Department Of Medical Education - Rajasthan

34202327 supply of rate contract for surgical and sutures for mndy , laying and jointing pvc pipe. heading , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , absorbable surgical suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb contrast needle 20 26mm, suture length 70cm ) , absorbable surgical suture, sterilised surgical needled suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26 30mm needle, suture length of 70cm ) , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , eye pressure shield , eyelid occlusion dressing , core biopsy instrument with compatible co axial needle ( automatic disposal ) , disposable bone marrow biopsy needle , sanitary napkin beltless with wings ( udan yojna ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , asepto syringe with transparent bulb sterile, 60 ml , blood administration set blood transfusion set ( details in rc ) , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , mucus extractor sterile ( details in rc ) , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , plaster of paris bandage 15cm x 2.7 mts / roll , plaster of paris bandage 10cm x 2.7mts , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , bone wax sterilised , skin graft knife blade ( sterile ) ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , face mask, disposable ( details in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , standard pama intra ocular lenses ( details in rc ) 11 to 17.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 , disposable sterile surgical rubber gloves size 8 inches, powdered , disposable sterile surgical rubber gloves size 8 inches, powder free , rubber examination gloves, non sterile, extra small ( details in rc ) , rubber examination gloves, size small ( details in rc ) , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , pressure monitoring line / high pressure extension line ( details in rc ) , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , bone cement , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , sanitary napkin beltless with wings ( details in rc ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , foleys catheter no. 14 ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , ecg electrode ( detail in rc ) , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) , urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) , vaccum suction set, 2.5 meter length ( detail in rc ) , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , nebulization mask adult ( detail in rc ) , nebulization mask paediatric ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) , braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm1 / 2 circle taper point , braided e caprolactone coated lactomer 2 0 90cm gs 25, 3omm1 / 2 circle taper point , braided e caprolactone coated lactomer 1 90cm gs 25, 37 40mm1 / 2 circle reverse cutting , braided e caprolactone coated lactomer 1, 90cm gs 24 , violet40mm1 / 2 circletaper point , braided e caprolactone coated lactomer 3 0 75cm c 14 , undyed24mm3 / 8 circlereverse cutting , braided e caprolactone coated lactomer 2 0 90cm gs 21 , undyed30mm1 / 2 circletaper point , braided e caprolactone coated lactomer 1 90cm gs 25 , undyed37 40mm1 / 2 circlereverse cutting , braided e caprolactone coated lactomer 0 90cm gs 24 , violet40mm1 / 2 circletaper point , braided e caprolactone coated lactomer 3 0 75cm cv 25 , violet20 22mm1 / 2 circletaper point , braided e caprolactone coated lactomer 1 0 90cm gs 25 , undyed37 40mm1 / 2 circlereverse cutting , polyglactin 910 violet braided, 1, 35 cm 1 / 2 circle reverse cutting ( heavy ) 23 mm , polyglactin 5 0 rb oval ½ circle 16 mm45 cm , polyglactin 5 0 cc 3 / 8 circle 16 mm 45 cm , polyglactin 6 0 micro point ¼ circle 8 mm 45 cm , polyglactin 910, braided coated withantibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cmsize 3 0 , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cmsize 4 0 , absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cmsize 5 0 , absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm , absorbable surgical suture sterilized surgical needled suture loopmonofilament polydiaxanone violet no 1 40mm1 / 2 circle reverse cutting length 90 cm , absorbable surgical suture sterilized surgical needled suturemonofilament polydiaxanone violet 2 0 rb 30 mm needle length 75 cm , absorbable surgical suture sterilized surgical double armedneedled suturemonofilament polydiaxanone violet 6 0 rb 17 mm needle length 90 cm , absorbable surgical suture sterilized surgical double armedneedled suturemonofilament polydiaxanone violet 6 0 rb 11 mm needle length 90 cm , absorbable surgical suture sterilized surgical double armedneedled suturemonofilament polydiaxanone violet 5 0 rb 11 mm needle length 90 cm , absorbable surgical suture sterilized surgical singlearmedneedled suturemonofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm , monofilament polyglyconate 1 150cm gs 25 loop, green48mm1 / 2 circletaper point , monofilament polyglyconate 2 0, 75cm green26 30mm1 / 2 circletaper point , monofilament polyglyconate 3 0, 75cm green20 26mm1 / 2 circletaper point , monofilament polyglyconate 4 0, 75cm green17 20mm1 / 2 circletaper point , polydioxanone voilet monofilament, 3 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, , polydioxanone voilet monofilament, 4 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, , polydioxanone monofilament ( voilet ) , 5 0, 70 cm 1 / 2 circle round body double needle 13 mm , monofilament glycomer 1, 90cm gs 21 , volet37mm1 / 2 crcletaper pont , monofilament glycomer 2 0 90cm gs 21 , volet37mm1 / 2 crcletaper pont , non absorbable surgical suture, sterilized surical needledblack braided silk with needle 1 / 2 circle round bodied 30 mm needle , length 70 cm size 2 0 , silk reel 1 0 , silk reel 2 0 , silk reel 3 0 , silk reel 4 0 , braided polyester caoted with silicon 2 0 8x75cm 2xy 31 plgt , blue & white16mm1 / 2 circletapercutting oval pledget , braided polyester caoted with silicon 2 0 10x75 2xcv 305 pgt , blue & white25mm1 / 2 circletaper point oval pledget , braided polyester caoted with polybutylate 2 0 8x75cm 2x plgt , blue & white16mm1 / 2 circletapercutting oval pledget , braided polyester caoted with polybutylate 2 0 10x752x plgt, blue & white25mm1 / 2 circletaper point oval pledget , braided polyester caoted with silicon 2, 26mm1 / 2 circlerc 75cm , braided polyester caoted with silicon 5, 55mm1 / 2 circlerc 75cm , braided polyester caoted with polybutylate 2, 26mm1 / 2 circlerc 75cm , braided polyester caoted with polybutylate 5, 55mm1 / 2 circlerc 75cm , monofilament polypropylene with peg additive 3 0 90cm 2xvf 20 , blue26mm1 / 2 circletaper point , monofilament polypropylene with peg additive 2 0 90cm 2xv 20 , blue30mm1 / 2 circletaper point , monofilament polypropylene with peg additive 4 0 90cm 2xcv 23 , blue17mm1 / 2 crcletaper cut , monofilament polypropylene with peg additive 5 0 90cm 2xcv 23 , blue17mm1 / 2 crcletaper pont , monofilament polypropylene with peg additive 6 0 75cm 2xcv 22 , blue13mm1 / 2 crcletaper pont , monofilament polypropylene with peg additive 7 0 60cm 2xkv 1 , blue9mm3 / 8 crcletapercuttng , polypropylene blue monofilament, 2 0, 90 cm 1 / 2 circle round body double needle 26 mm , polypropylene blue monofilament, 3 0, 90cm 1 / 2 circle round body double needle 26 mm , polypropylene blue monofilament, 4 0, 75cm 1 / 2 circle round body double needle 17 mm , polypropylene blue monofilament, 5 0, 90cm 1 / 2 circle round body double needle 17 mm , polypropylene blue monofilament, 6 0, 75 cm 3 / 8 circle round body ( 380 microns ) double needle 13 mm , polypropylene blue monofilament, no. 7 0, 60 cm 3 / 8 circle round body, taper pointdouble needle 9 mm , monofilament polybuetester coated with polytribiolate 6 0 75cm 2xcv 1x36 , blue9mm3 / 8 circletaper point , monofilament polybuetester coated with polytribiolate 4 0 90cm 2xcv 23x36 , blue17mm1 / 2 circletaper point , monofilament polybuetester coated with polytribiolate 7 0 60cm 2xmv 175 8 , blue8mm3 / 8 circletaper point , monofilament polybuetester coated with polytribiolate 2 0 90cm 2xv 20x36 , blue26mm1 / 2 circletaper point , monofilament polybuetester coated with polytribiolate 3 0 90cm 2xv 20x36 , blue26mm1 / 2 circletaper point , non absorbable synthetic unidrectional dual cut angle barb with welded loop end made up with polybeutester size 1, 37mm, 30cm, 1 / 2 circle, tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polybeutester blue size 2 0, 1 / 2 circle, 37mm, 30cm tp, , absorbable synthetic unidirectional dual cut angle barbed with welded loop end made up with polyglyconate 2 026 30 mm 30 cm 1 / 2 circle taper point , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 1 0, 1 / 2 circle, 37mm, 30cm tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 2 0, 1 / 2 circle, 26mm, 30cm tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 3 0, 1 / 2 circle, 26mm, 30cm tp , synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with glycomer blue size 2 0, 1 / 2 circle, 24mm, 30 45cm rc , laproscopic knotless pga pcl surgical suture self fixation device with autolock mechanism made up of pga pcl unidirectional taper point 26 mm & 20 cm size 2 0 , polyester ethylene terephthalatenonabsorbablesurgical suture polyester suture is a nonabsorbable, braided, sterile, surgical suture composed of poly ( ethylene terephthalate. ) it is prepared from fibers of high molecular weight, long chain, linear polyesters 1 / 2 circle tapercut 2 x v 5 double needle 26 mm 90 cm green color size 2 0 , laproscopic knotless pga pcl bidirectional taper point surgical suture self fixation device with autolock mechanism made up of pga pcl bidirectional taper point 17 mm & 32cm , absorbable antibacterialpolydiaxonone monofilamenttaper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point ct 1 40 mm needle 90 cm suture size 1 , absorbable antibacterialpolydiaxonone monofilament taper pointsurgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point loop ct sgle armed 65 mm needle 122 cmsuture size 1 , laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab reverse cutting 36 mm & 45 cm suture size 1 , laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab taper point 36 mm & 45 cm suture size 1 0 , non absorbable surgical suture black braided silk1 0 rb ½ circle 30 mm 90 cm , non absorbable surgical suture black braided silk1 0 rc 3 / 8 circle 45 mm 76 cm , non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm , non absorbable surgical suture black braided silk5 0 rb 3 / 8 circle 16 mm 76 cm , non absorbable surgical suture black braided silk 6 0 rc mp 3 / 8 circle 8 mm , non absorbable monofilament3 0 reverse cutting 24mm needle , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 2 0 rb ½ circle 30 mm 70 cm , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet6 0 rb micro point ¼ circle 8 mm 45 cm 2670 , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 4 0 cc 3 / 8 circle 16 mm 45 cm 2442 , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 3 0 cc 3 / 8 circle 16 mm 45 cm 2442 , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rc micro point ¼ circle 8 mm 45 cm 2670 , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 cc 3 / 8 circle 16 mm 45 cm 2442 , absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 rb oval 1 / 2 circle 16 mm 45 cm , endoloop ligature made with polyglactin suture length18 inch, narrow at one end and scored at other , non absorbale surgical suturesterlised surgical needle suturepolyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 9 0 , non absorbale surgical suturesterlised surgical needle suturepolyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 10 0 , non absorbale surgical suturesterlised surgical needle suturepolyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm3 0 , non absorbale surgical suturesterlised surgical needle suturepolyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm4 0 , non absorbale surgical suturesterlised surgical needle suturepolyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm 5 0 , non absorbale surgical suturesterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm6 0 , non absorbale surgical suturesterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm7 0 , non absorbale surgical suturesterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm3 0 , non absorbale surgical suturesterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm4 0 , non absorbale surgical suturesterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm 5 0 , non absorbale surgical suturesterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 3 0 , non absorbale surgical suturesterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 4 0 , non absorbale surgical suturesterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 5 0 , non absorbale surgical suturesterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 6 0 , nonabsorbable polypropylene light weight macroporous mesh , three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesivebarrier visceral side and stay suture in parietal side along with medial medial , three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial , three dimensional monofilament polyester composite mesh with with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial , absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. , absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. , non absorbable 5 mm hernia mesh fixation device with 30 helical shaped titanium tacks 3.96mm width and 0.61 mm diameter , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 15 fasteners , 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape , battery operated 60mm articulatingendo cutter with a disposable battery pack, for enhanced distal tip stability while firing, having closed channel in the cartrdige jaw for better stability during firing, 360 degree rotation shaft and one handed natural articulation up to 45 degrees, precision machined anvil to deliver initial, system wide compression, wide proximal to distal jaw aperture ( proximal 8mm , distal 22mm ) , 3 point gap control for alignment and calibration throughout the 60 mm staple line, knife direction / reverse control to discontinue the firing and return the knife, interchangeable 6 row cartridge options of white, blue , gold, green and black, all fits down to 12mm trocar sleeve, 440 mm shaft length 60 mm stapler , linear cutter 55mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only , linear cutter 75mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only , universal linear cutter cartridge 75mm open linear cutter compatible with selectable staple height linear cutter 75mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. , universal linear cutter cartridge 55mm for open linear cuttercompatible with selectable staple height linear cutter 55mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. , curved cutter stapler 40 mm linear cutter simultaneous cutting and stapling , curved green cartridge having close staple height of 2.0 mm, tactile feedback on completion of firing sequence, new anvil, knife with every catridge , powered circular stapler 29 mm with 3d staple and not slip grip , powered circular stapler 31mm with 3d staple and not slip grip , circular stapler 33mm with controlled tissue compression with adjustable staple height ( 1.0 2.5 mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface , laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height with gripping surface technology and six rows compatible with all range ofendoscopic linear cutter 60mm , laparoscopic cartridge for stapler 60 mm green, 2.0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm , pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hemorrhoidal circular stapler ( with fixed anvil, adjustable closed staple height from 0.75 mm – 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, circular anal dilator, purse string suture anoscope, suture for purse string. , optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. , optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. , facial closure device contain optical bladeless trocar with facial closure device comaptible with clear cannula have two side opening meant for uniform port closure , varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length , varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length , linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler, compatible with tri staple gia 60 mm open linear cutterreloads / cartridges purpule and black , eea circular stapler purple colour medium thick , triple row with tristaple technology ( three row of staple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm , linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler, compatible with tri staple gia 80 mm open linear cutterreloads / cartridges purpule and black , wound protector with double ring in small 2.5 6 cm usfda approved , wound protector with double ring inmedium 5 9 cm , wound protector with double ring in large in size 9 14 cm usfda approved , endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft length , 10mm with leakproof and impervious material to cancer cells of 0.5 microns / pretied purse string on pouch usfda approved , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logictechnology and digital display titanium clips u shaped , laparoscopic liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mmcapable of loading all length cartridges on same gun only , laparoscopic liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only , laparoscopic liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only , hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 9cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels up to and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 9 , hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 17cm length, 16mm curved active bladewith adaptive tissue technologycapable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 , advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation , advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation , advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length, 6 mm wide straight jaw design with jaw length of 38 mm , sealing vessel upto and including 7mm through radio frequency energy , having separate seal and cut buttons, capable of 360 degrees rotation , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 degrees rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation , advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation , advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation , advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable of hand and foot activation with an integrated hand piece and transducer. , connecting cable for ultrasonic harmonic scalpel for open energy probes compatible with focus plus shear hp blue , connecting cable for ultrasonic harmonic scalpel for lap energy probes compatible withace plus shear hp054 , laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation , nasal haemostatic sponge pack ( with airway ) 10inch , platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 2*2 ) holedrill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*2 ) holedrill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*1 ) holedrill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2 mm ) diameter drill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 1.5 mm ) diameter drill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2.5 mm ) diameter drill bit machine with insertiontools , platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 3 mm ) diameter drill bit machine with insertiontools , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 4 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 6 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 8 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 10 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 12.5 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 4 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 6 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 8 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 10 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 12.5 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 6 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 8 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 10 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 12.5 mm ) , speech prosthesis for laryngectomy ( indwelling lowresistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 4 mm ) , block used in thyroplasty ( sialestic and gortex ) 70*50 mm with 20 mm thickness , disposable needle 16g x 1 inch , curved tip & stepped cartridges face from inner to outer side 2.0, 2.5 and 3.0 mm staple heights rowfor variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm tan colour code for vascular applications , curved tip & stepped cartridges face from inner to outer side 3.0, 3.5 and 4.0 mm staple heights rowfor variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm purpule colour code for medium to thick tissue , varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with black varied staple height of 4, 4.5 and 5mm leg length , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logictechnology and digital display titanium clips u shaped , synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm , synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm , disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism: medium / large size , disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism large size , endo liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mm, capable of loading all length cartridges on same gun only , endo liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of45mm capable of loading all length cartridges on same gun only , endo liner cutterwithout integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only , disposable clip applier preloaded with 20 clips, superinterlock security with clip designtechnology medium , disposable clip applier preloaded with 20 clips, superinterlock security with clip designtechnology small , sterile hypodermic syringe with needle attached, 22g, single use 2 ml , sterile hypodermic syringe with needle attached, 22g, single use 5 ml , biological glue with thrombin & aprotinin 1ml , biological glue with thrombin & aprotinin 2ml , close wound drainage device under negative pressure ( closed wound suction unit ) , close wound drainage device under negative pressure ( closed wound suction unit ) , close wound drainage device under negative pressure ( closed wound suction unit ) , close wound drainage device under negative pressure ( closed wound suction unit ) , sterile oxidized regenerated cellulose hemostating agentin netform fibrillar and in thick sheath as per ip , urine collecting bag, disposable 2000 ml with uroflow meter , central neck line double lumen ( 3 nobel metal coated ( gold, silver, palladium ) central lumen catheter, double lumen ) , microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers , microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment , microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch , microcatheterflow dependent super selective high flow infusion microcatheters for cerebral / spinal avms ( compatible with dmso ) , micro guide wirefor microcatheter shapable distal end and with torque 0.014inch , bare platinum coil complex shape, soft, electrolytic detachable framing and filling , bare platinum coil complex shape, soft, mechanically detachable framing and filling , bare platinum coil helical shape, soft, electrolytic detachable , bare platinum coil helical shape, soft, mechanically detachable , aortic punch 2.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 3length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 3.5length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 4 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 4.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 5length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 5.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , aortic punch 3.6length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing , folleys catheter fixation divice foley catheter holder universal size should have leg band and is disposable single patiemnt use device should have catheter grip of 18 to 24 fr catheter and made of crobelt or any other. , tur settur irrigation set disposable urology instrument urology equipment endosurgery, mfg from clinical grade non toxic medical transparent pvc sheet, y shaped connector with pointed spike to easy pierce facilities alternative change solution, thumb operated clamp smooth chnage of bottle, proximal end fitted with flexible latest tubing for easy connection to endoscope, eto steril individual pack. should have minium lenght of 260 cm or more. , laproscopic port with trocar 5mm optically guided bladeless trocar 5mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. , patient pre operative skin prepration solution 26 ml in one step sterile applicator container for single use with 2% chlorohexdine gluconate ( chg ) and 70% ipa with orange tint colour or easy visulization, us fda approved , rem and non remsingle use, corded patient return electrodesconductive adhesive hydrogel with usfda. , chlorhexidine impregnated paraffin gauze30x10cm , chlorhexidine impregnated paraffin 15 cm x 1 roll , surgical gloves 6.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved , surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved , surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved , ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds5 cms x 5 cms , ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds10 cms x 10 cms , self adherent moist wound dressing made up of triple hydrocolloid matrix, elastomeric polymer for pressure ulcers / bed sores 10 cms x 10 cms , stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand broad spectrum antimicrobial & bactricidal activity with high exudate management capability with a wear time of 21 days & locking in edudates in gel form 23 x 100 cms , double wall resuscitator with peep valve in adultit should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified , double wall resuscitator with peep valve in paediatrics it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve forpeadiatric it should have provision to attach manometer for paediatrics ambu bag bag volume:mark iv baby ( 300 ml ) weight:baby ( 190 g ) it should be us fda, ce & iso certified , single patient use sebs resuscitator ( spur ii with peep valve in adult ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: adult ( 1475 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. , single patient use sebs resuscitator ( spur ii with peep valve inpaed ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand should have provision to attach manometer for paediatrics ambu bag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. , single patient use sebs resuscitator ( spur ii with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonate ( 220ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. , pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubationit should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubationit should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubationit should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , pre formed sga with gastric access & intubationit should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified , silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga total size 8 • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga• it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga• it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga• it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified , cervical collar with 12 sizes settings • it should be latex free adjustable collar with12 size setting in paediatric collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified , cervical collar with 16 sizes settings• it should be latex free adjustable collar with 16 size setting in adult collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified , offset connector cardio sensor electrodes• it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm , offset connector cardio sensor electrodes• it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm , offset connector cardio sensor electrodes• it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm , anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone , anatomical face mask with thumb rest silicone•thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , anatomical face mask with thumb rest silicone•thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , anatomical face mask with thumb rest silicone•thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , anatomical face mask with thumb rest silicone•thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c , disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve• it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve• it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , disposable sga anatomical curve• it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion , rhinolaryngo single patient use slim scope insertion tube diameter : 3.0mm. working length: 300 mm bending range: 130 degree up & 130 degree down field of view: 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or bettercomplete system should be us fda and european ce certified , rhinolaryngo single patient use invtervention scope channel width: 2.2mm insertion tube diameter: 5.0 mm. working length : 350 mm bending range:130 degree up & 130 degree down field of view : 85 degree or more direction of view: 0 degree ( forward view ) depth of field: 6 50 mm or better complete system should be us fda and european ce certified , ultrasorbs ap disposable drypads, dry pad for moisture management, 58.4x90cm, with breathable layer, super absorbent core, aqua shield film and air permeable back sheet, absorbency of 1800 2300gm, usfda / ce / bis compliant, iso13485 compliant , elastic head strap cannulas pediatricelastic head strap cannulas pediatric must be soft siliconised, transparent vinyl; adjustable elastic band for comfortable, snug fit below the ears; complete kit with 7 ft oxygen supply tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , over the ear nasal cannulaover the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provides a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink resistant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , volumetric incentive spirometer ( pediatric ) volumetric incentive spirometer ( pediatric ) 2500 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , inspiratory exerciser with 3 color coded balls, 3 chambers inspiratory exerciser with 3 color coded balls, 3 chambers & wide flow rate range from 600 to 1200 cc / sec, with minimum flow imprinted on each chamber. must be compact design and made of break resistant plastic. