm length 70 cm) 4/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide ) (1/2 cir rb needle 40mm length 90 cm 2/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) (1/2 cir rb needle 40mm length 90 cm) 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting needle 22mm length 45 cm 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting 16mm needle, suture length70cm 4/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (1/2 cir rb needle 20mm, length 76 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (3/8cir reverse cutting needle 26mm, length 76 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (3/8cir reverse cutting needle 45mm, length 76 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon)(3/8 cir micropoint round body ,6mm length 38 cm) 8/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 conventional cutting needle 16 mm length 70 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 conventional cutting needle 19mm length 60 cm.) 4/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cir slim blade cutting needle 15mm length 70 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cirr cutting needle 40 45mm length 60 70 cm.) 2/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cir r cutting needle 45mm length 70 cm.) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb13 mm needle,length 75cm) double arm 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8cir rb 16mm needle,length 90 cm) 6/0 , non absorbable surgical suture,sterilised surgical needled suture monofilament polypropylene blue(3/8cir rb double 8mm needle, length 60 cm) 7/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8cir rb 16 mm needle, length 70 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 30mm length 90 cm) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb heavy needle 40 45mm length 75 90 cm) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir tapercut double needle cutting size 16 17mm length 70 90 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir tapercut double needle 17mm length 70 90 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir rb needle 25mm, length 90 cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 30mm, length 90 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir tapercut needle 17mm length 75 cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir tapercut needle,25 mm length 90 cm) double arm 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue usp(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 6/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir rb 13mm needle, length 90 cm double arm 6/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 16 mm length 70 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir cutting needle 25mm length 45 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb heavy 40mm, length 90 cm) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (l/2 cir reverse cutting, 45 mm needle length 100 cm) 1 , non absorbable surgical suture, ,sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir rb , 8mm double needle, suture length of 70cm) 8/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 circle tapercut 13mm double needle 70cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 circle cc 13mm needle, suture length of 70cm) double arm 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 25mm, suture length of 75cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturebraided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided green/ blue (1/2 cir tapercut ,17 mm double needle, length 75 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided white (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided green / blue (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) 1/2 circle taper cut , 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 2/0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) *with 1/2 circle taper cut , 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/whitecoated polyster braided (green / blue)with 1/2 circle tapercut double needle 25mm, suture length 90 cm 3/0 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures(1/2 circle oval rb needle 26mm needle, suture length of 70cm) 2/0 , absorbable surgical suturespolyglecaprone / polyglyconate, monofilament sutures (l/2 circle oval rbcontrast needle 26mm, suture length 70cm) , absorbable surgicalsuturesmonofilament sutures polyglecaprone /polyglyconate (l/2 circle cutting 16mm needle,suture length 70cm) 4/0 , absorbablesurgical suturespolyglecaprone / polyglyconate, monofilament sutures(3/8 circle cutting24 26mm needle, suture length of 70 90cm) 3/0 , absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanoneviolet (1/2 circle reverse cutting 40 50 mm length 70 90cm) 1 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 31mm needle, length 70cm) 2/0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 30mm needle, length 70cm) 1/0 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoatedpolyglactin/ polyglycolic acidviolet) 1/2 circle ctroundbodied 40mm,gsneedle,suture length 90 cm/ 1 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/ polyglycolic acidviolet)1/2circle ctroundbodied 40mm,gsneedle,suture length 90 cm 1/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin / polyglycolic acid violet)1/2 circle round bodied 30mm, suture length 90 cm/ 2/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/ polyglycolic acidviolet)1/2 circle reverse cutting,os 40mm, suture length 90 cm 1 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin /polyglycolic acid violet)1/2 circle reverse cutting 36mm, os needle, suture length 90 cm/ 1/0 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin /polyglycolic acid violet) 1/2 circle round bodied 20mm, suture length 70 cm 3/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/polyglycolic acidviolet)3/8circle r cutting, ps 1,24mm, suture length 70 cm 3/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm10/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 16mm, length 76 cm) 5/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir cutting needle 8mm, length 35 cm) 6/0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk (3/8 cir rb needle 20mm, length 76 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk(3/8 cir rb needle 16mm, length 76 cm) 5/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 19mm length 76 cm) 4/0 , b.p. instrument(murkary) , b.p. instrument (digital) , stethoscope , weight machine(digital) , baby weight machine(digital) , glucometer freewith 500 strips , glucometerstrips , disposable bed sheets , disposable pillow cover , pulse oximeter , triple layer mask , cotton mask , n 95 mask , hand sanitizer 250ml , nebulizer machine , bleaching powder 25 kg , cotton roll (net 500gm) , folding stretcher , hospital bed (28 kg) , side locker , i.v stand , delivery table , hiv(50 test) , gloves , micro slides , tourni cwet belt , esr cup. , pregenancy card , widal 4x5 ml , vdrl strit(50 test) , disposable syring 2 ml , disposable syring 5 ml , btct capilary , hcl n/10 500ml , disposable niddle , test tube glass , n.p. cards (50 test) , disposable mask , chemistrix ah.100 strips , urine strip , glemsa’s stain (500 ml) , scissor 6” , urine contianer , centrifuge machine , sprit 5 litre , anti abd , edta k3 singal cap. , test tube stand , hemoglobinometer free with 1000 strips , hemoglobinstrips , x ray film 12x15 green base , x ray film 10x12 green base , x ray film 10x12 blue base , erba.giucose reagents , erba urea reagents , erba creatinine reagents , erba sgot reagents , erba sgot,sgpt reagents , erba alp reagents , erba bill,t reagents , erba choletrol reagents , erba triglyceride reagents , erba hdl reagents , erba protine reagents , new pehal kit , jsb (i) 500 ml , jsb (ii) 500 ml , devloper 13.5 lt. , fixer 13.5 lt. , involap 10x12(x ray film) , involap 12x15(x ray film) , prinking niddle , liquid parafine 500ml , sidarwood 500ml , disteld water cane 5 liter , micro slides 50 pkt , ganesh pump 2 liter plastic body , ganesh pump 2 liter steel body , streup pump for ddt spray , knopsack pump for bti spray , methyal alcohal 500ml , oil errerson lance100x , eye piece lance 5x , biker (borosil) 100ml , staining rack with glass rod steel body , fogging machine auto start , zn oil 1liter , oxgen cilender b type/ d type , ecg machine 3 channel , hiv kit disposable ( face mask , cap, gloves, bedsheet,cord clamp, aprin,bio bag,goggles) , o.t. kit disposable (gown, cap, mask, shoe coover, gloves, bedsheet,holesheet, trolly cover) , suger strips , hemo cue hb 301 ...

Medical Health And Family Welfare - Rajasthan

32024471 supply of surgical, dental, x ray item in govt bdm hospital kotputli supply of surgical, dental, x ray item in govt bdm hospital kotputli , list of surgical item , allis forcep 6 ( ss ) , allis forcep 8 ( ss ) , allis forcep 10 ( ss ) , artery forcep 6 ( ss ) curved , artery forcep 8 ( ss ) curved , artery forcep 10 ( ss ) curved , a.k. traction adult , a.k. traction child , abdominal gauze swab ( sponge for o.t. ) 25 cm x 25 cm x 8 ply x 5 nos , adhesive tap 1 , adhesive tap 1 / 2 , adhesive tap 4 , asepto syringe with transparent bulb, sterile 60ml , autoclave drum ( 15 x 12 ) as per annexure a technical specification , autoclave drum ( 11 x 9 ) as per annexure b technical specification , b.k. traction adult , b.k. traction child , biowaste poly bag24x28 inch ( black / blue / red / yellow / green ) per kg , biowaste poly bag24x36 inch ( black / blue / red / yellow / green ) per kg , biowaste poly bag26x38 inch ( black / blue / red / yellow / green ) per kg , blood donor set , blood tranfusion set / blood administration set , bone cement , bone wax sterilised 2.5 gm pkt , bp instrument ( para wala ) , bp instrument ( digital ) , corona dead body cover , cotton pkt 500gm , disposable sterilesurgical rubber gloves size 6 inches , disposable sterilesurgical rubber gloves size 6.5 inches , disposable sterilesurgical rubber gloves size 7 inches , disposable sterilesurgical rubber gloves size 7.5 inches , disposable sterilesurgical rubber gloves size 8 inches , disposal sterile syringe10ml , disposal sterile syringe1ml , disposal sterile syringe20ml , disposal sterile syringe2ml , disposal sterile syringe50ml , disposal sterile syringe5ml , disposble apron plastic ( for delivery ) , elastic adhesive bandage 1m*10cm , endotracheal tube, cuff size 4 to 9 mm , endotracheal tube, plain size2.5 to 8.5 mm , foleys ballon catheter, sterile no. 12 , foleys ballon catheter, sterile no. 14 , foleys ballon catheter, sterile no. 16 , foleys ballon catheter, sterile no. 18 , foleys ballon catheter, sterile no. 20 , foleys ballon catheter, sterile no. 22 , foleys ballon catheter, sterile no. 24 , foleys ballon catheter, sterile no. 8 , foleys ballon catheter, sterile no.10 , glancet / lancet needle , glucostips , gauze & cotton cutting scissors , i.v. cannula no. 18 ( sterile i.v. cannula with integrated 3 way stop cock ) , i.v. cannula no. 20 ( sterile i.v. cannula with integrated 3 way stop cock ) , i.v. cannula no. 22 ( sterile i.v. cannula with integrated 3 way stop cock ) , i.v. cannula no. 24 ( sterile i.v. cannula without port ) , i.v. cannula no. 26 ( sterile disposable i.v. cannula with integrated 3 way stop cock ) , i.v. drip set ( infusion set with airway & needle ) adult use , infant feeding tube, size 10g , infant feeding tube, size 5g , infant feeding tube, size 8g , infrared thermometer , insulin syringe ( 40 units ) with fixed 30g needle , k 90 urethral catheter ( size f14 ) , k 91 urethral catheter ( size f10 ) , knife handle 2, 3, 4, 5 no , l.p. needle no. 18 , l.p. needle no. 20 , l.p. needle no. 22 , l.p. needle no. 24 , l.p. needle no. 26 , mackintosh rubber , meclicot catheter 10 no , meclicot catheter 16 no , meclicot catheter 18 no , meclicot catheter 20 no , meclicot catheter 22 no , meclicot catheter 8 no , micro iv set ( disposable infusion set with microdrip ) , mucus extractor / sukker , n 95 mask isi mark , nasal oxygen set, twin bore, adult , nasal oxygen set, twin bore, paediatric , nasal pronge neonatal , nebilizer mask adult , nebilizer mask peadiatric , nebilizer machine , needle cutter machine ( electric ) , nitrile gloves , niv mask ( non invasive ventilation mask ) adult , niv mask ( non invasive ventilation mask ) paediatric , oxygen mask adult , oxygen mask paediatric , p.o.p. bandage 4 10cm*2.7 mts / roll , p.o.p. bandage 6 15cm*2.7 mts / roll , paper adhesive tape 1 inch*9 mts with cutter , paper adhesive tape 1 / 2 inch*9 mts with cutter , paper adhesive tape 2 inch*9 mts with cutter , paper adhesivetape 3 inch*9 mts with cutter , paper gloves ( examination gloves ) , pedia set ( infusion set with airway & needle ) paediatric use , pulse oxymeter finger tip , plaster cutter electric machine , plaster cutting scissors , rubber examination gloves, non sterile size large , rubber examination gloves, non sterile size medium , rubber examination gloves, non sterile size small , ryles tube no. 10 ( neogastric tube ) , ryles tube no. 12 ( neogastric tube ) , ryles tube no. 14 ( neogastric tube ) , ryles tube no. 16 ( neogastric tube ) , ryles tube no. 18 ( neogastric tube ) , sanitary pads ( rounded cotton pad ) containing 08 piece , shoe covers knee length , shoes cover , side pote blade ( 1 piece rate ) , spinal needle 20g , spinal needle 22g , spinal needle 25g , stocki net 1 mtr. , stocki net 1.5 mtr. , suction catheter, sterile, size fg 10 , suction catheter, sterile, size fg 12 , suction catheter, sterile, size fg 14 , suction catheter, sterile, size fg 16 , suction catheter, sterile, size fg 18 , suction catheter, sterile, size fg 20 , suction catheter, sterile, size fg 22 , suction catheter, sterile, size fg 5 , suction catheter, sterile, size fg 6 , suction catheter, sterile, size fg 8 , supra pubic catheter ( spc kit ) size 12 to 16 , surgical blade no. 10, sterile ( packet of 100 no. ) , surgical blade no. 11, sterile ( packet of 100 no. ) , surgical blade no. 15, sterile ( packet of 100 no. ) , surgical blade no. 20, sterile ( packet of 100 no. ) , surgical blade no. 22, sterile ( packet of 100 no. ) , surgical blade no. 23, sterile ( packet of 100 no. ) , surgical cap, disposable ( for nurses ) , surgical cap, disposable ( for surgeons ) , three way adopter ( 3 way stop cock ) , tracheostomy tube cuff size , tracheostomy tube plain size , traction pully , umbilical catheter for new born , umbilical cord clamp , urine collecting bag for new born, capacity, 100 ml , urine collecting bag, disposable 2000 ml , ventilator mask ( non vanted mask ) small , ventilator mask ( non vanted mask ) medium , ventilator mask ( non vanted mask ) large , bandage 10 inch , bandage 15 inch , bandage 2.5 inch , bandage 4 inch , bandage 6 inch , bandage 7.5 inch , diaper adult ( s / m / l ) , knee cap , lignocain 10 % spray , abdominal suction set , baby diaper small size for infents , crape bandaze 10 ( 4 mtr. length ) , sutures : , absorbable suture ( vicryl ) sterilised needleed ( braided ) coated polyglactin / polyglycolic acid size 1 , absorbable suture ( vicryl ) sterilised needleed ( braided ) coated polyglactin / polyglycolic acid size 1 / 0 , absorbable suture ( vicryl ) sterilised needleed ( braided ) coated polyglactin / polyglycolic acid size 2 / 0 , absorbable suture ( vicryl ) sterilised needleed ( braided ) coated polyglactin / polyglycolic acid size 3 / 0 , antibacterialcoated suture, sterilised needled, braided coated polyglactin / polyglycolic acid violet size 1 , antibacterialcoated suture, sterilised needled, braided coated polyglactin / polyglycolic acid violet size 1 / 0 , antibacterialcoated suture, sterilised needled, braided coated polyglactin / polyglycolic acid violet size 2 / 0 , antibacterialcoated suture, sterilised needled, braided coated polyglactin / polyglycolic acid violet size 3 / 0 , barbar thread 40 no. , barbar thread 60 no. , catgut absorbable suture ( chromic ) 1 0 , catgut absorbable suture ( chromic ) 4 0 , catgut absorbable suture ( chromic ) 6 0 , catgut absorbable suture ( chromic ) 2 0 , catgut absorbable suture ( chromic ) 3 0 , catgut, absorbable suture ( chromic ) 1 , mersilk 1 0 ( b. b. silk suture ) , mersilk 2 0 ( b. b. silk suture ) , mersilk 3 0 ( b. b. silk suture ) , mersilk 4 0 ( b. b. silk suture ) , non absorbable suture ( non vicryl ) sterilised needle monofilament polypropylene blue size 1 , non absorbable suture ( non vicryl ) sterilised needle monofilament polypropylene blue size 2 / 0 , non absorbable suture ( non vicryl ) sterilised needle monofilament polypropylene blue size 3 / 0 , non absorbable suture ( non vicryl ) sterilised needle monofilament polypropylene blue size 5 / 0 , non absorbable suture ( non vicryl ) sterilised needle polyamide monofilament black ( nylon ) size 2 / 0 , non absorbable suture ( non vicryl ) sterilised needle, polyamide monofilament black ( nylon ) size 1 / 0 , non absorbable suture ( non vicryl ) sterilised needle, polyamide monofilament black ( nylon ) size 1 / 0 , prolline suture no 1 , suture thread roll ( cotton ) , suture thread roll ( silk black ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , dental item , arch bar , balbed broach ( no 15 40 ) ( pack 10 piece ) , bonding agent for composet 2.5 ml , ca ( oh ) 2 powder8 gm , calcium in syringe for rc fill3 gm , composit restorativ material syring 30 gm , d palpin 7.5 gm , diamond burs inverted , diamond burs round , diamond burs straight , diamond burs tapered , etchant gel syring 1.6 gm , eugenol oil110 ml , formocresol 12 ml , g.p. solvent ( rc solve ) 15 ml , gic restotive material 10 gm powder , gp pointno 15 , gp pointno 20 , gp pointno 25 , gp pointno 30 , gp pointno 35 , gp pointno 40 , gp pointno 45 , gp pointno 50 , gp pointno 55 , gp pointno 60 , gp pointno 70 , gp pointno 80 , iodoform + caoh ) 2 ( metapack ) 2.2 gm , iodoform obturation material 3 gm , iodoform powder for dressing , murcury 30 gm , needle holder 6 ( ss ) , needle holder 8 ( ss ) , needle holder 10 ( ss ) , paper point 25 mm ( 1 packet ) , paper point 40 mm ( 1 packet ) , prepcanal edta 2 gm , prepcanal edta syring 2gm , scissor sharp curved 6 ( ss ) , scissor sharp curved 8 ( ss ) , scissor sharp straight 6 ( ss ) , scissor sharp straight 8 ( ss ) , set no. 10 ( length 21 mm ) , set no. 10 ( length 25 mm ) , set no. 15 ( length 21 mm ) , set no. 15 ( length 25 mm ) , set no. 15 40 ( length 21 mm ) , set no. 15 40 ( length 25 mm ) , set no. 20 ( length 21 mm ) , set no. 20 ( length 25 mm ) , set no. 25 ( length 21 mm ) , set no. 25 ( length 25 mm ) , set no. 30 ( length 21 mm ) , set no. 30 ( length 25 mm ) , set no. 35 ( length 21 mm ) , set no. 35 ( length 25 mm ) , set no. 40 ( length 21 mm ) , set no. 40 ( length 25 mm ) , set no. 45 80 ( length 25 mm ) , set no. 45 80 ( length 31 mm ) , set no. 6 ( length 21 mm ) , set no. 6 ( length 25 mm ) , silver powder 30 gm , sodium hypochloride for irrigation 3% , sodium hypochloride for irrigation 5% , steel tray ( ss ) 12x12 , steel tray ( ss ) 9x12 , temprary felling material ( cavite mp ) 30 gm , tooth / plain forcep 6 ( ss ) , tooth / plain forcep 4 ( ss ) , wire 26 gauge 0.25 ounce , zinc oxide powder110 gm , x ray item , medical x ray films green base14x17 , medical x ray films green base14x14 , medical x ray films green base 12x15 , medical x ray films green base10x12 , medical x ray films green base8x10 , dental x ray film ( medical ) , devloper powder 22.5 ltr. ( capcity ) , fixer powder 22.5 lter. ( cap. ) , x ray replensor 4.50 ltr ( cap. ) , lead letter0 to 9 , intensifying screen green base 14x17 , intensifying screen green base 14x14 , intensifying screen green base 12x15 , intensifying screen green base 10x12 , intensifying screen green base 8x10 , casessttes 12x15 , casessttes 10x12 , casessttes 8x10 , casessttes 14x14 , casessttes 14x17 , devloping tank capcity 22.5 ltr , x ray hanger 14x14 , x ray hanger 14x17 , x ray hanger 10x12 , x ray hanger 12x15 , x ray hanger 8x10 , casessttes push button 14x14 , casessttes push button 14x17 , casessttes push button 10x12 , casessttes push button 12x15 , casessttes push button 8x10 , protection barrier 6x3 ( for x ray ) , cr syatem plate reader digital radiographydihl 8x10 , cr syatem plate reader digital radiography dihl 10x12 , cr syatem plate reader digital radiography dihl 12x15 , cr syatem plate reader digital radiography dihl 14x14 , cr syatem plate reader digital radiography dihl 14x17 , x ray view box ( led ) single film , x ray view box ( led ) double film , ecg paper roll 50 mm x 20 mtr , 6208t bpl 60 mmx15mtr , 6108t bpl 50mmx 20mtr , 108t bpl 50mmx 20mtr , ecg jelly 250gm , sonography jelly 250 gm , ecg chest lead , ecg ruber bulb , ecg machine fuse , sonography print roll 110 mm x 20 mtr , paper for ctmt , electrods for ctmt , ecg paper roll 3 ( ecg vesta 301i machine ) , ecg charger ( ecg vesta 301i machine ) , silicon ambu bag 250 ml , silicon ambu bag 500 ml , silicon ambu bag 750 ml , stethescope 1 piece , thermameter ( para ) 1 piece , thermameter ( digital ) 1 piece , urine analyzer paper roll 55 mm x 20 mtr , cbc paper roll 57 mm x 20 mtr ( for 3 part horiba ) , ot gown ( green cotton cloth ) standard size , ot dress ( pink, blue, green cotton cloth ) standard size , ot sheet with hole 6 x 3 feet , ot sheet with hole 3 x 4 feet , ot sleeper ( foot wear ) 6 no. , ot sleeper ( foot wear ) 7no. , ot sleeper ( foot wear ) 8no. , ot sleeper ( foot wear ) 9no. , ot sleeper ( foot wear ) 10 no. , ot sleeper ( foot wear ) covered 6 no , ot sleeper ( foot wear ) covered 7 no , ot sleeper ( foot wear ) covered 8 no , ot sleeper ( foot wear ) covered 9 no , ot sleeper ( foot wear ) covered 10 no , lead apron standard size , auto refractor roll 57 mm x 20 mtr...