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , adult mask for tracheostomy adult mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , pardiatric mask for tracheostomy pediatric mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , elongated aerosol mask adult elongated aerosol mask adult with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , elongated aerosol mask pediatricelongated aerosol mask pediatric with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , elongated three in one adult maskelongated three in one adult mask must be able to use as a medium concentration, high concentration or nonrebreathing mask which includes mask with flapper valve, nonrebreathing bag assembly; adjustable nose clip assures comfortable fit; with 7 ft. star lumen oxygen supply tubing; 750 ml reservoir bag. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , adult conventional single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , adult ventilator circuit single limb portable adult ventilator circuit with universal single limb. must be complete kit with main circuit hose, exhalation valve manifold, aerosol hose, patient elbow connector, proximal airway pressure line, exhalation valve line, and humidifier limb. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , adult ventilator circuit single water trapadult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , adult conventional dual limb water trap adult conventional dual limb water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector dual limb inspiratory & expiratory water trap 22mm tubing, ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , infant prong cpap cannulainfant prong cpap cannula nasal size 0 with designed to reduce trauma associated with delivery of infant nasal cpap. must be soft siliconised, anatomically curved prongs to enhance fit. luer fitting on expiratory connector to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; inspiratory & expiratory elbow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , fhme heat and moisture exchangers with bacteria viral filtersbacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999% . filter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care. , tracheostomy hme: 1 heat and moisture exchangers for spontaneously breathing tracheotomy patients. 2 should have in built oxygen port. 3 should be compact & light wt. 4 should be suitable for ambulatory patients, sampling and suctioning can be done without removing it. 5 the system should have kink resisting oxygen tubing , double lumen endobronchial tube left:size 28fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube left:size 32fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube left:size 35fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube left: size 37fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube left:size 39fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube left:size 41fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube right: size 35fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube right: size 37fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , double lumen endobronchial tube right: size 39fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. , sub glottic tube taper guard evac: sizes 6mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 6.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 7mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 7.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 8mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 8.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , sub glottic tube taper guard evac: sizes 9mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. , inflation device inflation device in 30atm & 20ml with clear polycarbonate barrel for easy visualisation of bubbles, luminescent dial, airless rotator, lock release handle for easy one handed control and primelok for easy preparation.usfda approved , manifold manifolds in 2, 3, 5 port with configuration of left right orientation, on off handle, full half body, 200 psi 500 psi rating and wide port spacing. should have clear polycarbonate body to provide durability and visibility, airless rotator and large bore inner lumen throughout including rotator.usfda approved , high pressure tube high pressure tubing in 25cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved , high pressure tube high pressure tubing in 51cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved , high pressure tube high pressure tubing in 76, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved , high pressure tubehigh pressure tubing in122, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved , high pressure tube high pressure tubing in183cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved , torque device torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism.usfda approved , radial bandradial hemostatis band in 24 cm . curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved , radial band radial hemostatis band in 29 cm. curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved , angiography needle angiography needle in 18g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved , angiography needleangiography needle in 19g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved , angiography needle angiography needle in 20g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved , angiography needle angiography needle in 21g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved , angiography wire ptfe guidewire in .035, .038, in regular length. should have 3mm j tip, straight tip, pre coating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved , angiography wire long length ptfe guidewire in .035, .038, with exchange length. should have 3mm j tip, straight tip, pre coating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved , amplatz wire ptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm. should be available in multiple flexible tip length of 1.0cm, 3.5cm, 4.0cm, 6cm, 7cm and j 3.0mm. usfda approved. usfda approved , hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved , hydrophilic wire long length hydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved , hydrophillic braided sheath hydrophilic braided sheath introducer in 4f to 7f, length of 7, 11, 16, 23cm with the option of .018, .021, .025 plastic jacketed and spring coil guidewire. should have ultra thin wall and flat wire braiding technology to provide support and low profile.usfda approved , femoral sheath with needle femoral sheath in 5f to 8f, length of 11 23cm with puncher needle of 18g and guidewire of .035, .038. should have rotating suture ring, snap fit dilator to prevent slipping during insertion and holster pack. should be available in polypropylene. usfda approved , angiography catheterdiagnostic catheter in 4f 6f, length of 70 110cm & 125cm , should come in various shapes & curve length including jl & jr ( 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6 cm ) , al, ar, tig, mp, im, sones, pigtail ( straight, angle, radial ) . should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. should be available in various configurations braided, non braided, short tip, bumper tip, sideholes as applicable. usfda approved , angiography radial cathetersdiagnostic radial catheter with radial ultimate curve in 4 6f. lenght of 100cm, 110cm, 125cm. should have four type of radial ultimate curves. should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. us fda approved , one loop & triple loop snare snare kit ( 2 35mm diameter, 90 degree nitinol & gold plated tungsten loop ) and multiloop snare kit ( 2 45mm diameter, three interlaced nitinol loops ) for foreign body retrieval, should come with flexible, reinforced, strain relief hub to reduce buckling and unique peel away insertion tool. usfda approved , ptca kit ( 1 ) three port manifold with knobs to turnright when open ( 2 ) one pressure line, ( 3 ) fluid connecting line, ( 4 ) contrast connecting line, ( 5 ) one three way stop cock, ( 6 ) one y connector hemoststic valve with spring type push and release mechanism, ( 7 ) one inflation device with manometer upto 30 atm ( easy to operate with luminescent dial ) , ( 8 ) one luer lock controlled syringe of 10 ml with finger grip, ( 9 ) insertion needle, ( 10 ) torque device.usfda approved , closed suction catheter for paediatricsnumber and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 5fr. , closed suction catheter for paediatricsnumber and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 6fr , closed suction catheter for paediatricsnumber and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 7fr. , closed suction catheter for paediatricsnumber and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes8fr. , closed suction catheter for paediatricsnumber and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are10fr. , closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes 12fr. , paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. , paediatric endotracheal tubepaediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. , paediatric endotracheal tubepaediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 5.5mm , adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 5.5mm. , adult endotrachealtube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 10mm. , kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. t size 13fr . , kimvent bal cathnon bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering.sizes16fr. , disposable spo2 sensor it should be base on original nellcor technology withoriginaloximax technology , catheter mountdouble swivel connector, it should have bronchoscopy port . it sholud be approved by us fda , gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 12, length ( 0.8 – 5.0 ) , gastrostomy feeding tubemedical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 14 length ( 0.8 – 5.0 ) , gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 16 length ( 0.8 – 5.0 ) , gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 18, length ( 0.8 – 5.0 ) , gastrostomy feeding tubemedical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 20 length ( 0.8 – 5.0 ) , gastrostomy feeding tubemedical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 24fr length ( 0.8 – 5.0 ) , percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 14fr , percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes –20fr , percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 24fr , silk protein based sterile surgical pu foam dressing non adhesive biomodified, silk protein based, sterile, soft, conformable, absorbent, double layered polyurethene foam dressingcomprised ofsilk protein 8% and asiaticoside nlt 0.6%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized , silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing non adhesivebiomodified, silk protein & silver impregnated, soft, conformable, absorbent, double layered polyurethene foam dressingcomprised ofsilk protein 8%, asiaticoside nlt 0.6% and silver 1.2%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized , silk protein & antimicrobial silver based sterile surgical mesh wound dressing biomodified, bilaminated silk protein and silver wound dressing with mesh pores to facilitatethe easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6% and, sterlization gamma sterlizedsilver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized , silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet biomodified, bilaminatedsilk protein & silver based surgical wound dressing comprised of activatedsilk matrix 46% and asiaticoside 0.6% and silver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized , silk protein derived sterile surgical meshed wound dressing biomodified, bilaminated silk protein wound dressing with mesh pores to facilitatethe easy drainage of exudates, comprised of activatedsilk matrix 46% and asiaticoside nlt 0.6%.non adhesive dressing, square / rectangular in shape, sterlization gamma sterlized , silk protein based sterile surgical wound dressing sheet biomodified, bilaminated silk protein wound dressing comprised of activatedsilk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular shape, sterlization gamma sterlized , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silverbiomodified silk protein and silver based wound healing ointment comprised of silk powder 8% , asiaticoside nlt 0.6% and silver:1.2%, sterlization gamma sterlized , silk protein and nanosilver based microbicidal sterile surgical wound dressing sprinkling powder bottle biomodified silk protein and silver based microbicidal sprinkling powder, comprised of silk powder 8%, asiaticoside nlt 0.6% and silver :1.2% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized , silk protein based sterile surgical wound dressing sprinkling powder bottle biomodified silk protein based wound healing sprinkling powder, comprised of silk powder 8% and asiaticoside nlt 0.6% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized , centella asiatica extract based skin moisturization and antiscar gelcentella asiatica extract based skin moisturization and antiscar gel, comprised of centella asiatica extract, glycerol and vitamin e., sterlization gamma sterlized , silk protein based sterile surgical particle wound dressingbiomodified, bioabsorbable silk protein and collagen containing particle wound dressing, comprised of silk powder 8% , asiaticoside 0.6% and collagen , having natural moisturizing factor ( nmf ) , suitable for cavity wound and any kind of slow and non healing wound, sterlization gamma sterlized , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5mlbiomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing10ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing10*25cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing15*15cm silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management10*20cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*25cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*21.5cms silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cmsilk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cmsilk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm . silk protein & nanocrystalline silver based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing10*25cm . silk protein & nanocrystalline silver based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm . silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized , papain urea & silk protein based wound debriding ointment and cream 25gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg , papain urea & silk protein based wound debriding ointment and cream50gmpapain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gmbroad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment50gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. , anti microbial gloves , anti microbial gloves , anti microbial gloves , anti microbial gloves , anti microbial gloves , anterior chamber iol pmma material, single piecekelman multiflex design5 6 mm optic size with 12 13 mm overall size biconvex power range +12 to +24should be iso or ce certified. manufacturer should be asked to sample for approval. , capsular tension ringstandard capsular tension ringpmma material with one eyelet each at each end 10 mm to 12 mm overall diameter sterile should be iso / ce certified mfg. , iris hooks / retractors set of five disposable sterile iris hooks with soft silicon stopper sterile peek should be made pmma iso / ce certified mfg. , silicone rod for ptosis repairimplantable flexible silicon rod attached to malleable sharp needles with a silicon sleeve. needlelength 60 70mmdiameter 920 ?length of silicone rod 40cm, length of silicon sleeve 0.7 mm. , reusable anaesthetia face mask of siliconeautocalvable & pure transparent. us fda approved and size should be mentioned on mask. , reusable anaesthetia face mask of siliconeautocalvable & pure transparent. us fda approved and size should be mentioned on mask. , reusable anaesthetia face mask of siliconeautocalvable & pure transparent. us fda approved and size should be mentioned on mask. , reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. , reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. , reusable anaesthetia face mask of siliconeautocalvable & pure transparent. us fda approved and size should be mentioned on mask. , flow regulator extension set flow rate 2ml to 350ml per hour , sterile disposable hypodermic needle no. 18x1½ , sterile disposable hypodermic needleno. 21x1½ , sterile disposable hypodermic needle no. 23x1½ , neonatal single heated wire breathing systemwith autofill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. , paed. single heated wire breathing systemwith autofill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. , adult single heated wire breathing systemwith autofill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. , neonatal high flow nasal cannula having8 litre flow. should have soft tip . , pur xro catheter 20 cm, 28g / 1fr picc line with stylet, splitting needle with securing wings with 8 cm extension tubing ( flow rate 1ml / min ) , pur xro catheter 30 cm, 24g / 2fr picc line with split cannula and 10cm extension tubing over catheter ( flow rate 0.2ml / min ) , dead body bag 7x3 ft size leak proof material pp closed on all other sides and zipped on front or on 3 sides , introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , introducer sheath with puncture needle for adultsus fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , intoducer sheath for adults ( size 10 fr.. ) ( standard length ) us fda approvedus fda + ce / dgci approved· 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eyefor securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved , intoducer sheath for adults ( size 11 fr. ) ( standard length ) us fda approvedus fda + ce / dgci approved· · 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved , long introducer sheath ( 20 30 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 6fr. ) us fda + ce / dgci approved· .· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 7fr. ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 8fr ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 9fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 20 30 cm long ) ( size 11fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , trans radial introducer sheeths 4f us fda + ce / dgci approved· sizes 4 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , trans radial introducer sheeths 5f us fda + ce / dgci approved· sizes 5 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , trans radial introducer sheeths 6f us fda + ce / dgci approved· sizes6 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , steerable introducer sheeths 5f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design·movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 6fr us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 7f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 8fus fda + ce / dgci approved· size 55 to 90 cms·to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 9f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 10f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 11f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , steerable introducer sheeths 12f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel , long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during ins ertion , long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long introducer sheath ( 30 50 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 6 fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 7fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 8fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 9fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath ( 30 50 cm long ) ( size 11fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath dedicated for transradial access us fda + ce / dgciapproved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion , long introducer sheath us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long introducer sheath us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long introducer sheath us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , long introducer sheath us fda + ce / dgci approved· should be 90 cm and above· 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion , ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in0.032 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.035size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in0.038 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032, inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in , 0.035 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in0.038 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 240 300 cm long· should be available as straight & j shaped tip , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.035 inches size· should be between 240 300 cm long· should be available as straight & j shaped tip , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 240 300 cm long· should be available as straight & j shaped tip , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved·should be available in0.035 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 120 300 cm long , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in0.038 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long , radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.025inchessize· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 150 180 cm long , radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in0.032, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 150 180 cm long , radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in0.035 inches size· should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long , radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in0.038 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long , radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.025, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved , radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in0.032 inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved , radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in0.038 inches size·should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved , judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. , judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. , judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. , judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. , judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. , judkins catheter ( jl ) us fda + ce / dgci approved ·leftjudkins catheters in various standard curves and lengths. , judkins catheter ( jl ) us fda + ce / dgci approved ·leftjudkins catheters in various standard curves and lengths. , judkins catheter ( jl ) us fda + ce / dgci approved ·leftjudkins catheters in various standard curves and lengths. , judkins catheter ( jl ) us fda + ce / dgci approved ·leftjudkins catheters in various standard curves and lengths. , judkins catheter ( jl ) us fda + ce / dgci approved ·leftjudkins catheters in various standard curves and lengths. , judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. , judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. , judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. , judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. , judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. , multipurpose catheterus fda + ce / dgci approvedmultipurpose catheters in various standard curves and lengths. , multipurpose catheterus fda + ce / dgci approvedmultipurpose catheters in various standard curves and lengths. , multipurpose catheterus fda + ce / dgci approvedmultipurpose catheters in various standard curves and lengths. , multipurpose catheterus fda + ce / dgci approvedmultipurpose catheters in various standard curves and lengths. , multipurpose catheterus fda + ce / dgci approvedmultipurpose catheters in various standard curves and lengths. , amplatz catheterus fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approvedamplatz right ( ar ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approvedamplatz right ( ar ) catheter in various standard curves and lengths. · , amplatz catheterus fda + ce / dgci approvedamplatz right ( ar ) catheter in various standard curves and lengths. · , internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. , internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. , internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. , internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. , internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. , by pass graft catheterus fda + ce / dgci approved, in various standard curves and lengths. , by pass graft catheterus fda + ce / dgci approved, in various standard curves and lengths. , by pass graft catheterus fda + ce / dgci approved, in various standard curves and lengths. , by pass graft catheterus fda + ce / dgci approved, in various standard curves and lengths. , by pass graft catheterus fda + ce / dgci approved, in various standard curves and lengths. , transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · , transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · , transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · , transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · , transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · , nih catheterus fda + ce / dgci approved ·in various standard curves and lengths. , nih catheterus fda + ce / dgci approved ·in various standard curves and lengths. , nih catheterus fda + ce / dgci approved ·in various standard curves and lengths. , nih catheterus fda + ce / dgci approved ·in various standard curves and lengths. , nih catheterus fda + ce / dgci approved ·in various standard curves and lengths. , cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. , cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. , cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. , cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. , cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. , introducer sheaths for pediatric use ( size 4 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion , introducer sheaths for pediatric use ( size 5 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion , introducer sheaths for pediatric use ( size 6 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion , judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved , judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved , judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved , special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved , special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved , special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved , angiographic double leumen tracking catheter us fda + ce / dgci approved , angiographic double leumen tracking catheter us fda + ce / dgci approved , angiographic double leumen tracking catheter us fda + ce / dgci approved , 3 ‘french’ diagnostic catheters for neonatal use us fda + ce / dgci approved· pigtail, judkins, multipurpose, cobra and other diagnostic catheters of 3 fr. size·varying lengths and shapes , swan ganz catheter us fda + ce / dgci approved , swan ganz catheter us fda + ce / dgci approved , balloon tipped angiography catheter us fda + ce / dgci approved , balloon tipped angiography catheter us fda + ce / dgci approved , balloon tipped angiography catheter us fda + ce / dgci approved , berman catheter us fda + ce / dgci approved· sizes· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth , berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth , berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth , berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth , reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire , reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire , reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire , reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire , arterial pressure monitor lines ( 100 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. , arterial pressure monitor lines ( 150 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. , arterial pressure monitor lines ( 200 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight long introducer sheath with hydrophilic introducer guide wireus fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatiblewith radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved more than60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port.with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip , straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible with radio opaque tip , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 4f size with the largest id· should have lengths ranging from 40 110 cm , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 5f size with the largest id· should have lengths ranging from 40 110 cm , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 6f size with the largest id· should have lengths ranging from 40 110 cm , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 7 f size with the largest id· should have lengths ranging from 40 110 cm , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 8 f size with the largest id· should have lengths ranging from 40 110 cm , long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in9 f size with the largest id· should have lengths ranging from 40 110 cm , mullin’s sheath for special dilation us fda + ce / dgci approvedshould be in septal puncture needle should be in 6fseptal puncture needle , angio.kit / ptca kit ( 3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce / approved , micro catheter for super selective catherization usfda / ce approved , micro catheter for super selective catherization usfda / ce approved , micro catheter for super selective catherization usfda / ce approved , micro catheter for super selective catherization usfda / ce approved , multi side port catheter infusion for catheter directed thromobolysis usa / fda / ce approved , clot retrieval sheath usa / fda / ce approved aspiration catheter 16 fincluding flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm , clot retrieval sheath usa / fda / ce approved aspiration catheter 20 fincluding flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm , clot retrieval sheath usa / fda / ce approved aspiration catheter 24 fincluding flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm , loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved , loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved , loadable microsphere for embolisation of tumoursuper absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved , pcd set puncture needle 18g, 0.035, j stiff stiff wire 0.035 / 80 cm , dilator set , pig tail / malecot catheter 8 24f , ring biliary catheter usa / fda / ce approvedcatheter 8.5 f / 10 / 3 compatible 0.038 length~40 cm , catheter side ports 32 , side port segment length 8 cm , catheter introducer, stiffening cannula , secured device , venaseal closure system for varicose veins usa / fda approved n butyl based adhesive formation 50 / 90 / 105 / 120 cm 145 cm ( 3 / 4 / 6 / 8 f , 014 / 0.35 compatible , liver access and biopsy needle set usa / fda approved usa / fda approved18g / 60 cm biopsy needle , 14 g cannula / 53.5 cm length sheath 7f , tran jugular intrahepatic porto sytemic shunt ( tips set ) intoducer 10f / 40 cm , toclar diameter 0.038 legth60 cm , cannula 14 g / 51.5 cm , percutaneous gastrostomy balloon retention tube set catheter 12 20 f, length 10 cm , balloon 5 20 ml , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm.should have sharp beveled trocar.should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. withcompatible disposable coaxial needle:should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar for risk free penetration option. should be available in gauze size 13, 15, 17, 19 with different length size cm 7.8, 13.8. usfda / ce approved , breast nodule localizationwire should have curved locking element that provide superior migration resistance. the localization wire can be repositioned or removed after placement if required. usfda / ce approved , disposable semi automatic core biopsy instrument with compatible coaxial needle. should be available with dual penetration throw of 10 and 20mm in single instrument. should be available with fire ready indicator. should be available with compatible coaxial needle set with a blunt tip needle & trocar needle. should be usfda approved. , ultra clipdisposable breast tissue marker should be available in coil shape & ribbon shape. should have color coded dual triggers identify different marker shape. should be visible in ultrasound, mri, mammography imaging. should be available in needle size of 17 gauge. should be available in coil shape and ribbon shape. , bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verification marking should be available in 8, 11, 13 gauze usfda / ce approved , bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved , bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved , silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , silicone foleys catheterwith three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) , cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer and divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. should have the manual cutting mechanism. and it should have including 7mm cutting and coag with usfda . , cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. should have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfda . , cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees ; multifunctional laparoscopic device for tissue fusion.and its should have including 7mm cutting and coag with usfda . , cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries with instrument length between 18 19cm and electrode length between 16 17cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. , cutting &coagulations device with tissue fusion ligasuretechnologyhave36mm jaw length, 180 degree rotatable instrument with curved blade for large volume tissue. should have the manual cutting mechanism. , cutting &coagulations device with tissue fusion ligasuretechnologyhave vessel sealing instrument for open surgeries withreusable clamp length between 16 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag with usfda . , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot , long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade , long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade , long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade , long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade , transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property , transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property , transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property , transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property , transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property , non fibre optic single use adult scopechannel width :2.2 mm insertion tube diameter:5.0mm. working length:600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view : 0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :6 mm illumination method :led complete system should be us fda and european ce certified , multi vent mask pediatric, multi vent mask pediatric, air entrainment masks, must be safe, simple delivery of variable oxygen concentrations. each mask to includes color coded diluters: green for low concentration, white for medium concentration. locking ring to secure flow setting. must include adaptor for high humidity entrainment. complete kit with 7 ft oxygen tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. , incentive spirometerincentive spirometer with wide flow range between 200 cc / sec and 1200 cc / sec. must have dual chamber design to help create constant resistance that lifts ball when patient maintains inspiration equal to selected adjustable flow setting & clearly marked flow settings for easy monitoring. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification , closed suction catheter mdi porthas isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. , closed suction catheter mdi porthas isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. , closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. , closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. , fenestrated tracheostomy tube cuffed with 2 inner cannula, inner cannula should reduce the id by 1mm of tracheostomy tube one inner cannula is with five fenestration holes and one is without fenestration , multifocal iolbiconvex, single piece designoptic size 6 mm, overall 12 13 mm sizetwo haptics, modified cuv blocking capability360 degrees square edge, sterile packingfoldable lens with insertion via injector, should able to insert in sub 2.8 m.msterile disposable injector with cartridge along with each iolinjector should be of good quality with smooth injection without damaging ioldiopters required +16 to +25 ddiffractive multifocal design with +3 to +4 dioptre additionshould be iso or ce certifiedmanufacturer should be asked to supply samples for approval3 piece feldable 11 28 d , glaucoma drainage implant ( valved ) with silicon tubeadult , glaucoma drainage implant ( valved ) with silicon tube paediatric , eye sphere implantsimplantable gradepmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter , eye sphere implantsimplantable gradepmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter , eye sphere implantsimplantable gradepmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter , eye sphere implantsimplantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter , eye sphere implantsimplantable gradepmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter , eye sphere implantsimplantable grade siliconesphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter , eye sphere implantsimplantable grade siliconesphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter , eye sphere implantsimplantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter , eye sphere implantsimplantable grade siliconesphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter , eye sphere implantsimplantable grade siliconesphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter , monocanalicular self retaining silicone stent for canalicular repair medical graded silicone implant forreconstructing traumaticcanalicular lacerations.silicone rod length40mm, silicone rod diameter 0.64 mm , lacrimal intubation set for dcr surgery – bicanalicular lacrimal intubation set comprised oftwo flexible stainless steel probes attached through a hollow medicaltube which is used in conventional dcr procedure. probe length probe diameter silicon tube length silicon tube idsilicon tube od 11 cm 0.60 mm ( 23g ) 30 cm 0.30 mm 0.64 mm , scleral fixiated intraoccular lense having multifoccal toric , three piece foldable intraoccular lense , vibratory pep therapy device for pead . patients , deliver airflow vibrations to the patients from 5 30 hzexpiratory resistance / frequency dial to allow therapy to be adjusted to patientss needs , tracheostomy tube cuffed with sub glotic suction line and with 2 inner cannula kit, inner cannula should reduce the id by 1mm of tracheostomy tube , dry lithium heparin pre filled abg syringe with airremoval filter cap 1ml , dry lithium heparin pre filled abg syringe with airremoval filter cap 3ml , epidural and spinal needle kit 16 / 18g should have needle to needle technique without backeye on epidural needle with lenght of 8cm . should have locking mechanism with graduation marking on hub of epidural needle and pencil point spinal needle , should have the marking on the epidural needle with 1 cm distance and marking should starts from 3 cm distance from the tip of the epidural needle . , epidural kit with epidural needle marking starts from 3cm from the tip and catheter fixation device with locking mechanism 16 / 18g , central line triple lumen with y needle and nitinol guide wire 8.5 fr with 16cm / 20cm catheter with tecoflex material , central line quadra lumen with y needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material , central line quadra lumen with straight needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material , peripherally inserted central line for high flow / power injection sterile made of polyurethane single 55 cm long, 5 french single, double and triple lumen made of polyutherane with guide wire & microintroducer. should deliever infusion at 5 ml / sec rate and have reverse taper hub to provide kink resitance. introducer needle of 21 g. and used for power injection & monitoring cvp . , latex folley balloon catheter , latex folley balloon catheter , ryle’s tube , ryle’s tube , post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved , post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved , post operative surgical cover dressingshydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved , 2 pcs flat base ostomy body fit60 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm, elastic tape in semi circular shape with hydrocolloid adhesive for extra security of base plate. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd sizebelt compatible for bags having 4 ear hooks , 2 pcs flat base ostomy body fit 70 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm.adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd sizebelt compatible for bags having 4 ear hooks , 2 pcs convex base ostomy body fit60 mm kittwo piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm.adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) neutral grey colour standerd sizebelt compatible for bags having 4 ear hooks , 2 pcs convex base ostomybody fit70 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm.adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd sizebelt compatible for bags having 4 ear hooks , 1 pcs trasnparent colostomy body fit60mm kit one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm.adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , 2 pcs flat base ostomy body fit bag 60 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm , 2 pcs flat base ostomy body fit bag 70 mm2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. , 2 pcs convex base ostomy body fit bag 60 mmtwo piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. , 2 pcs convex base ostomybody fit bag 70 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. , 1 pcs trasnparent colostomy body fit bag 60mmone piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus 0.34 n / mm ) , bag consists one barrier foil and a oecotex certifiedwater repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. , non fibre optic single use large scopechannel width :2.8mm insertion tube diameter:5.8 mm. working length:600 mm bending range :180 degree up & 160 degree down field of view:85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia:7 mm illumination method :led complete system should be us fda and european ce certified. , antimicrobial silver dresssingsterilenon occulusive woundcontact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) , antimicrobial silver dresssingsterilenon occulusive woundcontact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) , non fibre optic single use cysto scope for djr & diagnosticcystoscope it should be capable of easy navigation and fast identification of anatomical landmarks the scopes should be sterile packed one cmos camera and two led light source should be integrated at the distal end minimum length of the scope should be 380 400mm working channel should be of 6.5 6.6 fr the control lever on handle for the movement of distal tip up & down in a single plane with 210 degree up and 120 degree down , non fibre optic single use paediatrics scope channel width :1.2mm insertion tube diameter:3.8 mm. working length :600 mm bending range:180 degree up & 180 degree down field of view :85 degree or more direction of view:0 degree ( forward view ) depth of field:8 50 mm or better minimum ett inner dia :5 mm illumination method :led complete system should be us fda and european ce certified. , sterile self adherent with lipido colloid technologysterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technologysterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technologysterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technology sterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technology sterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technologysterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , sterile self adherent with lipido colloid technologysterile self adherentpatented tlc matrix ( lipido colloid technology ) wound contact layer combined withabsorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. , 100% polysiloxane based scar management in gel form pure poly siloxane based silicone scar management product in sheet form ( we also should mention about the 100% poly siloxane and nylon polyamide mesh ) , triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. , triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. , triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. , drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure , drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure , drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure , sulu stepped cartridges for variable tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 60mm inner to outer side 3.0, 3.5 and 4.0 mm , purplecolour code, usfda approved , sulu stepped cartridges for variable tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 60mm inner to outer side 3.0, 3.5 and 4.0 mm , purplecolour code, usfda approved , titanium total ossocular replacement prosthesis ( torp ) , titanium partial ossocular replacement prosthesis ( porp ) , pistontitanium ( 0.4mm ) diameter , pistontitanium ( 0.4mm ) diameter , pistontitanium ( 0.4mm ) diameter , pistontitanium ( 0.4mm ) diameter , pistontitanium ( 0.6mm ) diameter , pistontitanium ( 0.6mm ) diameter , pistontitanium ( 0.6mm ) diameter , pistontitanium ( 0.6mm ) diameter , piston titanium teflon mix ( 0.4mm ) diameter , piston titanium teflon mix ( 0.4mm ) diameter , piston titanium teflon mix ( 0.4mm ) diameter , piston titanium teflon mix ( 0.4mm ) diameter , piston titanium teflon mix ( 0.6mm ) diameter , piston titanium teflon mix ( 0.6mm ) diameter , piston titanium teflon mix ( 0.6mm ) diameter , piston titanium teflon mix ( 0.6mm ) diameter , piston teflon ( ptfe ) ( 0.4mm ) diameter , piston teflon ( ptfe ) ( 0.4mm ) diameter , piston teflon ( ptfe ) ( 0.4mm ) diameter , piston teflon ( ptfe ) ( 0.4mm ) diameter , piston teflon ( ptfe ) ( 0.6mm ) diameter , piston teflon ( ptfe ) ( 0.6mm ) diameter , piston teflon ( ptfe ) ( 0.6mm ) diameter , piston teflon ( ptfe ) ( 0.6mm ) diameter , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.5 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.6 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting / 0.8 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 1.6 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.3 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.8 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3.5 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 4 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 5 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.5 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.6 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond / 0.8 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 1.6 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.3 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.8 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3.5 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 4 mm , burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 5 mm , burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 1 mm , burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 3, mm , burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 5 mm , sialestic sheet 55*75 mm and thickness 0.5 mm , ear pack / wick ( 12*24 mm length ) , t tube ( silicone ) 9 mm length , nasal haemostatic sponge pack with out airway 8 inch , nasal haemostatic sponge pack with out airway 10 inch , nasal haemostatic sponge pack ( with airway ) 8 inch , tracheostomy tube ( pvc material ) double lumen 3.5 8mm all size , tracheostomy tube ( pvc material ) fenestrated 3.5 8mm all size , femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes , femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes , femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes , femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes , femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes , diagnostic catheter ar 1 aka amplatz right , diagnostic catheter ar 1 aka amplatz right , diagnostic catheter vert angled tip 125cm , diagnostic catheter sim 1 aka simmon’s , diagnostic catheter sim 1 aka simmon’s , diagnostic catheter sim 2 aka simmon , diagnostic catheter sim 3 aka simmon , diagnostic catheter h 1 aka headhunter , diagnostic catheter pigtail , guide wire hydrophilic coated angled tip soft regular standard , guide wire hydrophilic coated angled tip extra stiff , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes , guiding catheter braided guiding catheter in various shapes , guiding catheter balloon tipped guiding catheter size , distal access catheter , distal access catheter , intracranial support catheter with flat soft distal segment , intracranial support catheter with flat soft distal segment , flexometlic tube 3 8.5 with stylet reinforce et tube with wiring from tip to endit should be approved by *us fda , act tubesus fda + ce / dgci approved· disposable act tubes compatible with existing medtronic machines at smsh· should meet highest medical industrial standards· quality certification should be provided from authorized agencies. , high – presure injector lines us fda + ce / dgci approved· should be available in various lengths· should have male and female luer locks· should be transparent and kink resistant· should be able to take high pressure of angiographic injections , disposable transducers for invasive pressure monitoring compatible with available system in cath lab in smshus fda + ce / dgci approved· disposable transducers for invasive pressure monitoring· should be compatible with available system in cath lab ( iabp – data scope & cath lab transducer ) and iccu at smsh· should meet highest medical industrial standards· quality certification should be provided form authorized agencies , renal double curve catheter us fda + ce / dgci approved· , simmons / sidewinder catheter us fda + ce / dgci approved· , vertebral catheter , coeliac axis catheter us fda + ce / dgci approved· , shepherd’s hook catheter us fda + ce / dgci approved· , vtk diagnostic catheter us fda + ce / dgci approved· , angiographic sizing pigtail catheter 5fr us fda + ce / dgci approved , angiographic sizing pigtail catheter 6fr us fda + ce / dgci approved , angiographic sizing pigtail catheter 7fr us fda + ce / dgci approved , balloon inflation catheter for brtousa / fda / ce approved 9 / 10 f 0.035 compatible , length100 / 120 cm , max volume 30 / 40 cc , dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , multirate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate from 1 7 / hr and 2 14ml / hr , single rateelastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate of 2, 5, 8, 10ml / hr , pct kit with griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce , pct kit without griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce , double lumen closed suction set for et and tt , with mdi adopter , trach wedge , swiel connector and with reservoir , et tube with yellow subglotic suction line with inverted and soft seal cuff. with usfda / european ce , tt tube with yellow sub glotic suction line with inverted and soft seal cuff. with usfda / european ce , catheter stabilization device sterile latex free sutureless with sliding post , titanium maxillofacial fracture fixation miniplate 2.5 mm , titanium maxillofacial fracture fixation miniplate 2.5 mm , titanium maxillofacial fracture fixation miniplate 2.0 mm , titanium maxillofacial fracture fixation miniplate 2.0 mm , titanium maxillofacial fracture fixation miniplate 2.0 mm , titanium maxillofacial fracture fixation miniplate 2.0 mm , titanium maxillofacial fracture fixation miniplate 1.5 mm , titanium maxillofacial fracture fixation miniplate 1.5 mm , titanium maxillofacial fracture fixation miniplate 1.5 mm , titanium maxillofacial fracture fixation miniplate 1.5 mm , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate , titanium maxillofacial fracture fixation miniplate 1.5 mm c plate , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side , titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side , titanium maxillofacial fracture fixation miniplate 2.0 mm l plate right and left side , titanium maxillofacial fracture fixation screws 1.5 mm , titanium maxillofacial fracture fixation screws 2.0 mm , titanium maxillofacial fracture fixation screws 2.0 mm , titanium maxillofacial fracture fixation screws 2.5 mm , titanium maxillofacial fracture fixation screws 2.5 mm , titanium maxillofacial fracture fixation screws 2.5 mm , abdominal suction set , arterial line , av blood line , av fistula needle 16g , av fistula needle 17g , baby diaper small size for infents , bain circuit adult , bain circuit ped. , bains circuit paediatric / adult , bipolar prosthesis set , calcanum plate all size , ccs screw 4 mm, 6mm, 5mm , chest drainage catheter ( i.c.d. ) ( thoracic catheter ) size : fg: 16, 20, 24, 28, 32, 36 & 40. , chlorhexidine inpregnade paraffin gauze 10x10 , chlorhexidine inpregnade paraffin gauze 30x10 , chlorhexidine inpregnade paraffin gauze roll , clavical plate all size , close circuit , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, ( all size ) , creep bandage 10 inch , creep bandage 2 inch , creep bandage 4 inch , creep bandage 6 inch , diaper adult ( s / m / l ) , distal femur plate all size , distal humerus ( posterial & medial ) plate all size , distal humerus extra artecuilar plate all size ( right & left ) , distal radius t / oblique plate all size , distal tebia medial plate all size , dynamic hip screw size 80 to 110with plate long barrer & short barrer all size , endres nail 2.5 mm , endres nail 3 mm , endres nail 3.5 mm , endres nail 4 mm , endres nail 4.5 mm , febulla tubualar plate all size , femur nail no. 9 / 32 , femur nail no. 9 / 34 , femur nail no.9 / 36 , femur nail no. 9 / 38 , femur nail no. 9 / 40 , femur nail no. 9 / 42 , femur nail no. 10 / 32 , femur nail no.10 / 34 , femur nail no. 10 / 36 , femur nail no. 10 / 38 , femur nail no.10 / 40 , femur nail no. 10 / 42 , femur nail no. 11 / 32 , femur nail no. 11 / 34 , femur nail no. 11 / 36 , femur nail no. 11 / 38 , femur nail no.11 / 40 , femur nail no.11 / 42 , femur nail no. 12 / 32 , femur nail no.12 / 34 , femur nail no.12 / 36 , femur nail no. 12 / 38, , femur nail no.12 / 40 , femur nail no.12 / 42 , fistula needle 16 g , fixator set , gudel airway , hook plate all size , humerus nail all size , i / l femur nail set , i / l tibile nail with bolt set , knee cap , lignocain 10 % spray , locking plateall size , merocel nasal pack , needle ( all size 14 to 27 g ) , pedicle screw titanium with set all size , poteriomedial proximal tebia plate all size , proximal femur nail long & short no. 9 / 32 , proximal femur nail long & short no. 9 / 34 , proximal femur nail long & short no. 9 / 36 , proximal femur nail long & short no. 9 / 38 , proximal femur nail long & short no. 9 / 40 , proximal femur nail long & short no. 9 / 42 , proximal femur nail long & short no. 10 / 32 , proximal femur nail long & short no. 10 / 34 , proximal femur nail long & short no. 10 / 36 , proximal femur nail long & short no. 10 / 38 , proximal femur nail long & short no. 10 / 40 , proximal femur nail long & short no. 10 / 42 , proximal femur nail long & short no. 11 / 32 , proximal femur nail long & short no.11 / 34 , proximal femur nail long & short no. 11 / 36 , proximal femur nail long & short no. 11 / 38 , proximal femur nail long & short no. 11 / 40 , proximal femur nail long & short no. 11 / 42 , proximal femur nail long & short no. 29 / 25 , proximal femur nail long & short no. 10 / 25 , proximal femur nail long & short no. 11 / 25 , proximal femur nail long & short no. 12 / 25 , proximal hocky plate set , proximal humerus plate all size , proximal tebia t plate all size , raft plate ( right & left ) all size , recon plate all size , spine feusion cage all size , square nail 2 mm , square nail 2.5mm , square nail 3 mm , square nail 3.5mm , tibia nail & femur nail no. 8 / 28 , tibia nail & femur nail no. 8 / 30 , tibia nail & femur nail no. 8 / 32 , tibia nail & femur nail no. 8 / 34 , tibia nail & femur nail no. 8 / 36 , tibia nail & femur nail no. 8 / 38 , tibia nail & femur nail no. 9 / 28 , tibia nail & femur nail no. 9 / 30 , tibia nail & femur nail no. 9 / 32 , tibia nail & femur nail no. 9 / 34 , tibia nail & femur nail no. 9 / 36 , tibia nail & femur nail no. 9 / 38 , tibia nail & femur nail no. 10 / 28 , tibia nail & femur nail no. 10 / 30 , tibia nail & femur nail no. 10 / 32 , tibia nail & femur nail no. 10 / 36 , tibia nail & femur nail no. 10 / 38 , tibia nail & femur nail no. 11 / 28 , tibia nail & femur nail no. 11 / 30 , tibia nail & femur nail no. 11 / 32 , tibia nail & femur nail no. 11 / 34 , tibia nail & femur nail no. 11 / 36 , tibia nail & femur nail no. 11 / 38 , absorbent cotton 500gm...