Medical Health And Family Welfare - Rajasthan

32024450 supply of medicine and lab equipment cmho dungarpur supply of medicine and lab equipment cmho dungarpur , anaesthetics general anaesthetics and oxygen halothane , isoflurane , ketamine injection 50 mg/ml , propofol injection 10 mg/ml , thiopentone injection 0.5 g , sevoflurane , liquid medical oxygen (lmo) , local anaesthetics lignocaineointment 5% , lignocaine gelip 2% , lignocaine injection 2% , lignocaine and adrenaline injection 20mg + 0.01mg , lignocaine and dextrose injection 50mg + 75mg per ml , bupivacaine hydrochloride in dextrose injection5mg + 80 mg per ml , bupivacaine injection 0.50% , pre operative medication atropine sulphate injection0.6 mg/ml , midazolam injection ip 1 mg/ml , analgesic, antipyretic & anti inflammatory drugs opioid analgesics morphine sulphate injection ip 10 mg/ml , tramadol capsule 50 mg , tramadol injection 50 mg/ml , pentazocine injection 30 mg/ml , fentanyl citrate injection50 mcg/ml , fentanyl citrate injection50 mcg/ml , naproxen tablet ip 500 mg , naproxen tablet ip 250 mg , inj. butorphanol tartrate usp 1mg/ml 1ml size , non steroidal anti inflammatory drugs & antipyretics aspirintablet ip (gastro resistant) 150 mg , aceclofenac and paracetamol tablet 100 mg + 325 mg , diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% , diclofenac sodium and paracetamol tablet 50 + 325 mg , diclofenac sodium injection for im and iv 25 mg/ml , diclofenac sodium tablet 50 mg , diclofenac tablet (sr) 100 mg , etoricoxib tablet 90 mg , etoricoxib tablet ip 120 mg , ibuprofen and paracetamol tablet 400 mg + 325 mg , ibuprofen tablet 200 mg , ibuprofen tablet 400 mg , ibuprofen oral suspension 100 mg/5ml , indomethacin capsule 25 mg , mefenamic acid tablet 500 mg , paracetamoldrops 150 mg/ml , paracetamolsyrup ip 125 mg/5ml , paracetamoltablet 500 mg , paracetamol injection 150 mg/ml , inj diclofenac sodium aqueous 75mg/ml1ml size, iv & im use , paracetamol infusion ip 1% w/v 100ml size , tab. ketorolac 10 mg , muscle relaxants chlorzoxazone,diclofenac sodium& paracetamoltablet 250mg+50mg+325 mg , tab baclofen ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) , tab tizanidine hydrochloride ip 2 mg (each uncoated tablet containstizanidine hydrochloride ip 2 mg) , drugs for gout & rheumatoid arthritis allopurinol tablet 100 mg , hydroxychloroquine sulphatetablet 200 mg , leflunomide phosphate tablet 10 mg , leflunomide phosphate tablet 20 mg , sulfasalazine delayed release tablet 500 mg , antiallergics & drugs used in anaphylaxis corticosteroids betamethasone tablet 0.5 mg , betamethasone sodiumphosphate injection 4 mg/ml , dexamethasoneinjection 8 mg/2ml , dexamethasone tablet 0.5 mg , hydrocortisone sodium succinate injection 100 mg base / vial , methyl prednisolone sodium succinate for injection 500 mg , prednisolone tablet 5 mg , prednisolone tablet 10 mg , prednisolone tablet 20 mg , tab dexamethasone ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) , antihistaminics & drugs used in anaphylaxis adrenaline injection 1 mg/ml , chlorpheniramine maleate tablet 4 mg , hydroxyzine tablet 25 mg , pheniramine injection 22.75 mg/ml , promethazinesyrup ip 5 mg/ 5ml , promethazine injection 25 mg/ml , promethazine tablet 25 mg , anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml , cetirizine,phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg , cetirizine syrup 5 mg/ml , levoceitrizine tablet 5mg , montelukast 10 mg + levocetrizine 5mg tablet , antidotes and other substances used inpoisoning naloxone injection ip 0.4 mg/ml , pralidoxime chloride injection 25 mg/ml , n acetylcystine injection 200 mg/ml , anti epileptic drugs carbamazepinetablet 200 mg , carbamazepinetablet ip 100 mg , carbamazepine oral suspension usp 100 mg/5 ml , phenobarbitone tablet 30 mg , phenobarbitone injection ip 200 mg/ml , phenytoin injection 50 mg/ml , phenytoin oral suspension 25 mg/ml , phenytoin tablet 100 mg , pregabalin capsule ip 75 mg , sodium valproate ipinjection 100 mg/ml , sodium valproatetablet 200 mg , sodium valproate oral solution ip 200 mg/ 5 ml , sodium valproate(gastro resistant) ip tablet 500 mg , clobazam tablet/capsule 5 mg , clobazam tablet/capsule 10 mg , levetiracetam tablet 500 mg , levetiracetam oral solution suspension 100 mg/ml , levetiracetam injection 500 mg/5ml , gabapentine tablet/capsule 100 mg , gabapentine tablet/capsule 300 mg , tab lamotrigine ip50 mg (eachsustained releasetablet contains lamotrigineip 50 mg) , tab divalproex extended release ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) , tab oxcarbazepine ip150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) , tab lacosamide 100 mg (each film coated tablet contains lacosamide 100 mg) , tab topiramate ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) , anti infective drugs antibacterials aminoglycosides amikacininjection100 mg , amikacin injection250 mg , amikacininjection 500 mg , gentamycin injection 80 mg/2ml , betalactam penicillins amoxycillin capsule 250 mg , amoxycillin capsule 500 mg , amoxycillin trihydrate dispersible tablet 125 mg , amoxycillin oral suspension (dry syrup) 125 mg/5ml , amoxycillin and cloxacillin capsule 250 mg + 250 mg , amoxycillin and potassium clavulanate tabs 500 mg + 125 mg , amoxicillin and clavulanic acid injection 600 mg , amoxicillin and potassium clavulanate injection1.2 gm , amoxycillin& clavulanic acid syrup 200 mg + 28.5 mg / 5 ml , ampicillin capsule 500 mg , ampicillin injection ip 500 mg , benzathine benzylpenicillin injection ip12 lac units , benzathine benzylpenicillin injection 6 lac units , cloxacillin sodium injection 500 mg , piperacillin and tazobactum for injection 4 gm + 500 mg , tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg& potassiumclavulanate ip 125 mg , inj piperacillin 2 gm + tazobactom 250mg usp , cephalosporins cefepime injection500 mg , cefixime tablet 100 mg , cefixime tablet 200 mg , cefixime oral susp (drops) 25 mg/ml , cefoperazone and sulbactum for injection1 g + 0.5 g , cefotaxime injection1 g , cefotaxime injection 250 mg , cefpodoxime dispersible tablet 50 mg , ceftazidime injection 1 g , ceftazidime injection 250 mg , ceftazidime injection 500 mg , ceftriaxone injection ip 1 g/vial , ceftriaxone injection 250 mg , ceftriaxone injection ip 500 mg/vial , cefuroxime tablet 250 mg , cephalexin capsule 250 mg , cephalexin capsule ip 500 mg , cephalexin oral suspension ( cephalexin dry syrup) 125 mg/ 5ml , cephalexin tablet (dt) 125 mg , inj. ceftriaxone 1 gm + tazobactum 125 mg , tab.cefadroxil 250 mg , tab.cefadroxil 500 mg , macrolides azithromycin tablet (dt) 100 mg , azithromycin tablet ip 250 mg , azithromycin tablet 500 mg , quinolones ciprofloxacin injection 200 mg/ 100 ml , ciprofloxacin tablet 250 mg , ciprofloxacin tablet 500 mg , levofloxacin tablet250 mg , norfloxacintablet 400 mg , ofloxacin tablet 200 mg , ofloxacin suspension 50 mg/5 ml , ofloxacin injection 200mg / 100 ml , ofloxacinand ornidazole tablet 200 mg + 500 mg , ofloxacin oral suspension ip(each 5ml contains ofloxacin ip 100 mg) 30 ml size , tab. levofloxacin ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) , other anti bacterials aztreonam injection 500 mg , clindamycincapsule 150 mg , clindamycin capsule 300 mg , co trimoxazoleoral suspension 40 mg + 200 mg per 5ml , co trimoxazole tablet40 mg + 200 mg , co trimoxazole tablet160 mg + 800 mg , doxycycline capsule 100 mg , linezolid tablet ip 600 mg , linezolid injection 200 mg/100 ml , meropenem injection 500 mg , meropenem injection 1 g , nitrofurantoin tablet 100 mg , vancomycin injection 500 mg , vancomycin for intravenous infusion ip 1 gm , aztreonam 1gm injection , framycetin sulphate cream 1% , framycetin sulphate cream 1% , tab. faropenem sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) , injclindamycin phosphate ip 300 mg , injimipenem + cilastatin 500mg/500mg ip powder for solution , inj. polymixin sulphate b usp 5 lac i.u. , inj meropenem ip 250 mg , inj colistimethate ip 1m iu powder for solution , anti amoebic metronidazoleinjection 500 mg/ 100 ml , metronidazole benzoate oral suspension 100 mg/ 5 ml , metronidazole tablet 200 mg , metronidazole tablet 400 mg , tinidazole tablet ip 300 mg (film coated) , tinidazole tablet ip 500 mg (film coated) , anthelmintics albendazole oral suspension 400 mg/ 10 ml , albendazole tablet ip 400 mg , diethylcarbamazine tablets ip 100 mg , anti fungals clotrimazole cream ip 2% w/w , clotrimazole vaginal tablet 500 mg , fluconazole tablet 150 mg , griseofulvin tablets 125 mg , itraconazole capsule 100 mg , amphotericin b injection 50 mg , inj. liposomol amphotericine b 50 mg , inj. voriconazole200mg/vial , tab. terbinafine hydrochloride 250 mg , anti malarials artisunate injection 60 mg (combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection) , chloroquine phosphate injection 40 mg/ml , chloroquine phosphate tablet 250mg (=155 mg of chloroquine base) , chloroquine phosphate suspension 50 mg/ 5ml , mefloquine tablet250 mg , primaquine tablet 2.5 mg , primaquine tablet 7.5 mg , quinine dihydrochlorideinjection 300 mg/ml , quinine sulphate tablet 300 mg , act kit containing 3 tablet of artesunate (each tablet of artesunate 25mg strength) and 1 tablet of sulphadoxine pyremethamine (250 mg+ 12.5 mg) , act kit containing 3 tablet of artesunate (50mg each) and 1tablet of sulphadoxine pyremethamine (500+25) mg , act kit containing 3 tablet of artesunate (100 mg each) and 1 tablet of sulphadoxine pyremethamine (750 + 37.5) mg , act kit containing 3 tablet of artesunate 150 mgand 2 tablet of sulphadoxine pyremethamine (500 mg+ 25 mg) , act kit containing 3 tablet of artesunate (each 200 mg) and 2 tablet of sulphadoxine pyremethamine (750 + 37.5) mg each or 3 tablet sulphadoxine pyremethamine (500+25) mg each , artemether + leumefantrine tablet (40 mg and 240 mg) , artemether + leumefantrine tablet (80 mg and 480 mg) , anti viral acyclovir tablet200 mg , acyclovir tablet 800 mg , acyclovir suspension400 mg/ 5ml , acyclovir injection250 mg , acyclovir injection500 mg , tab. valganciclovir 450 mg , tab. entecavir ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) , inj. ganciclovir sodium 500mg (lyophilized powder for reconstitution) , anti neoplastic and immuno suppressant drugs azathioprine tablet ip 50 mg , bleomycin injection15 units , chlorambucil tablet 5 mg , cisplatin injection 50 mg/ 50 ml , cyclophosphamide injection200 mg , cyclophosphamide injection ip 500 mg , cyclosporine capsule usp 50 mg , cytarabineinjection100 mg/5 ml , danazol capsule ip 50 mg , daunorubicininjection 20 mg , doxorubicin injection50 mg/ 25 ml , etoposide injection 100 mg/ 5 ml , fluorouracil injection 250 mg/ 5 ml , l asparaginase injection 10000 iu , leucovorin calcium injection 10 mg/ml , melphalan tablet 5 mg , mercaptopurinetablet ip 50 mg , methotrexate injection 50 mg/2 ml , methotrexate tablet 2.5 mg , paclitaxel injection 260 mg , paclitaxel injection 100 mg , tamoxifen tablet 10 mg , vinblastineinjection 10 mg/10 ml , vincristineinjection 1 mg/ml , alpha interferon injection 3 million unit , carboplatin injection 150mg , carboplatin injection 450mg , cisplatin injection 10 mg/10 ml , dacarbazine injection 500 mg , filgrastim injection 300mcg/ml , gemcitabine injection 200 mg , gemcitabine injection 1gm , ifosfamide injection 1gm , imatinib tablet 400 mg , methotrexate tablet ip 10 mg , mitomycin c injection 10 mg , oxaliplatin injection 50 mg , capsuleprocarbazine hydrochloride usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) , injbendamustine 100 mg , tab capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) , tab letrozole usp2.5 mg (each film coated tablet containsletrozole usp2.5 mg) , capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) , inj. bortezomib 2mg , tab abiraterone acetate ip 250 mg(each uncoated tablet contains abiraterone acetate ip 250 mg) , capsule lomustine ip 40 mg(each capsule contains lomustine ip 40 mg) , cap thalidomide usp 100 mg(each hard gelatin capsule contains thalidomide usp 100 mg) , inj. bevacizumab 400 mg , inj. bevacizumab 100 mg , tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) , tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) , capsule mycophenolate mofetil usp 250 mg (each capsule conatin mycophenolate mofetil usp 250 mg) , capsule tacrolimus ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) , tab. mycophenolate sodium 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) , tab. bicalutamide usp 50 mg(each film tablet contains bicalutamide usp 50 mg) , tab. 6 thioguanine usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) , inj zoledronic acid ip 4mg vial , tab dasatinib 100 mg , anti parkinsonism drugs bromocriptine mesylate tablet2.5 mg , levodopa and carbidopa tablet 100 mg + 10 mg , levodopa and carbidopa tablet 250 mg + 25mg , trihexyphenidyl hydrochloride tablet 2 mg , drugs affecting blood anticoagulant acenocoumarol tablet 2 mg , enoxaparin sodium injection 60 mg , heparin sodium injection 5000 iu/ml , warfarin sod. tablet 5 mg , inj. n butyl alcohol 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size , haemostatic ethamsylate injection 250 mg/ 2ml , tranexamic acid tablet 500 mg , vitamin k injection10 mg/ml , tab ethamsylate bp 500 mg (each uncoated coated tablet contains ethamsylate bp 500 mg) , feracrylum 1% w/w sterile solution 100 ml , inj tranexamic acid ip 100mg/ml 5ml size , drugs used in haemophilia dried factor viii fraction (iv use) 250 iu , dried factor viii fraction (iv use) 500 iu , dried factor viii fraction (iv use) 1000 iu , factor – ix concentrate 600 iu , anti inhibitor coagulation complex[human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu] , recombinant coagulation factor viia 1 mg , recombinant coagulation factor viia 2 mg , recombinant f ix500 iu with diluent , 3rd generation recombinant f viii250 iu with diluent , 3rd generation recombinant f viii 1000 iu with diluent , drugs used in thalassaemia deferasirox tablet100 mg , deferasirox tablet 500 mg , deferiprone capsule 250 mg , deferiprone capsule 500 mg , desferrioxamine injection (for i.m. inj and i.v., s.c. infusion) 500 mg , erythropoetins rh erythropoetininjection10000 iu , rh erythropoetininjection 2000 iu , rh erythropoetininjection 4000 iu , plasma expanders humanalbumin solution 20% , hydroxyethyl starch (130/4) 6% w/vwith sodium chloride 0.9% w/v intravenous infusion , polygeline 3.5% solution with electrolytes for i.v. infusion , cardio vascular drugs antiarrhythmic adenosine injection6 mg/2ml , amiodaronetablet 100 mg , amiodaronetablet 200 mg , amiodarone hydrochloride injection 50 mg/ml , verapamil tablets ip 40 mg , thrombolytic streptokinase injection 15 lac units , urokinase injection 5 lac unit , antiplatelet aspirin delayed release tablet(enteric coated) 75 mg , clopidogrel tablet ip 75 mg , clopidogrel and aspirin tablet 75 mg +75 mg , antihypertensive amlodipine tabletip 2.5 mg , amlodipine tablet 5 mg , atenolol tablet 50 mg , atenolol tablet 25 mg , diltiazem tablet 30 mg , enalapril maleate tablet 10 mg , enalapril maleate tablet 5 mg , enalapril maleate tablet 2.5 mg , labetalol tablet 100 mg , labetalol hydrochloride injection 20 mg/ 4ml , lisinopril tablet 2.5 mg , lisinopril tablet 5 mg , lisinopril tablet 10 mg , losartan tablet 25 mg , losartan tablet 50 mg , amlodipine and enalapril maleate tablet 5 mg +5mg , losartan potassium & amlodipine tablet 50 mg + 5mg , losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg , amlodipine and lisinopril tablet 5mg +5 mg , amlodipine and atenolol tablet 5 mg +50 mg , methyldopa tablet 250 mg , metoprolol tablet ip 25 mg , metoprolol suscinate tablet (extended release) usp 50 mg , nifedipine capsule 5 mg , nifedipine tablet (sustained release) 10 mg , prazosin tablet (extended release) 2.5 mg , propranolol tablet 40 mg , ramipril tablet / capsule 2.5 mg , telmisartan tablet ip 40 mg , tab. clonidine hydrochloride usp 0.1 mg (each tablet contains clonidine hydrochloride usp 0.1 mg) , tab. sotalol hydrochloride usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) , inj. esmolol hydrochloride 10mg/ml 10ml size , inj. sodium nitroprusside25mg/ml2ml size , tab. carvedilol 3.125 mg , antianginal glyceryl trinitrate tablet 2.6 mg , isosorbide dinitrate tablet5 mg , isosorbide mononitrate tablet 20 mg , nitroglycerininjection 5 mg/ml , lipid lowering atorvastatin tablet 10 mg , atorvastatin tablet 40 mg , fenofibrate capsule 200 mg , tab rosuvastatin ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) , tab rosuvastatin 10 mg , drugs used in heart failure digoxin injection 0.25 mg/ml , digoxin tablet 0.25 mg , dobutamineinjection 50 mg/ml , dopamine hydrochloride injection40 mg/ml , isoprenaline injection 2mg / ml , tab. sacubitril 24 mg and valsartan 26 mg , miscellaneous noradrenaline injection 2 mg/ml , magnesium sulphate injection(50% ) 500 mg/ml , dental drugs chlorhexidine mouthwash bp 0.20% , dental gel: choline salicylate + benzalkonium + lignocaine 8.75% , desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % , gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% , metronidazole and chlorhexidine gel 1%+ 0.25% , dermatological drugs antifungal miconazole nitrate cream2% , clotrimazole mouth paint (clotrimazole 1% w/v) 1% , ketoconazole cream 2% , powder clotrimazole 1% w/w 30 gm , oint. terbinafine 1%w/w (10 gm tube) , anti infective beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% , clindamycin phosphate gel usp 1% , fusidic acid cream2% , neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg , olopatadine hydrochloride ophthalmic solution 0.1% w/v usp (e/d) 5ml size , cream mupirocin usp 2% (each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base) 15 gm size , topical steroids betamethasone dipropionate cream 0.05% , betamethasone lotion0.05% , clobetasol cream 0.05% , antiviral acyclovir cream 5% , scabicides & pediculocides gamma benzene hexachloride lotion(lindane lotion usp) 1% , permethrin cream 5% , permethrinlotion 5% , coal tar 6% & salicylic acid 3% onitment , others glycerin ip 100 ml , glycerin ip 400 gm , calamine lotion ip , compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% , tretenoin cream 0.03% , reagents & diagnostic agents blood grouping anti a blood grouping serum (anti a monoclonal serum ip) , anti b blood grouping serum , anti drh blood grouping serum , dyes & contrast media diatrizoate meglumine and diatrizoate sodium inj usp60% (iodine conc.292 mg/ml) 60% , diatrizoate meglumine and diatrizoate sodium inj usp 76%w/v (iodine conc.370 mg/ml)76% , gadodiamide injection0.5 mmol/ml , iohexol usp (solution for injection) non ionic contrastmedium in sterile aqueous solution 350 mg iodine/ml. , iohexol ( non ionic contrastmedium in sterile aqueous solution) 300 mg iodine/ml. , diagnostic multistix test strip , vdrl antigen (with +ve and ve control) / rpr slide kit , disinfectants & antiseptics cetrimide cream ip 0.50% , chlorhexidine gluconate solution 5% , compoundbenzoin tinctureip , formaldehyde solution (34.5% 38%) , gentian violet topical solution usp 1% , glutaraldehyde solution 2% , hydrogen peroxide solution 6% , lysol(cresol with soap solution) (cresol 50% + soap 50%) , povidone iodine solution5% , povidone iodine solution5% , povidone iodine solution10% , povidone iodine scrub solution / cleansing solution 7.5%w/v povidone iodine 7.5% , povidone iodine ointment 5% , povidone iodine ointment 5% , silver sulphadiazine cream 1% , silver sulphadiazine cream ip 1% , surgical spirit bp , surgical spirit bp , diuretics acetazolamide tablet 250 mg , furosemide tablet 40 mg , furosemide injection 10 mg/ml , hydrochlorthiazide tablet 12.5 mg , hydrochlorthiazide tablet 25 mg , mannitol injection 20% , spironolactone tablet 25 mg , spironolactone tablet 50 mg , torsemide tablet 10 mg , torsemide injection10 mg/ml , drugs for ear ailments ciprofloxacin and dexamethasoneear drops 0.3% + 0.1% , clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops , neomycin, polymixin b & hydrocortisone ear drops/otic solution usp (neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml) , wax dissolving ear drops: paradichlorobenzene , benzocaine , chlorobutanol , turpentine oil2% + 2.7% + 5% + 15% , gastro intestinal drugs antacid antacid tablet , antacidliquid , anti ulcer omeprazole capsule 20 mg , pantoprazole injection 40 mg , pantoprazole& domperidone sr capsule 40 mg+ 30 mg , ranitidine hcl injection 50 mg/2ml , ranitidine tablet 150 mg , ranitidine tablet 300 mg , abdominal colic & antispasmodic dicyclominetablet 10 mg , dicyclomineinjection 10 mg/ml , dicyclomine hydrochloride oral solution ip10 mg/5ml , dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml , dicyclomine and paracetamol tablet 20mg + 325mg , drotaverine tablet 40 mg , drotaverine hydrochloride injection 40 mg/2ml , drotaverine & mefenamic acidtablet 80 mg + 250 mg , hyoscine butylbromide tablet 10 mg , hyoscine butylbromide injection ip 20 mg/ml , antiemetic metoclopramide injection 10 mg/2ml , metoclopramide tablet 10 mg , metoclopramide syrup 5 mg/ 5ml , domperidone tablet 10 mg , domperidone oral drops 10 mg/ ml , domperidone suspension 5 mg/ 5ml , ondansetron orally disintegrating md tablet4 mg , ondansetron injection 2 mg/ml , tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg (each enteric coated tablet contains doxylamine succinateusp 20 mg & pyridoxine hydrochloride ip 20 mg) , inj prochlorperazine mesylate 12.5mg/ml 5ml size , drugs for constipation, diarrhoea, piles bisacodyl tablet 5 mg , lactic acid bacillus tablet 60 million spores , lactulose solution 10gm/15ml , liquid paraffin ip , liquid paraffin ip , loperamide tablet ip 2 mg , ors powder , ointment containing : lidocaine 3%, zinc oxide5% , hydrocortisone0.25%, allantoin0.5% , sodium phosphates enema bp , probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) , drugs for gall stones ursodeoxycholic acid tablet 300 mg , drugs for ulcerative colitis tab. mesalamine usp 1.2 gm enteric coated (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) , hormones, other endocrine drugs antidiabetics biphasic isophane insulin injection30 / 70 (30% soluble insulin &70% isophane insulin) 40 iu / ml , isophane insulin injection40 iu / ml , soluble insulin injection 40 iu / ml , glibenclamide tablet 5 mg , gliclazide tablets ip 40 mg , glimepiride tablet 2 mg , glimepiride tablet 1 mg , glipizide tablet ip 5 mg , metformin tablet 500 mg , pioglitazone tablet ip 15 mg , metformin hydrochloride sr tablet 1000 mg , glipizide and metformin hydrochloride tablet 5 mg + 500 mg , glibenclamide and metformin hydrochloride (sr) tablet 5 mg + 500 mg , metformin hydrochloride (sr) and glimepiride tablet 500 mg + 1 mg , metformin hydrochloride (sustained release) and glimepiride tablet500 mg + 2 mg , glimepiride, pioglitazone and metformin hydrochloride (sr) tablet2mg + 15mg + 500mg , gliclazideand metformin tablet 80 mg + 500 mg , insulin glargine 100 iu/ml with 15 insulin syringes and needles/cartridge 100 iu/ml with 15 needles and 1 pen per 20 cartridges , insulin glargine100 iu/mlwith 30 insulin syringes with needle , tenaligliptin tablet 20 mg , female hormonal preparations carboprosttromethamine injection0.25 mg/ml , clomiphene tablet ip 25 mg , clomiphene tablet 50 mg , conjugated estrogen tablet 0.625 mg , dinoprostone cream0.5 mg , ethinyloestradiol tablet ip 50 mcg , hydroxyprogesterone injection 250 mg/ml , norethisterone tablet 5 mg , progesteroneinjection 200 mg /2ml , medroxyprogesterone acetate tablet ip 10 mg , thyroid & anti thyroid carbimazole tablet 5 mg , thyroxine sodium tablet 100 mcg , thyroxine sodium tablets ip 50 mcg , others glucagon injection usp 1 mg/ml , octreotide injection 50 mcg/ml , immunologicals anti d immunoglobulin human anti d immunoglobulin injection (im use) 300 mcg , human anti d immunoglobulin 150 mcg , anti rabies & anti snake venum human rabies immunoglobulin injection 150 iu/ml , rabies vaccine human (cell culture) (intradermal)2.5 iu , rabies vaccine human (cell culture) (intramuscular) 2.5 iu/ dose , rabies antiserum ip (equine) (i.m./sc use) 300 units / ml , snake venom anti serum(polyvalent anti snake venom) lyophillized , others normal human intravenous immunoglobulin 5g/100ml , tetanus immunoglobulin 250iu , tetanus vaccine(adsorbed) ip , diphtheria antitoxin 10,000 iu , inj. hepatitis b immunologlobin ip 200 i.u , inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml(0.5 gm) , neuromuscular blockers& cholinesteraseinhibitors atracurium injection 10 mg/ml , glycopyrrolate injection 0.2 mg/ml , neostigmine injection ip 0.5 mg/ml , neostigmine injection 2.5 mg/5ml , neostigmine tablets ip 15 mg , succinylcholine injection 50 mg/ml , valethamate bromide injection 8 mg/ml , vecuronium bromide for injection 4 mg (freeze dried) , inj. cis atracurium besylate 2 mg/ml in 5 ml vial , ophthalmological preparations anti fungal fluconazole eye drops0.3% , acyclovir eye ointment ip 3% w/w 5gm size , anti inflammatory flurbiprofen sodium ophthalmic solution 0.03% , anti glaucoma betaxolol eye drops 0.50% , brimonidine tartrate and timolol eye drops0.15% + 0.5% , phenylephrine hydrochloride ophthalmic solution usp/ phenylephrine eye drops bp 5% , timolol eye drops 0.50% , travoprost ophthalmic solution 0.004% , pupillary dialators/constrictors atropine eye ointment 1% , atropine sulphate ophthalmic solution usp 1% , homatropine eye drops 2% , tropicamide eye drops 1% , antibiotic chloramphenicol eye drops 0.05% , ciprofloxacin eye drops0.30% , ciprofloxacin ophthalmic ointment 0.30% , tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% , tobramycin eye drops 0.30% , tobramycin ophthalmic ointment 0.30% , eye drop moxifloxacin0.5% w/v ophthalmic solutionip 5ml size , chloramphenicol 1% w/w eye ointment ip, 3gm size , local anaesthetic lidocaine hydrochloride topical solution usp 4% , others carboxymethylcellulose sodium lubricant eyedrops 0.50% , hyaluronidase injection 1500 iu , hydroxypropylmethyl cellulose solutionwith prefilled glass syringe with cannula20 mg/ml , drugs acting on uterus isoxsuprine injection 5 mg/ml , isoxsuprine tablet 20 mg , methylergometrine injection 0.2 mg/ml , methylergometrine tablet ip 0.125 mg , misoprostol tablet 200 mcg , mifepristone tablet200 mg , oxytocin injection 5 iu/ml , natural micronisedprogesteron soft gelatin capsule 200 mg (each soft gelatin capsule containsprogesteron ip 200 mg) , tab cabergoline ip 0.5mg(each uncoated coated tablet contains cabergoline ip 0.5mg) , inj human chorionic gonadotropin ip 5000 i.u. , leurprolide acetate depot 3.75 mg , leurprolide acetate depot 11.25 mg , psychotropic drugs anti psychotics chloridazepoxide tablets ip 10 mg , chlorpromazinetabletsip 100 mg , chlorpromazinetablets ip 25 mg , chlorpromazinetablets ip50 mg , chlorpromazineinjection ip 25 mg/ml , haloperidol injection 5 mg/ml , haloperidol tablet 1.5 mg , haloperidol tablet5 mg , olanzapine tablet5 mg , risperidone tablet2 mg , risperidone tablet 1 mg , trifluperazine tablets ip5 mg , quetiapine tablet ip 50 mg , quetiapine tablet ip 25 mg , tab. levosulpiride 25 mg (each uncoated tablet contains levosulpiride 25 mg) , anti depressants amitriptyline tablets ip 25 mg , escitalopram tablets ip10 mg , fluoxetine capsule ip 20 mg , imipramine tablet 25 mg , imipramine tablet 75 mg , lithium carbonate tablet 300 mg , sertraline tablet 50 mg , sedatives & tranquilizers alprazolam tablet 0.25 mg , alprazolam tablet 0.5 mg , clonazepam tablet 0.5 mg , diazepam injection10 mg/ 2ml , diazepam tablet 5 mg , lorazepam injection2 mg/ml , tab. lorazepam ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) , tab. zolpidem 5 mg , drugs acting on the respiratory tract anti asthmatic aminophylline injection25 mg/ml , beclomethasone inhalation 200 mcg/ dose , budesonide nebulizer suspension0.25 mg/ml , budesonide rotacap 200 mcg , ipratropium bromide nebulizer solution 250 mcg/ml , ipratropium rotacap40 mcg , salbutamoltablet 4 mg , salbutamol inhalation 100 mcg/ dose , salbutamol nebuliser solution 5 mg/ml , salbutamol tablet 2 mg , salbutamol syrup ip 2 mg/5ml , terbutaline sulphate tablet ip 2.5 mg , theophylline and etophylline injection 50.6mg + 169.4mg , theophylline and etophylline tablet 23mg + 77mg , theophylline tablet(sr) 400 mg , formoterol & budesoniderotacap 6 mcg+ 200 mcg , tab. acebrophylline 100 mg , antitussives cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] , dextromethorphan hydrobromide syrup 13.5 mg/ 5ml , cough syrup/ expectorant(ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg , local decongestant saline nasal solution(drops)0.65% , xylometazolinenasal drops 0.1% , solutions correcting water, electrolyte & acid base disturbance compound sodium lactate injection , dextrose injection25% , dextrose injection 10% , dextrose injection 5% , multiple electrolytes & dextrose injection type iip (electrolyte p injection ) , multiple electrolytes & dextrose injection type iiiip (electrolyte m injection) , potassium chloride injection0.15 gm/ml , potassium chloride oral solution usp500 mg/ 5ml , sodium chloride and dextrose injection 0.9 % + 5 % , sodium chloride injection , sodium chloride injection , ringer acetate infusion 500 ml , sodium chloride 0.45% w/v polypack 500 ml , drugs for urology finasteride tablet 5 mg , tamsulosinhcltablet 0.4 mg , flavoxate tablet 200 mg , tab savelamer carbonate 400 mg (each film coated tablet containssavelamer carbonate 400 mg) , tab sodium bicarbonate usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) , tab levamisol hydrochloride ip 50 mg (each uncoated tablet conatinlevamisol hydrochloride ip 50 mg) , tab.phenazopyridine 5 mg , tab. dutasteride 0.5 mg , syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate) , antivertigo betahistine tabletip 8 mg , betahistine tablet ip 16 mg , cinnarizine tablet ip 25 mg , cinnarizine tablet ip 75 mg , vitamins & minerals ascorbic acid tablet 500 mg , calcium gluconate injection 10% , calcium& vitamin d3 tablet 500 mg + 250 iu , calcium & vitamin d3 suspension (each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu) , calcitriol capsule0.25 mcg , cholecalciferol granules 60,000 iu /1gm , ferrous sulphate and folic acid tablet 100 mg + 0.5 mg , ferrous sulphate with folic acid tab.(paediatric) 20 mg + 0.1 mg , folic acidtablet ip 5 mg , iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg , iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg , mecobalamin injection 500 mcg/ml , multivitamin drops each ml contains vit a 3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, d pantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg , multivitamin tablets nfi formula sugar coated.vit a 2500 iu , pyridoxine tablet 10 mg , pyridoxine tablet40 mg , thiamine tablet 100 mg , vitamin a solution 1 lac iu/ml , vitamin b complex tablet nfi (prophylactic) , vitamin b complex injectionnfi , zinc sulphate dispersible ip elemental tablet 10 mg , methylcobalmin tablet 500 mcg , methylcobalmin tablet 1500 mcg , vitamin d3 oral solution 60000 iu , inj. ferric carboxymaltose 50 mg/ml 10 ml size , multi vitamin syrup , miscellaneous drugs flunarizine tablet 5 mg , black disinfectant fluid (phenyl) (as per schedule o grade iii , concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans , hameodialysis bicarbonate solution , peritonial dialysis solution ip , sodium bicarbonate injection ip 7.5% , water for injection ip , alendronate sodium tablets usp/bp 35 mg , mannitolwith glycerin injection 10% + 10% , surfactant for intratrecheal instillation(natural bovine lung surfactant) , oseltamivir 75 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir 45 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir 30 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg/ml. (each ml contains 12 mg oseltamivir base after reconstitution) , oseltamivir phosphate oral suspension ip 12 mg/ml (each ml contains : 12 mg oseltamivir after reconstitution , vitamin k 1 (phytomenadione) 1 mg/0.5ml injection , intravenous fat emulsion 20% w/v (pl/tg ratio 0.06) 250ml , tab pyridostigmine usp 60 mg (each tablet contains pyridostigmine usp 60 mg ) , inj. caffeine citrate usp 20mg/ml(equivalent to 10 mg caffeine base/ml) 3ml size , inj. amino acid 10% 100ml size , cap. vitamin e 400 mg , inj poractant alpha 80 mg/ml in pack of 1.5 ml , absorbable gelatin sponge ip 66, size 80(+ 10) mm x 50 mm x 10 mm should be sterlized. , absorbent cotton wool ip 500 gm , asepto syringe with transparent bulb sterile, 60 ml , blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824(part 3):1996 , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered,,without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • shouldconform to is 13422 • isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) , disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic •shouldconform to is 13422 •isi marked / ce certified / fda approved , disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powderfree (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • shouldconform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards , suction catheter, sterile. size: fg 5 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 6 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 8(for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 10 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 12 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 14 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 16 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 18(for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 20 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , suction catheter, sterile. size: fg 22 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 8 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is 11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size10 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size16 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size18 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size20 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size22 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 •color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 24 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specificationfor b,c,d,e,f,g should be mentioned as per is11497 for particular size , infant feeding tube size:10fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:8fg, length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , infant feeding tube size:5fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure •radio opaque line • sterile , sterile disposable perfusion set with airway and needle (adult use) • for gravity feed only • sharp and easy piercing spike with air vent • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • self sealing latex bulb which will also act as an port for extra medication • efficient roller clamp to control and adjust the fluid rate • 21 g needle • should conform to is 12655 4 standard , sterile disposable perfusion set (infusion set) with airway and needle(paediatric use) • burette type measured volume chamber of 100 ml • drop size of approx 60 drops per ml • injection port,latexfree, for intermittent medication. • floating auto shut off valve (latex free) in burette. • soft and kink resistant pvc tubing. • roller controller for flow control • tube length 150 cm • 23g needle • should conform to iso 8536 5 , sterile disposable infusion set with microdrip (i.v.) • microdrip infusion set with drop size reduced to approx 60 drops per ml • sharp and easy piercing spike • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the fluid rate • should conform to is 12655 4 standard , insulin syringe ( 40 units) with (fixed) 30 g needle shall conform to is 12227 , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 16g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable (single use teflon / ptfe i.v. cannula with integrated 3 way stop cock.)size 18g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20g • should be packed in transparent, single blister pack. • should conform to is 10555 standard , sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g • should be packed in transparent, single blister pack. •should conform to is 10555 standard , sterile disposable (single use) teflon/ ptfe i.v. cannula without port.size 24g • suitable for paediatric & neonatal use • should be packed in transparent, single blister pack. • should conform to is 10555 standard , mucus extractor sterile • clear transparent container • antibacterial filter • soft, kink resistant pvc tubing • tube size 10 fg; length 40 cm (min.) • capacity 25 ml , nasal oxygen cannula (set), twin bore (accessory for compressed air breathing)all sizes (adult) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , nasal oxygen cannula (set), twin bore (accessory for compressed air breathing)all sizes (pediatrics) •soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm , paper adhesive plaster 1 x 9.0 mts (with cutter) non woven adhesive tape,hypoallergic,should have some stretch bonding , paper adhesive plaster 2 x 9.0 mts (with cutter) non woven adhesive tape hypoallergic, should have some stretch bonding , paper adhesive plaster 3 x 9.0 mts (with cutter)non woven adhesive tape hypoallergic, should have some stretch bonding , plaster of paris bandages15cm x 2.7mts / roll should conform to schedulef(ii) of drug and cosmetic act 1940 , plaster of paris bandages 10cm x 2.7mts / roll should conform to schedulef(ii) of drug and cosmetic act 1940 , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:10 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:12 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:14 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:16 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size:18 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm , scalp vein set (disposable):size 18g •butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritanttube • sterile , scalp vein set (disposable):size 20g • butterfly shaped wings for easy handling and attachment with skin. colour coded •needle should be bevelled, siliconised and should ensure atraumatic cannulation •female luer fitting at one end •soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set (disposable):size 22g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , scalp vein set (disposable):size 24g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile , sterile hypodermic syringe with needle attached, 24g, single use 2 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container , sterile hypodermic syringe with needle attached, 24g, single use 5 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 10 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , sterile hypodermic syringe with needle attached, 22g, single use 20 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow •sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , surgical blade sterile, size 11 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 15 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , surgical blade sterile, size 22 • single peel pack in metal foil •the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , suture needles curved 1/2 circle round body assorted size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved 1/2 circle round body assorted size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle cutting size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting 1/2 circle size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , suture needles curved and cutting size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 , sterile disposable spinal needle for single use 22g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , sterile disposable spinal needle for single use 25g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma , urine collecting bag, disposable 2000 ml • transparent sheet • kink resistant flexible tubing not less than 90 cm in length • should have non return valve • top drainage outlet • graduated bag • moulded handle for easy handling , double j stent, sterile, both ends open size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, both ends open, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue , double j stent, sterile, one end closed, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue , endotracheal tube, plain size 2.