Medical And Health Services - Rajasthan

34166615 supply of lab items uric acid kit serum c.r.p kit serum amylase kit serum l.d.h. kit s. ck nac kit s. ck mb kit cholesterol kit seru triglyceride kit 19 20 fidl kit direct and precipitant 130t71 method s. electrolyte kit 21 22 erba wash cleaner micropipetie 0 50m1crolitre, 1 11111e glass 75x 12 witii rim 31 mt ii:1 istix 32 i justin alit, sugar 3? 11:s1 t1.1111: stand plasi ic 34 tim 111111? srand ai 1.1minium 35 tis1 111141, . ( il ass 100x12 mm 36 patter role 1:1 ) 11. eli ci roi n:11: maciiine 37 tes1 11111e with cap 12x75r1m 3k iii .11 it pappi it 39 di avkad marker pi ncil 40 1i55111. papper soef 41 pastel :r pipette 42 glacial. aci tic acid 1% 43 serum lipase kit 44 ggt kit 45 eletroly1e kit flud pack na+ / k , cl• 800ml, item code il 212id daily cleaning solution kit item codien1e 211w 5211 / 411, printer papper roil item code 25410 46 ptiinit stago start 4 machine pt regent neoplaspine papper rim i x10 ( 110 mm ) cuve1te i x100 steel bali. i x100 47 swine flu 48 micropro } ein 49 isopropyl. alcopial 50 vi stag ( ) 51 coagulation control 52 finntips for start i anti a monoclonal 2 anti b monoclonal 3 anti ab monoclonal 4 anti d igm + igg monoclonal antibody 5 anti h lectin 6 anti al lectin 7 anti human serum ( coombs anti sera ) 8 22% bovine albumin 9 anti d ign1 monoclonal anti body 10 glass slides 11 normal saline malaria card antigen, and antibody 1 dengue card ns 1 3 4 5 6 7 s 9 10 11 12 13 14 15 16 17 18 19 widal slide test card hiv rapid test card vdrl rapid test card rheumatoid factor test card kit aslo kit hbsag rapid card test urine pregnancy test card elisa kit for dengue elisa kit for scrub typhus elisa kit for chickenguniya card for scrub typhous widal test card; kit vtm kit ppe suit face mask dengue combi pack rapid + ns1+igm crp kit 20 ichickenguniya rapid igisdl 21 ibenedicts reagent 22 33% sulfosalicylic acid 23 hydrogen peroxide spirit lamp test tube 4 crp latex agglutination card csf fluid protein kit hand wash liquid vdrl test strip sodium hypochloride 5% giemsa stain reticulocute stain 1111.1 ) stain a field spain ii 5 hematoxyl1n stain 6 eosin stain ____ 7 rapid pap s fain 8 urine container 9 sputum container 10 pasteur pipette ii ed1a via!. k3 12 plain vial vacuutainer double cap 13 pt vial ( na+ citrate ) 14 cotton roll 15 fnac gun 16 1413 cuvette 301 17 semen diluting fluid 18 disposable esr tube 19 capillary tube for bt ct 20 tincture iodine 21 spirit 22 methanol 23 m ) 24 horiba cbc abx 20 liter 25 cleaner i liter 26 lyse i liter 27 m1noclair 500ml 28 black top vial ( e.5.11 ) 29 grey top vial ( gluestinestion ) 30 cbc five part sfri diluint 20 liter • 31 cleaner 10 liter 32 sheath 10 liter 33 lysoglobulin 500ml 34 cover slip for improved neubeaur 35 improved neui3eaur chamber silver . coated 36 test kit for occult blood stool 37 n / i 0 hcl 38 tourniquet 39 slides box 40 glass slide stand 41 microscope lens cleaner 1$ 011. i or olt, immursion !ins stip ( ovia 41 44 . 4, 46 ( oplin ) , 111 „....„.. i m 111111 wilt di i .1 , i ino 11.111 ) 47 riec dii 1 jim, fluid 0 ..... rstri soii i al c1tra1 i. ...._ a 49 iii 11.12 pa iipi.r 50 1% ( ar1101. !.! sciiin 51 25% si il imf ric acid 52 ion wily l i• blue 53 imu ;sill ior 4 i eaning or i i ni• i imic 54 1.1oui1 ) parawn 55 ?vinyl 56 microscopi be 1 b 20m, 57 nisrosam i. nt edle . 22 no 5s u.s1 ri1nt i 5n11. 59 d.s1 1211nici leivil 60 d.svri1n..i 21, n1l 61 gloves ( .5 62 gloves 7 63 gloves 7.5 64 tec solution 65 paper for h13 test 65 ili% sodium hypoci lome 67 rtaptt kit 68 stop watc11 69 x ylene 70 non tooth forcep 71 113 mission cuvette strip 72 h3 tube 73 sulphur powder 74 sticker for slides small 75 sticker for tedt tube mediun1 76 marker pen black 77 esr tube glass 78 dpx 79 blood bag 350m1. cpu a 80 blood transfer bag 350 91. 81 hiv test kli tridot 82 bleaciiing powder 83 lit mus paper 84 marker pan ( cd marker ) 85 n 95 disposable mask 86 nickmominuti digital fortemperature recording in reirig1 ( a1010 87 wi1atsman paper for a1.1. size 88 disposable needle no. 14, 16, 18 99 platelet count solution 90 glass mari: i ni; pencil 1 latex agglutination slide test for screening oft gondii 2 enzymatic / fixed 11me kinetic assay for ada determination 3 adenosine deaminase acitivity in serum, plasma biological fluid 4 latex agglutination inhibition slide test for detection of microalbuminaria in urine 5 cystatin c kit 6 plasma d dimer card test kit 7 rapid test hcv test kit 8 rapid test for psa kit 9 rapid test cea kit 10 rapid test afp kit 11 rapid test troponin i 12 logols iodine 13 bouins fixative 14 buffered fomalin 10% 15 hb al, c test kit 16 rh antibody titre 17 h pylori kit 1 latex agglutination slide test for screening of t gondii 2 enzymatic / fixed time kinetic assay for ada determination 3 adenosine deaminase acitivity in serum, plasma biological fluid 4 latex agglutination inhibition slide test for detection of microalbuminaria in urine 5 cystatin c kit 6 plasma d dimer card test kit 7 rapid test hcv test kit 8 rapid test for psa kit 9 rapid test cea kit 10 rapid test afp kit 11 rapid test troponin i 12 logols iodine 13 bouins fixative 14 buffered fomalin 10% 15 hb a1, c test kit 16 rh antibody titre 17 h pylori kit...

Sawai Man Singh Medical College - Rajasthan

34121915 tender for supply of surgical disposable and consumable , ready to use hypotonic irrigation solution npwt 500 ml , • neutral ph • safely preserved • solution with shelf life of 24 months after manufacturing and €60 days after opening• gel with shelf life of 18 months after manufacturing and 90€ days after opening • can be warmed to body temperature before usage • non cytotoxic and non irritating • ready to use • eases the loosening of crusted wound dressings • can be combined with granulox® • does not require neutralisation or rinsing off npwt 1000 ml , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) [ s120 ] , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) [ s123 ] , a reliable wound irrigation solution. hocl prevents the proliferation of gram+ and gram bacteria including; mrsa, gel 100 g , abdominal belt , abdominal drain kitno 22 , abdominal drain kit ( with collection bag 2000 ml size 24 , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 , absorbent cotton wool 500 gm , active ingredients: naocl / hocl ( 1000ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 250ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 500ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , active ingredients: naocl / hocl ( 50ml ) shelf life: 2 years sterilization method: non sterile packing information: the solution is filled in a pet bottle. there is a hanging label ( material: pehd ) on the bottle. on top of the bottle there is a plastic lid with 2 holes and a blue ov ring ( material: pp [ blue ] , pe [ white ] , tpe, pp ) . the lid of the bottle has got a sealing closure ( material: pe foil ) on top. 6 bottles come into a corrugated cardboard box as a trader unit and a leaflet for every bottle is also in the trader unit. it is an irrigation solution for cleansing and moisturising acute, chronic and contaminated wounds as well , adhesive paper tape with cutter 1 , adhesive paper tape with cutter 2 , adhesive paper tape with cutter 3 , adhesive silk tape1 / 2 , adhesive silk tape 1 , amboo bag 2 ltr. , anti microbial gloves , antimicrobial five layered highly absorbent foam dressing with activated carbon and sliver content 1.2mg / cm2, active release for 168hrs ( 7 days ) with self adherent borders and with soft silicone wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyethylene / polyester fibres, with acquisition and spreading layer made up of polyurethane silver foam, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 10x25 cm , antimicrobial five layered highly absorbent foam dressing with activated carbon and sliver content 1.2mg / cm2, active release for 168hrs ( 7 days ) with self adherent borders and with soft silicone wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyethylene / polyester fibres, with acquisition and spreading layer made up of polyurethane silver foam, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 10x30 cm , apple hunt trocar : should be single use sterile trocars, have side port , two cannula & one trocar , 5 mm & 10 mm trocar with pyramidal tip, ergonomic design , fascia anchoring thread should be usfda / ce approved , aprin plastic , asepto syringe with bulb 60 ml , auto clave lable , b.p. instrument ( digital ) , b.p. instrument ( marcurial ) , babykit ( cloth set for new bourn babies in summer use ) , babykit ( cloth set for new bourn babies in winter use ) , bain circuit for adult , bain circuit for neonatal , bakri postparyurnballoon catheter 100 % silicone, fda 510 clearance , band aid ( water proof ) long , band add long 0.5 inch , band add long 2inch , band add round , bed paan plastic , bed protective plastic sheet disposables size 120x210cm , biological glue with thrombin & aprotinin 2ml , blood administration set blood transfusion set , blood lancet pack of 100 pcs ( fill 100 pcs rate in boq ) , bp bulb with mattle scruw , bp cuff ruber , breast pump , cannula fixer , care handloom guaze pad ( sanitary pad ) pkt. of 10 pcc , carter thomason port closure : should be carter thomson type port closure system, have pilot guide and suture passer separately, able to use for trocar defects of 5mm 15mm, suture guide holes should be 180 degree access across each other’s, single use , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material , ceasarian drape sheet , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , central line triple lumen 8.5 fr with 16cm / 20cm catheter , chlorhexidine impregnated paraffin roll 15 cm x 1 , close suction system adult fr 14 , close suction system size 2.5 , close suction system size 3.0 , close suction system size 3.5 , close wound drainage device under negative pressure ( closed wound suction unit ) no. 12 , close wound drainage device under negative pressure ( closed wound suction unit ) no. 14 , closed suction catheter for paediatrics 6fr , cmg line ( central venus canula ) 45 cm + 70 cm 14 / 16 g , combined spinal epidural set 16g , combined spinal epidural set 18g , connecting cable for ultrasonic harmonic scalpel for lap energy with ace plus shear hp054 , connecting cable for ultrasonic harmonic scalpel for open energy with focus plus shear hp blue , cotton crepe bandage bp 6 cm x 4 m , cotton crepe bandage bp 8cm x 4 m , cotton crepe bandage bp 10cm x 4m , cotton roll 300 gm , culture plate , culture swab , culture vial , dead body bag , delivery kit ( disposable ) , diapers ( size adult ) pkt of 5 pcs. , diapers ( size neonate onwards ) pkt. of 5 pcs. , disposable laparoscopic clip applier with 16 clips, 5mm diameter , disposable needle18g. , disposable needle 21 g. , disposable needle 23 g. , disposable spo2 sensor , disposable syringe with needle1 ml. , dry lithium heparin pre filled abg syringe with air removal filter cap 1ml , dry lithium heparin pre filled abg syringe with air removal filter cap 3ml , dura pore 1 ( 2 to 3cm ) , dura pore 1 / 2 ( 1 to 2 cm ) , e.c.g. electrodes ( neonate ) , ecg electrode ( detail in rc ) [ s104 ] , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ) , electric suction machine , endoservical brush ( pep smea kit ) , endotracheal tube, cuff size 4.5mm , endotracheal tube, cuff size 5mm , endotracheal tube, cuff size 6mm , endotracheal tube, cuff size 7mm , endotracheal tube, cuff size 7.5 mm , endotracheal tube, cuff size 8mm , endotracheal tube, cuff size 8.5mm , endotracheal tube, cuff size 6.5 mm , endotracheal tube, plain size 2.5 mm , endotracheal tube, plain size 3mm , endotracheal tube, plain size 3.5 mm , endotracheal tubes plain size4mm , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile , epimatic lor syringe with precallibarated pressure band , face mask, disposable , five layered absordentfoam dressing with soft silicon saftac technology as wound contact layer with salf adherent borders bacterial and viral barrier water proof poly urethane backing filmsize 10x25 cm , five layered self adhesive absorbent sacral dressing designed for exuding wounds, with soft silicone adhesive wound contact layer, with wound pad absorption layer made up of polyacrylate fibres & polyester fibres, wound pad acquisition layer made up of polyurethane foam & spreading layer made up of non woven viscose polyester, with polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified. usage upto 7 days. size 22x25 cm , flow regulator extension set flow rate 2ml to 350ml per hour , foleys catheter no. 6 , folleys catheter fixation divice 18 to 24 fr , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) isi mark , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) isi mark , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) isi mark , gluco meter strips , hand activated curved taper tip coagulating shears compatible focus 17 , highly compressed silicone dressings for scars, with shower proof backing film made up of polyurethane film, with textile core made up of non woven polyester, with ultra violet protection factor 5. a protective release liner made up of polypropylene film. self adherent soft silicone adhesive technology. size 5x7.5 cm , highly compressed silicone dressings for scars, with shower proof backing film made up of polyurethane film, with textile core made up of non woven polyester, with ultra violet protection factor 5. a protective release liner made up of polypropylene film. self adherent soft silicone adhesive technology. size 10x18 cm , hiv kit , hypochlorous acid ( hocl ) ensures safe preservation and makes granudacyn®gel 50 g .for first and second degree burns. , infant feeding tube size 10fg , infant feeding tube size 5fg , infant feeding tube size 8fg , infusion set with microdrip set, ( i.v. ) sterile disposable [ s13 ] , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn , ionic silver dressings for low to high exuding wounds 10 cms x 10 cms , kellys pad rubber , l.r apron , labour drape set , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade [ , laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade , laproscopic port with trocar , long line intravenousno. 22 , long line intravenousno. 24 , long line intravenousno. 28 , long nipple feading bottle , mackantosh sheetplastic , mackantosh sheet rubber 1 x 2 mtr , manual vacuum aspiration ( mva kit ) , micro cuf et ( all size ) , milex silicon passeries: should be silicon pessary, latex free, pessaries to be available for pelvic organ prolapses and urinary incontinences, with ring, ring with support and ring with knob, etc., available in multiple sizes. should be usfda / ce approved , mucus extractor sterile , n 95 mask disposable , nasal prong seal , nebulization mask adult , nebulization mask paediatric , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent , nonabsorbable polypropylene light weight macroporous mesh , non fibre optic single use adult scope , o.t. dress large ( cotton cloth ) , optically guided bladeless trocar 12mm length 100mm , optically guided bladeless trocar 12mm length 150mm , opu kit , orsa, vrsa, vre, viruses, fungi and spores. gel 250 g , ot icd tray sterilised ot drain tray with trocar drain and dual suction hemlich valveand other component , oxygen mask ( adult ) , oxygen mask ( pediatric ) , oxygen nasal canula for neonates , papain urea & silk protein based wound debriding ointment and cream 50gm , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , patient pre operative skin prepration solution 26 ml , pe coilled extension line for fluid infusion, fda approved 1mm internal diameterlength 100 / 200 / 150cm , pebaby wrap double layer green house gas generating bad with adjustable hud, front velcro and spine support for preterm baby to avoid hypothermia ( size ..s, m, l ) , pe , prssure capacity 40bar, male to female, venous infusion andpressure monitringline, fda approvedlength with 1mm internal diameterus fda approve50 / 100 / 150 / 200 / 10cm , pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) , pediatric epidural set with 22 g soft polyurethane epidural catheter to prevent dura puncture, 19 g touhy needle, .22 micron filter and lor syringe , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposablem. v. set 110` ml ) [ s12 ] , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposablem. v. set 150` ml ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( iv set ) , pipet curette curettes for endometrial sampling should be single use sterile should have centimeter marking the od should be 3mm should have stylet with o ring for easy and safe sampling , plastic jar 1 ltr. , polythine gloves , powered circular stapler 29 mm , ppe kit for covid 19 95 gsm , resuscitation mask for new born : 1. should be anatomical shape ( not circular ) 2. should cover both mouth and nose , rubber examination gloves made of natural rubber latex, non sterile, size large [ , rubber examination gloves, non sterile, extra small , rubber examination gloves, size medium , rubber examination gloves, size small , ryle’s tube 6no , ryle’s tube 8no , ryles tube / nasogastric tube size: 16 , ryles tube / nasogastric tube size: 18 , ryles tube / nasogastric tube size:14 , sanitary napkin beltless , sanitary napkin beltless with wings [ , sanitary pads belt type , see clear: should be able to attach to the side port of trocar, single use latex free, able to remove 99.99% of 0.01 micron particles, dual filter have charcoal & ulpa, max. flow rate 8.0 ltr / min., tubing have 30’’ length should be usfda / ce approved , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film with safetec techology. product should be ce certified. usage upto 7 days. size 10x25 cm , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified with safetec techology.usage upto 7 days. size 10x30 cm , self adhesive multi layered absorbent surgical dressing white color for easy exudate monintoring , soft silicone adhesive wound contact layer for painless dressing change, wound pad absorption layer made up of polyacrylate fibres & polyester fibres& spreading layer made up of polyethylene / polypropylene fibres with high flexibilty of dressing to allow early mobilitywith polyurethane backing film as water, bacterial and viral barrier. a protective release liner made up of polyethylene film. product should be ce certified with safetec techology. usage upto 7 days. size 10x25 cm , sharp container , shoe cover ( plastic ) , shoe covers knee length , sigle rate elastomeric disposable infusion pump with air event end cap for air bubble removal with two micro iv filters in 100ml & 275ml with flow rate of 2, 5, 8, 10ml / hr. , silicon fioley balloon catheter ( bh model ) 16no. , silicone foleys catheter sizes 16fr , silicone foleys catheter sizes 18fr , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*25cm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm , silk reel 1 0 , skin shaving blade ( rezar blade ) , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g [ s15.c ] , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g [ s15.d ] , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g [ s15.b ] , sterile disposable hypodermic needle no. 18x1½ , sterile disposable hypodermic needle no. 21x1½ , sterile disposable hypodermic needle no. 23x1½ , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch , sterile hypodermic syringe with needle attached, 22g, single use 50 ml [ s106 ] , sterile oxidized regenerated cellulose hemostating agent , suction catheter, sterile. size: f g 10 , suction catheter, sterile. size: f g 14 , suction catheter, sterile. size: f g 6 , suction catheter, sterile. size: f g 8 , surgical blade sterile, size 11 , surgical blade sterile, size 22 , surgical cap disposable ( for surgeons ) , surgical cap, disposable ( for nurses ) , surgical gloves 6.5 puncture indicator technology , surgical gloves 7 puncture indicator technology , surgical gloves 7.5 puncture indicator technology , surgical retractors with self retaining retraction should be single use sterile should be available with variety of flexible, articulating shapes appropriate to surgical site should have adjustable hinges for customization should have elastic stay hooks stay hooks should be available with sharp hooks, blunt hooks and blade hooks should have usfda / ce certification , surgical scrub brush spog in 20%chlorhexidine in 15 ml sol of isopropylalcohol and water with nail cleaner , surgical sponge disposable 30 cm x 30 cm 8 layer ( x ray detected ) , surgical sponge disposable 45 cm x 45 cm 8 layer ( x ray detected ) , suthi , synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm , synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable , tegaderm 1 ( 2 two 3 cm ) , thermometer digital , three way adaptor , tur set , umbilical canulano. 4 , umbilical canula no. 5 , umbilical canula no. 6 , umbilical catheter for new born, all sizes , umbilical cord clamp , under pad ( adult ) 60x90cm , urethral catheter 90 ( fg 14 ) made up of medical grade pvc , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml , urine collecting bag, disposable 2000 ml with uroflow meter , urine collecting bag, disposable 2000 ml , urine pot male / female , uterine balloon tamponade* technical specifications should have a balloon capacity of 1000 2000ml should have a reservoir bag of 1000ml capacity height making for pressures of 60, 80, 100 and 120 mmhg are indicated on the tubing by black rings stock valve should be present tubing should be 1.8 m in length , vaccum suction set, 2.5 meter length ( yaunkuar suction set ) [ s109 ] , vaginal swap stick , wet wipes adult pack of 10 pcs , wet wipes baby pack of 40 pcs...

North Western Railway - Rajasthan

34082129 supply of sterile disposable needle size 26gx0.5%u2019%u2019sterile disposable needle size 26gx0.5%u2019%u2019, sterile disposable needle size 26gx0.5?? ( irp_no 80253 as per 80253.0 => limited...

Medical And Health Services - Rajasthan

34045938 rate contract for surgical & sutures for mndy sr. no. drug code drug name packing unit 1 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 2 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 3 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 4 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils 5 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 6 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 7 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 8 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 9 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 10 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 11 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 12 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 13 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 14 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 15 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 16 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 17 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 18 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm rc not exists 19 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 20 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 21 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) rc not exists 22 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 23 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 24 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 25 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 26 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 27 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 28 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 29 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 30 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 31 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 32 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 33 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 rc not exists 34 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 35 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 36 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 37 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 38 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 39 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 40 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 41 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 42 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 43 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 44 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 45 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 46 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 47 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 48 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 49 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 50 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 51 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 52 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 53 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 54 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 55 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) rc not exists 56 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 57 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 58 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 59 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 60 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 61 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 62 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 63 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 64 r82 absorbable surgical suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb contrast needle 20 26mm, suture length 70cm ) rc not exists 65 r81 absorbable surgical suture, sterilised surgical needled suture polyglyconate, monofilament sutures ( 1 / 2 circle oval rb needle 26 30mm needle, suture length of 70cm ) rc not exists 66 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 67 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 68 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 69 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 70 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 71 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 72 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 73 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 74 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 75 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 76 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 77 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 78 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 79 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 80 s140 eye pressure shield rc not exists 81 s141 eyelid occlusion dressing rc not exists 82 s138 core biopsy instrument with compatible co axial needle ( automatic disposal ) rc not exists 83 s139 disposable bone marrow biopsy needle rc not exists 84 s99.p2 sanitary napkin beltless with wings ( udan yojna ) 6 napkin / pack 85 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 86 s3 asepto syringe with transparent bulb sterile, 60 ml rc not exists 87 s4 blood administration set blood transfusion set ( details in rc ) unit 88 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 89 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 90 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 91 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 92 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 93 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 94 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 95 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 96 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 97 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 98 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 99 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 100 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 101 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 102 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 103 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 104 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 105 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 106 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 107 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 108 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 109 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 110 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 111 s10.a infant feeding tube size 10fg ( details in rc ) each piece 112 s10.b infant feeding tube size 8fg ( details in rc ) each piece 113 s10.c infant feeding tube size 5fg ( details in rc ) each piece 114 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 115 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 116 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 117 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 118 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 119 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 120 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 121 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 122 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 123 s16 mucus extractor sterile ( details in rc ) unit 124 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 125 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 126 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 127 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 128 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 129 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 130 s22 plaster of paris bandage 10cm x 2.7mts unit 131 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 132 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 133 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 134 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 135 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 136 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 137 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 138 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 139 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 140 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 141 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 142 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 143 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 144 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 145 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 146 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 147 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 148 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 149 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 150 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each piece 151 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each piece 152 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each piece 153 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each piece 154 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 155 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 156 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 157 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 158 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 159 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 160 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 161 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 162 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 163 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 164 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 165 s43.l endotracheal tube, plain size 8 ( details in rc ) rc not exists 166 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 167 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 168 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 169 s44.c endotracheal tube, cuff size 5 details in rc each piece 170 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 171 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 172 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 173 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 174 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 175 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 176 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 177 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 178 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 179 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 180 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 181 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 182 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 183 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 184 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 185 s80 bone wax sterilised 2.5 gram / packet 186 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 187 s84.a k wire, length 375 mm; 1mm ( details in rc ) each piece 188 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each piece 189 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each piece 190 s85 face mask, disposable ( details in rc ) piece 191 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) unit 192 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 193 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 194 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 195 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 196 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 197 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 198 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 199 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 200 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 201 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 202 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 203 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 204 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 205 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 206 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 207 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 208 s94 umbilical cord clamp ( details in rc ) each piece 209 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each piece 210 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 211 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 212 s98 bone cement rc not exists 213 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 214 s99.b sanitary pads belt type ( details in rc ) rc not exists 215 s99.p sanitary napkin beltless with wings ( details in rc ) rc not exists 216 s100 oxygen mask ( adult ) unit 217 s101 oxygen mask ( pediatric ) unit 218 s102 foleys catheter no. 14 ( detail in rc ) each piece 219 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 220 s104 ecg electrode ( detail in rc ) each piece 221 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 222 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 223 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 224 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 225 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 226 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 227 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 228 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 229 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 230 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 231 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 232 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each piece 233 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 234 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) rc not exists 235 s119 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 236 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 237 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 238 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 239 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 240 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 241 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 242 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 243 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 244 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) rc not exists 245 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 246 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 247 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 248 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 249 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 250 s134 nebulization mask adult ( detail in rc ) each piece 251 s135 nebulization mask paediatric ( detail in rc ) each piece 252 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) rc not exists 253 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) rc not exists 254 nrr 1 braided e caprolactone coated lactomer 1, 90cm gs 25, 37 40mm1 / 2 circle taper point each foil 255 nrr 2 braided e caprolactone coated lactomer 2 0 90cm gs 25, 3omm1 / 2 circle taper point each foil 256 nrr 3 braided e caprolactone coated lactomer 1 90cm gs 25, 37 40mm1 / 2 circle reverse cutting each foil 257 nrr 4 braided e caprolactone coated lactomer 1, 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 258 nrr 5 braided e caprolactone coated lactomer 3 0 75cm c 14 , undyed 24mm 3 / 8 circle reverse cutting each foil 259 nrr 6 braided e caprolactone coated lactomer 2 0 90cm gs 21 , undyed 30mm 1 / 2 circle taper point each foil 260 nrr 7 braided e caprolactone coated lactomer 1 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 261 nrr 8 braided e caprolactone coated lactomer 0 90cm gs 24 , violet 40mm 1 / 2 circle taper point each foil 262 nrr 9 braided e caprolactone coated lactomer 3 0 75cm cv 25 , violet 20 22mm 1 / 2 circle taper point each foil 263 nrr 10 braided e caprolactone coated lactomer 1 0 90cm gs 25 , undyed 37 40mm 1 / 2 circle reverse cutting each foil 264 nrr 11 polyglactin 910 violet braided, 1, 35 cm 1 / 2 circle reverse cutting ( heavy ) 23 mm each foil 265 nrr 12 polyglactin 5 0 rb oval ½ circle 16 mm 45 cm each foil 266 nrr 13 polyglactin 5 0 cc 3 / 8 circle 16 mm 45 cm each foil 267 nrr 14 polyglactin 6 0 micro point ¼ circle 8 mm 45 cm each foil 268 nrr 15 polyglactin 910, braided coated with antibacterial 2 / 0, 70 cm undyed with ½ circle 25 mm rb each foil 269 nrr 16 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 3 0 each foil 270 nrr 17 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 4 0 each foil 271 nrr 18 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 1 / 2 circle round bodied 30 mm needle, length 70cm size 5 0 each foil 272 nrr 19 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 273 nrr 20 absorbable surgical suture sterilized surgical needled suture loop monofilament polydiaxanone violet no 1 40mm1 / 2 circle reverse cutting length 90 cm each foil 274 nrr 21 absorbable surgical suture sterilized surgical needled suture monofilament polydiaxanone violet 2 0 rb 30 mm needle length 75 cm each foil 275 nrr 22 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 17 mm needle length 90 cm each foil 276 nrr 23 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 6 0 rb 11 mm needle length 90 cm each foil 277 nrr 24 absorbable surgical suture sterilized surgical double armed needled suture monofilament polydiaxanone violet 5 0 rb 11 mm needle length 90 cm each foil 278 nrr 25 absorbable surgical suture sterilized surgical single armed needled suture monofilament polydiaxanone violet 5 0 rb 17 mm needle length 90 cm each foil 279 nrr 26 monofilament polyglyconate 1 150cm gs 25 loop, green 48mm 1 / 2 circle taper point each foil 280 nrr 27 monofilament polyglyconate 2 0, 75cm green 26 30mm 1 / 2 circle taper point each foil 281 nrr 28 monofilament polyglyconate 3 0, 75cm green 20 26mm 1 / 2 circle taper point each foil 282 nrr 29 monofilament polyglyconate 4 0, 75cm green 17 20mm 1 / 2 circle taper point each foil 283 nrr 30 polydioxanone voilet monofilament, 3 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 284 nrr 31 polydioxanone voilet monofilament, 4 0, 70 cm, 1 / 2 circle taper point rb 1, 17mm, each foil 285 nrr 32 polydioxanone monofilament ( voilet ) , 5 0, 70 cm 1 / 2 circle round body double needle 13 mm each foil 286 nrr 33 monofilament glycomer 1, 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 287 nrr 34 monofilament glycomer 2 0 90cm gs 21 , volet 37mm 1 / 2 crcle taper pont each foil 288 nrr 35 non absorbable surgical suture, sterilized surical needled black braided silk with needle 1 / 2 circle round bodied 30 mm needle , length 70 cm size 2 0 each foil 289 nrr 36 silk reel 1 0 each foil 290 nrr 37 silk reel 2 0 each foil 291 nrr 38 silk reel 3 0 each foil 292 nrr 39 silk reel 4 0 each foil 293 nrr 40 braided polyester caoted with silicon 2 0 8x75cm 2xy 31 plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 294 nrr 41 braided polyester caoted with silicon 2 0 10x75 2xcv 305 pgt , blue & white 25mm 1 / 2 circle taper point oval pledget each foil 295 nrr 42 braided polyester caoted with polybutylate 2 0 8x75cm 2x plgt , blue & white 16mm 1 / 2 circle tapercutting oval pledget each foil 296 nrr 43 braided polyester caoted with polybutylate 2 0 10x75 2x plgt, blue & white 25mm 1 / 2 circle taper point oval pledget each foil 297 nrr 44 braided polyester caoted with silicon 2, 26mm 1 / 2 circle rc 75cm each foil 298 nrr 45 braided polyester caoted with silicon 5, 55mm 1 / 2 circle rc 75cm each foil 299 nrr 46 braided polyester caoted with polybutylate 2, 26mm 1 / 2 circle rc 75cm each foil 300 nrr 47 braided polyester caoted with polybutylate 5, 55mm 1 / 2 circle rc 75cm each foil 301 nrr 48 monofilament polypropylene with peg additive 3 0 90cm 2xvf 20 , blue 26mm 1 / 2 circle taper point each foil 302 nrr 49 monofilament polypropylene with peg additive 2 0 90cm 2xv 20 , blue 30mm 1 / 2 circle taper point each foil 303 nrr 50 monofilament polypropylene with peg additive 4 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper cut each foil 304 nrr 51 monofilament polypropylene with peg additive 5 0 90cm 2xcv 23 , blue 17mm 1 / 2 crcle taper pont each foil 305 nrr 52 monofilament polypropylene with peg additive 6 0 75cm 2xcv 22 , blue 13mm 1 / 2 crcle taper pont each foil 306 nrr 53 monofilament polypropylene with peg additive 7 0 60cm 2xkv 1 , blue 9mm 3 / 8 crcle tapercuttng each foil 307 nrr 54 polypropylene blue monofilament, 2 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 308 nrr 55 polypropylene blue monofilament, 3 0, 90 cm 1 / 2 circle round body double needle 26 mm each foil 309 nrr 56 polypropylene blue monofilament, 4 0, 75 cm 1 / 2 circle round body double needle 17 mm each foil 310 nrr 57 polypropylene blue monofilament, 5 0, 90 cm 1 / 2 circle round body double needle 17 mm each foil 311 nrr 58 polypropylene blue monofilament, 6 0, 75 cm 3 / 8 circle round body ( 380 microns ) double needle 13 mm each foil 312 nrr 59 polypropylene blue monofilament, no. 7 0, 60 cm 3 / 8 circle round body, taper point double needle 9 mm each foil 313 nrr 60 monofilament polybuetester coated with polytribiolate 6 0 75cm 2xcv 1x36 , blue 9mm 3 / 8 circle taper point each foil 314 nrr 61 monofilament polybuetester coated with polytribiolate 4 0 90cm 2xcv 23x36 , blue 17mm 1 / 2 circle taper point each foil 315 nrr 62 monofilament polybuetester coated with polytribiolate 7 0 60cm 2xmv 175 8 , blue 8mm 3 / 8 circle taper point each foil 316 nrr 63 monofilament polybuetester coated with polytribiolate 2 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 317 nrr 64 monofilament polybuetester coated with polytribiolate 3 0 90cm 2xv 20x36 , blue 26mm 1 / 2 circle taper point each foil 318 nrr 65 non absorbable synthetic unidrectional dual cut angle barb with welded loop end made up with polybeutester size 1, 37mm, 30cm, 1 / 2 circle, tp each foil 319 nrr 66 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polybeutester blue size 2 0, 1 / 2 circle, 37mm, 30cm tp, each foil 320 nrr 67 absorbable synthetic unidirectional dual cut angle barbed with welded loop end made up with polyglyconate 2 0 26 30 mm 30 cm 1 / 2 circle taper point each foil 321 nrr 68 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 1 0, 1 / 2 circle, 37mm, 30cm tp each foil 322 nrr 69 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 2 0, 1 / 2 circle, 26mm, 30cm tp each foil 323 nrr 70 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with polyglyconate green size 3 0, 1 / 2 circle, 26mm, 30cm tp each foil 324 nrr 71 synthetic absorbable wound closure device with dual cut barb with velded loop on end madeup with glycomer blue size 2 0, 1 / 2 circle, 24mm, 30 45cm rc each foil 325 nrr 72 laproscopic knotless pga pcl surgical suture self fixation device with autolock mechanism made up of pga pcl unidirectional taper point 26 mm & 20 cm size 2 0 each foil 326 nrr 73 polyester ethylene terephthalate nonabsorbable surgical suture polyester suture is a nonabsorbable, braided, sterile, surgical suture composed of poly ( ethylene terephthalate. ) it is prepared from fibers of high molecular weight, long chain, linear polyesters 1 / 2 circle tapercut 2 x v 5 double needle 26 mm 90 cm green color size 2 0 each foil 327 nrr 74 laproscopic knotless pga pcl bidirectional taper point surgical suture self fixation device with autolock mechanism made up of pga pcl bidirectional taper point 17 mm & 32cm each foil 328 nrr 75 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point ct 1 40 mm needle 90 cm suture size 1 each foil 329 nrr 76 absorbable antibacterial polydiaxonone monofilament taper point surgical suture absorbable antibacterial suture made up of polydiaxonone coated with triclosan voilet monofilament 1 / 2 circle taper point loop ct sgle armed 65 mm needle 122 cm suture size 1 each foil 330 nrr 77 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab reverse cutting 36 mm & 45 cm suture size 1 each foil 331 nrr 78 laproscopic knotless polydiaxonone with fixation surgical suture self fixation device with autolock mechanism made up of polydiaxonone with fixation tab taper point 36 mm & 45 cm suture size 1 0 each foil 332 nrr 79 non absorbable surgical suture black braided silk 1 0 rb ½ circle 30 mm 90 cm each foil 333 nrr 80 non absorbable surgical suture black braided silk 1 0 rc 3 / 8 circle 45 mm 76 cm each foil 334 nrr 81 non absorbable surgical suture black braided silk 5 0 rc 3 / 8 circle 12 mm 76 cm each foil 335 nrr 82 non absorbable surgical suture black braided silk 5 0 rb 3 / 8 circle 16 mm 76 cm each foil 336 nrr 83 non absorbable surgical suture black braided silk 6 0 rc mp 3 / 8 circle 8 mm each foil 337 nrr 84 non absorbable monofilament 3 0 reverse cutting 24mm needle each foil 338 nrr 85 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 2 0 rb ½ circle 30 mm 70 cm each foil 339 nrr 86 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rb micro point ¼ circle 8 mm 45 cm 2670 each foil 340 nrr 87 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 4 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 341 nrr 88 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 3 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 342 nrr 89 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 6 0 rc micro point ¼ circle 8 mm 45 cm 2670 each foil 343 nrr 90 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 cc 3 / 8 circle 16 mm 45 cm 2442 each foil 344 nrr 91 absorbable surgical suture ( synthetic ) coated polyglactin / pga 910 voilet 5 0 rb oval 1 / 2 circle 16 mm 45 cm each foil 345 nrr 92 endoloop ligature made with polyglactin suture length18 inch, narrow at one end and scored at