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 3.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 4.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 5.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain with radio opaque line, sterile, single use size 6mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 6.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 7.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, plain size 8.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile , endotracheal tube, cuffed size 4mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 4.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 6.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 7.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 8.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , endotracheal tube, cuff size 9 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product , tracheostomy tube (pvc), plain, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line , tracheostomy tube (pvc), cuffed, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line • balloon with non return valve , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 24) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 28) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 32) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , corrugateddrainage sheet, sterile, multichannel, with radio opaque line, single use all sizes , polypropylene nonabsorbable synthetic surgical mesh 7.5 cmx 15 cm soft to feel fast edges,slightly stretchbonding. , polypropylene nonabsorbable synthetic surgical mesh 15 cmx 15 cm soft to feel fast edges,slightly stretchbonding. , sterilised umbilical cotton tape width 3 mm, length 75 cm should conform to schedulef(iii) of drug and cosmetic act 1940 , bone wax sterilised , temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; straight cutting60 mm ,breakaway , skin graft knife blade (sterile) (disposable ) skin grafting knife blade (sterile) made of carbon steel or stainless steel material 158 mm long individually wrapped in wrapper corrosion inhibitor paper in single packet,.in packs of 10. the edge must be sharp enough to cut the skin in a single shave and should snugly fit in the handle should conform to is 3759. 2. skin grafting knife handle (watson modification of humby’s knife ) stainless steel, ce certified, in which the blade specified in (a) above should fit snugly. should conform to 7980 1976. , k wire, length 375 mm; 1mm length of wire should be mentioned with specification. should conformto is 8261 , k wire,length 375 mm;1.6mm • length of wire should be mentioned with specification. • should conformto is 8261 , k wire, length 375 mm; size 1.8mm • length of wire should be mentioned with specification. •should conformto is 8261 , face mask, disposable • should be manufactured from non woven poly prop fabric • should be 3 ply construction • should have high bacterial filtration efficiency • should be heat sealed to keep 3 layers together • standard size 17.5 x9 cm • color green/blue • there should be a string each at all four corners,length of string should be 40cm • nose clip should be there •no elastic band. , surgical cap, disposable (for surgeons) • should be manufactured from non woven fabric. • strip for tying the cap stitched on the back for proper grip on the forhead. • green colour • ultrasonically stitched • air permeable/breathable • should retain skin and hair particle. • strip for tying the cap , surgical cap, disposable ( for nurses) • should be manufactured from non wovenfabric • blue / green colour • round upon wearing, with elastic •air permeable / breathable •should retain skin and hair particles , foldable intra ocular lense with injector (size + 11 d to +17.5 d) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics (5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , foldable intra ocular lense with injector (size + 18 d to + 24 d) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , foldable intra ocular lense with injector (size + 24.5 d to + 28.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) material 2. bi convex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with disposable cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 24.5 d to + 28.5 d at 0.5 d step. 9. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 11 d to +17.5 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 18 d to + 24 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , standard pmma intra ocular lenses (size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10°anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowdered,without tear,properly folded in a paper • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size , disposable sterile surgical rubber gloves size 8 inches • made ofnaturalrubberlatexpowder free,without tear,properly folded in a paper • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small. should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium should conform to is 15354 , rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large should conform to is 15354 , pressure monitoring line / high pressure extension line • suitable for high pressure monitoring and for connection between syringe infusion pump and patient • male luer lock at one end and female luer lock at other end ; should fit all standard equipment. luer lock connectors should provide secure fitting. • pressure upto 800 psi • length 200 cm • sterile , urine collecting bag for new born /paediatric urine collection bag, capacity 100ml • should have suitability for both male and female patients • should be provided withadhesive for fixation and good grip with minimal risk of allergy and injury • capacity 100 ml • sterile , umbilical catheter (for new born) all sizes • radio opaque line • with female flexible mount • colour coded connector • open tip should be soft, rounded, atraumatic • length 40 cm , umbilical cord clamp • suitable for clamping umbilical cord of new born • security lock to prevent accidental opening after clamping • grooved clamping area , absorbable oxidizedregenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property , close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 16 fg , close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter18 fg , t – tube for common bile duct drainage • kehr’s t tube made from medical grade pvc, and siliconized • smooth, kink resistant • radio opaque line throughout the length • sterile • length 20 x 60 cm • size 10 to 18 fg , bone cement with antibiotics,fast and slow setting , general specificaition for s 99 (a) and s 99(b) sanitary napkins (for menstrual hygiene) specifications: sanitary napkin, beltless 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc. 3. back strip – a back strip for sticking the sanitary napkin onto the underwear should be there using good quality adhesive material. 4. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section total pad length 210 +_ 10 230 +_ 10 width60 to 75 70 to 85 thickness8 +_ 2 5. weight : not more than 10 gm . . instructionfor usage should be mentioned on every packet , sanitary napkin, belttype 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or non woven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc 3. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section pad length220 +_ 10 width70 +_ 5 thickness 17 +_ 3 4.weight : 12 +_ 3 gm 5.pack – six napkins in a pack. 6.elastic belt with loops shall be provided in each pack. 7.absorbency: the napkin should be able to absorb not less than 30 ml of normal saline or coloured water or test fluid when poured on to the centre of the napkin at the rate of 15 ml per minute. .instruction for usage should be mentioned on every packet. , belt less sanitary napkin with wings 1. covering (absorbing top sheet corrector)–good quality knitted sleeve or non woven fabric of rash free,non irritant and soft to touch material which has sufficient porosity to permit the assembled napkin to meet absorbency requirements.the napkins shall have a non absorbent barrier on one side with adhesive covered by a differently identifiable paper 2.overall length(mm)230 ± 5 3.core length220 mm± 10 4.fluff core/padlength220 mm± 10 5. over all width with wings160mm+_5 6.fluff core/padlength70 mm± 5 7.thickness of a single pad9 10mm 8.weight of a single pad : 8 10 gm 9.pack six napkins in a pack. 10type. belt less sanitary napkin withwings 11.minimum absorbency: 50ml 12.ph value of absorbent material6 8.5 b. disposable individual pouch or wrapper for each sanitary napkin(as per ministry of environment,forest and climate change dated 08.04.2016) pouch/wrapper specifications : 1. pouch/wrapper should be of the size of sanitary napkin being supplied. 2. it should have adhesive to seal the sanitary napkins within. 3. pouch/wrapper should not be transparent. note : instructions for use of disposable pouch/wrapper mst be written in hindi on disposable pouch/wrapper. blrseky fd;s gq;s lsusvjh usifdu dks eksm dj disposable pouch/wrapper esa mkys ,oa disposable pouch/wrapper dks xksan yxh iv~vh ls cun dj lqjf{kr rjhds ls dwmsnku esa mkysaa , oxygen mask (adult) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. , oxygen mask (paediatric) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc materialwith comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. • mask connector 4m , sterile catheter, single use, for urinary drainage(foley baloon catheter), 2 way, size 14 • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for a traumatic intubation • symmetrical foley balloon • balloon capacity 30+ 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and ballon capacity should be mentioned as per is 11497 • specification for b,c,d,e,f,g should be mentioned as per is 11497 , nelaton catheter size 14 fg distal end is close and proximal end has female colour code connector • soft, kink resistant medical grade pvc tube • length:40 cm • individually packed in poly and sterile , ecg electrode •reliable trace, •high conductivity,• easy to handle , surgical blade sterile, size 23 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 , sterile hypodermic syringe with needle attached, 22g, single use 50 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction duringmovement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use orequivalent should be written on unit container. , urethral catheter90 (fg 14), made up of medical grade pvc , urethral catheter91 (fg 10), made up of medical grade pvc , vaccum suction set, 2.5 meter length, •suction handle with suctiontube •sterile,• pyrogenic free, •latex free,• single use , epidural minipack 18g, 90 mm,metal stylet for single use only, •sterile, •epidural catheter 20g, l 90 cm, •6 lateral holes closedend, •borst adapter •epidural catheter flat filter 0.2 micro meter •thread assist guide•lor (loss of resistance) plastic syringe 6 ml , vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no.22double lumen size 30 cm (longline iv.) , vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv.) , vascular catheter with metal guide no.18 double lumen size 45 cm(longline iv.) , vascular catheter with metal guide no.20 double lumen size45 cm (longline iv.) , vascular catheter with metal guide no. 22 double lumen size 45cm (longline iv.) , 3 waystop cock ,non pyrogenic & single use,should be leak proof, with smooth movements , 3 waystop cock with extension tube(vein o line) size 10cm (non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 50cm (non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 100cm(non pyrogenic & single use) , 3 waystop cock with extension tube(vein o line) size 150 cm(non pyrogenic & single use) , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) • graduated bag, • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval , nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube , elastic adhesive bandage bp1m x 10cm adhesive material should have good quality sticking property, non allergic , sterile disposable (single use teflon/ptfe i.v cannula with integrated 3 way stop cock size 26g ·should be packed in transparent single blister pack · should confirm to is 10555 standard ·(neonatal iv cannula size 26) , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for ventilator without vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for ventilator without vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for bipap with vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) adult ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear. ·should be single use for bipap with vent ·non allergic, leak proof,contour should be maintained , niv mask (noninvasive ventilation mask) paediatric ·should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads in small size. ·should be with ergonomically designed clips/straps for easy disengagement of the head gear ·should be single use with bronchoscopy and co2 &o2 port with chin support ·non allergic, leak proof, contour should be maintained , nebulization mask adult , nebulization mask paediatric , chemotherapy port &non coring needles(adult) · valved catheter need only saline flush, catheter with intermediate size port with small septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 8fr with silicon material with peel apart percutaneous introducer system. ·chemo port huber needle 20g and 22g. , chemotherapy port &non coring needles(pediatric) · valved catheter need only saline flush, catheter with intermediate size power port with large septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 6fr with silicon material with peel apart percutaneous introducer system · .chemo port huber needle 20g and 22g. , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (3/8 cir rb needle 40mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (l/2 cir rb needle 20mm length 76 cm)3/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)2/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 40mm length 76 cm)1/0 , absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (3/8 rb needle 30mm length 76 cm)2/0 , absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (1/2 cir rb needle 45 mm length 100 cm)1 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 26mm, length 76 cm)3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) ½ cir rb needle 20mm length 70 cm 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)1/2 cir rb needle 30mm length 90 cm 2/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir rb needle 30mm length75 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir tapercut needle (heavy) 35 40mm length 75 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) ½ cir rb needle40mm length 90 cm 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) (1/2 cir conventional 25mm length 90 cm)undyed 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide)(1/2 cir rb needle 20mm length 70 cm) 4/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide ) (1/2 cir rb needle 40mm length 90 cm 2/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) (1/2 cir rb needle 40mm length 90 cm) 1/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting needle 22mm length 45 cm 3/0 , absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting 16mm needle, suture length70cm 4/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (1/2 cir rb needle 20mm, length 76 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (3/8cir reverse cutting needle 26mm, length 76 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled sutureblack braided silk (3/8cir reverse cutting needle 45mm, length 76 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon)(3/8 cir micropoint round body ,6mm length 38 cm) 8/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 conventional cutting needle 16 mm length 70 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 conventional cutting needle 19mm length 60 cm.) 4/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cir slim blade cutting needle 15mm length 70 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cirr cutting needle 40 45mm length 60 70 cm.) 2/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cir r cutting needle 45mm length 70 cm.) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb13 mm needle,length 75cm) double arm 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8cir rb 16mm needle,length 90 cm) 6/0 , non absorbable surgical suture,sterilised surgical needled suture monofilament polypropylene blue(3/8cir rb double 8mm needle, length 60 cm) 7/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8cir rb 16 mm needle, length 70 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 30mm length 90 cm) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb heavy needle 40 45mm length 75 90 cm) 1 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir tapercut double needle cutting size 16 17mm length 70 90 cm) 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir tapercut double needle 17mm length 70 90 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir rb needle 25mm, length 90 cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 30mm, length 90 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 cir tapercut needle 17mm length 75 cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir tapercut needle,25 mm length 90 cm) double arm 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue usp(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 6/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir rb 13mm needle, length 90 cm double arm 6/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 16 mm length 70 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir cutting needle 25mm length 45 cm) 3/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb heavy 40mm, length 90 cm) 1/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (l/2 cir reverse cutting, 45 mm needle length 100 cm) 1 , non absorbable surgical suture, ,sterilised surgical needled suturemonofilament polypropylene blue (3/8 cir rb , 8mm double needle, suture length of 70cm) 8/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 circle tapercut 13mm double needle 70cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue(1/2 circle cc 13mm needle, suture length of 70cm) double arm 5/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 2/0 , non absorbable surgical suture, sterilised surgical needled suturemonofilament polypropylene blue (1/2 cir rb needle 25mm, suture length of 75cm) double arm 3/0 , non absorbable surgical suture, sterilised surgical needled suturebraided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided green/ blue (1/2 cir tapercut ,17 mm double needle, length 75 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided white (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided green / blue (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) 1/2 circle taper cut , 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 2/0 , non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) *with 1/2 circle taper cut , 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm , non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/whitecoated polyster braided (green / blue)with 1/2 circle tapercut double needle 25mm, suture length 90 cm 3/0 , absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures(1/2 circle oval rb needle 26mm needle, suture length of 70cm) 2/0 , absorbable surgical suturespolyglecaprone / polyglyconate, monofilament sutures (l/2 circle oval rbcontrast needle 26mm, suture length 70cm) , absorbable surgicalsuturesmonofilament sutures polyglecaprone /polyglyconate (l/2 circle cutting 16mm needle,suture length 70cm) 4/0 , absorbablesurgical suturespolyglecaprone / polyglyconate, monofilament sutures(3/8 circle cutting24 26mm needle, suture length of 70 90cm) 3/0 , absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanoneviolet (1/2 circle reverse cutting 40 50 mm length 70 90cm) 1 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 31mm needle, length 70cm) 2/0 , absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 30mm needle, length 70cm) 1/0 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoatedpolyglactin/ polyglycolic acidviolet) 1/2 circle ctroundbodied 40mm,gsneedle,suture length 90 cm/ 1 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/ polyglycolic acidviolet)1/2circle ctroundbodied 40mm,gsneedle,suture length 90 cm 1/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin / polyglycolic acid violet)1/2 circle round bodied 30mm, suture length 90 cm/ 2/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/ polyglycolic acidviolet)1/2 circle reverse cutting,os 40mm, suture length 90 cm 1 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin /polyglycolic acid violet)1/2 circle reverse cutting 36mm, os needle, suture length 90 cm/ 1/0 , absorbablesurgicalsuture (synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin /polyglycolic acid violet) 1/2 circle round bodied 20mm, suture length 70 cm 3/0 , absorbablesurgicalsuture(synthetic) antibacterial coatedsterilisedneedledsuture (braidedcoated polyglactin/polyglycolic acidviolet)3/8circle r cutting, ps 1,24mm, suture length 70 cm 3/0 , non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm10/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 16mm, length 76 cm) 5/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir cutting needle 8mm, length 35 cm) 6/0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk (3/8 cir rb needle 20mm, length 76 cm) 4/0 , non absorbable surgical suture, sterilised surgical needled suture black braided silk withneedle silk(3/8 cir rb needle 16mm, length 76 cm) 5/0 , absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 19mm length 76 cm) 4/0 , b.p. instrument(murkary) , b.p. instrument (digital) , stethoscope , weight machine(digital) , baby weight machine(digital) , glucometer freewith 500 strips , glucometerstrips , disposable bed sheets , disposable pillow cover , pulse oximeter , triple layer mask , cotton mask , n 95 mask , hand sanitizer 250ml , nebulizer machine , bleaching powder 25 kg , cotton roll (net 500gm) , folding stretcher , hospital bed (28 kg) , side locker , i.v stand , delivery table , hiv(50 test) , gloves , micro slides , tourni cwet belt , esr cup. , pregenancy card , widal 4x5 ml , vdrl strit(50 test) , disposable syring 2 ml , disposable syring 5 ml , btct capilary , hcl n/10 500ml , disposable niddle , test tube glass , n.p. cards (50 test) , disposable mask , chemistrix ah.100 strips , urine strip , glemsa’s stain (500 ml) , scissor 6” , urine contianer , centrifuge machine , sprit 5 litre , anti abd , edta k3 singal cap. , test tube stand , hemoglobinometer free with 1000 strips , hemoglobinstrips , x ray film 12x15 green base , x ray film 10x12 green base , x ray film 10x12 blue base , erba.giucose reagents , erba urea reagents , erba creatinine reagents , erba sgot reagents , erba sgot,sgpt reagents , erba alp reagents , erba bill,t reagents , erba choletrol reagents , erba triglyceride reagents , erba hdl reagents , erba protine reagents , new pehal kit , jsb (i) 500 ml , jsb (ii) 500 ml , devloper 13.5 lt. , fixer 13.5 lt. , involap 10x12(x ray film) , involap 12x15(x ray film) , prinking niddle , liquid parafine 500ml , sidarwood 500ml , disteld water cane 5 liter , micro slides 50 pkt , ganesh pump 2 liter plastic body , ganesh pump 2 liter steel body , streup pump for ddt spray , knopsack pump for bti spray , methyal alcohal 500ml , oil errerson lance100x , eye piece lance 5x , biker (borosil) 100ml , staining rack with glass rod steel body , fogging machine auto start , zn oil 1liter , oxgen cilender b type/ d type , ecg machine 3 channel , hiv kit disposable ( face mask , cap, gloves, bedsheet,cord clamp, aprin,bio bag,goggles) , o.t. kit disposable (gown, cap, mask, shoe coover, gloves, bedsheet,holesheet, trolly cover) , suger strips , hemo cue hb 301...

Medical Health And Family Welfare - Rajasthan

31989202 surgical item purchase surgical item purchase for district hospital hanumangarh , surgicals items , a k traction set , abdominal drainage kit 20 , abdominal drainage kit 24 , abdominal drainage kit 28 , abdominal drainage kit 30 , abdominal drainage kit 32 , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , absorbable gelatin gel foam surgical , acepto syring , adhesive plaster ½” ( transpore / micropore / durapore / stikopore ) , adhesive plaster 1” ( transpore / micropore / durapore / stikopore ) , adhesive plaster 2” ( transpore / micropore / durapore / stikopore ) , adhesive plaster 3” ( transpore / micropore / durapore / stikopore ) , ammonia liquid 5 ltr. pack , antiseptic tulle dressing 10cm*10cm , arm pouch sling , autoclave verticle large size 2 drum , b k traction set , b.b silk 1.0 r / c , b.p instrument clock model , b.p instrument dial regular , b.p instrument digital , b.p instrument led standing , b.p instrument led table , baby care kit , baby dress kit , baby face mask ( silicon 0 and 1 no ) , bacillocid lotion 500 ml packing ( roman well ) , bactirial filtermoisture 33.5mgh2o2 for adult , bain circuit disposable , bains circuit ( non disposable ) , bandaze 10cm*5mt , bandaze 15cm*5mt , bandaze 7½cm*5mt , barber thread no. 30 , barber thread no. 40 , barber thread no. 60 , bb silk 1 0 round body 3 / 8 circle 45 mm 76 cm ethicon / suture india / dolphin / hll , bb silk 2 0 reverse cutting3 / 8 circle 45 mm 76 cm ethicon / suture india / dolphin / hll , bb silk 2 0 round body 3 / 8 circle 45 mm 76 cm ethicon / suture india / dolphin / hll , bb silk 3 0 cc3 / 8 circle 16 mm 76 cm ethicon / suture india / dolphin / hll round body , bb silk 3 0 reverse cutting3 / 8 circle 26 mm 76 cm ethicon / suture india / dolphin / hll , bb silk 3 0 round body ½ circle 20 mm 76 cm , bb silk 3 0 round body ½ circle 25 mm 90 cm , beakar glass 250 ml , beakar glass 500 ml , bi pep mask , bi valve , blood bag 100ml cpda , blood bag 350ml , blood bag 350ml cpda ( single ) , blood bag 350ml double , blood bag 350ml triple ( sagm ) , blood bag 350ml triple ( without sagm ) , blood bag tube sealer battery back up , blood glucose strips , blood lancet , blood transfusion set as per is 9824 iso1135 4 standard ( concept / romsons / nulife ) , bp instrument d clock type , breast pump with reservoir , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cannula fixer , catgut 1 no. round body ethicon / suture india / dolphin / hll , catgut 1 0 round body ½ circle 40 mm 76 cm ethicon / suture india / dolphin / hll , catgut 2 0 round body ½ circle 30 mm 76 cm ethicon / suture india / dolphin / hll , catgut 3 0 nrb ½ circle 20 mm 76 cm ethicon / suture india / dolphin / hll , cdr morophin / allmedicus / caressers , centerline 3 port , cervical collar , cetrimide solution 20% , cetrimide solution light , chest belt all size , clinical thermometer ( oval shape ) , close wound drainage kit 10 ( romsons ) multiperforated catheters vided with radio opaque line and satin smooth perforation / eye for trauma free performance , close wound drainage kit 12 ( romsons ) multiperforated catheters vided with radio opaque line and satin smooth perforation / eye for trauma free performance , close wound drainage kit 14 ( romsons ) multiperforated catheters vided with radio opaque line and satin smooth perforation / eye for trauma free performance , close wound drainage kit 16 ( romsons ) multiperforated catheters vided with radio opaque line and satin smooth perforation / eye for trauma free performance , close wound drainage kit 18 ( romsons ) multiperforated catheters vided with radio opaque line and satin smooth perforation / eye for trauma free performance , colostomy kit , conical flask glass 500 ml , corrugated rubber drain sheet , cotton ball / plastic ball smily , cotton roll absorbent 100 gm , cotton roll absorbent 200 gm , cotton roll absorbent 50 gm , cotton roll absorbent 500 gm , crepe bandage 2” , crepe bandage 4” , crepe bandage 6” , dark goggles , diapers large size , diapers medium size , diapers small size , dispoable cresent 2.1 mm 45 degree ( sharpedge ) , dispoable enlarger 5.2 mm 45 degree ( sharpedge ) , disposable baby nappy , disposable face mask ( with soft ear loop and melt brown filter ) , disposable gloves 6.5 ( nulife / romsons / suture india ) isi mark , disposable gloves 7.0 ( nulife / romsons / suture india ) isi mark , disposable gloves 7.5 ( nulife / romsons / suture india ) isi mark , disposable gloves 8.0 ( nulife / romsons / suture india ) isi mark , disposable gown , disposable keratome ( sharpedge ) , disposable mucus sucker , disposable plain endotracheal tube no.2 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.2.5 ( with cuff ) , disposable plain endotracheal tube no.3 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.3.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.3.5f29 standerd , disposable plain endotracheal tube no.3f29 standerd , disposable plain endotracheal tube no.4 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.4.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.4.5f29 standerd , disposable plain endotracheal tube no.4f29 standerd , disposable plain endotracheal tube no.5f29 standerd , disposable plain endotracheal tube no.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.5.5 , disposable plain endotracheal tube no.5.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.6 , disposable plain endotracheal tube no.6 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.6.5 ( with cuff ) f29 standerd ) , disposable plain endotracheal tube no.6.5f29 standerd , disposable plain endotracheal tube no.7.0 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.7.0f29 standerd , disposable plain endotracheal tube no.7.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.7.5f29 standerd , disposable plain endotracheal tube no.8.0 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.8.0f29 standerd , disposable plain endotracheal tube no.8.5 ( with cuff ) f29 standerd , disposable plain endotracheal tube no.8.5f29 standerd , disposable safe delivery kit , disposable suction irrigation tube set , disposable syringe 3 ml. , disposable tag for newborn , disposable tongue depressors , disposable vaginal specula of various size , disposalble syringe 1 ml , disposble cap ( doctor ) , disposble cap ( nurse ) , disposble safe surgical kit for aids , disposble syringe 10 ml , disposble syringe 2 ml , disposble syringe 20 ml , disposble syringe 5 ml , disposble syringe 50 ml , ecg gelly , ecg machine ( 12 ) , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( 108t / 408 ) 50*20mm , ecg paper roll ( 6108t ) 50*20mm , ecg paper roll ( medicat ) 20*105 mm , ecg roll 9108 z fold paper , ecg / tmt electrodes ( bpl / rms ) , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stalate , ethilon 1 0 suture , ett fixer , examaniation gloves large , examaniation gloves mediun , examaniation gloves small , fast absorbing polyglactin 910 1 0 / 2 0, suture , fogger machine , foley`scatheter no.10 ( romsons / bardia ) , foley`scatheter no.12 ( romsans / bardia ) , foley`scatheter no.14 ( romsans / bardia ) , foley`scatheter no.16 ( romsans / bardia ) , foley`scatheter no.18 ( romsans / bardia ) , foley`scatheter no.20 ( romsans / bardia ) , foley`scatheter no.20 ( romsans / bardia ) , foley`scatheter no.24 ( romsans / bardia ) , foley`scatheter no.6 ( romsans / bardia ) , foley`scatheter no.8 ( romsans / bardia ) , formalin liquid 5 ltr. , formaline tablets , g.v. paint liquid , gauze 120*9 mtr , gauze 60*18 mtr , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , gluteraldehyde solution 5 litre , graduated jar glass 1 ltr , guedel airways 2 no , guedel airways 4 no , hand held pulse oximeter , hand sanitizer 100 ml , hb strip haemocal , hb strip mission , hcg card ( pregnancy card ) , high flow oxygen mask soft transparent and odour free , hme filter , i.v. canula 2 way wings & injection port 18 no. fep teflon canula has extremely smooth inner and outer surface , i.v. canula 2 way wings & injection port 20 no. fep teflon canula has extremely smooth inner and outer surface , i.v. canula 2 way wings & injection port 22 no. fep teflon canula has extremely smooth inner and outer surface , i.v. canula 2 way wings & injection port 24 no. fep teflon canula has extremely smooth inner and outer surface , i.v. canula 3 way wings & injection port 18 no. , i.v. canula 3 way wings & injection port 20 no. , i.v. canula 3 way wings & injection port 22 no. , i.v. canula 3 way wings & injection port 24 no. , i.v. drip set non vented ( romson / nulife ) , i.v. infusion set with needle having built in air vent as per is 12655 , infant feeding tube no. 10 , infant feeding tube no. 12 , infant feeding tube no. 14 , infant feeding tube no. 16 , infant feeding tube no. 18 , infant feeding tube no. 5 , infant feeding tube no. 6 , infant feeding tube no. 8 , insulin syringe , intercoaster drain tube size 16 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 18 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 20 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 22 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 24 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 26 ( thoracic trocar ) romsons / polymed , intercoaster drain tube size 28 ( thoracic trocar ) romsons / polymed , iol ( different powers in diopters ) anteriorchamber ( appa / indo american ) , iol ( different powers in diopters ) posterior chamber ( appa / indo american ) , k 90 catheter , k 91 catheter , l s belt all size , l.p. needle ( imported ) 18 sharp berel design for low puncture , l.p. needle ( imported ) 20sharp berel design for low puncture , l.p. needle ( imported ) 22sharp berel design for low puncture , l.p. needle ( imported ) 23sharp berel design for low puncture , l.p. needle ( imported ) 25sharp berel design for low puncture , l.p. needle ( imported ) 27sharp berel design for low puncture , ligaclip no. 300 , ligaclip no. 400 , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , macantoes in meter , malicot catheter no. 22, 24, 26, 28, 30 , malicot condom catheter 10, 24, 28, 30 no , medicated dressing e.g. band aid , microdrip set ( romsons ) , micropore surgical with cutter adhesive 10 , micropore surgical with cutter adhesive 2.5 , micropore surgical with cutter adhesive 7.5 , n 95 face mask 6 layer , nasal prone ( neonatal ) , nasal prong adult , nasal prong paed. , nasogasrtric tube 10 no , nasogastrictube 8 no , nasogastric tube 5 no , nasogastric tube 6 no , nebuliser mask adult , nebuliser mask paedia , nebulizer chamber with mask & tube with flow adjustable , needle disposable no. 18 to 24 , o.t. dress kit , ortho cotton 10cm*5m , oxy lock adult ( venturi mask ) , paediatric oxygen face mask with soft and strap for better fit and comfort , paediatric oxygen face mask with variable venture system , paediatric urine collection bag having self adhesive facility , paraffin liquid 400 gm , pedia set ( romsons ) measured volume 110 ml , pediatric blood bags ( 100ml ) , plastic bag black capacity 25 ltr. ( biowaste ) ( 50 to 55 micron ) , plastic bag blue capacity 25 ltr. ( biowaste ) ( 50 to 55 micron ) , plastic bag red capacity 25 ltr. ( biowaste ) ( 50 to 55 micron ) , plastic bag yellow capacity 25 ltr. ( biowaste ) ( 50 to 55 micron ) , plastic sheet 3*4 , plastic sheet 6*4 , plastic stool small , plastic swab box 500 gm , plastic tray 30 cm*15cm , platelate agitator cum incubator , pmo line , pop 4” , pop 6” , prolene mesh 3*6 , prolene mesh 6*6 , prolene no. 1 round body ½ circle 30mm70 cm , prolene no. 1 0 round body ½ circle 30mm70 cm , prolene no. 2 0 round body ½ circle 30mm 90 cm , red rubber catheter 1, 12, 14, 16, 18, g , ryle`s tube 14mm to 20 mm , ryle`s tube 6mm to 12 mm , safety cup goggle , sanitarypad ( whisper / carefree / careleak / stay fit ) , scalp vein set 18 to 24 no. , section cathetor 10 with ultra soft catheter with specially added plasticizer for gental feel to tissue , section cathetor 12 with ultra soft catheter with specially added plasticizer for gental feel to tissue , section cathetor 14 with ultra soft catheter with specially added plasticizer for gental feel to tissue , section cathetor 16 with ultra soft catheter with specially added plasticizer for gental feel to tissue , sharp bin box blue , sharp bin box white , shoe cover , skin grafting blade , skin traction kit , soap dettol & savlon 125 gm , sodaline granules 10 kg packing , sodium hypochloride solution 5 ltr , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , steel wire for wiring 18 to 30 no , sterlium liquid 500 ml pack , sterlizing solution for instrument 500 ml pack , stokinet 8cm , stretcher trolly , suction canula , suction catheter 18, 20, 22 no. , suction catheter 6 no , suction catheter 8 nosurgical , supracath paed. medium adult , surgical blade 22 no , surgical blade no.10 , surgical blade no.12 , surgical blade no.15 , surgical blade no.20 , surgical blade no.23 , surgical hand disinfection 500ml pack , suture needle cutting no. 3 to 11 , suture needle round body n. 8 to 10 , thermometer digital , thermometer mercury , tmt electrode , trachea t pipe , tracheostomy tube 7.5 no cuffed , tracheostomy tube 7.5 no uncuffed , tryptan blue ofphail solution ( visiblue ) , tuni cator plastic 4 , tuni cator plastic 6 , ultrasound jelly , umbelical cord clamp , umbilical catheter 5, 6, 8 , underwater seal drainage system , urine collection bag 2 ltr. , vacuum suction set with built in on off switch , ventilator sensor , vicryl suture 1 ( round body ) , vicryl suture 1 0 ( round body ) , vicryl suture 2 0 ( round body ) , vicryl suture 3 0 ( round body ) , vicryl suture 4 0 ( round body ) , vicryl suture 5 0 ( round body ) , vicryl suture 6 0 ( round body ) , wash bottle 500 ml , welch allym bulb, opthalmoscope , wheel chair folding durable ms frame chrome plated, 8inch castors with pu tubless tyre, rust proof, load capacity 100kgs, ...