other each foil 346 nrr 93 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 9 0 each foil 347 nrr 94 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) ( 3 / 8 cir micropoint royund body 6mm length 38 cm ) 10 0 each foil 348 nrr 95 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm3 0 each foil 349 nrr 96 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm4 0 each foil 350 nrr 97 non absorbale surgical suture sterlised surgical needle suture polyamide mono filament black ( nylon ) 3 / 8 conventional cutting needle 6mm length 70cm 5 0 each foil 351 nrr 98 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 6 0 each foil 352 nrr 99 non absorbale surgical suture sterlised surgical needle suture monofilament polypropylene blue 1 / 2 circle round body 13 mm needle length 75 cm 7 0 each foil 353 nrr 100 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm3 0 each foil 354 nrr 101 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm4 0 each foil 355 nrr 102 non absorbale surgical suture sterlised surgical needle suture polyglycaprone / polyglyconate monofilament sutures 1 / 2 circle oval round body needle 26mm needle length 70 cm 5 0 each foil 356 nrr 103 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 3 0 each foil 357 nrr 104 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 4 0 each foil 358 nrr 105 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 5 0 each foil 359 nrr 106 non absorbale surgical suture sterlised surgical needle suture ( braided , coated polyglactin / polyglycolic acid violet ) 1 / 2 circle ct round bodied 40 mm gs needle suture length 90 cm 6 0 each foil 360 nrs 1 nonabsorbable polypropylene light weight macroporous mesh each unit 361 nrs 2 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 362 nrs 3 three dimensional monofilament polyester composite mesh with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 363 nrs 4 three dimensional monofilament polyester composite mesh with with collagen with glycerol anti adhesive barrier visceral side and stay suture in parietal side along with medial medial each unit 364 nrs 5 absorbable 5 mm hernia mesh fixation device 30 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 365 nrs 6 absorbable 5 mm hernia mesh fixation device 15 screw shaped with proximal wings of pgla tacks of 4.1 mm length along with flexible shaft up to 3 cm. each unit 366 nrs 7 non absorbable 5 mm hernia mesh fixation device with 30 helical shaped titanium tacks 3.96mm width and 0.61 mm diameter each unit 367 nrs 8 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 15 fasteners each unit 368 nrs 9 5mm nonabsorbable helical fastener made up of medical grade stainless steel covered with atraumatic polymer ( peek ) cap to avoid metal exposure with 30 fasteners each unit 369 nrs 10 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 370 nrs 11 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 371 nrs 12 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 372 nrs 13 light weight monofilament polypropylene mesh, design to confirm inguinal anatomy, 3d shape each unit 373 nrs 14 battery operated 60mm articulating endo cutter with a disposable battery pack, for enhanced distal tip stability while firing, having closed channel in the cartrdige jaw for better stability during firing, 360 degree rotation shaft and one handed natural articulation up to 45 degrees, precision machined anvil to deliver initial, system wide compression, wide proximal to distal jaw aperture ( proximal 8mm , distal 22mm ) , 3 point gap control for alignment and calibration throughout the 60 mm staple line, knife direction / reverse control to discontinue the firing and return the knife, interchangeable 6 row cartridge options of white, blue , gold, green and black, all fits down to 12mm trocar sleeve, 440 mm shaft length 60 mm stapler each unit 374 nrs 15 linear cutter 55mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 375 nrs 16 linear cutter 75mm with six rows, 3d staple formation, option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only each unit 376 nrs 17 universal linear cutter cartridge 75mm open linear cutter compatible with selectable staple height linear cutter 75mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 377 nrs 18 universal linear cutter cartridge 55mm for open linear cutter compatible with selectable staple height linear cutter 55mm.option of closed staple height of 1.5mm / 1.8mm / 2mm in one cartridge only. 6 rows 3 d staple technology. each unit 378 nrs 19 curved cutter stapler 40 mm linear cutter simultaneous cutting and stapling each unit 379 nrs 20 curved green cartridge having close staple height of 2.0 mm, tactile feedback on completion of firing sequence, new anvil, knife with every catridge each unit 380 nrs 21 powered circular stapler 29 mm with 3d staple and not slip grip each unit 381 nrs 22 powered circular stapler 31mm with 3d staple and not slip grip each unit 382 nrs 23 circular stapler 33mm with controlled tissue compression with adjustable staple height ( 1.0 2.5 mm ) for controlled tissue compression, longer staple leg 5.5mm & non slip grip surface each unit 383 nrs 24 laparoscopic cartridge for stapler 60 mm blue, 1.5 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 384 nrs 25 laparoscopic cartridge for stapler 60 mm green, 2.0 mm closed staple height with gripping surface technology and six rows compatible with all range of endoscopic linear cutter 60mm each unit 385 nrs 26 pph stapler 33mm hemorrhoidal stapler kit consists of 33mm hemorrhoidal circular stapler ( with fixed anvil, adjustable closed staple height from 0.75 mm – 1.5 mm, staple open leg length of 5.5 mm ) , suture threader, circular anal dilator, purse string suture anoscope, suture for purse string. each unit 386 nrs 27 optically guided bladeless trocar 12mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 387 nrs 28 optically guided bladeless trocar 12 mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer length 100mm. each unit 388 nrs 29 facial closure device contain optical bladeless trocar with facial closure device comaptible with clear cannula have two side opening meant for uniform port closure each unit 389 nrs 30 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 390 nrs 31 varied staple height reloads / cartridges for 80 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with purple varied staple height of 3, 3.5 and 4mm leg length each unit 391 nrs 32 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 60 mm tristaple gia stapler, compatible with tri staple gia 60 mm open linear cutter reloads / cartridges purpule and black each unit 392 nrs 33 eea circular stapler purple colour medium thick , triple row with tristaple technology ( three row of staple inner to outer row 3.0, 3.5 and 4.0 mm with sloped cartridges face in one stapler ) diameter 31mm each unit 393 nrs 34 linear cutter with varied staple height, tri staple technology enabled reloads integration with left and right firing knob ( both side firing ) , linear cutter stapler with integrated gap control technology in 80 mm tristaple gia stapler, compatible with tri staple gia 80 mm open linear cutter reloads / cartridges purpule and black each unit 394 nrs 35 wound protector with double ring in small 2.5 6 cm usfda approved each unit 395 nrs 36 wound protector with double ring in medium 5 9 cm each unit 396 nrs 37 wound protector with double ring in large in size 9 14 cm usfda approved each unit 397 nrs 38 endo catch specimen removal kit:with continuous ring , polyurethane pouch with 34.5 cm shaft length , 10mm with leakproof and impervious material to cancer cells of 0.5 microns / pretied purse string on pouch usfda approved each unit 398 nrs 39 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 399 nrs 40 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mmcapable of loading all length cartridges on same gun only each unit 400 nrs 41 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 401 nrs 42 laparoscopic liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 402 nrs 43 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 9cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels up to and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 9 each unit 403 nrs 44 hand activated curved taper tip coagulating shears compatible with ultrasonic cutting and coagulation device, 17cm length, 16mm curved active blade with adaptive tissue technology capable of sealing blood vessels upto and including 5mm in diameter, with ergonomic symmetrical finger ring grip focus 17 each unit 404 nrs 45 advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 405 nrs 46 advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide straight jaw design with seal length of 20mm and cut length of 16mm, sealing vessel upto and including 7mm through radio frequency energy and having a temperature controlled mechanism within the jaw and having articulation of 110 degree ( 55 degrees on both sides ) and capable of 360 degrees rotation each unit 406 nrs 47 advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length, 6 mm wide straight jaw design with jaw length of 38 mm , sealing vessel upto and including 7mm through radio frequency energy , having separate seal and cut buttons, capable of 360 degrees rotation each unit 407 nrs 48 laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 5mm in diameter, 360 degrees rotation, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 408 nrs 49 advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in open surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 409 nrs 50 advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 410 nrs 51 advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm jaw aperture designed for use in laproscopic surgical procedures with curved and tapered tip and uses an advanced algorithm for intelligent and efficient energy delivery. device to have intuitive design with separate seal and cut button and 360 degree continuous shaft rotation each unit 411 nrs 52 laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter , ergonomic handle compatible with ultrasonic energy source, capable of hand and foot activation with an integrated hand piece and transducer. each unit 412 nrs 53 connecting cable for ultrasonic harmonic scalpel for open energy probes compatible with focus plus shear hp blue each unit 413 nrs 54 connecting cable for ultrasonic harmonic scalpel for lap energy probes compatible with ace plus shear hp054 each unit 414 nrs 55 laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade and a clamp arm with tissue pad, capable of cutting, sealing, grasping and coagulating blood vessels up to and including 7mm in diameter, 360 degrees rotation, advance hemostasis hand activation mode for sealing vessels upto 7mm in diameter, ergonomic handle compatible with ultrasonic energy source and capable of hand and foot activation each unit 415 nrs 56 nasal haemostatic sponge pack ( with airway ) 10 inch each unit 416 nrs 57 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 2*2 ) hole drill bit machine with insertion tools each unit 417 nrs 58 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*2 ) hole drill bit machine with insertion tools each unit 418 nrs 59 platting for maxillary swing and mandibular fixation surgeries ( titanium ) plates 2 mm thickness ( 1*1 ) hole drill bit machine with insertion tools each unit 419 nrs 60 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2 mm ) diameter drill bit machine with insertion tools each unit 420 nrs 61 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 1.5 mm ) diameter drill bit machine with insertion tools each unit 421 nrs 62 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 2.5 mm ) diameter drill bit machine with insertion tools each unit 422 nrs 63 platting for maxillary swing and mandibular fixation surgeries ( titanium ) screw ( 3 mm ) diameter drill bit machine with insertion tools each unit 423 nrs 64 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 4 mm ) each unit 424 nrs 65 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 6 mm ) each unit 425 nrs 66 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 8 mm ) each unit 426 nrs 67 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 10 mm ) each unit 427 nrs 68 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 17fr ( 12.5 mm ) each unit 428 nrs 69 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 4 mm ) each unit 429 nrs 70 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 6 mm ) each unit 430 nrs 71 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 8 mm ) each unit 431 nrs 72 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 10 mm ) each unit 432 nrs 73 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 20fr ( 12.5 mm ) each unit 433 nrs 74 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 6 mm ) each unit 434 nrs 75 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 8 mm ) each unit 435 nrs 76 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 10 mm ) each unit 436 nrs 77 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 12.5 mm ) each unit 437 nrs 78 speech prosthesis for laryngectomy ( indwelling low resistance silicon voice prosthesis varied diameter with varied length should have blue teflon valve seet for primary and secondary insertion along with inserting tools and cleaning accessories ) 22.5fr ( 4 mm ) each unit 438 nrs 79 block used in thyroplasty ( sialestic and gortex ) 70*50 mm with 20 mm thickness each unit 439 nrs 80 disposable needle 16g x 1 inch each unit 440 nrs 81 curved tip & stepped cartridges face from inner to outer side 2.0, 2.5 and 3.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm tan colour code for vascular applications each unit 441 nrs 82 curved tip & stepped cartridges face from inner to outer side 3.0, 3.5 and 4.0 mm staple heights row for variable thickness tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 45 mm purpule colour code for medium to thick tissue each unit 442 nrs 83 varied staple height reloads / cartridges for 60 mm gia instruments with tri staple technology, with the cutting knife blade incorporated in the reloads itself, with black varied staple height of 4, 4.5 and 5mm leg length each unit 443 nrs 84 disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter with clip logic technology and digital display titanium clips u shaped each unit 444 nrs 85 synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm each unit 445 nrs 86 synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm each unit 446 nrs 87 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism: medium / large size each unit 447 nrs 88 disposable 10 mm endoscopic clip applier with facility of loading clips independent of the firing mechanism large size each unit 448 nrs 89 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 30mm, capable of loading all length cartridges on same gun only each unit 449 nrs 90 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 45mm capable of loading all length cartridges on same gun only each unit 450 nrs 91 endo liner cutter without integrated fresh knife with 360*rotation & 0 45* articulation in both direction : for use with cartridges in sizes of 60mm, capable of loading all length cartridges on same gun only each unit 451 nrs 92 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology medium each unit 452 nrs 93 disposable clip applier preloaded with 20 clips, superinterlock security with clip design technology small each unit 453 nrs 94 sterile hypodermic syringe with needle attached, 22g, single use 2 ml each unit 454 nrs 95 sterile hypodermic syringe with needle attached, 22g, single use 5 ml each unit 455 nrs 96 biological glue with thrombin & aprotinin 1ml each unit 456 nrs 97 biological glue with thrombin & aprotinin 2ml each unit 457 nrs 98 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 458 nrs 99 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 459 nrs 100 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 460 nrs 101 close wound drainage device under negative pressure ( closed wound suction unit ) each unit 461 nrs 102 sterile oxidized regenerated cellulose hemostating agent in netform fibrillar and in thick sheath as per ip each unit 462 nrs 103 urine collecting bag, disposable 2000 ml with uroflow meter each unit 463 nrs 104 central neck line double lumen ( 3 nobel metal coated ( gold, silver, palladium ) central lumen catheter, double lumen ) each unit 464 nrs 105 microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers each unit 465 nrs 106 microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment each unit 466 nrs 107 microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch each unit 467 nrs 108 microcatheter flow dependent super selective high flow infusion microcatheters for cerebral / spinal avms ( compatible with dmso ) each unit 468 nrs 109 micro guide wire for microcatheter shapable distal end and with torque 0.014inch each unit 469 nrs 110 bare platinum coil complex shape, soft, electrolytic detachable framing and filling each unit 470 nrs 111 bare platinum coil complex shape, soft, mechanically detachable framing and filling each unit 471 nrs 112 bare platinum coil helical shape, soft, electrolytic detachable each unit 472 nrs 113 bare platinum coil helical shape, soft, mechanically detachable each unit 473 nrs 114 aortic punch 2.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 474 nrs 115 aortic punch 3 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 475 nrs 116 aortic punch 3.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 476 nrs 117 aortic punch 4 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 477 nrs 118 aortic punch 4.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 478 nrs 119 aortic punch 5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 479 nrs 120 aortic punch 5.5 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 480 nrs 121 aortic punch 3.6 length betwwen 6 to 7 midlength diamond edge sharp, dual cut edge for clean precise removal of aortic tissue, conical tip or round / eliptical tip for easy insertation by straight or button hole tech, should have long and short handle confirguaration, sterile packing each unit 481 nrs 122 folleys catheter fixation divice foley catheter holder universal size should have leg band and is disposable single patiemnt use device should have catheter grip of 18 to 24 fr catheter and made of crobelt or any other. each unit 482 nrs 123 tur set tur irrigation set disposable urology instrument urology equipment endosurgery, mfg from clinical grade non toxic medical transparent pvc sheet, y shaped connector with pointed spike to easy pierce facilities alternative change solution, thumb operated clamp smooth chnage of bottle, proximal end fitted with flexible latest tubing for easy connection to endoscope, eto steril individual pack. should have minium lenght of 260 cm or more. each unit 483 nrs 124 laproscopic port with trocar 5mm optically guided bladeless trocar 5mm with bilateral tissue separators, optical tip to eliminate blind entry, clear ribbed cannula to enhance abdominal wall retention, recessed stopcock valve, funnel shaped housing, duckbill secondary seal, integrated universal seal that eliminates the use of reducer, 150mm length. each unit 484 nrs 125 each unit 485 nrs 126 each unit 486 nrs 127 each unit 487 nrs 128 each unit 488 nrs 129 each unit 489 nrs 130 each unit 490 nrs 131 each unit 491 nrs 132 each unit 492 nrs 133 each unit 493 nrs 134 each unit 494 nrs 135 each unit 495 nrs 136 each unit 496 nrs 137 each unit 497 nrs 138 each unit 498 nrs 139 each unit 499 nrs 140 patient pre operative skin prepration solution 26 ml in one step sterile applicator container for single use with 2% chlorohexdine gluconate ( chg ) and 70% ipa with orange tint colour or easy visulization, us fda approved each unit 500 nrs 141 rem and non rem single use, corded patient return electrodes conductive adhesive hydrogel with usfda. each unit 501 nrs 142 chlorhexidine impregnated paraffin gauze 30x10 cm each unit 502 nrs 143 chlorhexidine impregnated paraffin 15 cm x 1 roll each unit programmable automatic bipsy gun with compitible co axial needle should have 20mm sample notch and thin wall cannula for larger core and echogenic making on both stylet tip and cannula for improved visibility during procedure. should have three programmable firing mode automatic mode, delay mode and zero throw mode. should have two firing btton on surface of the gun, size 12g, 14g, 16g, 18g, 20g with length 11cm, 15cm, 20cm. should come with compitible coaxial packed with biopsy gun. usfda approved. 503 nrs 144 surgical gloves 6.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 504 nrs 145 surgical gloves 7 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 505 nrs 146 surgical gloves 7.5 non latex surgical gloves synthetic polyisoprene powder free overall length 283mm with puncture indicator technology usfda approved each unit 506 nrs 147 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 5 cms x 5 cms each unit 507 nrs 148 ionic silver dressings with broad spectrum antimicrobial, bactericidal, biofilm destruction & reformation efficacies recommended for low to high exuding wounds 10 cms x 10 cms each unit 508 nrs 149 self adherent moist wound dressing made up of triple hydrocolloid matrix, elastomeric polymer for pressure ulcers / bed sores 10 cms x 10 cms each unit 509 nrs 150 stich bonded hydrofiber burns dresssings with 1.2% impregnated ionic silver with sustained and on demand broad spectrum antimicrobial & bactricidal activity with high exudate management capability with a wear time of 21 days & locking in edudates in gel form 23 x 100 cms each unit 510 nrs 151 double wall resuscitator with peep valve in adult it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for adult bag volume: mark iv ( 1300 ml ) weight: adult ( 415 g ) it should be us fda, ce & iso certified each unit 511 nrs 152 double wall resuscitator with peep valve in paediatrics it should be fully autoclavable double wall with hand strap it should be supplied with autoclavable reservoir bag it should have a single shutter valve system made of silicone rubber it should have easy attachment of peep valve for peadiatric it should have provision to attach manometer for paediatrics ambu bag bag volume: mark iv baby ( 300 ml ) weight: baby ( 190 g ) it should be us fda, ce & iso certified each unit 512 nrs 153 single patient use sebs resuscitator ( spur ii with peep valve in adult ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: adult ( 1475 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 513 nrs 154 single patient use sebs resuscitator ( spur ii with peep valve in paed ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand should have provision to attach manometer for paediatrics ambu bag. • resuscitator volume: pediatric ( 635 ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 514 nrs 155 single patient use sebs resuscitator ( spur ii with peep valve in neonatal ) • it should be single use resuscitator made to sebs material not pvc. • it should have unique single shutter valve system for reliable functionality & swivel between valve and mask permits 360° positioning in relation to the patient • it should have thin walled compression bag with hand strip. • resuscitator volume: neonate ( 220ml ) • ( including reservoir and mask ) • it should be ce / iso, us fda certified. each unit 515 nrs 156 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 516 nrs 157 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 517 nrs 158 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 518 nrs 159 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 519 nrs 160 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 520 nrs 161 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 521 nrs 162 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 522 nrs 163 pre formed sga with gastric access & intubation it should be latex free preformed laryngeal mask having gastric access channel and should be used as a conduit for direct endotracheal intubation with any brand ett • it should built in, anatomically correct curve and cuff & tube moulded as a single unit. • ultra thin pilot balloon with tactile indication of degree of inflation. • universal 15mm connector ( iso ) . • it should be ce / iso, us fda certified each unit 523 nrs 164 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 524 nrs 165 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 525 nrs 166 silicone pre formed sga total size 8 • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 526 nrs 167 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 527 nrs 168 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 528 nrs 169 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 529 nrs 170 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 530 nrs 171 silicone pre formed sga • it should be and autoclavable up to 40 times • it should have reinforced tip at cuff and cuff & tube moulded as a single unit. • atraumatic insertion and removal. • it should be ce / iso, us fda certified each unit 531 nrs 172 cervical collar with 12 sizes settings • it should be latex free adjustable collar with 12 size setting in paediatric collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 532 nrs 173 cervical collar with 16 sizes settings • it should be latex free adjustable collar with 16 size setting in adult collar • it should have standard sizing line for easy and accurate sizing • it should be ce / iso, us fda certified each unit 533 nrs 174 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 534 nrs 175 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 535 nrs 176 offset connector cardio sensor electrodes • it should have high conductive wet gel to ensure reliable traces. • it should be design with offset connector to prevent artefacts from disrupting the readouts • it should have high quality ag / agcl sensor to ensure excellent trace quality • it should have size not more than 72 x 68 mm each unit 536 nrs 177 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone each unit 537 nrs 178 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 538 nrs 179 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 539 nrs 180 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 540 nrs 181 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 541 nrs 182 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 542 nrs 183 anatomical face mask with thumb rest silicone •thumb rest for a tight, easy seal, made up of silicone • can be autoclaved repeatedly at 134°c each unit 543 nrs 184 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 544 nrs 185 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 545 nrs 186 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 546 nrs 187 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 547 nrs 188 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 548 nrs 189 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 549 nrs 190 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 550 nrs 191 disposable sga anatomical curve • it should have special curve that carefully replicates natural human anatomy • it moulded directly into the tube • should have a d shaped airway tube to give a firm and ergonomically grip during insertion each unit 551 nrs 192 rhinolaryngo single patient use slim scope insertion tube diameter : 3.0mm. working length: 300 mm bending range : 130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 552 nrs 193 rhinolaryngo single patient use invtervention scope channel width : 2.2mm insertion tube diameter : 5.0 mm. working length : 350 mm bending range :130 degree up & 130 degree down field of view : 85 degree or more direction of view : 0 degree ( forward view ) depth of field : 6 50 mm or better complete system should be us fda and european ce certified each unit 553 nrs 194 ultrasorbs ap disposable drypads, dry pad for moisture management, 58.4x90cm, with breathable layer, super absorbent core, aqua shield film and air permeable back sheet, absorbency of 1800 2300gm, usfda / ce / bis compliant, iso13485 compliant each unit 554 nrs 195 elastic head strap cannulas pediatric elastic head strap cannulas pediatric must be soft siliconised, transparent vinyl; adjustable elastic band for comfortable, snug fit below the ears; complete kit with 7 ft oxygen supply tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 555 nrs 196 over the ear nasal cannula over the ear nasal cannula with star lumen, 50 tubing, must be flexible contoured lip tab provides a high level of stability and patient comfort. over the ear design for a comfortable and secure fit, crush and kink resistant tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 556 nrs 197 pediatric nasal cannula pediatric nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 557 nrs 198 infant nasal cannula infant nasal cannula softech with universal oxygen connector, 7 star lumen tubing lightweight, flexible nasal cannula with standard over the ear designed that optimizes fit and stability, soft nasal prongs to help maximize patient comfort. individually packaged for convenience and sterility. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 558 nrs 199 volumetric incentive spirometer ( adult ) volumetric incentive spirometer ( adult ) 4000 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have goodbetter best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 559 nrs 200 volumetric incentive spirometer ( pediatric ) volumetric incentive spirometer ( pediatric ) 2500 ml with handle. volume measurement must be compact comfortable designed to accommodate large inspired volumes. must have good better best flow window & advanced, low work of breathing design. particulate filter screen in device housing must help to reduce risk of foreign matter passing to patients. expandable and collapsible tube must help patients find comfortable position for treatments and can be removed when storing the device. ergonomic swiveled mouthpiece allows to patients create tight seal to enable more accurate measurement. flow indicator with smiley face provides visual target for desired inhalation and bright green flow indicator make it easy for patients to see results. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 560 nrs 201 inspiratory exerciser with 3 color coded balls, 3 chambers inspiratory exerciser with 3 color coded balls, 3 chambers & wide flow rate range from 600 to 1200 cc / sec, with minimum flow imprinted on each chamber. must be compact design and made of break resistant plastic. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 561 nrs 202 adult mask for tracheostomy adult mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 562 nrs 203 pardiatric mask for tracheostomy pediatric mask for tracheostomy and laryngectomy aerosol therapy tubing connector must swivels 360° for ease of positioning; 22 mm od connector accepts 22 mm, corrugated tubing and nebulizer tees. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 563 nrs 204 elongated aerosol mask adult elongated aerosol mask adult with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 564 nrs 205 elongated aerosol mask pediatric elongated aerosol mask pediatric with under the chin design for excellent fit on wide range of face sizes must be clear, soft vinyl for patient comfort; adjustable nose clip assures comfortable fit; specifically designed for aerosol therapy; must be with supplied with 6 ft. corr a flex corrugated tubing, featuring cuttable sections every 6 in. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 565 nrs 206 elongated three in one adult mask elongated three in one adult mask must be able to use as a medium concentration, highconcentration or nonrebreathing mask which includes mask with flapper valve, nonrebreathing bag assembly; adjustable nose clip assures comfortable fit; with 7 ft. star lumen oxygen supply tubing; 750 ml reservoir bag. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 566 nrs 207 adult conventional single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 567 nrs 208 adult ventilator circuit single limb portable adult ventilator circuit with universal single limb. must be complete kit with main circuit hose, exhalation valve manifold, aerosol hose, patient elbow connector, proximal airway pressure line, exhalation valve line, and humidifier limb. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 568 nrs 209 adult ventilator circuit single water trap adult conventional single water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector inspiratory limb water trap ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 569 nrs 210 adult conventional dual limb water trap adult conventional dual limb water trap ( non heated ) ventilator circuits are available in a variety of different configurations and incorporate standard connectors for use with a variety of ventilators, ported wyes allow pressure sensing and temperature monitoring and include tethered caps, all adult conventional circuits with 72 in. long, standard ventilator circuit with straight connector dual limb inspiratory & expiratory water trap 22mm tubing, ( for use with hmes only ) . manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 570 nrs 211 infant prong cpap cannula infant prong cpap cannula nasal size 0 with designed to reduce trauma associated with delivery of infant nasal cpap. must be soft siliconised, anatomically curved prongs to enhance fit. luer fitting on expiratory connector to allow proximal airway pressure monitoring. each set to include, soft siliconised cannula; inspiratory & expiratory elbow connector; knit cap; two 6 in. hook and loop fastener sections; two 10 to 7.5 mm adaptors. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 571 nrs 212 fhme heat and moisture exchangers with bacteria viral filters bacterial filtration efficiency> 99.99 % and viral filtration efficiency > 99.9999% . filter membrane should be of a hydrophobic non woven polypropylene material. should be tailored to meet the specific needs of both anaesthesia and intensive care. each unit 572 nrs 213 tracheostomy hme: 1 heat and moisture exchangers for spontaneously breathing tracheotomy patients. 2 should have in built oxygen port. 3 should be compact & light wt. 4 should be suitable for ambulatory patients, sampling and suctioning can be done without removing it. 5 the system should have kink resisting oxygen tubing each unit 573 nrs 214 double lumen endobronchial tube left: size 28fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 574 nrs 215 double lumen endobronchial tube left: size 32fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 575 nrs 216 double lumen endobronchial tube left: size 35fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 576 nrs 217 double lumen endobronchial tube left: size 37fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 577 nrs 218 double lumen endobronchial tube left: size 39fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 578 nrs 219 double lumen endobronchial tube left: size 41fr low pressure tracheal and bronchial cuffs to minimise risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fiberoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 579 nrs 220 double lumen endobronchial tube right: size 35fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 580 nrs 221 double lumen endobronchial tube right: size 37fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 581 nrs 222 double lumen endobronchial tube right: size 39fr low pressure tracheal and bronchial cuffs to minimize risk of mucosal damage. color coded bronchial cuff, bronchial proximal lumen and bronchial pilot balloon assists in location of tube and tip when verification is confirmed by fibreoptic bronchoscope. x ray opaque markers at distal tip above bronchial cuff and at tracheal opening for verification of tube position. each unit 582 nrs 223 sub glottic tube taper guard evac: sizes 6mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 583 nrs 224 sub glottic tube taper guard evac: sizes 6.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 584 nrs 225 sub glottic tube taper guard evac: sizes 7mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 585 nrs 226 sub glottic tube taper guard evac: sizes 7.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 586 nrs 227 sub glottic tube taper guard evac: sizes 8mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 587 nrs 228 sub glottic tube taper guard evac: sizes 8.5mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 588 nrs 229 sub glottic tube taper guard evac: sizes 9mm the tube should have an additional lumen integrated into the wall of the tube to allow suctioning of subglottic space. should have cuff in taper size to prevent micro aspiration should have low volume / low pressure cuff. each unit 589 nrs 230 inflation device inflation device in 30atm & 20ml with clear polycarbonate barrel for easy visualisation of bubbles, luminescent dial, airless rotator, lock release handle for easy one handed control and primelok for easy preparation.usfda approved each unit 590 nrs 231 manifold manifolds in 2, 3, 5 port with configuration of left right orientation, on off handle, full half body, 200 psi 500 psi rating and wide port spacing. should have clear polycarbonate body to provide durability and visibility, airless rotator and large bore inner lumen throughout including rotator.usfda approved each unit 591 nrs 232 high pressure tube high pressure tubing in 25cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 592 nrs 233 high pressure tube high pressure tubing in 51cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 593 nrs 234 high pressure tube high pressure tubing in 76, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 594 nrs 235 high pressure tube high pressure tubing in 122, cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 595 nrs 236 high pressure tube high pressure tubing in 183cm with braided, flexible tubing of polyurethane rated 1200 psi. usfda approved each unit 596 nrs 237 torque device torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism.usfda approved each unit 597 nrs 238 radial band radial hemostatis band in 24 cm . curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 598 nrs 239 radial band radial hemostatis band in 29 cm. curved backer plat with large area & clear unobstructed site visibility, convinient tubing clip with two check valve options and device stickers. should be available with standard luer and specialized connection syringe. us fda approved each unit 599 nrs 240 angiography needle angiography needle in 18g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 600 nrs 241 angiography needle angiography needle in 19g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 601 nrs 242 angiography needle angiography needle in 20g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 602 nrs 243 angiography needle angiography needle in 21g, length of 2 9cm. should be available in echo enhanced & smooth finish, ergonomic hub with bevel orientation point, silicone coated stainless steel to reduce needle drag and superior sharpness to facilitate entry into tissue and vessel wall. usfda approved each unit 603 nrs 244 angiography wire ptfe guidewire in .035, .038, in regular length. should have 3mm j tip, straight tip, precoating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 604 nrs 245 angiography wire long length ptfe guidewire in .035, .038, with exchange length. should have 3mm j tip, straight tip, pre coating for smooth surface with less friction, finger straight able with precise j tip memory and packed in flush hoop with j straightener. should have option of fixed core, movable core, heparin coating, 1.5mm j tip. usfda approved each unit 605 nrs 246 amplatz wire ptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm. should be available in multiple flexible tip length of 1.0cm, 3.5cm, 4.0cm, 6cm, 7cm and j 3.0mm. usfda approved. usfda approved each unit 606 nrs 247 hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 607 nrs 248 hydrophilic wire long length hydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length with straight, angled tip. should come in stiff & standard configuration, nitinol core polyurethane jacket hydrophilic coated guide wires with radiopaque jacket for enhanced visibility, hydrated gel coating and true 1:1 torque. usfda approved each unit 608 nrs 249 hydrophillic braided sheath hydrophilic braided sheath introducer in 4f to 7f, length of 7, 11, 16, 23cm with the option of .018, .021, .025 plastic jacketed and spring coil guidewire. should have ultra thin wall and flat wire braiding technology to provide support and low profile.usfda approved each unit 609 nrs 250 femoral sheath with needle femoral sheath in 5f to 8f, length of 11 23cm with puncher needle of 18g and guidewire of .035, .038. should have rotating suture ring, snap fit dilator to prevent slipping during insertion and holster pack. should be available in polypropylene. usfda approved each unit 610 nrs 251 angiography catheter diagnostic catheter in 4f 6f, length of 70 110cm & 125cm , should come in various shapes & curve length including jl & jr ( 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6 cm ) , al, ar, tig, mp, im, sones, pigtail ( straight, angle, radial ) . should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. should be available in various configurations braided, non braided, short tip, bumper tip, sideholes as applicable. usfda approved each unit 611 nrs 252 angiography radial catheters diagnostic radial catheter with radial ultimate curve in 4 6f. lenght of 100cm, 110cm, 125cm. should have four type of radial ultimate curves. should have flat wire braiding, nylon material, thin wall design for higher flow rates, radio opaque tip, strain relief and winged polycarbonate hub. us fda approved each unit 612 nrs 253 one loop & triple loop snare snare kit ( 2 35mm diameter, 90 degree nitinol & gold plated tungsten loop ) and multiloop snare kit ( 2 45mm diameter, three interlaced nitinol loops ) for foreign body retrieval, should come with flexible, reinforced, strain relief hub to reduce buckling and unique peel away insertion tool. usfda approved each unit 613 nrs 254 ptca kit ( 1 ) three port manifold with knobs to turnright when open ( 2 ) one pressure line, ( 3 ) fluid connecting line, ( 4 ) contrast connecting line, ( 5 ) one three way stop cock, ( 6 ) one yconnector hemoststic valve with spring type push and release mechanism, ( 7 ) one inflation device with manometer upto 30 atm ( easy to operate with luminescent dial ) , ( 8 ) one luer lock controlled syringe of 10 ml with finger grip, ( 9 ) insertion needle, ( 10 ) torque device.usfda approved each unit 614 nrs 255 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 5fr. each unit 615 nrs 256 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 6fr each unit 616 nrs 257 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes are 7fr. each unit 617 nrs 258 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes 8fr. each unit 618 nrs 259 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material.sizes are 10fr. each unit 619 nrs 260 closed suction catheter for paediatrics number and color coded graduations for controlled depth suctioning.separate y connectors available for different tubes in the pack.catheter is made up of medical grade silicon material. sizes 12fr. each unit 620 nrs 261 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3mm. each unit 621 nrs 262 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 3.5mm. each unit 622 nrs 263 paediatric endotracheal tube paediatric microcuff designed according to the paediatric anatomy.cuff is made up of polyurethane, thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 11 cmh2o.burst pressure of cuff is 805cmh2o.anatomically based intubation depth marking with precision bands.cuff with play mode function. sizes are 5.5mm each unit 623 nrs 264 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 5.5mm. each unit 624 nrs 265 adult endotracheal tube cuff is made up of polyurethane.thickness of cuff is 10 microns.microcuff seals at an average cuff pressure of 20 cmh2o.burst pressure of cuff is 800cmh2o.cuff with play mode function. sizes 10mm. each unit 625 nrs 266 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. t size 13fr . each unit 626 nrs 267 kimvent bal cath non bronchoscopic bal for bronchial aspirate sampling. can be performed in minutes at bedside. directional tip allows right or left lung sampling.maintains peep when used with supplied ventilator adapter. soft, cushioned, radiopaque tip for safe sampling. protected with outer catheter covering. sizes 16fr. each unit 627 nrs 268 disposable spo2 sensor it should be base on original nellcor technology with original oximax technology each unit 628 nrs 269 catheter mount double swivel connector, it should have bronchoscopy port . it sholud be approved by us fda each unit 629 nrs 270 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 12, length ( 0.8 – 5.0 ) each unit 630 nrs 271 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 14 length ( 0.8 – 5.0 ) each unit 631 nrs 272 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 16 length ( 0.8 – 5.0 ) each unit 632 nrs 273 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 18, length ( 0.8 – 5.0 ) each unit 633 nrs 274 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilizedsize – 20 length ( 0.8 – 5.0 ) each unit 634 nrs 275 gastrostomy feeding tube medical grade silicone construction.low profile design.tapered distal tip, silicone internal retention balloon.distal tip recessed at 5m.lproximal anti reflux valve.secur lok extention set connector mechanism, radiopaque stripe, gamma sterilized size – 24fr length ( 0.8 – 5.0 ) each unit 635 nrs 276 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 14fr each unit 636 nrs 277 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 20fr each unit 637 nrs 278 percutaneous endoscopic gastrostomy ( peg ) medical grade silicone construction.external retention ring .universal and bolus feeding port connectors, medication port.collapsible internal retention bumper.radiopaque stripe and bumper.tubing clamp.eto sterilized.sizes – 24fr each unit 638 nrs 279 silk protein based sterile surgical pu foam dressing non adhesive biomodified, silk protein based, sterile, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8% and asiaticoside nlt 0.6%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 639 nrs 280 silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing non adhesive biomodified, silk protein & silver impregnated, soft, conformable, absorbent, double layered polyurethene foam dressing comprised of silk protein 8%, asiaticoside nlt 0.6% and silver 1.2%, with super fluid handling capacity, decreases the risk of maceration, sterlization gamma sterlized each unit 640 nrs 281 silk protein & antimicrobial silver based sterile surgical mesh wound dressing biomodified, bilaminated silk protein and silver wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6% and, sterlization gamma sterlizedsilver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 641 nrs 282 silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet biomodified, bilaminated silk protein & silver based surgical wound dressing comprised of activated silk matrix 46% and asiaticoside 0.6% and silver :1.2%. non adhesive, square / rectangular in shape, sterlization gamma sterlized each unit 642 nrs 283 silk protein derived sterile surgical meshed wound dressing biomodified, bilaminated silk protein wound dressing with mesh pores to facilitate the easy drainage of exudates, comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular in shape, sterlization gamma sterlized each unit 643 nrs 284 silk protein based sterile surgical wound dressing sheet biomodified, bilaminated