Medical And Health Services - Rajasthan

31987106 supply of medicine and lab equipment in cmho, dungarpur anaesthetics general anaesthetics and oxygen halothane 1.00 250 ml bottle 0.00 inr zero only 2 isoflurane 1.00 100 ml 0.00 inr zero only price schedule (this boq template must not be modified/replaced by the bidder and the same should be uploaded after filling the relevent columns, else the bidder is liable to be rejected for this tender. bidders are allowed to enter the bidder name and values only ) item rate boq tender inviting authority: dk;k zy; e q[; fpfdrlk ,o a loklf; vf/kdkjh m awxji qj name of work: vk sk/kh ,o a y sc midj.k vki wfr z djoku s contract no: validate print help 2 isoflurane 1.00 100 ml 0.00 3 ketamine injection 50 mg/ml 1.00 10 ml vial 0.00 inr zero only 4 propofol injection 10 mg/ml 1.00 20 ml 0.00 inr zero only 5 thiopentone injection 0.5 g 1.00 vial 0.00 inr zero only 6 sevoflurane 1.00 250 ml 0.00 inr zero only 7 liquid medical oxygen (lmo) 1.00 kl 0.00 inr zero only 8 local anaesthetics lignocaine ointment 5% 1.00 10 gm tube in a unit carton 0.00 inr zero only 9 lignocaine gel ip 2% 1.00 30 gm tube in mono carton 0.00 inr zero only 10 lignocaine injection 2% 1.00 30 ml vial 0.00 inr zero only 11 lignocaine and adrenaline injection 20mg + 0.01mg 1.00 30 ml vial 0.00 inr zero only 12 lignocaine and dextrose injection 50mg + 75mg per ml 1.00 2 ml amp 0.00 inr zero only 13 bupivacaine hydrochloride in dextrose injection 5mg + 80 mg per ml 1.00 4 ml amp 0.00 inr zero only 14 bupivacaine injection 0.50% 1.00 20 ml vial 0.00 inr zero only 15 pre operative medication atropine sulphate injection 0.6 mg/ml 1.00 1 ml amp (25 ampoule s) 0.00 inr zero only 16 midazolam injection ip 1 mg/ml 1.00 5 ml vial 0.00 inr zero only 17 analgesic, antipyretic & antiinflammatory drugs opioid analgesics morphine sulphate injection ip 10 mg/ml 1.00 1 ml amp 0.00 inr zero only 18 tramadol capsule 50 mg 1.00 10 cap 0.00 inr zero only 19 tramadol injection 50 mg/ml 1.00 2 ml amp 0.00 inr zero only 20 pentazocine injection 30 mg/ml 1.00 1 ml amp 0.00 inr zero only 21 fentanyl citrate injection 50 mcg/ml 1.00 2 ml amp 0.00 inr zero only 22 fentanyl citrate injection 50 mcg/ml 1.00 10 ml vial 0.00 inr zero only 23 naproxen tablet ip 500 mg 1.00 10 x 10 tab blister 0.00 inr zero only 24 naproxen tablet ip 250 mg 1.00 10 x 10 tab blister 0.00 inr zero only 25 inj. butorphanol tartrate usp 1mg/ml 1ml size 1.00 1 ml inr zero only amp 0.00 inr zero only 26 non steroidal anti inflammatory drugs & antipyretics aspirin tablet ip (gastro resistant) 150 mg 1.00 14 x 10 tab 0.00 inr zero only 27 aceclofenac and paracetamol tablet 100 mg + 325 mg 1.00 10 tab 0.00 inr zero only 28 diclofenac gel: diclofenac diethylamine , methyl salicylate , linseed oil and menthol 1.16%+10%+3%+ 5% 1.00 20 gm 0.00 inr zero only 29 diclofenac sodium and paracetamol tablet 50 + 325 mg 1.00 10 tab 0.00 inr zero only 30 diclofenac sodium injection for im and iv 25 mg/ml 1.00 3 ml amp 0.00 inr zero only 31 diclofenac sodium tablet 50 mg 1.00 10 tab 0.00 inr zero only 32 diclofenac tablet (sr) 100 mg 1.00 10 tab 0.00 inr zero only 33 etoricoxib tablet 90 mg 1.00 10 x 10 tab 0.00 inr zero only 34 etoricoxib tablet ip 120 mg 1.00 10 tab 0.00 inr zero only 35 ibuprofen and paracetamol tablet 400 mg + 325 mg 1.00 10 tab 0.00 inr zero only 36 ibuprofen tablet 200 mg 1.00 10 tab 0.00 inr zero only 37 ibuprofen tablet 400 mg 1.00 10 tab 0.00 inr zero only 38 ibuprofen oral suspension 100 mg/5ml 1.00 60 ml 0.00 inr zero only 39 indomethacin capsule 25 mg 1.00 10 tab 0.00 inr zero only 40 mefenamic acid tablet 500 mg 1.00 10 tab 0.00 inr zero only 41 paracetamol drops 150 mg/ml 1.00 15 ml bottle 0.00 inr zero only 42 paracetamol syrup ip 125 mg/5ml 1.00 60 ml bottle with measuri ng cap 0.00 inr zero only 43 paracetamol tablet 500 mg 1.00 10 tab 0.00 inr zero only 44 paracetamol injection 150 mg/ml 1.00 2 ml amp 0.00 inr zero only 45 inj diclofenac sodium aqueous 75mg/ml 1ml size, iv & im use 1.00 1 ml amp 0.00 inr zero only 46 paracetamol infusion ip 1% w/v 100ml size 1.00 100 ml bottle 0.00 inr zero only 47 tab. ketorolac 10 mg 1.00 10 x10 0.00 inr zero only 48 muscle relaxants chlorzoxazone, diclofenac sodium & paracetamol tablet 250mg+50mg+325 mg 1.00 10 tab 0.00 inr zero only 49 tab baclofen ip 10 mg (each uncoated tablet contains baclofen ip 10 mg ) 1.00 10x10 0.00 inr zero only 50 tab tizanidine hydrochloride ip 2 mg (each uncoated tablet contains tizanidine hydrochloride ip 2 mg) 1.00 10x10 0.00 inr zero only 51 drugs for gout & rheumatoid 1.00 10 tab 0.00 51 drugs for gout & rheumatoid inr zero only arthritis allopurinol tablet 100 mg 1.00 10 tab 0.00 52 hydroxychloroquine sulphate tablet 200 mg 1.00 10 tab 0.00 inr zero only 53 leflunomide phosphate tablet 10 mg 1.00 10 tab 0.00 inr zero only 54 leflunomide phosphate tablet 20 mg 1.00 10 tab 0.00 inr zero only 55 sulfasalazine delayed release tablet 500 mg 1.00 10 tab 0.00 inr zero only 56 antiallergics & drugs used in anaphylaxis corticosteroids betamethasone tablet 0.5 mg 1.00 10 tab 0.00 inr zero only 57 betamethasone sodium phosphate injection 4 mg/ml 1.00 1 ml vial 0.00 inr zero only 58 dexamethasone injection 8 mg/2ml 1.00 2 ml vial 0.00 inr zero only 59 dexamethasone tablet 0.5 mg 1.00 10 x 10 tab 0.00 inr zero only 60 hydrocortisone sodium succinate injection 100 mg base / vial 1.00 vial 0.00 inr zero only 61 methyl prednisolone sodium succinate for injection 500 mg 1.00 vial 0.00 inr zero only 62 prednisolone tablet 5 mg 1.00 10 tab 0.00 inr zero only 63 prednisolone tablet 10 mg 1.00 10 tab 0.00 inr zero only 64 prednisolone tablet 20 mg 1.00 10 x 10 tab 0.00 inr zero only 65 tab dexamethasone ip 4 mg (each uncoated tablet contains dexamethasone ip 4 mg) 1.00 10 x 10 tab 0.00 inr zero only 66 antihistaminics & drugs used in anaphylaxis adrenaline injection 1 mg/ml 1.00 1 ml amp 0.00 inr zero only 67 chlorpheniramine maleate tablet 4 mg 1.00 10 tab 0.00 inr zero only 68 hydroxyzine tablet 25 mg 1.00 10 x 10tab 0.00 inr zero only 69 pheniramine injection 22.75 mg/ml 1.00 2 ml amp 0.00 inr zero only 70 promethazine syrup ip 5 mg/ 5ml 1.00 60 ml bottle with measuri ng cap 0.00 inr zero only 71 promethazine injection 25 mg/ml 1.00 2 ml amp 0.00 inr zero only 72 promethazine tablet 25 mg 1.00 10 tab 0.00 inr zero only 73 anticold syrup: phenylephrine hcl , chlorpheniramine maleate, and paracetamol 2.5 mg+ 1 mg+125 mg/5ml 1.00 30 ml bottle 0.00 inr zero only 74 cetirizine, phenylephrine& paracetamol tablet 5 mg + 10 mg + 325 mg 1.00 10 tab 0.00 inr zero only 75 cetirizine syrup 5 mg/ml 1.00 30 ml 0.00 75 cetirizine syrup 5 mg/ml 1.00 30 ml inr zero only 0.00 76 levoceitrizine tablet 5mg 1.00 10 x 10 tablet 0.00 inr zero only 77 montelukast 10 mg + levocetrizine 5mg tablet 1.00 10x10 tablet strip / blister / alu alu pack 0.00 inr zero only 78 antidotes and other substances used in poisoning naloxone injection ip 0.4 mg/ml 1.00 1 ml amp (10 ampoule s) 0.00 inr zero only 79 pralidoxime chloride injection 25 mg/ml 1.00 20 ml 0.00 inr zero only 80 n acetylcystine injection 200 mg/ml 1.00 2 ml amp 0.00 inr zero only 81 anti epileptic drugs carbamazepine tablet 200 mg 1.00 10 tab 0.00 inr zero only 82 carbamazepine tablet ip 100 mg 1.00 10 x 10 tab strip/blis ter 0.00 inr zero only 83 carbamazepine oral suspension usp 100 mg/5 ml 1.00 100 ml bottle with measuri ng cap 0.00 inr zero only 84 phenobarbitone tablet 30 mg 1.00 10 tab 0.00 inr zero only 85 phenobarbitone injection ip 200 mg/ml 1.00 1 ml 0.00 inr zero only 86 phenytoin injection 50 mg/ml 1.00 2 ml amp 0.00 inr zero only 87 phenytoin oral suspension 25 mg/ml 1.00 100 ml 0.00 inr zero only 88 phenytoin tablet 100 mg 1.00 10 tab 0.00 inr zero only 89 pregabalin capsule ip 75 mg 1.00 10 cap 0.00 inr zero only 90 sodium valproate ip injection 100 mg/ml 1.00 5 ml vial 0.00 inr zero only 91 sodium valproate tablet 200 mg 1.00 10 tab 0.00 inr zero only 92 sodium valproate oral solution ip 200 mg/ 5 ml 1.00 100 ml bottle with measuri ng cap 0.00 inr zero only 93 sodium valproate(gastro resistant) ip tablet 500 mg 1.00 10 x 10 tab strip 0.00 inr zero only 94 clobazam tablet/capsule 5 mg 1.00 10 x 10 tab/cap blister 0.00 inr zero only 95 clobazam tablet/capsule 10 mg 1.00 10 x 10 tab/cap blister 0.00 inr zero only 96 levetiracetam tablet 500 mg 1.00 10 x 10 0.00 96 levetiracetam tablet 500 mg 1.00 10 x 10 inr zero only tab blister 0.00 97 levetiracetam oral solution suspension 100 mg/ml 1.00 100 ml bottle in unit carton 0.00 inr zero only 98 levetiracetam injection 500 mg/5ml 1.00 5 ml vial/am p 0.00 inr zero only 99 gabapentine tablet/capsule 100 mg 1.00 10 x 10 tab/cap blister/s trip 0.00 inr zero only 100 gabapentine tablet/capsule 300 mg 1.00 10 x 10 tab/cap sule blister/s trip 0.00 inr zero only 101 tab lamotrigine ip 50 mg (each sustained releasetablet contains lamotrigine ip 50 mg) 1.00 10x10 0.00 inr zero only 102 tab divalproex extended release ip 250 mg (each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg) 1.00 10x10 0.00 inr zero only 103 tab oxcarbazepine ip 150 mg (each film coated tablet contains oxcarbazepine ip 150 mg) 1.00 10x10 0.00 inr zero only 104 tab lacosamide 100 mg (each film coated tablet contains lacosamide 100 mg) 1.00 10x10 0.00 inr zero only 105 tab topiramate ip 25 mg (each film coated tablet contains topiramate ip 25 mg ) 1.00 10x10 0.00 inr zero only 106 anti infective drugs antibacterials aminoglycosides amikacin injection 100 mg 1.00 2 ml vial 0.00 inr zero only 107 amikacin injection 250 mg 1.00 vial 0.00 inr zero only 108 amikacin injection 500 mg 1.00 2 ml vial 0.00 inr zero only 109 gentamycin injection 80 mg/2ml 1.00 2 ml amp 0.00 inr zero only 110 betalactam penicillins amoxycillin capsule 250 mg 1.00 10 cap 0.00 inr zero only 111 amoxycillin capsule 500 mg 1.00 10 cap 0.00 inr zero only 112 amoxycillin trihydrate dispersible tablet 125 mg 1.00 10 tab 0.00 inr zero only 113 amoxycillin oral suspension (dry syrup) 125 1.00 30 ml 0.00 113 amoxycillin oral suspension (dry syrup) 125 inr zero only mg/5ml 1.00 30 ml bottle 0.00 114 amoxycillin and cloxacillin capsule 250 mg + 250 mg 1.00 10 x 10 cap strip 0.00 inr zero only 115 amoxycillin and potassium clavulanate tabs 500 mg + 125 mg 1.00 10 tab 0.00 inr zero only 116 amoxicillin and clavulanic acid injection 600 mg 1.00 vial 0.00 inr zero only 117 amoxicillin and potassium clavulanate injection 1.2 gm 1.00 vial 0.00 inr zero only 118 amoxycillin & clavulanic acid syrup 200 mg + 28.5 mg / 5 ml 1.00 30 ml 0.00 inr zero only 119 ampicillin capsule 500 mg 1.00 10 cap 0.00 inr zero only 120 ampicillin injection ip 500 mg 1.00 vial 0.00 inr zero only 121 benzathine benzylpenicillin injection ip12 lac units 1.00 vial 0.00 inr zero only 122 benzathine benzylpenicillin injection 6 lac units 1.00 vial 0.00 inr zero only 123 cloxacillin sodium injection 500 mg 1.00 vial 0.00 inr zero only 124 piperacillin and tazobactum for injection 4 gm + 500 mg 1.00 vial 0.00 inr zero only 125 tab. amoxycillin 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 1.00 10x10 0.00 inr zero only 126 inj piperacillin 2 gm + tazobactom 250mg usp 1.00 vial 0.00 inr zero only 127 cephalosporins cefepime injection 500 mg 1.00 vial 0.00 inr zero only 128 cefixime tablet 100 mg 1.00 10 x 10tab 0.00 inr zero only 129 cefixime tablet 200 mg 1.00 10 tab 0.00 inr zero only 130 cefixime oral susp (drops) 25 mg/ml 1.00 10 ml bottle 0.00 inr zero only 131 cefoperazone and sulbactum for injection 1 g + 0.5 g 1.00 vial 0.00 inr zero only 132 cefotaxime injection 1 g 1.00 vial 0.00 inr zero only 133 cefotaxime injection 250 mg 1.00 vial 0.00 inr zero only 134 cefpodoxime dispersible tablet 50 mg 1.00 10 tab 0.00 inr zero only 135 ceftazidime injection 1 g 1.00 vial 0.00 inr zero only 136 ceftazidime injection 250 mg 1.00 vial 0.00 inr zero only 137 ceftazidime injection 500 mg 1.00 vial 0.00 inr zero only 138 ceftriaxone injection ip 1 g/vial 1.00 vial 0.00 inr zero only 139 ceftriaxone injection 250 mg 1.00 vial 0.00 inr zero only 140 ceftriaxone injection ip 500 mg/vial 1.00 vial 0.00 inr zero only 141 cefuroxime tablet 250 mg 1.00 10 tab 0.00 inr zero only 142 cephalexin capsule 250 mg 1.00 10 x 10 cap blister 0.00 inr zero only 143 cephalexin capsule ip 500 mg 1.00 10 x 10 cap blister 0.00 inr zero only 144 cephalexin oral suspension ( cephalexin dry 1.00 30 ml 0.00 144 cephalexin oral suspension ( cephalexin dry inr zero only syrup) 125 mg/ 5ml 1.00 30 ml bottle 0.00 inr zero only 145 cephalexin tablet (dt) 125 mg 1.00 10 tab 0.00 inr zero only 146 inj. ceftriaxone 1 gm + tazobactum 125 mg 1.00 vial 0.00 inr zero only 147 tab.cefadroxil 250 mg 1.00 10x10 0.00 inr zero only 148 tab.cefadroxil 500 mg 1.00 10x10 0.00 inr zero only 149 macrolides azithromycin tablet (dt) 100 mg 1.00 3 tab 0.00 inr zero only 150 azithromycin tablet ip 250 mg 1.00 3 tab 0.00 inr zero only 151 azithromycin tablet 500 mg 1.00 3 tab 0.00 inr zero only 152 quinolones ciprofloxacin injection 200 mg/ 100 ml 1.00 100 ml bottle 0.00 inr zero only 153 ciprofloxacin tablet 250 mg 1.00 10 tab 0.00 inr zero only 154 ciprofloxacin tablet 500 mg 1.00 10 tab 0.00 inr zero only 155 levofloxacin tablet 250 mg 1.00 10 tab 0.00 inr zero only 156 norfloxacin tablet 400 mg 1.00 10 tab 0.00 inr zero only 157 ofloxacin tablet 200 mg 1.00 10 tab 0.00 inr zero only 158 ofloxacin suspension 50 mg/5 ml 1.00 30 ml bottle 0.00 inr zero only 159 ofloxacin injection 200mg / 100 ml 1.00 100 ml bottle 0.00 inr zero only 160 ofloxacin and ornidazole tablet 200 mg + 500 mg 1.00 10 tab 0.00 inr zero only 161 ofloxacin oral suspension ip (each 5ml contains ofloxacin ip 100 mg) 30 ml size 1.00 30 ml bottle 0.00 inr zero only 162 tab. levofloxacin ip 500 mg (each film coated tablet contains levofloxacin hemihydrate ip 500 mg) 1.00 10x10 0.00 inr zero only 163 other anti bacterials aztreonam injection 500 mg 1.00 vial 0.00 inr zero only 164 clindamycin capsule 150 mg 1.00 10 cap 0.00 inr zero only 165 clindamycin capsule 300 mg 1.00 10 cap 0.00 inr zero only 166 co trimoxazole oral suspension 40 mg + 200 mg per 5ml 1.00 50 ml bottle with measuri ng cap 0.00 inr zero only 167 co trimoxazole tablet 40 mg + 200 mg 1.00 10 tab 0.00 inr zero only 168 co trimoxazole tablet 160 mg + 800 mg 1.00 10 x 10 tab 0.00 inr zero only 169 doxycycline capsule 100 mg 1.00 10 tab 0.00 inr zero only 170 linezolid tablet ip 600 mg 1.00 10 x 10 tab 0.00 inr zero only 171 linezolid injection 200 mg/100 ml 1.00 100 ml 0.00 inr zero only 172 meropenem injection 500 mg 1.00 vial 0.00 inr zero only 173 meropenem injection 1 g 1.00 vial 0.00 inr zero only 174 nitrofurantoin tablet 100 mg 1.00 10 tab 0.00 inr zero only 175 vancomycin injection 500 mg 1.00 vial 0.00 inr zero only 176 vancomycin for intravenous infusion ip 1 gm 1.00 vial 0.00 inr zero only 177 aztreonam 1gm injection 1.00 vial 0.00 177 aztreonam 1gm injection 1.00 vial inr zero only 0.00 inr zero only 178 framycetin sulphate cream 1% 1.00 30 gm pack 0.00 inr zero only 179 framycetin sulphate cream 1% 1.00 100 gm pack 0.00 inr zero only 180 tab. faropenem sodium 200 mg (each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg) 1.00 10x10 0.00 inr zero only 181 inj clindamycin phosphate ip 300 mg 1.00 vial 0.00 inr zero only 182 inj imipenem + cilastatin 500mg/500mg ip powder for solution 1.00 vial 0.00 inr zero only 183 inj. polymixin sulphate b usp 5 lac i.u. 1.00 vial 0.00 inr zero only 184 inj meropenem ip 250 mg 1.00 vial 0.00 inr zero only 185 inj colistimethate ip 1m iu powder for solution 1.00 vial 0.00 inr zero only 186 anti amoebic metronidazole injection 500 mg/ 100 ml 1.00 100 ml bottle 0.00 inr zero only 187 metronidazole benzoate oral suspension 100 mg/ 5 ml 1.00 60 ml bottle 0.00 inr zero only 188 metronidazole tablet 200 mg 1.00 10 tab 0.00 inr zero only 189 metronidazole tablet 400 mg 1.00 10 tab 0.00 inr zero only 190 tinidazole tablet ip 300 mg (film coated) 1.00 10 x 10 tab blister 0.00 inr zero only 191 tinidazole tablet ip 500 mg (film coated) 1.00 10 x 10 tab blister 0.00 inr zero only 192 anthelmintics albendazole oral suspension 400 mg/ 10 ml 1.00 10 ml bottle 0.00 inr zero only 193 albendazole tablet ip 400 mg 1.00 10 x 10 tab 0.00 inr zero only 194 diethylcarbamazine tablets ip 100 mg 1.00 10 x10 tab blister 0.00 inr zero only 195 anti fungals clotrimazole cream ip 2% w/w 1.00 15 gm tube 0.00 inr zero only 196 clotrimazole vaginal tablet 500 mg 1.00 single tab 0.00 inr zero only 197 fluconazole tablet 150 mg 1.00 10 tab 0.00 inr zero only 198 griseofulvin tablets 125 mg 1.00 10 x 10 tab strip 0.00 inr zero only 199 itraconazole capsule 100 mg 1.00 4 cap 0.00 inr zero only 200 amphotericin b injection 50 mg 1.00 vial 0.00 inr zero only 201 inj. liposomol amphotericine b 50 mg 1.00 vial 0.00 inr zero only 202 inj. voriconazole 200mg/vial 1.00 vial 0.00 inr zero only 203 tab. terbinafine hydrochloride 250 mg 1.00 10x10 0.00 inr zero only 204 anti malarials artisunate injection 60 mg (combo pack with 1 ml ampoule of 5% sodium bicarbonate injection and 5 ml ampoule of 0.9% sodium chloride injection) 1.00 vial 0.00 inr zero only 205 chloroquine phosphate injection 40 mg/ml 1.00 5 ml amp 0.00 inr zero only 206 chloroquine phosphate tablet 250mg (=155 mg of chloroquine base) 1.00 10 tab 0.00 inr zero only 207 chloroquine phosphate suspension 50 mg/ 5ml 1.00 60 ml bottle with measuri ng cap 0.00 inr zero only 208 mefloquine tablet 250 mg 1.00 6 tab 0.00 inr zero only 209 primaquine tablet 2.5 mg 1.00 10 tab 0.00 inr zero only 210 primaquine tablet 7.5 mg 1.00 10 tab 0.00 inr zero only 211 quinine dihydrochloride injection 300 mg/ml 1.00 2 ml amp 0.00 inr zero only 212 quinine sulphate tablet 300 mg 1.00 10 tab 0.00 inr zero only 213 act kit containing 3 tablet of artesunate (each tablet of artesunate 25mg strength) and 1 tablet of sulphadoxine pyremethamine (250 mg+ 12.5 mg) 1.00 3 tablet pink color pack 0.00 inr zero only 214 act kit containing 3 tablet of artesunate (50mg each) and 1tablet of sulphadoxine pyremethamine (500+25) mg 1.00 3 tablet yellow color pack 0.00 inr zero only 215 act kit containing 3 tablet of artesunate (100 mg each) and 1 tablet of sulphadoxine pyremethamine (750 + 37.5) mg 1.00 3 tablet green color pack 0.00 inr zero only 216 act kit containing 3 tablet of artesunate 150 mg and 2 tablet of sulphadoxine pyremethamine (500 mg+ 25 mg) 1.00 3 tablet red color pack 0.00 inr zero only 217 act kit containing 3 tablet of artesunate (each 200 mg) and 2 tablet of sulphadoxine pyremethamine (750 + 37.5) mg each or 3 tablet sulphadoxine pyremethamine (500+25) mg each 1.00 3 tablet white color pack 0.00 inr zero only 218 artemether + leumefantrine tablet (40 mg and 240 mg) 1.00 1x6 blister 0.00 inr zero only 219 artemether + leumefantrine tablet (80 mg and 480 mg) 1.00 1x 6 blister 0.00 inr zero only 220 anti viral acyclovir tablet 200 mg 1.00 10 tab 0.00 inr zero only 221 acyclovir tablet 800 mg 1.00 10 tab 0.00 inr zero only 222 acyclovir suspension 400 mg/ 5ml 1.00 60 ml bottle 0.00 inr zero only 223 acyclovir injection 250 mg 1.00 vial 0.00 inr zero only 224 acyclovir injection 500 mg 1.00 vial 0.00 inr zero only 225 tab. valganciclovir 450 mg 1.00 10x10 0.00 inr zero only 226 tab. entecavir ip 0.5 mg (each film coated tablet conatins entecavir ip 0.5 mg) 1.00 10x10 0.00 inr zero only 227 inj. ganciclovir sodium 500mg (lyophilized 1.00 vial 0.00 227 inr zero only inj. ganciclovir sodium 500mg (lyophilized powder for reconstitution) 1.00 vial 0.00 228 anti neoplastic and immuno suppressant drugs azathioprine tablet ip 50 mg 1.00 10x10 tab strip 0.00 inr zero only 229 bleomycin injection 15 units 1.00 vial 0.00 inr zero only 230 chlorambucil tablet 5 mg 1.00 30 tab bottle 0.00 inr zero only 231 cisplatin injection 50 mg/ 50 ml 1.00 50 ml vial 0.00 inr zero only 232 cyclophosphamide injection 200 mg 1.00 10 ml vial 0.00 inr zero only 233 cyclophosphamide injection ip 500 mg 1.00 25 ml glass vial 0.00 inr zero only 234 cyclosporine capsule usp 50 mg 1.00 50 caps pack 0.00 inr zero only 235 cytarabine injection 100 mg/5 ml 1.00 5 ml vial 0.00 inr zero only 236 danazol capsule ip 50 mg 1.00 10 x 10 cap blister 0.00 inr zero only 237 daunorubicin injection 20 mg 1.00 10 ml vial 0.00 inr zero only 238 doxorubicin injection 50 mg/ 25 ml 1.00 25 ml vial 0.00 inr zero only 239 etoposide injection 100 mg/ 5 ml 1.00 5 ml vial 0.00 inr zero only 240 fluorouracil injection 250 mg/ 5 ml 1.00 5 ml amp 0.00 inr zero only 241 l asparaginase injection 10000 iu 1.00 vial 0.00 inr zero only 242 leucovorin calcium injection 10 mg/ml 1.00 5 ml vial 0.00 inr zero only 243 melphalan tablet 5 mg 1.00 25 tab bottle 0.00 inr zero only 244 mercaptopurine tablet ip 50 mg 1.00 10 x10 tab strip 0.00 inr zero only 245 methotrexate injection 50 mg/2 ml 1.00 2 ml vial 0.00 inr zero only 246 methotrexate tablet 2.5 mg 1.00 10 tab 0.00 inr zero only 247 paclitaxel injection 260 mg 1.00 43.4 ml vial 0.00 inr zero only 248 paclitaxel injection 100 mg 1.00 16.7 ml vial 0.00 inr zero only 249 tamoxifen tablet 10 mg 1.00 10 tab 0.00 inr zero only 250 vinblastine injection 10 mg/10 ml 1.00 10 ml vial 0.00 inr zero only 251 vincristine injection 1 mg/ml 1.00 1 ml vial 0.00 inr zero only 252 alpha interferon injection 3 million unit 1.00 vial 0.00 inr zero only 253 carboplatin injection 150mg 1.00 15 ml 0.00 253 carboplatin injection 150mg 1.00 15 ml inr zero only vial 0.00 254 carboplatin injection 450mg 1.00 45 ml vial 0.00 inr zero only 255 cisplatin injection 10 mg/10 ml 1.00 10 ml vial 0.00 inr zero only 256 dacarbazine injection 500 mg 1.00 vial 0.00 inr zero only 257 filgrastim injection 300mcg/ml 1.00 1 ml pfs 0.00 inr zero only 258 gemcitabine injection 200 mg 1.00 vial 0.00 inr zero only 259 gemcitabine injection 1gm 1.00 vial 0.00 inr zero only 260 ifosfamide injection 1gm 1.00 vial 0.00 inr zero only 261 imatinib tablet 400 mg 1.00 10 tab 0.00 inr zero only 262 methotrexate tablet ip 10 mg 1.00 10 x 10 tab strip 0.00 inr zero only 263 mitomycin c injection 10 mg 1.00 vial 0.00 inr zero only 264 oxaliplatin injection 50 mg 1.00 25 ml vial 0.00 inr zero only 265 capsule procarbazine hydrochloride usp 50 mg (each capsule contains procarbazine hydrochloride usp 50 mg) 1.00 10x10 0.00 inr zero only 266 inj bendamustine 100 mg 1.00 vial 0.00 inr zero only 267 tab capecitabine ip 500 mg (each film coated tablet contains capecitabine ip 500 mg) 1.00 10x10 0.00 inr zero only 268 tab letrozole usp 2.5 mg (each film coated tablet contains letrozole usp 2.5 mg) 1.00 10x10 0.00 inr zero only 269 capsule temozolomide ip 100 mg (each hard gelatin capsule contains temozolomide ip 100mg) 1.00 10x10 0.00 inr zero only 270 inj. bortezomib 2mg 1.00 vial 0.00 inr zero only 271 tab abiraterone acetate ip 250 mg (each uncoated tablet contains abiraterone acetate ip 250 mg) 1.00 10x10 0.00 inr zero only 272 capsule lomustine ip 40 mg (each capsule contains lomustine ip 40 mg) 1.00 10x10 0.00 inr zero only 273 cap thalidomide usp 100 mg (each hard gelatin capsule contains thalidomide usp 100 mg) 1.00 10x10 0.00 inr zero only 274 inj. bevacizumab 400 mg 1.00 vial 0.00 inr zero only 275 inj. bevacizumab 100 mg 1.00 vial 0.00 inr zero only 276 tab cyclophosphamide ip 50 mg (each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg) 1.00 10x10 0.00 inr zero only 277 tab gefitinib ip 250 mg (each film coated tablet contains gefitinib ip 250 mg) 1.00 10x10 0.00 inr zero only 278 capsule mycophenolate mofetil usp 250 mg (each capsule conatin mycophenolate mofetil usp 250 mg) 1.00 10x10 0.00 inr zero only 279 capsule tacrolimus ip 0.5 mg (each hard gealtin capsule tacrolimus ip 0.5 mg) 1.00 10x10 0.00 inr zero only 280 tab. mycophenolate sodium 360 mg (each enteric coated tablet conatin mycophenolate sodium 360 mg) 1.00 10x10 0.00 inr zero only 281 tab. bicalutamide usp 50 mg (each film tablet contains bicalutamide usp 50 mg) 1.00 10x10 0.00 inr zero only 282 tab. 6 thioguanine usp 40 mg (each uncoated tablet contains 6 thioguanine usp 40 mg) 1.00 10x10 0.00 inr zero only 283 inj zoledronic acid ip 4mg vial 1.00 100 ml 0.00 inr zero only 284 tab dasatinib 100 mg 1.00 60 tab 0.00 inr zero only 285 anti parkinsonism drugs bromocriptine mesylate tablet 2.5 mg 1.00 10 tab 0.00 inr zero only 286 levodopa and carbidopa tablet 100 mg + 10 mg 1.00 10 x 10 tab strip 0.00 inr zero only 287 levodopa and carbidopa tablet 250 mg + 25mg 1.00 10 x 10 tab strip 0.00 inr zero only 288 trihexyphenidyl hydrochloride tablet 2 mg 1.00 10 x 10 tab strip 0.00 inr zero only 289 drugs affecting blood anticoagulant acenocoumarol tablet 2 mg 1.00 10 tab 0.00 inr zero only 290 enoxaparin sodium injection 60 mg 1.00 vial / pfs 0.00 inr zero only 291 heparin sodium injection 5000 iu/ml 1.00 5 ml vial 0.00 inr zero only 292 warfarin sod. tablet 5 mg 1.00 10 tab 0.00 inr zero only 293 inj. n butyl alcohol 0.26mg/5ml, citric acid 2.5mg/5ml and sod. chloride solution 5 ml size 1.00 5 ml vial 0.00 inr zero only 294 haemostatic ethamsylate injection 250 mg/ 2ml 1.00 2 ml amp 0.00 inr zero only 295 tranexamic acid tablet 500 mg 1.00 6 tab 0.00 inr zero only 296 vitamin k injection 10 mg/ml 1.00 1 ml amp 0.00 inr zero only 297 tab ethamsylate bp 500 mg (each uncoated coated tablet contains ethamsylate bp 500 mg) 1.00 10x10 0.00 inr zero only 298 feracrylum 1% w/w sterile solution 100 ml 1.00 100 ml 0.00 inr zero only 299 inj tranexamic acid ip 100mg/ml 5ml size 1.00 5 ml vial 0.00 inr zero only 300 drugs used in haemophilia dried factor viii fraction (iv use) 250 iu 1.00 vial with diluent 0.00 inr zero only 301 dried factor viii fraction (iv use) 500 iu 1.00 vial with diluent 0.00 inr zero only 302 dried factor viii fraction (iv use) 1000 iu 1.00 vial with diluent 0.00 inr zero only 303 factor – ix concentrate 600 iu 1.00 vial with solvent 0.00 inr zero only 304 anti inhibitor coagulation complex [human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial 500 iu] 1.00 vial with 20 ml solvent 0.00 inr zero only 305 recombinant coagulation factor viia 1 mg 1.00 1 ml vial 0.00 inr zero only 306 recombinant coagulation factor viia 2 mg 1.00 2 ml vial 0.00 inr zero only 307 recombinant f ix 500 iu with diluent 1.00 vial with diluent 0.00 inr zero only 308 3rd generation recombinant f viii 250 iu with diluent 1.00 vial with diluent 0.00 inr zero only 309 3rd generation recombinant f viii 1000 iu with diluent 1.00 vial with diluent 0.00 inr zero only 310 drugs used in thalassaemia deferasirox tablet 100 mg 1.00 30 tab 0.00 inr zero only 311 deferasirox tablet 500 mg 1.00 30 tab 0.00 inr zero only 312 deferiprone capsule 250 mg 1.00 50 caps 0.00 inr zero only 313 deferiprone capsule 500 mg 1.00 50 caps 0.00 inr zero only 314 desferrioxamine injection (for i.m. inj and i.v., s.c. infusion) 500 mg 1.00 vial 0.00 inr zero only 315 erythropoetins rh erythropoetin injection 10000 iu 1.00 vial / pfs 0.00 inr zero only 316 rh erythropoetin injection 2000 iu 1.00 vial / pfs 0.00 inr zero only 317 rh erythropoetin injection 4000 iu 1.00 vial / pfs 0.00 inr zero only 318 plasma expanders human albumin solution 20% 1.00 100 ml bottle 0.00 inr zero only 319 hydroxyethyl starch (130/4) 6% w/v with sodium chloride 0.9% w/v intravenous infusion 1.00 500 ml plastic bottle 0.00 inr zero only 320 polygeline 3.5% solution with electrolytes for i.v. infusion 1.00 500 ml bottle 0.00 inr zero only 321 cardio vascular drugs antiarrhythmic adenosine injection 6 mg/2ml 1.00 2 ml vial 0.00 inr zero only 322 amiodarone tablet 100 mg 1.00 10 tab 0.00 inr zero only 323 amiodarone tablet 200 mg 1.00 10 tab 0.00 323 amiodarone tablet 200 mg 1.00 10 tab inr zero only 0.00 324 amiodarone hydrochloride injection 50 mg/ml 1.00 3 ml amp 0.00 inr zero only 325 verapamil tablets ip 40 mg 1.00 10 x 10 tab strip 0.00 inr zero only 326 thrombolytic streptokinase injection 15 lac units 1.00 vial 0.00 inr zero only 327 urokinase injection 5 lac unit 1.00 vial 0.00 inr zero only 328 antiplatelet aspirin delayed release tablet (enteric coated) 75 mg 1.00 10 x 14 tablets strip 0.00 inr zero only 329 clopidogrel tablet ip 75 mg 1.00 10 x 10 tab strip 0.00 inr zero only 330 clopidogrel and aspirin tablet 75 mg + 75 mg 1.00 10 tab 0.00 inr zero only 331 antihypertensive amlodipine tablet ip 2.5 mg 1.00 10 tab 0.00 inr zero only 332 amlodipine tablet 5 mg 1.00 10 tab 0.00 inr zero only 333 atenolol tablet 50 mg 1.00 14 tab 0.00 inr zero only 334 atenolol tablet 25 mg 1.00 14 tab 0.00 inr zero only 335 diltiazem tablet 30 mg 1.00 10 tab 0.00 inr zero only 336 enalapril maleate tablet 10 mg 1.00 10 tab 0.00 inr zero only 337 enalapril maleate tablet 5 mg 1.00 10 tab 0.00 inr zero only 338 enalapril maleate tablet 2.5 mg 1.00 10 tab 0.00 inr zero only 339 labetalol tablet 100 mg 1.00 10 tab 0.00 inr zero only 340 labetalol hydrochloride injection 20 mg/ 4ml 1.00 4 ml amp 0.00 inr zero only 341 lisinopril tablet 2.5 mg 1.00 10 tab 0.00 inr zero only 342 lisinopril tablet 5 mg 1.00 10 tab 0.00 inr zero only 343 lisinopril tablet 10 mg 1.00 10 tab 0.00 inr zero only 344 losartan tablet 25 mg 1.00 10 tab 0.00 inr zero only 345 losartan tablet 50 mg 1.00 10 tab 0.00 inr zero only 346 amlodipine and enalapril maleate tablet 5 mg +5mg 1.00 10 tab 0.00 inr zero only 347 losartan potassium & amlodipine tablet 50 mg + 5mg 1.00 10 tab 0.00 inr zero only 348 losartan potassium & hydrochlorothiazide tablet 50 mg + 12.5mg 1.00 10 tab 0.00 inr zero only 349 amlodipine and lisinopril tablet 5mg +5 mg 1.00 10 tab 0.00 inr zero only 350 amlodipine and atenolol tablet 5 mg +50 mg 1.00 10 tab 0.00 inr zero only 351 methyldopa tablet 250 mg 1.00 10 tab 0.00 inr zero only 352 metoprolol tablet ip 25 mg 1.00 10 x 10 tab 0.00 inr zero only 353 metoprolol suscinate tablet (extended release) usp 50 mg 1.00 10 x 10 tab 0.00 inr zero only 354 nifedipine capsule 5 mg 1.00 10 cap 0.00 inr zero only 355 nifedipine tablet (sustained release) 10 mg 1.00 10 tab 0.00 inr zero only 356 prazosin tablet (extended release) 2.5 mg 1.00 14 tab 0.00 inr zero only 357 propranolol tablet 40 mg 1.00 10 tab 0.00 inr zero only 358 ramipril tablet / capsule 2.5 mg 1.00 10 x 10 cap 0.00 inr zero only 359 telmisartan tablet ip 40 mg 1.00 10 x 10 tab 0.00 inr zero only 360 tab. clonidine hydrochloride usp 0.1 mg (each tablet contains clonidine hydrochloride usp 0.1 mg) 1.00 10 x 10 tab 0.00 inr zero only 361 tab. sotalol hydrochloride usp/bp 40mg (each film coated tablet contains sotalol hydrochloride usp/bp 40mg) 1.00 10 x 10 tab 0.00 inr zero only 362 inj. esmolol hydrochloride 10mg/ml 10ml size 1.00 10 ml 0.00 inr zero only 363 inj. sodium nitroprusside 25mg/ml 2ml size 1.00 2 ml 0.00 inr zero only 364 tab. carvedilol 3.125 mg 1.00 10 x 10 tab 0.00 inr zero only 365 antianginal glyceryl trinitrate tablet 2.6 mg 1.00 10 tab 0.00 inr zero only 366 isosorbide dinitrate tablet 5 mg 1.00 10 tab 0.00 inr zero only 367 isosorbide mononitrate tablet 20 mg 1.00 10 tab 0.00 inr zero only 368 nitroglycerin injection 5 mg/ml 1.00 5 ml amp 0.00 inr zero only 369 lipid lowering atorvastatin tablet 10 mg 1.00 10 tab 0.00 inr zero only 370 atorvastatin tablet 40 mg 1.00 10 tab 0.00 inr zero only 371 fenofibrate capsule 200 mg 1.00 10 cap 0.00 inr zero only 372 tab rosuvastatin ip 20 mg (each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg) 1.00 10 x 10 tab 0.00 inr zero only 373 tab rosuvastatin 10 mg 1.00 10 x 10 tab 0.00 inr zero only 374 drugs used in heart failure digoxin injection 0.25 mg/ml 1.00 2 ml amp 0.00 inr zero only 375 digoxin tablet 0.25 mg 1.00 10 x 10 tab strip 0.00 inr zero only 376 dobutamine injection 50 mg/ml 1.00 5 ml amp 0.00 inr zero only 377 dopamine hydrochloride injection 40 mg/ml 1.00 5 ml amp 0.00 inr zero only 378 isoprenaline injection 2mg / ml 1.00 1 ml amp 0.00 inr zero only 379 tab. sacubitril 24 mg and valsartan 26 mg 1.00 10x10 0.00 inr zero only 380 miscellaneous noradrenaline injection 2 mg/ml 1.00 1 ml amp 0.00 inr zero only 381 magnesium sulphate injection (50% ) 500 mg/ml 1.00 2 ml amp 0.00 inr zero only 382 dental drugs chlorhexidine mouthwash bp 0.20% 1.00 50 ml bottle 0.00 inr zero only 383 dental gel: choline salicylate + benzalkonium + lignocaine 8.75% 1.00 10 gm 0.00 inr zero only 384 desensitizing tooth gel with sodium mono fluoro phosphate & pot. nitrate 0.7%+ 5 % 1.00 50 gm 0.00 inr zero only 385 gum paint containing tannic acid , cetrimide , zinc chloride 2%+0.1%+1% 1.00 15 ml 0.00 inr zero only 386 metronidazole and chlorhexidine gel 1%+ 0.25% 1.00 10 gm 0.00 inr zero only 387 dermatological drugs antifungal miconazole nitrate cream 2% 1.00 15 gm tube 0.00 inr zero only 388 clotrimazole mouth paint (clotrimazole 1% w/v) 1% 1.00 15 ml 0.00 inr zero only 389 ketoconazole cream 2% 1.00 15 gm tube in mono carton 0.00 inr zero only 390 powder clotrimazole 1% w/w 30 gm 1.00 30 gm bottle 0.00 inr zero only 391 oint. terbinafine 1%w/w (10 gm tube) 1.00 10 gm tube 0.00 inr zero only 392 anti infective beclomethasone, neomycin and clotrimazole cream 0.025% + 0.5% + 1% 1.00 10g tube 0.00 inr zero only 393 clindamycin phosphate gel usp 1% 1.00 20 gm tube in mono carton 0.00 inr zero only 394 fusidic acid cream 2% 1.00 10 gm tube 0.00 inr zero only 395 neomycin, bacitracin with sulphacetamide powder 5mg + 250units + 60mg 1.00 10 gm 0.00 inr zero only 396 olopatadine hydrochloride ophthalmic solution 0.1% w/v usp (e/d) 5ml size 1.00 5 ml bottle 0.00 inr zero only 397 cream mupirocin usp 2% (each gram contains 21.5 mg mupirocin calcium usp in a mineral oil cream base) 15 gm size 1.00 15 gm tube 0.00 inr zero only 398 topical steroids betamethasone dipropionate cream 0.05% 1.00 15 gm 0.00 inr zero only 399 betamethasone lotion 0.05% 1.00 50 ml 0.00 inr zero only 400 clobetasol cream 0.05% 1.00 20 gm tube 0.00 inr zero only 401 antiviral acyclovir cream 5% 1.00 5 gm tube 0.00 inr zero only 402 scabicides & pediculocides gamma benzene hexachloride lotion(lindane lotion usp) 1% 1.00 100 ml bottle 0.00 inr zero only 403 permethrin cream 5% 1.00 30 gm tube 0.00 inr zero only 404 permethrin lotion 5% 1.00 30 ml 0.00 404 permethrin lotion 5% 1.00 30 ml inr zero only 0.00 405 coal tar 6% & salicylic acid 3% onitment 1.00 20gm 0.00 inr zero only 406 others glycerin ip 100 ml 1.00 100 ml bottle 0.00 inr zero only 407 glycerin ip 400 gm 1.00 400 gm bottle 0.00 inr zero only 408 calamine lotion ip 1.00 100 ml bottle 0.00 inr zero only 409 compound benzoic acid ointment ip benzoic acid 6%+ salicylic acid 3% 1.00 15 gm tube 0.00 inr zero only 410 tretenoin cream 0.03% 1.00 20 gm tube in mono carton 0.00 inr zero only 411 reagents & diagnostic agents blood grouping anti a blood grouping serum (anti a monoclonal serum ip) 1.00 10 ml vial 0.00 inr zero only 412 anti b blood grouping serum 1.00 10 ml vial 0.00 inr zero only 413 anti drh blood grouping serum 1.00 10 ml vial 0.00 inr zero only 414 dyes & contrast media diatrizoate meglumine and diatrizoate sodium inj usp 60% (iodine conc. 292 mg/ml) 60% 1.00 20 ml amp 0.00 inr zero only 415 diatrizoate meglumine and diatrizoate sodium inj usp 76%w/v (iodine conc. 370 mg/ml) 76% 1.00 20 ml amp 0.00 inr zero only 416 gadodiamide injection 0.5 mmol/ml 1.00 10 ml vial 0.00 inr zero only 417 iohexol usp (solution for injection) non ionic contrast medium in sterile aqueous solution 350 mg iodine/ml. 1.00 50 ml pack 0.00 inr zero only 418 iohexol ( non ionic contrast medium in sterile aqueous solution) 300 mg iodine/ml. 1.00 20 ml pack 0.00 inr zero only 419 diagnostic multistix test strip 1.00 100s pack 0.00 inr zero only 420 vdrl antigen (with +ve and ve control) / rpr slide kit 1.00 100 test kits 0.00 inr zero only 421 disinfectants & antiseptics cetrimide cream ip 0.50% 1.00 15 gm tube 0.00 inr zero only 422 chlorhexidine gluconate solution 5% 1.00 250 ml bottle 0.00 inr zero only 423 compound benzoin tincture ip 1.00 500 ml bottle 0.00 inr zero only 424 formaldehyde solution (34.5% 38%) 1.00 450 ml bottle 0.00 inr zero only 425 gentian violet topical solution usp 1% 1.00 200 ml bottle 0.00 inr zero only 426 glutaraldehyde solution 2% 1.00 5 lit can 0.00 inr zero only 427 hydrogen peroxide solution 6% 1.00 400 ml bottle 0.00 inr zero only 428 lysol (cresol with soap solution) (cresol 50% + soap 50%) 1.00 5 lit can 0.00 inr zero only 429 povidone iodine solution 5% 1.00 500 ml bottle 0.00 inr zero only 430 povidone iodine solution 5% 1.00 100 ml bottle 0.00 inr zero only 431 povidone iodine solution 10% 1.00 100 ml bottle 0.00 inr zero only 432 povidone iodine scrub solution / cleansing solution 7.5% w/v povidone iodine 7.5% 1.00 500 ml bottle 0.00 inr zero only 433 povidone iodine ointment 5% 1.00 15 gm tube 0.00 inr zero only 434 povidone iodine ointment 5% 1.00 250 gm pack 0.00 inr zero only 435 silver sulphadiazine cream 1% 1.00 50 gm tube 0.00 inr zero only 436 silver sulphadiazine cream ip 1% 1.00 500 gm jar 0.00 inr zero only 437 surgical spirit bp 1.00 500 ml bottle 0.00 inr zero only 438 surgical spirit bp 1.00 100 ml bottle 0.00 inr zero only 439 diuretics acetazolamide tablet 250 mg 1.00 10 tab 0.00 inr zero only 440 furosemide tablet 40 mg 1.00 10 tab 0.00 inr zero only 441 furosemide injection 10 mg/ml 1.00 2 ml amp 0.00 inr zero only 442 hydrochlorthiazide tablet 12.5 mg 1.00 10 tab 0.00 inr zero only 443 hydrochlorthiazide tablet 25 mg 1.00 10 tab 0.00 inr zero only 444 mannitol injection 20% 1.00 100 ml bottle 0.00 inr zero only 445 spironolactone tablet 25 mg 1.00 10 tab 0.00 inr zero only 446 spironolactone tablet 50 mg 1.00 10 tab 0.00 inr zero only 447 torsemide tablet 10 mg 1.00 10 x 10 tab 0.00 inr zero only 448 torsemide injection 10 mg/ml 1.00 2 ml amp 0.00 inr zero only 449 drugs for ear ailments ciprofloxacin and dexamethasone ear drops 0.3% + 0.1% 1.00 5 ml vial 0.00 inr zero only 450 clotrimazole 1% with beclomethasone dipropionate 0.025% ear drops 1.00 5 ml ear drops 0.00 inr zero only 451 neomycin, polymixin b & hydrocortisone ear drops/otic solution usp (neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu and hydrocortisone 10 mg per ml) 1.00 5 ml bottle/vi al with separate dropper 0.00 inr zero only 452 wax dissolving ear drops: paradichlorobenzene , benzocaine , 1.00 10 ml bottle 0.00 inr zero only chlorobutanol , turpentine oil 2% + 2.7% + 5% + 15% bottle 453 gastro intestinal drugs antacid antacid tablet 1.00 10 x 10 tab blister 0.00 inr zero only 454 antacid liquid 1.00 60 ml bottle with measuri ng cap 0.00 inr zero only 455 anti ulcer omeprazole capsule 20 mg 1.00 10 cap 0.00 inr zero only 456 pantoprazole injection 40 mg 1.00 vial 0.00 inr zero only 457 pantoprazole & domperidone sr capsule 40 mg+ 30 mg 1.00 10 cap 0.00 inr zero only 458 ranitidine hcl injection 50 mg/2ml 1.00 2 ml amp 0.00 inr zero only 459 ranitidine tablet 150 mg 1.00 10 tab 0.00 inr zero only 460 ranitidine tablet 300 mg 1.00 10 tab 0.00 inr zero only 461 abdominal colic & antispasmodic dicyclomine tablet 10 mg 1.00 10 tab 0.00 inr zero only 462 dicyclomine injection 10 mg/ml 1.00 2 ml amp 0.00 inr zero only 463 dicyclomine hydrochloride oral solution ip10 mg/5ml 1.00 30 ml bottle with measuri ng cap 0.00 inr zero only 464 dicyclomine hydrochloride and activated dimethicone suspension 10mg + 40mg per ml 1.00 10 ml bottle 0.00 inr zero only 465 dicyclomine and paracetamol tablet 20mg + 325mg 1.00 10 x 10 tab blister 0.00 inr zero only 466 drotaverine tablet 40 mg 1.00 10 tab 0.00 inr zero only 467 drotaverine hydrochloride injection 40 mg/2ml 1.00 2 ml amp 0.00 inr zero only 468 drotaverine & mefenamic acid tablet 80 mg + 250 mg 1.00 10 x 10 tab 0.00 inr zero only 469 hyoscine butylbromide tablet 10 mg 1.00 10 tab 0.00 inr zero only 470 hyoscine butylbromide injection ip 20 mg/ml 1.00 1 ml amp 0.00 inr zero only 471 antiemetic metoclopramide injection 10 mg/2ml 1.00 2 ml amp 0.00 inr zero only 472 metoclopramide tablet 10 mg 1.00 10 tab 0.00 inr zero only 473 metoclopramide syrup 5 mg/ 5ml 1.00 30 ml bottle 0.00 inr zero only 474 domperidone tablet 10 mg 1.00 10 tab 0.00 inr zero only 475 domperidone oral drops 10 mg/ ml 1.00 10 ml bottle (with a separate dropper, which 0.00 inr zero only should be able to screw & cap the bottle) in a unit carton 476 domperidone suspension 5 mg/ 5ml 1.00 30 ml bottle 0.00 inr zero only 477 ondansetron orally disintegrating md tablet 4 mg 1.00 10 x 10 tab 0.00 inr zero only 478 ondansetron injection 2 mg/ml 1.00 2 ml amp 0.00 inr zero only 479 tab doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg (each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 1.00 10 x 10 tab 0.00 inr zero only 480 inj prochlorperazine mesylate 12.5mg/ml 5ml size 1.00 5 ml 0.00 inr zero only 481 drugs for constipation, diarrhoea, piles bisacodyl tablet 5 mg 1.00 10 tab 0.00 inr zero only 482 lactic acid bacillus tablet 60 million spores 1.00 10 x 10 tab 0.00 inr zero only 483 lactulose solution 10gm/15ml 1.00 100 ml bottle 0.00 inr zero only 484 liquid paraffin ip 1.00 100 ml bottle 0.00 inr zero only 485 liquid paraffin ip 1.00 400 ml bottle 0.00 inr zero only 486 loperamide tablet ip 2 mg 1.00 10 x 10tab 0.00 inr zero only 487 ors powder 1.00 pouches 20.5gms 0.00 inr zero only 488 ointment containing : lidocaine 3%, zinc oxide 5% , hydrocortisone 0.25%, allantoin 0.5% 1.00 15 gm tube 0.00 inr zero only 489 sodium phosphates enema bp 1.00 100 ml 0.00 inr zero only 490 probiotic sachets 1 gm size (each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores) 1.00 1 gm each sachet 0.00 inr zero only 491 drugs for gall stones ursodeoxycholic acid tablet 300 mg 1.00 10 tab 0.00 inr zero only 492 drugs for ulcerative colitis tab. mesalamine usp 1.2 gm enteric coated 1.00 10x10 0.00 inr zero only (each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm) 493 hormones, other endocrine drugs antidiabetics biphasic isophane insulin injection 30 / 70 (30% soluble insulin & 70% isophane insulin) 40 iu / ml 1.00 10 ml vial 0.00 inr zero only 494 isophane insulin injection 40 iu / ml 1.00 10 ml vial 0.00 inr zero only 495 soluble insulin injection 40 iu / ml 1.00 10 ml vial 0.00 inr zero only 496 glibenclamide tablet 5 mg 1.00 10 tab 0.00 inr zero only 497 gliclazide tablets ip 40 mg 1.00 10 x10 tab strip /blister 0.00 inr zero only 498 glimepiride tablet 2 mg 1.00 10 tab 0.00 inr zero only 499 glimepiride tablet 1 mg 1.00 10 tab 0.00 inr zero only 500 glipizide tablet ip 5 mg 1.00 10 x 10 tab 0.00 inr zero only 501 metformin tablet 500 mg 1.00 10 x 10 tab 0.00 inr zero only 502 pioglitazone tablet ip 15 mg 1.00 10 x 10 tab 0.00 inr zero only 503 metformin hydrochloride sr tablet 1000 mg 1.00 10 tab 0.00 inr zero only 504 glipizide and metformin hydrochloride tablet 5 mg + 500 mg 1.00 10 tab 0.00 inr zero only 505 glibenclamide and metformin hydrochloride (sr) tablet 5 mg + 500 mg 1.00 10 tab 0.00 inr zero only 506 metformin hydrochloride (sr) and glimepiride tablet 500 mg + 1 mg 1.00 10 tab 0.00 inr zero only 507 metformin hydrochloride (sustained release) and glimepiride tablet 500 mg + 2 mg 1.00 10 tab 0.00 inr zero only 508 glimepiride, pioglitazone and metformin hydrochloride (sr) tablet 2mg + 15mg + 500mg 1.00 10 x 10 tab 0.00 inr zero only 509 gliclazide and metformin tablet 80 mg + 500 mg 1.00 10 tab 0.00 inr zero only 510 insulin glargine 100 iu/ml with 15 insulin syringes and needles/cartridge 100 iu/ml with 15 needles and 1 pen per 20 cartridges 1.00 3 ml vial 0.00 inr zero only 511 insulin glargine 100 iu/ml with 30 insulin syringes with needle 1.00 10 ml vial 0.00 inr zero only 512 tenaligliptin tablet 20 mg 1.00 10 x10 tab blister/al ualu pack 0.00 inr zero only 513 female hormonal preparations 1.00 1 ml 0.00 513 female hormonal preparations inr zero only carboprost tromethamine injection 0.25 mg/ml 1.00 1 ml amp 0.00 inr zero only 514 clomiphene tablet ip 25 mg 1.00 10 x 10 tab strip 0.00 inr zero only 515 clomiphene tablet 50 mg 1.00 10 tab 0.00 inr zero only 516 conjugated estrogen tablet 0.625 mg 1.00 10 tab 0.00 inr zero only 517 dinoprostone cream 0.5 mg 1.00 syringe 0.00 inr zero only 518 ethinyloestradiol tablet ip 50 mcg 1.00 10 x 10 tab strip 0.00 inr zero only 519 hydroxyprogesterone injection 250 mg/ml 1.00 1 ml amp 0.00 inr zero only 520 norethisterone tablet 5 mg 1.00 10 tab 0.00 inr zero only 521 progesterone injection 200 mg /2ml 1.00 2 ml amp 0.00 inr zero only 522 medroxyprogesterone acetate tablet ip 10 mg 1.00 10 x 10 tab 0.00 inr zero only 523 thyroid & anti thyroid carbimazole tablet 5 mg 1.00 10 tab 0.00 inr zero only 524 thyroxine sodium tablet 100 mcg 1.00 10 tab 0.00 inr zero only 525 thyroxine sodium tablets ip 50 mcg 1.00 10x 10 tab 0.00 inr zero only 526 others glucagon injection usp 1 mg/ml 1.00 vial 0.00 inr zero only 527 octreotide injection 50 mcg/ml 1.00 1 ml amp 0.00 inr zero only 528 immunologicals anti d immunoglobulin human anti d immunoglobulin injection (im use) 300 mcg 1.00 pfs/vial 0.00 inr zero only 529 human anti d immunoglobulin 150 mcg 1.00 1 ml vial 0.00 inr zero only 530 anti rabies & anti snake venum human rabies immunoglobulin injection 150 iu/ml 1.00 2 ml vial 0.00 inr zero only 531 rabies vaccine human (cell culture) (intradermal) 2.5 iu 1.00 1 ml vial with 1.0 ml diluent 0.00 inr zero only 532 rabies vaccine human (cell culture) (intramuscular) 2.5 iu/ dose 1.00 single dose vial 0.00 inr zero only 533 rabies antiserum ip (equine) (i.m./sc use) 300 units / ml 1.00 5 ml vial 0.00 inr zero only 534 snake venom anti serum (polyvalent anti snake venom) lyophillized 1.00 10 ml vial 0.00 inr zero only 535 others normal human intravenous immunoglobulin 5g/100ml 1.00 100 ml vial 0.00 inr zero only 536 tetanus immunoglobulin 250 iu 1.00 vial / ampoul e 0.00 inr zero only 537 tetanus vaccine (adsorbed) ip 1.00 5 ml vial 0.00 537 tetanus vaccine (adsorbed) ip 1.00 5 ml vial inr zero only 538 diphtheria antitoxin 10,000 iu 1.00 vial 0.00 inr zero only 539 inj. hepatitis b immunologlobin ip 200 i.u 1.00 vial 0.00 inr zero only 540 inj. human immunologlobin 12%igm, 12%iga &76% igg 10 ml(0.5 gm) 1.00 10 ml vial (0.5 gm) 0.00 inr zero only 541 neuromuscular blockers & cholinesterase inhibitors atracurium injection 10 mg/ml 1.00 2.5 ml amp 0.00 inr zero only 542 glycopyrrolate injection 0.2 mg/ml 1.00 1 ml amp 0.00 inr zero only 543 neostigmine injection ip 0.5 mg/ml 1.00 1 ml amp 0.00 inr zero only 544 neostigmine injection 2.5 mg/5ml 1.00 5 ml amp 0.00 inr zero only 545 neostigmine tablets ip 15 mg 1.00 10 x 10 tab strip 0.00 inr zero only 546 succinylcholine injection 50 mg/ml 1.00 10 ml vial 0.00 inr zero only 547 valethamate bromide injection 8 mg/ml 1.00 1 ml amp 0.00 inr zero only 548 vecuronium bromide for injection 4 mg (freeze dried) 1.00 vial/ amp 0.00 inr zero only 549 inj. cis atracurium besylate 2 mg/ml in 5 ml vial 1.00 5 ml vial 0.00 inr zero only 550 ophthalmological preparations anti fungal fluconazole eye drops 0.3% 1.00 5 ml vial with sterilise d dropper or squeeze vial 0.00 inr zero only 551 acyclovir eye ointment ip 3% w/w 5gm size 1.00 5 gm tube 0.00 inr zero only 552 anti inflammatory flurbiprofen sodium ophthalmic solution 0.03% 1.00 5 ml vial 0.00 inr zero only 553 anti glaucoma betaxolol eye drops 0.50% 1.00 5 ml squeeze vial 0.00 inr zero only 554 brimonidine tartrate and timolol eye drops 0.15% + 0.5% 1.00 5 ml vial 0.00 inr zero only 555 phenylephrine hydrochloride ophthalmic solution usp/ phenylephrine eye drops bp 5% 1.00 5 ml squeeze vial 0.00 inr zero only 556 timolol eye drops 0.50% 1.00 5 ml vial 0.00 inr zero only 557 travoprost ophthalmic solution 0.004% 1.00 3 ml squeeze 0.00 inr zero only vial 558 pupillary dialators/constrictors atropine eye ointment 1% 1.00 3 gm tube 0.00 inr zero only 559 atropine sulphate ophthalmic solution usp 1% 1.00 5 ml vial with sterilized dropper or squeeze vial 0.00 inr zero only 560 homatropine eye drops 2% 1.00 5 ml vial 0.00 inr zero only 561 tropicamide eye drops 1% 1.00 5 ml vial 0.00 inr zero only 562 antibiotic chloramphenicol eye drops 0.05% 1.00 5 ml vial 0.00 inr zero only 563 ciprofloxacin eye drops 0.30% 1.00 5 ml vial 0.00 inr zero only 564 ciprofloxacin ophthalmic ointment 0.30% 1.00 5 gm tube 0.00 inr zero only 565 tobramycin and dexamethasone ophthalmic suspension 0.30%+0.10% 1.00 5 ml vial 0.00 inr zero only 566 tobramycin eye drops 0.567 tobramycin ophthalmic ointment 0.30% 1.00 5 gm tube 0.00 inr zero only 568 eye drop moxifloxacin 0.5% w/v ophthalmic solution ip 5ml size 1.00 5 ml vial with sterilized dropper or squeeze vial 0.00 inr zero only 569 chloramphenicol 1% w/w eye ointment ip, 3gm size 1.00 3 gm tube 0.00 inr zero only 570 local anaesthetic lidocaine hydrochloride topical solution usp 4% 1.00 30 ml vial 0.00 inr zero only 571 others carboxymethylcellulose sodium lubricant eye drops 0.50% 1.00 10 ml vial 0.00 inr zero only 572 hyaluronidase injection 1500 iu 1.00 vial 0.00 inr zero only 573 hydroxypropylmethyl cellulose solution with prefilled glass syringe with cannula 20 mg/ml 1.00 2 ml pfs 0.00 inr zero only 574 drugs acting on uterus isoxsuprine injection 5 mg/ml 1.00 2 ml amp 0.00 inr zero only inr zero only isoxsuprine injection 5 mg/ml 575 isoxsuprine tablet 20 mg 1.00 10 tab 0.00 576 methylergometrine injection 0.2 mg/ml 1.00 1 ml amp 0.00 inr zero only 577 methylergometrine tablet ip 0.125 mg 1.00 10 x 10 tab strip 0.00 inr zero only 578 misoprostol tablet 200 mcg 1.00 10 tab 0.00 inr zero only 579 mifepristone tablet 200 mg 1.00 single tab 0.00 inr zero only 580 oxytocin injection 5 iu/ml 1.00 1 ml amp 0.00 inr zero only 581 natural micronised progesteron soft gelatin capsule 200 mg (each soft gelatin capsule contains progesteron ip 200 mg) 1.00 10x10 0.00 inr zero only 582 tab cabergoline ip 0.5mg (each uncoated coated tablet contains cabergoline ip 0.5mg) 1.00 10x10 0.00 inr zero only 583 inj human chorionic gonadotropin ip 5000 i.u. 1.00 vial 0.00 inr zero only 584 leurprolide acetate depot 3.75 mg 1.00 vial 0.00 inr zero only 585 leurprolide acetate depot 11.25 mg 1.00 vial 0.00 inr zero only 586 psychotropic drugs anti psychotics chloridazepoxide tablets ip 10 mg 1.00 10 x 10 tab strip 0.00 inr zero only 587 chlorpromazine tablets ip 100 mg 1.00 10 x 10 tab strip 0.00 inr zero only 588 chlorpromazine tablets ip 25 mg 1.00 10 x 10 tab strip 0.00 inr zero only 589 chlorpromazine tablets ip 50 mg 1.00 10 x 10 tab strip 0.00 inr zero only 590 chlorpromazine injection ip 25 mg/ml 1.00 2 ml amp 0.00 inr zero only 591 haloperidol injection 5 mg/ml 1.00 1 ml amp 0.00 inr zero only 592 haloperidol tablet 1.5 mg 1.00 10 tab 0.00 inr zero only 593 haloperidol tablet 5 mg 1.00 10 tab 0.00 inr zero only 594 olanzapine tablet 5 mg 1.00 10 tab 0.00 inr zero only 595 risperidone tablet 2 mg 1.00 10 tab 0.00 inr zero only 596 risperidone tablet 1 mg 1.00 10 tab 0.00 inr zero only 597 trifluperazine tablets ip 5 mg 1.00 10 x 10 tab strip /blister 0.00 inr zero only 598 quetiapine tablet ip 50 mg 1.00 10 x 10 tab blister 0.00 inr zero only 599 quetiapine tablet ip 25 mg 1.00 10 x 10 0.00 599 quetiapine tablet ip 25 mg 1.00 10 x 10 inr zero only tab blister 0.00 600 tab. levosulpiride 25 mg (each uncoated tablet contains levosulpiride 25 mg) 1.00 10x10 0.00 inr zero only 601 anti depressants amitriptyline tablets ip 25 mg 1.00 10 x 10 tab 0.00 inr zero only 602 escitalopram tablets ip 10 mg 1.00 10 x 10 tab strip /blister 0.00 inr zero only 603 fluoxetine capsule ip 20 mg 1.00 10 cap 0.00 inr zero only 604 imipramine tablet 25 mg 1.00 10 tab 0.00 inr zero only 605 imipramine tablet 75 mg 1.00 10 tab 0.00 inr zero only 606 lithium carbonate tablet 300 mg 1.00 10 tab 0.00 inr zero only 607 sertraline tablet 50 mg 1.00 10 tab 0.00 inr zero only 608 sedatives & tranquilizers alprazolam tablet 0.25 mg 1.00 10 tab 0.00 inr zero only 609 alprazolam tablet 0.5 mg 1.00 10 tab 0.00 inr zero only 610 clonazepam tablet 0.5 mg 1.00 10 x 10 tab 0.00 inr zero only 611 diazepam injection 10 mg/ 2ml 1.00 2 ml amp 0.00 inr zero only 612 diazepam tablet 5 mg 1.00 10 tab 0.00 inr zero only 613 lorazepam injection 2 mg/ml 1.00 2 ml amp 0.00 inr zero only 614 tab. lorazepam ip 2 mg (each uncoated tablet contains lorazepam ip 2 mg ) 1.00 10x10 0.00 inr zero only 615 tab. zolpidem 5 mg 1.00 10x10 0.00 inr zero only 616 drugs acting on the respiratory tract anti asthmatic aminophylline injection 25 mg/ml 1.00 10 ml amp 0.00 inr zero only 617 beclomethasone inhalation 200 mcg/ dose 1.00 200 metered doses containe r 0.00 inr zero only 618 budesonide nebulizer suspension 0.25 mg/ml 1.00 2 ml amp 0.00 inr zero only 619 budesonide rotacap 200 mcg 1.00 30 capsule (rotaca ps) 0.00 inr zero only 620 ipratropium bromide nebulizer solution 250 mcg/ml 1.00 15 ml vial 0.00 inr zero only 621 ipratropium rotacap 40 mcg 1.00 30 capsule (rotaca ps) 0.00 inr zero only 622 salbutamol tablet 4 mg 1.00 10 tab 0.00 inr zero only 623 salbutamol inhalation 100 mcg/ dose 1.00 200 metered doses containe r 0.00 inr zero only 624 salbutamol nebuliser solution 5 mg/ml 1.00 10 ml vial 0.00 inr zero only 625 salbutamol tablet 2 mg 1.00 10 tab 0.00 inr zero only 626 salbutamol syrup ip 2 mg/5ml 1.00 100 ml bottle 0.00 inr zero only 627 terbutaline sulphate tablet ip 2.5 mg 1.00 10 x 10 tab 0.00 inr zero only 628 theophylline and etophylline injection 50.6mg + 169.4mg 1.00 2 ml amp 0.00 inr zero only 629 theophylline and etophylline tablet 23mg + 77mg 1.00 10 tab 0.00 inr zero only 630 theophylline tablet (sr) 400 mg 1.00 10 x 10 tab blister 0.00 inr zero only 631 formoterol & budesonide rotacap 6 mcg+ 200 mcg 1.00 30 capsule (rotaca ps) 0.00 inr zero only 632 tab. acebrophylline 100 mg 1.00 10x10 0.00 inr zero only 633 antitussives cough syrup [each 5ml contains chlorpheniramine maleate ip 3mg ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg] 1.00 50 ml bottle with measuri ng cap 0.00 inr zero only 634 dextromethorphan hydrobromide syrup 13.5 mg/ 5ml 1.00 30 ml bottle 0.00 inr zero only 635 cough syrup/ expectorant (ambroxol hydrochloride ip 15 mg, terbutaline sulphate ip 1.5 mg, guaiphenesin ip 50 mg, menthol ip 1 mg 1.00 50 ml bottle with measuri ng cap 0.00 inr zero only 636 local decongestant saline nasal solution (drops) 0.65% 1.00 10 ml bottle 0.00 inr zero only 637 xylometazoline nasal drops 0.1% 1.00 5 ml vial 0.00 inr zero only 638 solutions correcting water, electrolyte & acid base disturbance compound sodium lactate injection 1.00 500 ml bottle 0.00 inr zero only 639 dextrose injection 25% 1.00 100 ml bottle 0.00 inr zero only 640 dextrose injection 10% 1.00 500 ml bottle 0.00 inr zero only 641 dextrose injection 5% 1.00 500 ml bottle 0.00 inr zero only 642 multiple electrolytes & dextrose injection type i ip (electrolyte p injection ) 1.00 500 ml bottle 0.00 inr zero only 643 multiple electrolytes & dextrose injection type iii ip (electrolyte m injection) 1.00 500 ml bottle 0.00 inr zero only 644 potassium chloride injection 0.15 gm/ml 1.00 10 ml amp 0.00 inr zero only 645 potassium chloride oral solution usp 500 mg/ 5ml 1.00 200 ml bottle with measuri ng cap 0.00 inr zero only 646 sodium chloride and dextrose injection 0.9 % + 5 % 1.00 500 ml bottle 0.00 inr zero only 647 sodium chloride injection 1.00 500 ml bottle 0.00 inr zero only 648 sodium chloride injection 1.00 100 ml bottle 0.00 inr zero only 649 ringer acetate infusion 500 ml 1.00 500 ml bottle 0.00 inr zero only 650 sodium chloride 0.45% w/v polypack 500 ml 1.00 500 ml bottle 0.00 inr zero only 651 drugs for urology finasteride tablet 5 mg 1.00 10 tab 0.00 inr zero only 652 tamsulosin hcl tablet 0.4 mg 1.00 10 tab 0.00 inr zero only 653 flavoxate tablet 200 mg 1.00 10 tab 0.00 inr zero only 654 tab savelamer carbonate 400 mg (each film coated tablet contains savelamer carbonate 400 mg) 1.00 10x10 0.00 inr zero only 655 tab sodium bicarbonate usp 1 gm (each film coated tablet contains sodium bicarbonate usp 1 gm) 1.00 10x10 0.00 inr zero only 656 tab levamisol hydrochloride ip 50 mg (each uncoated tablet conatin levamisol hydrochloride ip 50 mg) 1.00 10x10 0.00 inr zero only 657 tab.phenazopyridine 5 mg 1.00 10x10 0.00 inr zero only 658 tab. dutasteride 0.5 mg 1.00 10x10 0.00 inr zero only 659 syp. alkylizer 1.4 gm/5 ml ( 100 ml ) (disodium hydrogen citrate) 1.00 100 ml bottle 0.00 inr zero only 660 antivertigo betahistine tablet ip 8 mg 1.00 10 x 10tab 0.00 inr zero only 661 betahistine tablet ip 16 mg 1.00 10 x 10 tab 0.00 inr zero only 662 cinnarizine tablet ip 25 mg 1.00 10 x 10 tab 0.00 inr zero only 663 cinnarizine tablet ip 75 mg 1.00 10 x 10 tab 0.00 inr zero only 664 vitamins & minerals ascorbic acid tablet 500 mg 1.00 10 tab 0.00 inr zero only 665 calcium gluconate injection 10% 1.00 10 ml amp 0.00 inr zero only 666 calcium & vitamin d3 tablet 500 mg + 250 iu 1.00 10 tab 0.00 666 calcium & vitamin d3 tablet 500 mg + 250 iu 1.00 10 tab inr zero only 0.00 667 calcium & vitamin d3 suspension (each 5 ml contains calcium carbonate equivalentvto elemental calcium 250 mg + vitamin d3 125 iu) 1.00 100 ml bottle (with measuri ng cap) 0.00 inr zero only 668 calcitriol capsule 0.25 mcg 1.00 10 cap 0.00 inr zero only 669 cholecalciferol granules 60,000 iu /1gm 1.00 1 gm sachet 0.00 inr zero only 670 ferrous sulphate and folic acid tablet 100 mg + 0.5 mg 1.00 10 tab 0.00 inr zero only 671 ferrous sulphate with folic acid tab.(paediatric) 20 mg + 0.1 mg 1.00 10 tab 0.00 inr zero only 672 folic acid tablet ip 5 mg 1.00 10 tab 0.00 inr zero only 673 iron and folic acid syrup each 5 ml contains ferrous fumerate equivalent to elemental iron 100 mg, folic acid 500 mcg 1.00 100 ml bottle with dropper 0.00 inr zero only 674 iron sucrose injection 20 mg/ml usp/bp 20 mg/ml (for iv use) each ml contain : ferric hydroxide in comples with sucrose equivalent to elemental iron 20 mg 1.00 5 ml amp 0.00 inr zero only 675 mecobalamin injection 500 mcg/ml 1.00 1 ml amp 0.00 inr zero only 676 multivitamin drops each ml contains vit a3000 iu, vit d3 300iu, vit b 1 1mg, riboflavine phosphate sodium 2 mg, dpantenol 2.5 mg, niacinamide 10 mg, pyridoxine hcl 1 mg, cyanocobalamin 1 mcg, lysine hcl 10 mg 1.00 15 ml bottle with dropper 0.00 inr zero only 677 multivitamin tablets nfi formula sugar coated.vit a 2500 iu 1.00 10 x 10 tab 0.00 inr zero only 678 pyridoxine tablet 10 mg 1.00 10 tab 0.00 inr zero only 679 pyridoxine tablet 40 mg 1.00 10 tab 0.00 inr zero only 680 thiamine tablet 100 mg 1.00 10 tab 0.00 inr zero only 681 vitamin a solution 1 lac iu/ml 1.00 100 ml bottle 0.00 inr zero only 682 vitamin b complex tablet nfi (prophylactic) 1.00 10 tab 0.00 inr zero only 683 vitamin b complex injection nfi 1.00 10 ml vial 0.00 inr zero only 684 zinc sulphate dispersible ip elemental tablet 10 mg 1.00 10x 10 tab 0.00 inr zero only 685 methylcobalmin tablet 500 mcg 1.00 10 x 10 tab blister/s trip 0.00 inr zero only 686 methylcobalmin tablet 1500 mcg 1.00 10 x 10 tab blister/s 0.00 inr zero only trip 687 vitamin d3 oral solution 60000 iu 1.00 5ml glass bottle in unit carton 0.00 inr zero only 688 inj. ferric carboxymaltose 50 mg/ml 10 ml size 1.00 10 ml vial 0.00 inr zero only 689 multi vitamin syrup 1.00 100 ml 0.00 inr zero only 690 miscellaneous drugs flunarizine tablet 5 mg 1.00 10 tab 0.00 inr zero only 691 black disinfectant fluid (phenyl) (as per schedule o grade iii 1.00 5 lit can 0.00 inr zero only 692 concentrated solution for haemodialysis b.p acetate concentrate in 10 litre cans 1.00 10 ltrs 0.00 inr zero only 693 hameodialysis bicarbonate solution 1.00 10 ltrs 0.00 inr zero only 694 peritonial dialysis solution ip 1.00 1000 ml pack 0.00 inr zero only 695 sodium bicarbonate injection ip 7.5% 1.00 10 ml amp 0.00 inr zero only 696 water for injection ip 1.00 10 ml amp 0.00 inr zero only 697 alendronate sodium tablets usp/bp 35 mg 1.00 4 tab 0.00 inr zero only 698 mannitol with glycerin injection 10% + 10% 1.00 100 ml 0.00 inr zero only 699 surfactant for intratrecheal instillation(natural bovine lung surfactant) 1.00 4 ml vial 0.00 inr zero only 700 oseltamivir 75 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 1.00 10 capsule strip 0.00 inr zero only 701 oseltamivir 45 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 1.00 10 capsule strip 0.00 inr zero only 702 oseltamivir 30 mg capsule (each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 1.00 10 capsule strip 0.00 inr zero only 703 oseltamivir syrup oseltamivir phosphate for oral suspension 12 mg/ml. (each ml contains 12 mg oseltamivir base after reconstitution) 1.00 75 ml bottle with measuri ng cap 0.00 inr zero only 704 oseltamivir phosphate oral suspension ip 12 mg/ml (each ml contains : 12 mg oseltamivir after reconstitution 1.00 60 ml bottle with measuri ng spoon 0.00 inr zero only 705 vitamin k 1 (phytomenadione) 1 mg/0.5ml injection 1.00 1 mg/0.5m l injection 0.00 inr zero only 706 intravenous fat emulsion 20% w/v (pl/tg ratio 0.06) 250ml 1.00 250 ml bottle 0.00 inr zero only 707 tab pyridostigmine usp 60 mg (each tablet contains pyridostigmine usp 60 mg ) 1.00 10x10 0.00 inr zero only 708 inj. caffeine citrate usp 20mg/ml (equivalent to 10 mg caffeine base/ml) 3ml size 1.00 3 ml vial 0.00 inr zero only 709 inj. amino acid 10% 100ml size 1.00 100 ml bottle 0.00 inr zero only 710 cap. vitamin e 400 mg 1.00 10x10 0.00 inr zero only 711 inj poractant alpha 80 mg/ml in pack of 1.5 ml 1.00 1.5 ml vial 0.00 inr zero only 712 absorbable gelatin sponge ip 66, size 80(+ 10) mm x 50 mm x 10 mm should be sterlized. 1.00 piece 0.00 inr zero only 713 absorbent cotton wool ip 500 gm 1.00 packet 0.00 inr zero only 714 asepto syringe with transparent bulb sterile, 60 ml 1.00 piece 0.00 inr zero only 715 blood administration set / blood transfusion set • sharp and easy piercing spike suitable for blood bags and standard blood containers • transparent cylindrical drip chamber with filter.filter size should be 200+20 micrometer. • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the transfusion rate • should conform to is 9824(part 3):1996 1.00 unit 0.00 inr zero only 716 disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 1.00 pair 0.00 inr zero only 717 disposable sterile surgical rubber gloves size 6 ½ inches • made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper 1.00 pair 0.00 inr zero only • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) 718 disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powdered,,without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 1.00 pair 0.00 inr zero only 719 disposable sterile surgical rubber gloves size 7 inches • made of natural rubber latex, powder free (polymer /silicon coated), without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards) 1.00 pair 0.00 inr zero only 720 disposable sterile surgical rubber gloves size 7½ inches • made of natural rubber latex, powdered, without tear, properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • powder should be non allergenic • should conform to is 13422 • isi marked / ce certified / fda approved 1.00 pair 0.00 inr zero only 721 disposable sterile surgical rubber gloves size 7 ½ inches • made of natural rubber latex, powder free (polymer /silicon coated), without tear, 1.00 pair 0.00 inr zero only properly folded in a paper • free of holes, with acceptable quality level (aql) of 1.5 or less • tensile strength as per en 455 2 • should conform to is 13422 isi marked / ce certified / fda approved (ce certification / fda approval for item is mandatory for importer firms, that cannot avail is standards 722 suction catheter, sterile. size: fg 5 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 723 suction catheter, sterile. size: fg 6 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 724 suction catheter, sterile. size: fg 8 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 725 suction catheter, sterile. size: fg 10 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 726 suction catheter, sterile. size: fg 12 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 727 suction catheter, sterile. size: fg 14 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 728 suction catheter, sterile. size: fg 16 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 729 suction catheter, sterile. size: fg 18 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 730 suction catheter, sterile. size: fg 20 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 731 suction catheter, sterile. size: fg 22 (for use in respiratory tract) • soft, kink resistant tubing • rounded open tip with lateral eye • colour coded universal funnel connector for safe connection to standard suction equipment • length 50 cm (min.) • should conform to is0 8836:2014 1.00 each piece 0.00 inr zero only 732 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 8 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon 1.00 each piece 0.00 inr zero only • balloon capacity 3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is 11497 for particular size 733 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size10 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity 3 5 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 1.00 each piece 0.00 inr zero only 734 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size16 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity 30 ± 1ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 1.00 each piece 0.00 inr zero only 735 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size18 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon 1.00 each piece 0.00 inr zero only • balloon capacity 30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 736 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size20 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity 30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 1.00 each piece 0.00 inr zero only 737 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size22 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation • symmetrical foley balloon • balloon capacity 30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 1.00 each piece 0.00 inr zero only 738 sterile catheter, single use, for urinary drainage (foley balloon catheter), 2 way, size 24 fg • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for atraumatic intubation 1.00 each piece 0.00 inr zero only • symmetrical foley balloon • balloon capacity 30 ± 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and balloon capacity should be mentioned as per is 11497. • specification for b,c,d,e,f,g should be mentioned as per is11497 for particular size 739 infant feeding tube size:10fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure • radio opaque line • sterile 1.00 each piece 0.00 inr zero only 740 infant feeding tube size:8fg, length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure • radio opaque line • sterile 1.00 each piece 0.00 inr zero only 741 infant feeding tube size:5fg length 50 cm (min.) • two lateral eyes at distal end • soft, kink resistant non toxic pvc tubing, non irritant to delicate mucosa • with female flexible mount with in built closure • radio opaque line • sterile 1.00 each piece 0.00 inr zero only 742 sterile disposable perfusion set with airway and needle (adult use) • for gravity feed only • sharp and easy piercing spike with air vent • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • self sealing latex bulb which will also act as an port for extra medication • efficient roller clamp to control and adjust the 1.00 unit 0.00 inr zero only fluid rate • 21 g needle • should conform to is 12655 4 standard 743 sterile disposable perfusion set (infusion set) with airway and needle (paediatric use) • burette type measured volume chamber of 100 ml • drop size of approx 60 drops per ml • injection port,latexfree, for intermittent medication. • floating auto shut off valve (latex free) in burette. • soft and kink resistant pvc tubing. • roller controller for flow control • tube length 150 cm • 23g needle • should conform to iso 8536 5 1.00 unit 0.00 inr zero only 744 sterile disposable infusion set with microdrip (i.v.) • microdrip infusion set with drop size reduced to approx 60 drops per ml • sharp and easy piercing spike • transparent and flexible drip chamber • 150 cm long smooth kink resistant tubing • efficient roller clamp to control and adjust the fluid rate • should conform to is 12655 4 standard 1.00 unit 0.00 inr zero only 745 insulin syringe ( 40 units) with (fixed) 30 g needle shall conform to is 12227 1.00 unit 0.00 inr zero only 746 sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock. size 16g • should be packed in transparent, single blister pack. • should conform to is 10555 standard 1.00 each piece 0.00 inr zero only 747 sterile disposable (single use teflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g • should be packed in transparent, single blister pack. • should conform to is 10555 standard 1.00 each piece 0.00 inr zero only 748 sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock. size 20g 1.00 each piece 0.00 inr zero only • should be packed in transparent, single blister pack. • should conform to is 10555 standard 749 sterile disposable (single use) teflon / ptfe i.v. cannula with integrated 3 way stop cock. size 22g • should be packed in transparent, single blister pack. • should conform to is 10555 standard 1.00 each piece 0.00 inr zero only 750 sterile disposable (single use) teflon/ ptfe i.v. cannula without port. size 24g • suitable for paediatric & neonatal use • should be packed in transparent, single blister pack. • should conform to is 10555 standard 1.00 each piece 0.00 inr zero only 751 mucus extractor sterile • clear transparent container • antibacterial filter • soft, kink resistant pvc tubing • tube size 10 fg; length 40 cm (min.) • capacity 25 ml 1.00 unit 0.00 inr zero only 752 nasal oxygen cannula (set), twin bore (accessory for compressed air breathing) all sizes (adult) • soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm 1.00 each piece 0.00 inr zero only 753 nasal oxygen cannula (set), twin bore (accessory for compressed air breathing) all sizes (pediatrics) • soft and kink resistant pvc tubing • multichannel / star lumen to preventing accidental kinking • twin bores should ensure equal volume of oxygen to both air passages • connector for easy connection to the oxygen source • tube length 200 cm 1.00 each piece 0.00 inr zero only 754 paper adhesive plaster 1 x 9.0 mts (with cutter) non woven adhesive tape,hypoallergic,should have some stretch 1.00 unit 0.00 inr zero only bonding 755 paper adhesive plaster 2 x 9.0 mts (with cutter) non woven adhesive tape hypoallergic, should have some stretch bonding 1.00 unit 0.00 inr zero only 756 paper adhesive plaster 3 x 9.0 mts (with cutter) non woven adhesive tape hypoallergic, should have some stretch bonding 1.00 unit 0.00 inr zero only 757 plaster of paris bandages 15cm x 2.7mts / roll should conform to schedule f(ii) of drug and cosmetic act 1940 1.00 unit 0.00 inr zero only 758 plaster of paris bandages 10cm x 2.7mts / roll should conform to schedule f(ii) of drug and cosmetic act 1940 1.00 unit 0.00 inr zero only 759 ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size: 10 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm 1.00 each piece 0.00 inr zero only 760 ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size: 12 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm 1.00 each piece 0.00 inr zero only 761 ryles tube / nasogastric tube (p.v.c.) with 1.00 each 0.00 761 ryles tube / nasogastric tube (p.v.c.) with inr zero only radio opaque lining. size: 14 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm 1.00 each piece 0.00 inr zero only 762 ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size: 16 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm 1.00 each piece 0.00 inr zero only 763 ryles tube / nasogastric tube (p.v.c.) with radio opaque lining. size: 18 • soft, kink resistant pvc tubing for atraumatic intubation • closed distal end should be coned with radio opaque material for accurate intubation • four lateral eyes for greater efficiency • radio opaque line • marking at 50, 60, 70 cm from tip • colour coded funnel • with luer connector / closure • length 105 cm 1.00 each piece 0.00 inr zero only 764 scalp vein set (disposable): size 18g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile 1.00 each piece 0.00 inr zero only 765 scalp vein set (disposable): size 20g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation 1.00 each piece 0.00 inr zero only • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile 766 scalp vein set (disposable): size 22g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile 1.00 each piece 0.00 inr zero only 767 scalp vein set (disposable): size 24g • butterfly shaped wings for easy handling and attachment with skin. colour coded • needle should be bevelled, siliconised and should ensure atraumatic cannulation • female luer fitting at one end • soft, kink resistant, non toxic, non irritant tube • sterile 1.00 each piece 0.00 inr zero only 768 sterile hypodermic syringe with needle attached, 24g, single use 2 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use or equivalent should be written on unit container 1.00 unit 0.00 inr zero only 769 sterile hypodermic syringe with needle attached, 24g, single use 5 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack 1.00 unit 0.00 inr zero only • the words destroy after single use or equivalent should be written on unit container. 770 sterile hypodermic syringe with needle attached, 22g, single use 10 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use or equivalent should be written on unit container. 1.00 unit 0.00 inr zero only 771 sterile hypodermic syringe with needle attached, 22g, single use 20 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use or equivalent should be written on unit container. 1.00 unit 0.00 inr zero only 772 surgical blade sterile, size 11 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 1.00 100 blades/ packet 0.00 inr zero only 773 surgical blade sterile, size 15 • single peel pack in metal foil • the tip of the blade shall be well defined, 1.00 100 blades/ packet 0.00 inr zero only • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 packet 774 surgical blade sterile, size 22 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 1.00 100 blades/ packet 0.00 inr zero only 775 suture needles curved 1/2 circle round body assorted size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. /pkt. 0.00 inr zero only 776 suture needles curved 1/2 circle round body assorted size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. /pkt. 0.00 inr zero only 777 suture needles curved 1/2 circle round body assorted size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. /pkt. 0.00 inr zero only 778 suture needles curved 1/2 circle round body assorted size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. /pkt. 0.00 inr zero only 779 suture needles curved and cutting 1/2 circle cutting size 6 10 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. 1.00 6 nos. / pkt. 0.00 inr zero only • should conform to is 9165 780 suture needles curved and cutting 1/2 circle size 11 15 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. / pkt. 0.00 inr zero only 781 suture needles curved and cutting 1/2 circle size 16 20 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. /pkt. 0.00 inr zero only 782 suture needles curved and cutting size 1 5 • it should be mentioned whether needle is pointed or blunt with type of its point. • type of eye of the needle should be mentioned. • should conform to is 9165 1.00 6 nos. / pkt 0.00 inr zero only 783 sterile disposable spinal needle for single use 22g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma 1.00 each piece 0.00 inr zero only 784 sterile disposable spinal needle for single use 25g x 3 ½ inch • clear / transparent hub • sharp tip which should ensure minimal puncture trauma 1.00 each piece 0.00 inr zero only 785 urine collecting bag, disposable 2000 ml • transparent sheet • kink resistant flexible tubing not less than 90 cm in length • should have non return valve • top drainage outlet • graduated bag • moulded handle for easy handling 1.00 unit 0.00 inr zero only 786 double j stent, sterile, both ends open size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to tissue 1.00 each piece 0.00 inr zero only 787 double j stent, sterile, both ends open, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue 1.00 each piece 0.00 inr zero only 788 double j stent, sterile, one end closed size 4f, length 16 cm • radio opaque • should be of inert material, non irritant to 1.00 each piece 0.00 inr zero only tissue 789 double j stent, sterile, one end closed, size 5f, length 20 cm • radio opaque • should be of inert material, non irritant to tissue 1.00 each piece 0.00 inr zero only 790 endotracheal tube, plain size 2.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 791 endotracheal tube, plain size 3mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 792 endotracheal tube, plain size 3.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 793 endotracheal tube, plain size 4mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 794 endotracheal tube, plain size 4.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 795 endotracheal tube, plain size 5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 796 endotracheal tube, plain size 5.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 797 endotracheal tube, plain with radio opaque line, sterile, single use size 6mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 798 endotracheal tube, plain size 6.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 799 endotracheal tube, plain size 7mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 800 endotracheal tube, plain size 7.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 801 endotracheal tube, plain size 8mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 802 endotracheal tube, plain size 8.5mm • transparent • standard 15 mm connector at proximal end • radio opaque line throughout the length • tip suitable for nasal and oral intubation • single use, sterile 1.00 each piece 0.00 inr zero only 803 endotracheal tube, cuffed size 4mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line 1.00 each piece 0.00 inr zero only • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 804 endotracheal tube, cuff size 4.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 805 endotracheal tube, cuff size 5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 806 endotracheal tube, cuff size 6mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 807 endotracheal tube, cuff size 6.5mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 808 endotracheal tube, cuff size 7mm • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector 1.00 each piece 0.00 inr zero only • sterile, single use • curved shaped blister pack – suiting the shape of product 809 endotracheal tube, cuff size 7.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 810 endotracheal tube, cuff size 8 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 811 endotracheal tube, cuff size 8.5 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 812 endotracheal tube, cuff size 9 • soft cuff towards the distal end • kink resistant inflation tube • murphy eye at distal end with polished smoothness • radio opaque line • standard 15 mm connector • sterile, single use • curved shaped blister pack – suiting the shape of product 1.00 each piece 0.00 inr zero only 813 tracheostomy tube (pvc), plain, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line 1.00 each piece 0.00 inr zero only 814 tracheostomy tube (pvc), cuffed, sterile, single use all sizes • soft flexible flange at for easy fixation • 15 mm connector at terminal end which can be rotated in 360 degree direction • non irritant • radio opaque line • balloon with non return valve 1.00 each piece 0.00 inr zero only 815 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 24) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval 1.00 each piece 0.00 inr zero only 816 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 28) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval 1.00 each piece 0.00 inr zero only 817 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 32) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval 1.00 each piece 0.00 inr zero only 818 corrugated drainage sheet, sterile, multichannel, with radio opaque line, single use all sizes 1.00 each piece 0.00 inr zero only 819 polypropylene nonabsorbable synthetic 1.00 piece 0.00 819 polypropylene nonabsorbable synthetic inr zero only surgical mesh 7.5 cmx 15 cm soft to feel fast edges,slightly stretchbonding. 1.00 piece 0.00 inr zero only 820 polypropylene nonabsorbable synthetic surgical mesh 15 cmx 15 cm soft to feel fast edges,slightly stretchbonding. 1.00 piece 0.00 inr zero only 821 sterilised umbilical cotton tape width 3 mm, length 75 cm should conform to schedule f(iii) of drug and cosmetic act 1940 1.00 each piece 0.00 inr zero only 822 bone wax sterilised 1.00 2 gm/ packet 0.00 inr zero only 823 temporary cardiac pacing wire (electrode) sterile ½ cir, tapercut, 26 mm; straight cutting 60 mm ,breakaway 1.00 sachet 0.00 inr zero only 824 skin graft knife blade (sterile) (disposable ) skin grafting knife blade (sterile) made of carbon steel or stainless steel material 158 mm long individually wrapped in wrapper corrosion inhibitor paper in single packet,.in packs of 10. the edge must be sharp enough to cut the skin in a single shave and should snugly fit in the handle should conform to is 3759. 2. skin grafting knife handle (watson modification of humby’s knife ) stainless steel, ce certified, in which the blade specified in (a) above should fit snugly. should conform to 7980 1976. 1.00 one pack each 0.00 inr zero only 825 k wire, length 375 mm; 1mm length of wire should be mentioned with specification. should conform to is 8261 1.00 each unit 0.00 inr zero only 826 k wire, length 375 mm;1.6mm • length of wire should be mentioned with specification. • should conform to is 8261 1.00 each unit 0.00 inr zero only 827 k wire, length 375 mm; size 1.8mm • length of wire should be mentioned with specification. •should conform to is 8261 1.00 each unit 0.00 inr zero only 828 face mask, disposable 1.00 piece 0.00 828 face mask, disposable inr zero only • should be manufactured from non woven poly prop fabric • should be 3 ply construction • should have high bacterial filtration efficiency • should be heat sealed to keep 3 layers together • standard size 17.5 x9 cm • color green/blue • there should be a string each at all four corners,length of string should be 40cm • nose clip should be there • no elastic band. 1.00 piece 0.00 inr zero only 829 surgical cap, disposable (for surgeons) • should be manufactured from non woven fabric. • strip for tying the cap stitched on the back for proper grip on the forhead. • green colour • ultrasonically stitched • air permeable/breathable • should retain skin and hair particle. • strip for tying the cap 1.00 piece 0.00 inr zero only 830 surgical cap, disposable ( for nurses) • should be manufactured from non woven fabric • blue / green colour • round upon wearing, with elastic • air permeable / breathable • should retain skin and hair particles 1.00 piece 0.00 inr zero only 831 foldable intra ocular lense with injector (size + 11 d to +17.5 d) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) mate rial 2. biconvex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics ( 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with dispos able cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 11 d to +17.5 d at 0.5 d step. 9. supplying unit should be iso accredited an d iol should be ce/us fda certified. 1.00 each piece 0.00 inr zero only 832 foldable intra ocular lense with injector (size + 18 d to + 24 d) size:6mm optics. 12 1.00 each piece 0.00 inr zero only 13mm total diameter 1. made of foldable acrylic (hydrophobic) mate rial 2. biconvex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with dispos able cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 18 d to + 24 d at 0.5 d step. 9. supplying unit should be iso accredited an d iol should be ce/us fda certified. piece 0.00 833 foldable intra ocular lense with injector (size + 24.5 d to + 28.5 d ) size:6mm optics. 12 13mm total diameter 1. made of foldable acrylic (hydrophobic) mate rial 2. biconvex single piece iol with aspheric optics 3. size:6mm optics. 12 13mm total diameter. 4. modified c loop haptic/plate haptics 5. iol should have uv blocking capability 6. iol should have 360°square edge.. 7. foldable and insertion by injector with dispos able cartridge insertable by a sub 2.8 mm incision size or smaller incision 8. diopters + 24.5 d to + 28.5 d at 0.5 d step. 9. supplying unit should be iso accredited an d iol should be ce/us fda certified. 1.00 each piece 0.00 inr zero only 834 standard pmma intra ocular lenses (size + 11 d to +17.5 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 1.00 each piece 0.00 inr zero only 10° anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 11 d to +17.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. 835 standard pmma intra ocular lenses (size + 18 d to + 24 d) • 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, biconvex 3. iol haptics – modified c shaped with 5° 10° anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 18 d to + 24 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. 1.00 each piece 0.00 inr zero only 836 standard pmma intra ocular lenses (size + 24.5 d to + 28.5 d ) 6mm optic size 12.5 13.0 mm total diameter, biconvex 1. pmma optics and haptics single piece with hole 2. 6mm optic size 12.5 to 13mm total diameter, bioconvex 3. iol haptics – modified c shaped with 5° 10° anterior angulation. 4. should have 360° square edges. 5. iol should have uv blocking capability 6. diopters + 24.5 d to + 28.5 d at 0.5 d step. 7. supplying unit should be iso accredited and iol should be ce/us fda certified. 1.00 each piece 0.00 inr zero only 837 disposable sterile surgical rubber gloves size 8 inches • made of natural rubber latex powdered,without tear,properly folded in a paper • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size 1.00 pair 0.00 inr zero only 838 disposable sterile surgical rubber gloves size 8 inches • made of natural rubber latex powder free,without tear,properly folded in a paper 1.00 pair 0.00 inr zero only • should conform to is 13422 • isi marked/ce certified/fda approved • colour code marking to designate size 839 rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small. should conform to is 15354 1.00 dispens er box of 100 gloves 0.00 inr zero only 840 rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small should conform to is 15354 1.00 dispens er box of 100 gloves 0.00 inr zero only 841 rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium should conform to is 15354 1.00 dispens er box of 100 gloves 0.00 inr zero only 842 rubber examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large should conform to is 15354 1.00 dispens er box of 100 gloves 0.00 inr zero only 843 pressure monitoring line / high pressure extension line • suitable for high pressure monitoring and for connection between syringe infusion pump and patient • male luer lock at one end and female luer lock at other end ; should fit all standard equipment. luer lock connectors should provide secure fitting. • pressure upto 800 psi • length 200 cm • sterile 1.00 each piece in blister pack 0.00 inr zero only 844 urine collecting bag for new born /paediatric urine collection bag, capacity 100ml • should have suitability for both male and female patients • should be provided with adhesive for fixation and good grip with minimal risk of allergy and injury • capacity 100 ml • sterile 1.00 each piece 0.00 inr zero only 845 umbilical catheter (for new born) all sizes • radio opaque line • with female flexible mount • colour coded connector • open tip should be soft, rounded, atraumatic 1.00 each piece 0.00 inr zero only • length 40 cm 846 umbilical cord clamp • suitable for clamping umbilical cord of new born • security lock to prevent accidental opening after clamping • grooved clamping area 1.00 each piece 0.00 inr zero only 847 absorbable oxidized regenerated cellulose net size 2”x 3” with surgical sponge topical absorbable haemostatic bactericidal property 1.00 each piece 0.00 inr zero only 848 close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 16 fg 1.00 each piece 0.00 inr zero only 849 close wound drainage device under negative pressure (closed wound suction unit) • option to use one or two catheters simultaneously • bellow chamber with capacity 800 ml • bellow unit with connector • graduated bellow • connecting tube with clamp and “y”connector • curved needle / trocar with catheter • multiperforated catheter / radon drain with radio opaque line • catheter 18 fg 1.00 each piece 0.00 inr zero only 850 t – tube for common bile duct drainage • kehr’s t tube made from medical grade pvc, and siliconized • smooth, kink resistant • radio opaque line throughout the length • sterile • length 20 x 60 cm • size 10 to 18 fg 1.00 each piece 0.00 inr zero only 851 bone cement with antibiotics,fast and slow setting 1.00 40 g pack 0.00 inr zero only 852 general specificaition for s 99 (a) and s99(b) sanitary napkins (for menstrual hygiene) 1.00 6 napkins per pack 0.00 inr zero only sanitary napkins (for menstrual hygiene) specifications: sanitary napkin, beltless 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or nonwoven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc. 3. back strip – a back strip for sticking the sanitary napkin onto the underwear should be there using good quality adhesive material. 4. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section total pad length 210 +_ 10 230 +_ 10 width 60 to 75 70 to 85 thickness 8 +_ 2 5. weight : not more than 10 gm . . instruction for usage should be mentioned on every per pack 853 sanitary napkin, belttype 1. covering – covering of the absorbent filler shall be good quality knitted sleeve or nonwoven fabric which has sufficient porosity to permit the assembled napkin to meet the absorbency requirements. the napkins shall have a non absorbent barrier on one side which shall have an identifying mark indicating the side of the barrier. 2. absorbent filler – the filler material shall consist of cellulose pulp/ wadding, and shall be free from lumps, oil spots, dirt or foreign material, etc 3. size the size of absorbent section / complete sanitary napkin shall be as follows: ( in mm) absorbent section pad length 220 +_ 10 width 70 +_ 5 thickness 17 +_ 3 4. weight : 12 +_ 3 gm 5. pack – six napkins in a pack. 6. elastic belt with loops shall be provided in each pack. 7. absorbency: the napkin should be able to absorb not less than 30 ml of normal saline or coloured water or test fluid when poured on to 1.00 6 napkins per pack 0.00 inr zero only coloured water or test fluid when poured on to the centre of the napkin at the rate of 15 ml per minute. .instruction for usage should be 854 belt less sanitary napkin with wings 1. covering (absorbing top sheet corrector)–good quality knitted sleeve or non woven fabric of rash free,non irritant and soft to touch material which has sufficient porosity to permit the assembled napkin to meet absorbency requirements.the napkins shall have a non absorbent barrier on one side with adhesive covered by a differently identifiable paper 2.overall length (mm) 230 ± 5 3.core length 220 mm± 10 4.fluff core/pad length 220 mm± 10 5. over all width with wings 160mm+_5 6.fluff core/pad length 70 mm± 5 7.thickness of a single pad 9 10mm 8. weight of a single pad : 8 10 gm 9. pack six napkins in a pack. 10type. belt less sanitary napkin with wings 11. minimum absorbency: 50ml 12.ph value of absorbent material 6 8.5 b. disposable individual pouch or wrapper for each sanitary napkin(as per ministry of 1.00 6 napkins per pack 0.00 inr zero only for each sanitary napkin(as per ministry of environment,forest and climate change dated 08.04.2016) 855 oxygen mask (adult) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. 1.00 unit 0.00 inr zero only 856 oxygen mask (paediatric) • mould facemask with adjustable elastic strap for proper position of mask on the mouth and nasal area • friendly soft medical pvc material with comfortable fitting. • aluminium nasal clip provides better fixation. • anatomical design provides lighter seal. • latex free elastic strap available. • mask connector 4m 1.00 unit 0.00 inr zero only 857 sterile catheter, single use, for urinary drainage(foley baloon catheter), 2 way, size 14 • made of silicone elastomer bonded with latex • should have hard plastic valve • smooth distal end with smooth eyes for a traumatic intubation • symmetrical foley balloon • balloon capacity 30+ 1 ml • should conform to is 11497 • color coding marking to identify size • length, wall thickness and ballon capacity should be mentioned as per is 11497 • specification for b,c,d,e,f,g should be mentioned as per is 11497 1.00 each piece 0.00 inr zero only 858 nelaton catheter size 14 fg distal end is close and proximal end has female colour code connector • soft, kink resistant medical grade pvc tube • length:40 cm • individually packed in poly and sterile 1.00 each piece 0.00 inr zero only 859 ecg electrode •reliable trace, •high conductivity,• easy to 1.00 each piece 0.00 inr zero only handle 860 surgical blade sterile, size 23 • single peel pack in metal foil • the tip of the blade shall be well defined, central and sharp. there shall be no waviness, jags, feathers, nicks, or other defects on the cutting edge. the surfaces of the blade shall be smooth and free from tool marks and any sign of corrosion. • should conform to is 3319 1.00 each piece 0.00 inr zero only 861 sterile hypodermic syringe with needle attached, 22g, single use 50 ml • clear transparent chamber • prominent graduation • inert material gasket at the piston to minimise friction during movement & prevent leakage and back flow • sharp needle ensuring minimum trauma during penetration • shall conform to is 12050 • packing: needle should be attached with the syringe and packed in unit ribbon pack • the words destroy after single use or equivalent should be written on unit container. 1.00 each piece 0.00 inr zero only 862 urethral catheter 90 (fg 14), made up of medical grade pvc 1.00 each piece 0.00 inr zero only 863 urethral catheter 91 (fg 10), made up of medical grade pvc 1.00 each piece 0.00 inr zero only 864 vaccum suction set, 2.5 meter length, •suction handle with suction tube •sterile,• pyrogenic free, •latex free,• single use 1.00 each piece 0.00 inr zero only 865 epidural minipack 18g, 90 mm, metal stylet for single use only, •sterile, •epidural catheter 20g, l 90 cm, •6 lateral holes closed end, •borst adapter •epidural catheter flat filter 0.2 micro meter •thread assist guide•lor (loss of resistance) plastic syringe 6 ml 1.00 each piece 0.00 inr zero only 866 vascular catheter with metal guide no. 16, double lumen size 30 cm (longline iv.) 1.00 each piece 0.00 inr zero only 867 vascular catheter with metal guide no. 18 double lumen size 30 cm (longline iv.) 1.00 each piece 0.00 inr zero only 868 vascular catheter with metal guide no. 20 double lumen size 30 cm (longline iv.) 1.00 each piece 0.00 inr zero only 869 vascular catheter with metal guide no. 22 double lumen size 30 cm (longline iv.) 1.00 each piece 0.00 inr zero only 870 vascular catheter with metal guide no. 16 double lumen size 45 cm (longline iv.) 1.00 each piece 0.00 inr zero only double lumen size 45 cm (longline iv.) piece 871 vascular catheter with metal guide no. 18 double lumen size 45 cm (longline iv.) 1.00 each piece 0.00 inr zero only 872 vascular catheter with metal guide no. 20 double lumen size 45 cm (longline iv.) 1.00 each piece 0.00 inr zero only 873 vascular catheter with metal guide no. 22 double lumen size 45 cm (longline iv.) 1.00 each piece 0.00 inr zero only 874 3 way stop cock , non pyrogenic & single use, should be leak proof, with smooth movements 1.00 each piece 0.00 inr zero only 875 3 way stop cock with extension tube (vein o line) size 10 cm (non pyrogenic & single use) 1.00 each piece 0.00 inr zero only 876 3 way stop cock with extension tube (vein o line) size 50 cm (non pyrogenic & single use) 1.00 each piece 0.00 inr zero only 877 3 way stop cock with extension tube (vein o line) size 100 cm (non pyrogenic & single use) 1.00 each piece 0.00 inr zero only 878 3 way stop cock with extension tube (vein o line) size 150 cm (non pyrogenic & single use) 1.00 each piece 0.00 inr zero only 879 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 16) • graduated bag, • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval 1.00 each piece 0.00 inr zero only 880 abdominal drain kit, sterile, having drainage catheter and collection bag (2000 ml) (size 20) • graduated bag • should have well fitting cap • soft drainage catheter 50 cm long, with radio opaque line • rounded open distal end with smooth atraumatic eyes in catheter • catheter with markings at 2 cm interval 1.00 each piece 0.00 inr zero only 881 nasal pronge neonatal (flexible medical grade, 2 meter long, multichannel kink resistance tube 1.00 each piece 0.00 inr zero only 882 elastic adhesive bandage bp 1m x 10cm adhesive material should have good quality sticking property, non allergic 1.00 each piece 0.00 inr zero only 883 sterile disposable (single use teflon/ptfe 1.00 each 0.00 883 sterile disposable (single use teflon/ptfe inr zero only i.v cannula with integrated 3 way stop cock size 26g · should be packed in transparent single blister pack · should confirm to is 10555 standard · (neonatal iv cannula size 26) 1.00 each piece 0.00 inr zero only 884 niv mask (noninvasive ventilation mask) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips/straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained 1.00 each piece 0.00 inr zero only 885 niv mask (noninvasive ventilation mask) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips/straps for easy disengagement of the head gear. · should be single use for ventilator without vent · non allergic, leak proof, contour should be maintained 1.00 each piece 0.00 inr zero only 886 niv mask (noninvasive ventilation mask) adult · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in large size. · should be with ergonomically designed clips/straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained 1.00 each piece 0.00 inr zero only 887 niv mask (noninvasive ventilation mask) adult 1.00 each piece 0.00 inr zero only · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads for adults in medium size. · should be with ergonomically designed clips/straps for easy disengagement of the head gear. · should be single use for bipap with vent · non allergic, leak proof, contour should be maintained piece 0.00 888 niv mask (noninvasive ventilation mask) paediatric · should be light weight silicon based full face & nasal mask with face &forehead soft cushion pads in small size. · should be with ergonomically designed clips/straps for easy disengagement of the head gear · should be single use with bronchoscopy and co2 &o2 port with chin support · non allergic, leak proof, contour should be maintained 1.00 each piece 0.00 inr zero only 889 nebulization mask adult 1.00 each piece 0.00 inr zero only 890 nebulization mask paediatric 1.00 each piece 0.00 inr zero only 891 chemotherapy port &non coring needles(adult) · valved catheter need only saline flush, catheter with intermediate size port with small septum and silicon filled suture holes, should be mri compatible with cathlock radio opaque ring. 8fr with silicon material with peel apart percutaneous introducer system. · chemo port huber needle 20g and 22g. 1.00 each piece 0.00 inr zero only 892 chemotherapy port &non coring needles(pediatric) · valved catheter need only saline flush, catheter with intermediate size power port with large septum and silicon filled suture holes, should be mri compatible with cathlock radioopaque ring. 6fr with silicon material with peel apart percutaneous introducer system · .chemo port huber needle 20g and 22g. 1.00 each piece 0.00 inr zero only 893 absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (3/8 cir rb needle 40mm length 76 cm)1/0 1.00 12 foils 0.00 inr zero only 894 absorbable surgical suture (sterile 1.00 12 foils 0.00 894 absorbable surgical suture (sterile inr zero only catgut),bp/usp needled suture chromic (l/2 cir rb needle 20mm length 76 cm)3/0 1.00 12 foils 0.00 inr zero only 895 absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)2/0 1.00 12 foils 0.00 inr zero only 896 absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 30mm length 76 cm)1/0 1.00 12 foils 0.00 inr zero only 897 absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (l/2 cir rb needle 40mm length 76 cm)1/0 1.00 12 foils 0.00 inr zero only 898 absorbable surgical suture (sterile catgut), bp/usp needled suture chromic (3/8 rb needle 30mm length 76 cm)2/0 1.00 12 foils 0.00 inr zero only 899 absorbable surgical suture (sterile catgut),bp/usp needled suture chromic (1/2 cir rb needle 45 mm length 100 cm)1 1.00 12 foils 0.00 inr zero only 900 absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 26mm, length 76 cm)3/0 1.00 12 foils 0.00 inr zero only 901 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolideco l lactide) ½ cir rb needle 20mm length 70 cm 3/0 1.00 12 foils 0.00 inr zero only 902 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir rb needle 30mm length 90 cm 2/0 1.00 12 foils 0.00 inr zero only 903 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir rb needle 30mm length75 90 cm 1/0 1.00 12 foils 0.00 inr zero only 904 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 1/2 cir tapercut needle (heavy) 35 40mm length 75 90 cm 1/0 1.00 12 foils 0.00 inr zero only 905 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated 1.00 12 foils 0.00 inr zero only polyglactin /polyglycolic acid / poly(glycolideco l lactide) ½ cir rb needle40mm length 90 cm 1/0 906 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolideco l lactide) (1/2 cir conventional 25mm length 90 cm)undyed 3/0 1.00 12 foils 0.00 inr zero only 907 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolideco l lactide) (1/2 cir rb needle 20mm length 70 cm) 4/0 1.00 12 foils 0.00 inr zero only 908 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide ) (1/2 cir rb needle 40mm length 90 cm 2/0 1.00 12 foils 0.00 inr zero only 909 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolideco l lactide) (1/2 cir rb needle 40mm length 90 cm) 1/0 1.00 12 foils 0.00 inr zero only 910 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting needle 22mm length 45 cm 3/0 1.00 12 foils 0.00 inr zero only 911 absorbable surgical suture (synthetic) sterilised surgical needled suture (braided) coated polyglactin /polyglycolic acid / poly(glycolide co l lactide) 3/8 circle cutting 16mm needle, suture length 70cm 4/0 1.00 12 foils 0.00 inr zero only 912 non absorbable surgical suture, sterilised surgical needled suture black braided silk (1/2 cir rb needle 20mm, length 76 cm) 3/0 1.00 12 foils 0.00 inr zero only 913 non absorbable surgical suture, sterilised surgical needled suture black braided silk (3/8cir reverse cutting needle 26mm, length 76 cm) 1.00 12 foils 0.00 inr zero only 3/0 914 non absorbable surgical suture, sterilised surgical needled suture black braided silk (3/8cir reverse cutting needle 45mm, length 76 cm) 2/0 1.00 12 foils 0.00 inr zero only 915 non absorbable surgical suture, sterilised surgical needled suturepolyamide monofilament black (nylon) (3/8 cir micropoint round body ,6mm length 38 cm) 8/0 1.00 12 foils 0.00 inr zero only 916 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 conventional cutting needle 16 mm length 70 cm) 3/0 1.00 12 foils 0.00 inr zero only 917 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 conventional cutting needle 19mm length 60 cm.) 4/0 1.00 12 foils 0.00 inr zero only 918 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 cir slim blade cutting needle 15mm length 70 cm) 5/0 1.00 12 foils 0.00 inr zero only 919 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 cir r cutting needle 40 45mm length 60 70 cm.) 2/0 1.00 12 foils 0.00 inr zero only 920 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 cir r cutting needle 45mm length 70 cm.) 1/0 1.00 12 foils 0.00 inr zero only 921 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb 13 mm needle,length 75cm) double arm 5/0 1.00 12 foils 0.00 inr zero only 922 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue 1.00 12 foils 0.00 inr zero only (3/8cir rb 16mm needle,length 90 cm) 6/0 923 non absorbable surgical suture,sterilised surgical needled suture monofilament polypropylene blue (3/8cir rb double 8mm needle, length 60 cm) 7/0 1.00 12 foils 0.00 inr zero only 924 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (3/8cir rb 16 mm needle, length 70 cm) 5/0 1.00 12 foils 0.00 inr zero only 925 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb needle 30mm length 90 cm) 1/0 1.00 12 foils 0.00 inr zero only 926 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb heavy needle 40 45mm length 75 90 cm) 1 1.00 12 foils 0.00 inr zero only 927 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir tapercut double needle cutting size 16 17mm length 70 90 cm) 5/0 1.00 12 foils 0.00 inr zero only 928 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir tapercut double needle 17mm length 70 90 cm) 4/0 1.00 12 foils 0.00 inr zero only 929 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb needle 25mm, length 90 cm) double arm 3/0 1.00 12 foils 0.00 inr zero only 930 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb needle 30mm, length 90 cm) 2/0 1.00 12 foils 0.00 inr zero only 931 non absorbable surgical suture, sterilised surgical needled suture 1.00 12 foils 0.00 inr zero only monofilament polypropylene blue (1/2 cir tapercut needle 17mm length 75 cm) double arm 3/0 0.00 932 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir tapercut needle,25 mm length 90 cm) double arm 2/0 1.00 12 foils 0.00 inr zero only 933 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue usp(3/8 cir conventional cutting pc 3needle 15mm length 60cm) 6/0 1.00 12 foils 0.00 inr zero only 934 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (3/8 cir rb 13mm needle, length 90 cm double arm 6/0 1.00 12 foils 0.00 inr zero only 935 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb needle 16 mm length 70 cm) 4/0 1.00 12 foils 0.00 inr zero only 936 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (3/8 cir cutting needle 25mm length 45 cm) 3/0 1.00 12 foils 0.00 inr zero only 937 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb heavy 40mm, length 90 cm) 1/0 1.00 12 foils 0.00 inr zero only 938 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (l/2 cir reverse cutting, 45 mm needle length 100 cm) 1 1.00 12 foils 0.00 inr zero only 939 non absorbable surgical suture, ,sterilised surgical needled suture monofilament 1.00 12 foils 0.00 inr zero only polypropylene blue (3/8 cir rb , 8mm double needle, suture length of 70cm) 8/0 940 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 circle tapercut 13mm double needle 70cm) 4/0 1.00 12 foils 0.00 inr zero only 941 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 circle cc 13mm needle, suture length of 70cm) double arm 5/0 1.00 12 foils 0.00 inr zero only 942 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 circle tapercut needle 17mm suture length of 90cm) double arm 2/0 1.00 12 foils 0.00 inr zero only 943 non absorbable surgical suture, sterilised surgical needled suture monofilament polypropylene blue (1/2 cir rb needle 25mm, suture length of 75cm) double arm 3/0 1.00 12 foils 0.00 inr zero only 944 non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided green/ blue (1/2 cir tapercut ,17 mm double needle, length 75 cm) 4/0 1.00 12 foils 0.00 inr zero only 945 non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white polybutylate / silicon coated polyster braided white (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 1.00 12 foils 0.00 inr zero only 946 non absorbable surgical suture, sterilised surgical needled suture braided coated 1.00 12 foils 0.00 inr zero only polyster,green/white or blue/white polybutylate / silicon coated polyster braided green / blue (1/2 cir tapercut ,17 mm double needle, length 90 cm) 2/0 947 non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) 1/2 circle taper cut , 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 2/0 1.00 6 foils 0.00 inr zero only 948 non absorbable surgical suture sterilized surgical needled suture polybutylate / silicon coated with polyster braided (green / blue) *with 1/2 circle taper cut , 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x l.5mm 1.00 6 foils 0.00 inr zero only 949 non absorbable surgical suture, sterilised surgical needled suture braided coated polyster,green/white or blue/white coated polyster braided (green / blue) with 1/2 circle tapercut double needle 25mm, suture length 90 cm 3/0 1.00 12 foils 0.00 inr zero only 950 absorbable surgical suture, sterilised surgical needled suture polyglecaprone / polyglyconate, monofilament sutures (1/2 circle oval rb needle 26mm needle, suture length of 70cm) 2/0 1.00 12 foils 0.00 inr zero only 951 absorbable surgical sutures polyglecaprone / polyglyconate, monofilament sutures (l/2 circle oval rb contrast needle 26mm, suture length 70cm) 1.00 12 foils 0.00 inr zero only 952 absorbable surgical sutures monofilament sutures polyglecaprone /polyglyconate (l/2 circle cutting 16mm needle,suture length 70cm) 4/0 1.00 12 foils 0.00 inr zero only 953 absorbable surgical sutures polyglecaprone / polyglyconate, 1.00 12 foils 0.00 inr zero only monofilament sutures (3/8 circle cutting24 26mm needle, suture length of 70 90cm) 3/0 0.00 954 absorbable surgical suture (synthetic) sterilised needled suture monofilament polydioxanone violet (1/2 circle reverse cutting 40 50 mm length 70 90cm) 1 1.00 12 foils 0.00 inr zero only 955 absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 31mm needle, length 70cm) 2/0 1.00 36 foils 0.00 inr zero only 956 absorbable surgical suture, sterilised surgical needled suture monofilament polydioxanone violet (1/2 circle rb 30mm needle, length 70cm) 1/0 1.00 12 foils 0.00 inr zero only 957 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet) 1/2 circle ct round bodied 40mm, gs needle, suture length 90 cm/ 1 1.00 12 foils 0.00 inr zero only 958 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)1/2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1/0 1.00 12 foils 0.00 inr zero only 959 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)1/2 circle round bodied 30mm, suture length 90 cm/ 2/0 1.00 12 foils 0.00 inr zero only 960 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)1/2 circle reverse cutting,os 40mm, suture length 90 cm 1 1.00 12 foils 0.00 inr zero only 961 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin / polyglycolic acid violet)1/2 circle reverse cutting 36mm, os needle, suture length 90 cm/ 1/0 1.00 12 foils 0.00 inr zero only 962 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture 1.00 12 foils 0.00 inr zero only (braided coated polyglactin / polyglycolic acid violet) 1/2 circle round bodied 20mm, suture length 70 cm 3/0 0.00 963 absorbable surgical suture (synthetic) antibacterial coated sterilised needled suture (braided coated polyglactin/ polyglycolic acid violet)3/8 circle r cutting, ps 1,24mm, suture length 70 cm 3/0 1.00 12 foils 0.00 inr zero only 964 non absorbable surgical suture, sterilised surgical needled suture polyamide monofilament black (nylon) (3/8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 10/0 1.00 12 foils 0.00 inr zero only 965 absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 16mm, length 76 cm) 5/0 1.00 12 foils 0.00 inr zero only 966 absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir cutting needle 8mm, length 35 cm) 6/0 1.00 12 foils 0.00 inr zero only 967 non absorbable surgical suture, sterilised surgical needled suture black braided silk with needle silk (3/8 cir rb needle 20mm, length 76 cm) 4/0 1.00 12 foils 0.00 inr zero only 968 non absorbable surgical suture, sterilised surgical needled suture black braided silk with needle silk (3/8 cir rb needle 16mm, length 76 cm) 5/0 1.00 12 foils 0.00 inr zero only 969 absorbable surgical suture (sterile catgut), needled suture chromic (3/8 cir rcutting needle 19mm length 76 cm) 4/0 1.00 12 foils 0.00 inr zero only 970 b.p. instrument(murkary) 1.00 each 0.00 inr zero only 971 b.p. instrument (digital) 1.00 each 0.00 inr zero only 972 stethoscope 1.00 each 0.00 inr zero only 973 weight machine(digital) 1.00 each 0.00 inr zero only 974 baby weight machine(digital) 1.00 each 0.00 inr zero only 975 glucometer free with 500 strips 1.00 each 0.00 inr zero only 976 glucometer strips 1.00 each 0.00 inr zero only 977 disposable bed sheets 1.00 each 0.00 inr zero only 978 disposable pillow cover 1.00 each 0.00 inr zero only 979 pulse oximeter 1.00 each 0.00 979 pulse oximeter 1.00 each inr zero only 0.00 inr zero only 980 triple layer mask 1.00 each 0.00 inr zero only 981 cotton mask 1.00 each 0.00 inr zero only 982 n 95 mask 1.00 each 0.00 inr zero only 983 hand sanitizer 250ml 1.00 each 0.00 inr zero only 984 nebulizer machine 1.00 each 0.00 inr zero only 985 bleaching powder 25 kg 1.00 each 0.00 inr zero only 986 cotton roll (net 500gm) 1.00 each 0.00 inr zero only 987 folding stretcher 1.00 each 0.00 inr zero only 988 hospital bed (28 kg) 1.00 each 0.00 inr zero only 989 side locker 1.00 each 0.00 inr zero only 990 i.v stand 1.00 each 0.00 inr zero only 991 delivery table 1.00 each 0.00 inr zero only 992 hiv(50 test) 1.00 each 0.00 inr zero only 993 gloves 1.00 each 0.00 inr zero only 994 micro slides 1.00 each 0.00 inr zero only 995 tourni cwet belt 1.00 each 0.00 inr zero only 996 esr cup. 1.00 each 0.00 inr zero only 997 pregenancy card 1.00 (50 test) 0.00 inr zero only 998 widal 4x5 ml 1.00 each 0.00 inr zero only 999 vdrl strit(50 test) 1.00 each 0.00 inr zero only 1000 disposable syring 2 ml 1.00 each 0.00 inr zero only 1001 disposable syring 5 ml 1.00 each 0.00 inr zero only 1002 btct capilary 1.00 each 0.00 inr zero only 1003 hcl n/10 500ml 1.00 each 0.00 inr zero only 1004 disposable niddle 1.00 each 0.00 inr zero only 1005 test tube glass 1.00 each 0.00 inr zero only 1006 n.p. cards (50 test) 1.00 each 0.00 inr zero only 1007 disposable mask 1.00 each 0.00 inr zero only 1008 chemistrix ah.100 strips 1.00 each 0.00 inr zero only 1009 urine strip 1.00 each 0.00 inr zero only 1010 glemsa’s stain (500 ml) 1.00 each 0.00 inr zero only 1011 scissor 6” 1.00 each 0.00 inr zero only 1012 urine contianer 1.00 each 0.00 inr zero only 1013 centrifuge machine 1.00 each 0.00 inr zero only 1014 sprit 5 litre 1.00 each 0.00 inr zero only 1015 anti abd 1.00 each 0.00 inr zero only 1016 edta k3 singal cap. 1.00 each 0.00 inr zero only 1017 test tube stand 1.00 each 0.00 inr zero only 1018 hemoglobinometer free with 1000 strips 1.00 each 0.00 inr zero only 1019 hemoglobin strips 1.00 each 0.00 inr zero only 1020 x ray film 12x15 green base 1.00 each 0.00 inr zero only 1021 x ray film 10x12 green base 1.00 each 0.00 inr zero only 1022 x ray film 10x12 blue base 1.00 each 0.00 inr zero only 1023 erba.giucose reagents 1.00 each 0.00 inr zero only 1024 erba urea reagents 1.00 each 0.00 inr zero only 1025 erba creatinine reagents 1.00 each 0.00 inr zero only 1026 erba sgot reagents 1.00 each 0.00 inr zero only 1027 erba sgot,sgpt reagents 1.00 each 0.00 inr zero only 1028 erba alp reagents 1.00 each 0.00 inr zero only 1029 erba bill,t reagents 1.00 each 0.00 1029 erba bill,t reagents 1.00 each inr zero only 0.00 1030 erba choletrol reagents 1.00 each 0.00 inr zero only 1031 erba triglyceride reagents 1.00 each 0.00 inr zero only 1032 erba hdl reagents 1.00 each 0.00 inr zero only 1033 erba protine reagents 1.00 each 0.00 inr zero only 1034 new pehal kit 1.00 each 0.00 inr zero only 1035 jsb (i) 500 ml 1.00 each 0.00 inr zero only 1036 jsb (ii) 500 ml 1.00 each 0.00 inr zero only 1037 devloper 13.5 lt. 1.00 each 0.00 inr zero only 1038 fixer 13.5 lt. 1.00 each 0.00 inr zero only 1039 involap 10x12(x ray film) 1.00 each 0.00 inr zero only 1040 involap 12x15(x ray film) 1.00 each 0.00 inr zero only 1041 prinking niddle 1.00 each 0.00 inr zero only 1042 liquid parafine 500ml 1.00 each 0.00 inr zero only 1043 sidarwood 500ml 1.00 each 0.00 inr zero only 1044 disteld water cane 5 liter 1.00 each 0.00 inr zero only 1045 micro slides 50 pkt 1.00 each 0.00 inr zero only 1046 ganesh pump 2 liter plastic body 1.00 each 0.00 inr zero only 1047 ganesh pump 2 liter steel body 1.00 each 0.00 inr zero only 1048 streup pump for ddt spray 1.00 each 0.00 inr zero only 1049 knopsack pump for bti spray 1.00 each 0.00 inr zero only 1050 methyal alcohal 500ml 1.00 each 0.00 inr zero only 1051 oil errerson lance100x 1.00 each 0.00 inr zero only 1052 eye piece lance 5x 1.00 each 0.00 inr zero only 1053 biker (borosil) 100ml 1.00 each 0.00 inr zero only 1054 staining rack with glass rod steel body 1.00 each 0.00 inr zero only 1055 fogging machine auto start 1.00 each 0.00 inr zero only 1056 zn oil 1liter 1.00 each 0.00 inr zero only 1057 oxgen cilender b type/ d type 1.00 each 0.00 inr zero only 1058 ecg machine 3 channel 1.00 each 0.00 inr zero only 1059 hiv kit disposable ( face mask , cap, gloves, bedsheet,cord clamp, aprin,bio bag,goggles) 1.00 each 0.00 inr zero only 1060 o.t. kit disposable (gown, cap, mask, shoe coover, gloves, bedsheet,holesheet, trolly cover) 1.00 each 0.00 inr zero only 1061 suger strips 1.00 each 0.00 inr zero only 1062 hemo cue hb 301 ...

Medical Health And Family Welfare - Rajasthan

31756413 surgical equipment and ojar supply surgical equipment and ojar supply , oxygen cycilindra 40 cft isi , oxygen cycilindra 110 cft isi , oxygen cycilindra 220 cft isi , bp instument desk top , bp instument desk top with floor stand , iv drip stand iran 4 legs , amboo beg / adult / pad , patient trolly iran , nubelozar machine , trolly wheel 4 complete , rubberised hospital coir metres length 190.5cm x width 91.4cm x thickness 10.2cm , oxygen cylendar troly 110, , oxygen cylendar troly 220 , oxygen cylendar troly 40, , oxygen regulator with humidifier , sahli hb meter , sahil hb tube , sahil hb pipete , new bars chamber couling , wbc pipet , trbc pipet , needle syring destrozar , centifuze machine , micro scope binocular , shaker , hb meter , hb tube glass , glass slid ( 1*100 ) , fillar paper , pt vial ( prothrobin time wal ) , capilary tub , test tub stand , sliderack , stain rod , esr stand , esp tube , p.c.v. tub , esr pump , stop watch , refrigerator 220ltr, 190ltr , scissor bulnt / sharp , blood mixar , elecric rod ( electrod ) chest , ecg bulve , ecg clip , bed side screen , patient trolly & structur , artary , weight machine electronic adult , weight machine electronic paedtric , weight machine paedtric , weight machine adult , blood beg carrier ( 100 begs carrier ) , stethoscope , artaryforcefs 6” , artaryforcefs12” , alligo forcefs 6” , alligo forcefs 12” , needle holder 6” , needle holder 12” , kocher artary 6” st , kocher artary 12” st , kocher artary 6” curved , kocher artary 12” curved , chetal forcefs , sponge holder forcef 6” , sponge holder forcef 12” , b p hendal no.3 , b p hendal no.4 , b p hendal no.7 , gauge cutting scissor , iris scissor 4” , tonsil scissor , episiotomy scissor , suture cutting scissor , towel clip , intestinal clump , fistula director , mayo scissor , tongue dipprasur , ear speculam , nesal speculam , ear probe small size , tleringial mirror , head light with eliminator , bull eye lamp , nasal dressing forceps , dignostic ent set complete , s s tray with lid 11”x7” , s s tray with lid 12”x8” , dressing drum ss 12”x15” , dressing drum ss 10”x12” , dressing drum ss 8”x10” , dressing drum ss 11”x 9” , fire existing apparatus 5kg , oxygen key , thermometer electronic , extraction forceps set , ( a ) upper moler ( right ) , ( b ) upper moler ( left ) , ( c ) lower moler extraction forceps , ( d ) upper auterior extraction forceps , ( e ) lower auterior extraction forceps , ( f ) upper premolar extraction forceps , ( g ) root forceps , elevators , ( a ) straight elevator , ( b ) crier elevator ( right ) , ( c ) crier elevator ( left ) , ( d ) apexoelevator ( right ) , ( e ) apexoelevator ( left ) , excavator , mirror top with handle , probe , twiser , explorer ( curved ) , plastic filling instrument , bone ronger , wire cutter , iron wire , fraction wire , spatula for mixing cement , dental materials , ( a ) zinc oxide powder , ( b ) eugend liquid 100ml , ( c ) glass inomer cement , ( d ) calcium hydroxide powder , spo2 sensor for fluse oxymeter , d.h.s. plateall size ( 4, 5, 6, 7, 8, 9 ) set , d.h.s. screw ( leg screw ) no. ( 70, 75, 80, 85, 90, 95, 100, 105 ) , corticle screw 4 mm for d.h.s. all size , inter locking tilia nail all size , interlocking femmer nail all size , locking belt 3.9mm / 4.9mm all size , a.m. prosthesis all size , d.c.p. plate for small ergment 5, 6, 7, 8, 9 hole , d.c.p. plate for large ergment 6, 7, 8, 9, 10, 12, 14 hole , corticle screw for c.p. plate 3.5mm no. 12, 14, 16, 18, 20, 22 , tenh nail ( flaxilet nail ) no. 2, 2.5, 3, 3.5mm , p.f.n. set with nail with all size , conuated screw driver set , conslus screw guide wize set , bulk o2 regulator , ecg machine6 channel , ecg machine 12 channel , x ray view box , lead number 0 to 9 , lead apron , glycerine syringe , eustachion tube catherter , suction machine , fess set , 0 / 70 dergee telescope with pv / camera , smr & septoplasty set , led head light , anterior commissure larygosocpe , hypopharyngoscope, oesophagoscope , tonsillectomy & adenoidectomy set , mastoidectomy set with drill machine , tympanoplasty set ( micro ear surgery ) , operating microscope for ear surgery , o.t. spot light single dom , bone cement , bmw trolly , gum boot , k wire cutter large , circalege wire18, 20, , schiotz tonometer , ishihara colour book , direct optholmoscope heine ( with chargebel battery ) , trial lens set ( alluminium metal fitted lens ) , vision drum distance ( illuminated ) , near vision drum ( illuminated ) , opthalmic chair unit , heine rechargeble opthmoscope battery b 2000 , trial frame ( adult size ) , upper & lower toothextraction set , root for up , cryer set , elevetur set , ultrasonic scaler with set , air roter , artery for up , mirror with top , twisor, prabe , kanch ki jar with steel dakkan 1 ltr ( dk¡p dh tkj lvhy

Medical And Health Services - Rajasthan

31716580 supply of surgical equipment and tools medical and surgical equipments 1 oxygen cylinder 40 cft isi 2 oxygen cycilindra 110 cft 151 3 oxygen cycilindra 220 cft 1s1 bp instument desk top i bp instument desk top with floor stand 1v drip stand iran 4 legs 4 5 6 7 amboo beg / adult / pad patient trolly lran nubelozar machine trolly wheel 4” complete 8 9 10 11 rubberised hospital coir metres length 190.5cm x width 91.4cm x thickness 10.2cm 12 oxygen cylendar troly 110, 13 oxygen cylendar troly 220 14 oxygen cylendar troly 40, 15 oxygen regulator with humidifier sahli hb meter sahilh8tube sahil hb pipete 16 17 18 — 19 new bars chamber couling 20 wbc_pipet 21 trbcpipet 22 needle syring destrozar 23 centifuze machine 24 micro scope binocular 25 shaker 26 hbmeter . 27 hb tube glass . 28 glass slid (1’10o) 29 1 fiaiar paper 30 pt vial (prothrobin time wal) 31 capilary tub 32 testtubstand 33 slide rack 34 stain rod 35 esr stand 36 esp tube 37 p.c.v. tub 38 esr pump 39 stop watch .___...___..? 40 refrigerator 22oltr19oftr 41 scissor bulnt/sharp 42 blood mixar 43 elecric rod (electrod) chest 44 ecg bulve 45 ecg clip — 46 bed side screen 47 patient trolly & structur 48 artary 49 weight machine electronic adult 5o weight machine electronic paedtric 51 weight machine paedtric 52 weight machine adult 53 blood beg carrier (100 begs carrier) 54 stethoscope 55 artary forcefs 6” _.....__ 56 artary forcefs 12” 57 alligo forcefs 6” 58 alligo forcefs 12” 59 needle holder 6” 60 needle holder 12” 61 kocher artary 6” st 62 kocher artary 12” st 63 kocher artary 6” curved 63 kocher artary 6” curved 64 kocher artary 12” curved 65 chetal fortefs 66 sponge holder forcef 6” 67 sponge holder eorcef 12” 68 b p hendal no.3 / 69 b p hendal no.4 70 b p hendal no.7 71 gauge cutting scissor 72 iris scissor 4” 73 tonsil scissor 74 episiotomy scissor 75 suture cutting scissor 76 towel clip 77 intestinal clump 78 fistula director 79 mayo scissor 80 tongue dipprasur 81 ear speculam 82 nesal speculam 83 ear probe small size 84 t leringial mirror 85 head light with eliminator 86 bull eye lamp 87 nasal dressing forceps 88 dignostic ent set complete 89 s s tray with lid 11”x7” 90 s s tray with lid 12”x8” 91 dressing drum ss 12”x15” 92 dressing drum ss 10”x12” 93 dressing drum 55 8”x1o” 94 dressing drum ss 11x 9” 95 fire existing apparatus 5kg 96 oxygen key 97 thermometer electronic 98 extraction forceps set m (a) ‘upper moler (right) (b) upper moler (left) (c) lower moler extraction forceps (d) upper auterior extraction forceps (e) lower auterior extraction forceps (f) upper premolar extraction forceps (g) root forceps 99 elevators (a) straight elevator (a) straigi elevator (b) crier elevator (right) (c) crier elevator_(left) (d) apexo elevator (right) ______ (e) apexo_elevator_(left) 100 excavator 101 mirror top with handle 102 probe 103 twiser 104 explorer (curved) 105 plastic filling instrument 106 bone ronger 107 wire cutter 108 iron wire ......... 109 fraction wire 110 spatula for mixing cement 111 dental materials (a) zinc oxideepowder . d (b) eugend_liquid_loomi (c) glass inomer cement (d) calcium hydroxide powder 112 spo2 sensor for fluse oxymeter 113 d.h.s. plate all size (4,5,6,7,8,9) set 114 d.h.s. screw (leg screw) no. (70,75,80,85,90,95,100,105) 115 corticle screw 4 mm for d.h.s. all size 116 inter locking tilia nail all size 117 inter locking femmer nail all size 118 locking belt 3.9mm/4.9mm all size 119 a.m. prosthesis all size 120 d.c.p. plate for small ergment 5,6,7,8,9 hole 121 d.c.p. plate for large ergment 6,7,8,9,10,12,14 hole 122 corticle screw for c.p. plate 3.5mm no. 12,14,16,18,20,22 123 tenh nail (flaxilet nail) no. 2,2.5,3,3.5mm 124 p.f.n. set with nail with all size 125 conuated screw driver set 126 conslus screw guide wize set 127 bulk 02_regulator 128 ecg machine 6 channel 129 ecg machine 12 channel 130 x ray view box 131 lead number oto9 132 lead apron 133 glycerine syringe 134 eustachion tube catherter 135 136 suction machine fess set 137 0/70 dergee telescope with pv/camera 138 smr & septoplasty set 139 led head light 140 anterior commissure larygosocpe hypopharyngoscope, oesophagoscope 141 tonsillectomy & adenoidectomy set 142 mastoidectomy set with drill machine 143 tympanoplasty set (micro ear surgery) 144 operating microscope for ear surgery 145 o.t. spot light single dom 146 bone cement 147 bmw trolly 148 gum boot 149 153 direct optholmoscope heine (with chargebel battery) 154 trial lens set (alluminium metal fitted lens) 155 vision drum distance (illuminated) 156 near vision drum (illuminated) 157 opthalmic chair unit 158 heine rechargeble opthmoscope battery 8 2000 159 trial frame (adult size) 160 upper & lower tooth extraction set 161 root for up 162 cryer set 163 elevetur set 164 ultrasonic scaler with set 165 air roter 166 arteny for up mirror with top 167 168 twisor,prabe 169 kanch ki jar with steel dakkan 1 ltr(dkip dh tkj lvhy