silk protein wound dressing comprised of activated silk matrix 46% and asiaticoside nlt 0.6%. non adhesive dressing, square / rectangular shape, sterlization gamma sterlized each unit 644 nrs 285 silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver biomodified silk protein and silver based wound healing ointment comprised of silk powder 8% , asiaticoside nlt 0.6% and silver:1.2%, sterlization gamma sterlized each unit 645 nrs 286 silk protein and nanosilver based microbicidal sterile surgical wound dressing sprinkling powder bottle biomodified silk protein and silver based microbicidal sprinkling powder, comprised of silk powder 8%, asiaticoside nlt 0.6% and silver :1.2% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 646 nrs 287 silk protein based sterile surgical wound dressing sprinkling powder bottle biomodified silk protein based wound healing sprinkling powder, comprised of silk powder 8% and asiaticoside nlt 0.6% . conforms to any wound shape and size, easy to apply, sterlization gamma sterlized each unit 647 nrs 288 centella asiatica extract based skin moisturization and antiscar gel centella asiatica extract based skin moisturization and antiscar gel, comprised of centella asiatica extract, glycerol and vitamin e., sterlization gamma sterlized each unit 648 nrs 289 silk protein based sterile surgical particle wound dressingbiomodified, bioabsorbable silk protein and collagen containing particle wound dressing, comprised of silk powder 8% , asiaticoside 0.6% and collagen , having natural moisturizing factor ( nmf ) , suitable for cavity wound and any kind of slow and non healing wound, sterlization gamma sterlized each unit 649 nrs 290 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 650 nrs 291 silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 10ml biomodified, bioabsorbable silk protein, collagen and silver containing broadspectrum antimicrobial particle wound dressing , comprised of silk powder 8%, asiaticoside 0.6% , having natural moisturizing factor ( nmf ) , suitable for deep, tunneling cavity wound or any kind of slow and non healing wound, sterlization gamma sterlized each unit 651 nrs 292 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 652 nrs 293 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*25cm, silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 653 nrs 294 silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 15*15cm silk protein and nanocrystalline silver based highly conformable sterile antimicrobial dressing with adhesive backing and absorbent layer , sterlization gamma sterlized each unit 654 nrs 295 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*20cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 655 nrs 296 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*25cm , silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlization gamma sterlized each unit 656 nrs 297 silk protein and pu foam pad with self adhesive border, water proof dressing for postoperative scar or any scar management 10*21.5cm s silk protein based highly conformable sterile pu foam with antiscarring properties and adhesive backin, sterlizationgamma sterlized each unit 657 nrs 298 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 658 nrs 299 silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cm silk protein, nanocrystalline silver & asiaticoside based highly conformable sterile antimicrobial surgical and scar free wound healing dressing with adhesive backing and absorbent layer, sterlization gamma sterlized each unit 659 nrs 300 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 660 nrs 301 silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*25cm . silk protein & nanocrystalline silver based sterile, nonadherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 661 nrs 302 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlizationgamma sterlized each unit 662 nrs 303 silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm . silk protein based sterile, non adherent, antimicrobial gauze dressing , sterlization gamma sterlized each unit 663 nrs 304 papain urea & silk protein based wound debriding ointment and cream 25gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 664 nrs 305 papain urea & silk protein based wound debriding ointment and cream 50gm papain urea based debriding ointment and cream for removal of necrotic tissue and slough in infected wounds, containing papain ip : >521700 units and urea ip : 100mg each unit 665 nrs 306 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 666 nrs 307 silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 50gm broad spectrum antiseptic and antimicrobial topical ointment containing povidone iodine usp: 5% w / w, silk protein, centella asiatica for prevention of skin and wound infections. each unit 667 nrs 308 anti microbial gloves each unit 668 nrs 309 anterior chamber iol pmma material, single piecekelman multiflex design5 6 mm optic size with 12 13 mm overall size biconvex power range +12 to +24should be iso or ce certified. manufacturer should be asked to sample for approval. each unit 669 nrs 310 capsular tension ring standard capsular tension ringpmma material with one eyelet each at each end 10 mm to 12 mm overall diameter sterile should be iso / ce certified mfg. each unit 670 nrs 311 iris hooks / retractors set of five disposable sterile iris hooks with soft silicon stopper sterile peek should be made pmma iso / ce certified mfg. each unit 671 nrs 312 silicone rod for ptosis repair implantable flexible silicon rod attached to malleable sharp needles with a silicon sleeve. needlelength 60 70mm diameter 920 μ length of silicone rod 40cm, length of silicon sleeve 0.7 mm. each unit 672 nrs 313 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 673 nrs 314 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 674 nrs 315 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 675 nrs 316 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 676 nrs 317 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 677 nrs 318 reusable anaesthetia face mask of silicone autocalvable & pure transparent. us fda approved and size should be mentioned on mask. each unit 678 nrs 319 flow regulator extension set flow rate 2ml to 350ml per hour each unit 679 nrs 320 sterile disposable hypodermic needle no. 18x1½ each unit 680 nrs 321 sterile disposable hypodermic needle no. 21x1½ each unit 681 nrs 322 sterile disposable hypodermic needle no. 23x1½ each unit 682 nrs 323 neonatal single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 683 nrs 324 paed. single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 684 nrs 325 adult single heated wire breathing system with auto fill humidification chamber in sterile pack and us fda approved. should be compatible every humidifier. each unit 685 nrs 326 neonatal high flow nasal cannula having 8 litre flow. should have soft tip . each unit 686 nrs 327 pur xro catheter 20 cm, 28g / 1fr picc line with stylet, splitting needle with securing wings with 8 cm extension tubing ( flow rate 1ml / min ) each unit 687 nrs 328 pur xro catheter 30 cm, 24g / 2fr picc line with split cannula and 10cm extension tubing over catheter ( flow rate 0.2ml / min ) each unit 688 nrs 329 dead body bag 7x3 ft size leak proof material pp closed on all other sides and zipped on front or on 3 sides each unit 689 nrs 330 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 690 nrs 331 introducer sheath with puncture needle for adults us fda approved· 10 11 cm long· pack must include 18 g, 6 7.5 cm long puncture needle: 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 691 nrs 332 intoducer sheath for adults ( size 10 fr.. ) ( standard length ) us fda approved us fda + ce / dgci approved· 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 692 nrs 333 intoducer sheath for adults ( size 11 fr. ) ( standard length ) us fda approved us fda + ce / dgci approved· · 10 11 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertionus fda + ce / dgci approved each unit 693 nrs 334 long introducer sheath ( 20 30 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 694 nrs 335 long introducer sheath ( 20 30 cm long ) ( size 6fr. ) us fda + ce / dgci approved· .· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 695 nrs 336 long introducer sheath ( 20 30 cm long ) ( size 7fr. ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 696 nrs 337 long introducer sheath ( 20 30 cm long ) ( size 8fr ) us fda + ce / dgci approved· · sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 697 nrs 338 long introducer sheath ( 20 30 cm long ) ( size 9fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 698 nrs 339 long introducer sheath ( 20 30 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 699 nrs 340 long introducer sheath ( 20 30 cm long ) ( size 11fr. ) us fda + ce / dgci approved· sheath should be between 20 30 cm long· 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 700 nrs 341 trans radial introducer sheeths 4f us fda + ce / dgci approved· sizes 4 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 701 nrs 342 trans radial introducer sheeths 5f us fda + ce / dgci approved· sizes 5 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 702 nrs 343 trans radial introducer sheeths 6f us fda + ce / dgci approved· sizes 6 french 10 20 cm long· pack must include 18 g, 21 g, 6 7.5 cm long puncture needle· 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 703 nrs 344 steerable introducer sheeths 5f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 704 nrs 345 steerable introducer sheeths 6fr us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 705 nrs 346 steerable introducer sheeths 7f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 706 nrs 347 steerable introducer sheeths 8fus fda + ce / dgci approved· size 55 to 90 cms·to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 707 nrs 348 steerable introducer sheeths 9f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 708 nrs 349 steerable introducer sheeths 10f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 709 nrs 350 steerable introducer sheeths 11f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 710 nrs 351 steerable introducer sheeths 12f us fda + ce / dgci approved· size 55 to 90 cms· to provide greater access to reaching target with ergonomic handle design· movable tip for different curves and torquability to ready vessel each unit 711 nrs 352 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 712 nrs 353 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 713 nrs 354 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 714 nrs 355 long braded introducer sheath – us fda approved us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 715 nrs 356 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 716 nrs 357 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during ins ertion each unit 717 nrs 358 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 718 nrs 359 long braded contra lateral introducer sheath us fda + ce / dgci approved· should be 20 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 719 nrs 360 long introducer sheath ( 30 50 cm long ) ( size 5fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 720 nrs 361 long introducer sheath ( 30 50 cm long ) ( size 6 fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 721 nrs 362 long introducer sheath ( 30 50 cm long ) ( size 7fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 722 nrs 363 long introducer sheath ( 30 50 cm long ) ( size 8fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 723 nrs 364 long introducer sheath ( 30 50 cm long ) ( size 9fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 724 nrs 365 long introducer sheath ( 30 50 cm long ) ( size 10fr.. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 725 nrs 366 long introducer sheath ( 30 50 cm long ) ( size 11fr. ) us fda + ce / dgci approved· between 30 50 cm long · 0.035 or 0.038 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 726 nrs 367 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 727 nrs 368 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 728 nrs 369 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 729 nrs 370 long introducer sheath dedicated for transradial access us fda + ce / dgci approved· between 7 11 cm long · 0.021 or 0.025 inch guide wire compatible · with haemostatic valve to prevent back leak and air aspiration· integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion· with smooth and resistance free insertion each unit 730 nrs 371 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 731 nrs 372 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 732 nrs 373 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 733 nrs 374 long introducer sheath us fda + ce / dgci approved· should be 90 cm and above · 0.021 or 0.025 inch guide wire compatible· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant · with dilator hub lock mechanism to prevent its back out during insertion each unit 734 nrs 375 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 735 nrs 376 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 736 nrs 377 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.035 size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 737 nrs 378 ptfe coated diagnostic guide wire – ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 145 180 cm long· should be available as straight & j shaped tip· should be available in variable lengths of flexible / floppy end· should be available in variable j tip sizes· should be available fixed as well as movable core. each unit 738 nrs 379 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 739 nrs 380 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032, inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 740 nrs 381 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in , 0.035 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 741 nrs 382 ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size· should be 240 300 cm long· should be available as straight or j shaped tip· should be available fixed as well as movable core. each unit 742 nrs 383 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.032 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 743 nrs 384 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.035 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 744 nrs 385 ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type us fda + ce / dgci approved· should be available in 0.038 inches size· should be between 240 300 cm long· should be available as straight & jshaped tip each unit 745 nrs 386 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.025 inches size· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 746 nrs 387 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.032 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 747 nrs 388 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved·should be available in 0.035 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 120 300 cm long each unit 748 nrs 389 hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 120 300 cm long each unit 749 nrs 390 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.025 inchessize· should have superelastic alloy core·should have super flexible wire tip·should be available in straight and angled tip·should be between 150 180 cm long each unit 750 nrs 391 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.032, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 150 180 cm long each unit 751 nrs 392 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.035 inches size· should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 752 nrs 393 radiofocus miniplastic guidewire ( , regular stiffness ) us fda + ce / dgci approved· sould be available in 0.038 inches size·should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 150 180 cm long each unit 753 nrs 394 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.025, inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip· should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 754 nrs 395 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.032 inches size· should have superelastic alloy core·should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 755 nrs 396 radiofocus miniplastic guidewire ( long length ) us fda + ce / dgci approved· should be available in 0.038 inches size·should have superelastic alloy core· should have super flexible wire tip· should be available in straight and angled tip·should be between 260cm, 300 cm50 180 cm longus fda + ce / dgci approved each unit 756 nrs 397 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 757 nrs 398 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 758 nrs 399 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 759 nrs 400 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 760 nrs 401 judkins catheter ( jr ) right judkins catheters in various standard curves and lengths. each unit 761 nrs 402 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 762 nrs 403 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 763 nrs 404 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 764 nrs 405 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 765 nrs 406 judkins catheter ( jl ) us fda + ce / dgci approved ·left judkins catheters in various standard curves and lengths. each unit 766 nrs 407 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 767 nrs 408 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 768 nrs 409 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 769 nrs 410 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 770 nrs 411 judkins catheter pigtail us fda + ce / dgci approved left and right judkins catheters in various standard curves and lengths. each unit 771 nrs 412 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 772 nrs 413 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 773 nrs 414 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 774 nrs 415 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 775 nrs 416 multipurpose catheter us fda + ce / dgci approved multipurpose catheters in various standard curves and lengths. each unit 776 nrs 417 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 777 nrs 418 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 778 nrs 419 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 779 nrs 420 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 780 nrs 421 amplatz catheter us fda + ce / dgci approved amplatz left ( al ) catheter in various standard curves and lengths. · each unit 781 nrs 422 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 782 nrs 423 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 783 nrs 424 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 784 nrs 425 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 785 nrs 426 amplatz catheter us fda + ce / dgci approved amplatz right ( ar ) catheter in various standard curves and lengths. · each unit 786 nrs 427 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 787 nrs 428 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 788 nrs 429 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 789 nrs 430 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 790 nrs 431 internal mammary catheter us fda + ce / dgci approved · in various standard curves and lengths. each unit 791 nrs 432 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 792 nrs 433 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 793 nrs 434 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 794 nrs 435 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 795 nrs 436 by pass graft catheter us fda + ce / dgci approved, in various standard curves and lengths. each unit 796 nrs 437 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 797 nrs 438 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 798 nrs 439 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 799 nrs 440 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 800 nrs 441 transradial diagnostic coronary catheter tiger type diagnostic coronary catheters of tig curves and lengths dedicated for trans radial coronary angiography and brachial approach also us fda + ce / dgci approved · each unit 801 nrs 442 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 802 nrs 443 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 803 nrs 444 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 804 nrs 445 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 805 nrs 446 nih catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 806 nrs 447 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 807 nrs 448 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 808 nrs 449 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 809 nrs 450 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 810 nrs 451 cournard catheter us fda + ce / dgci approved ·in various standard curves and lengths. each unit 811 nrs 452 introducer sheaths for pediatric use ( size 4 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 812 nrs 453 introducer sheaths for pediatric use ( size 5 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 813 nrs 454 introducer sheaths for pediatric use ( size 6 fr. ) with j tip / straight introducer wire us fda + ce / dgci approved· between 5.5 7.5 cm long· 0.021 inch straight introducer guide wire· with haemostatic valve to prevent back leak and air aspiration· with integral side port with attached 3 way stopcock· with suture eye for securing sheath· kink resistant· with dilator hub lock mechanism to prevent its back out during insertion· should have smooth and resistance free insertion each unit 814 nrs 455 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 815 nrs 456 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 816 nrs 457 judkins catheter ( pediatric ) us fda + ce / dgci approved·left and right judkins catheters in various standard curves and lengths· must be fda approved each unit 817 nrs 458 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 818 nrs 459 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 819 nrs 460 special judkins coronary catheter with 2.5 cm curve ( pediatric ) us fda + ce / dgci approved each unit 820 nrs 461 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 821 nrs 462 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 822 nrs 463 angiographic double leumen tracking catheter us fda + ce / dgci approved each unit 823 nrs 464 3 ‘french’ diagnostic catheters for neonatal use us fda + ce / dgci approved· pigtail, judkins, multipurpose, cobra and other diagnostic catheters of 3 fr. size·varying lengths and shapes each unit 824 nrs 465 swan ganz catheter us fda + ce / dgci approved each unit 825 nrs 466 swan ganz catheter us fda + ce / dgci approved each unit 826 nrs 467 balloon tipped angiography catheter us fda + ce / dgci approved each unit 827 nrs 468 balloon tipped angiography catheter us fda + ce / dgci approved each unit 828 nrs 469 balloon tipped angiography catheter us fda + ce / dgci approved each unit 829 nrs 470 berman catheter us fda + ce / dgci approved· sizes· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 830 nrs 471 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 831 nrs 472 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection·catheter should be tapered at tip to ensure uniform diameter of the whole catheter·10 cm marking along catheter body to confirm insertion depth each unit 832 nrs 473 berman catheter us fda + ce / dgci approved· should have 6 8 holes proximal to the balloon for dye injection· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· 10 cm marking along catheter body to confirm insertion depth each unit 833 nrs 474 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 834 nrs 475 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 835 nrs 476 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 836 nrs 477 reverse berman catheter us fda + ce / dgci approved· catheter should be tapered at tip to ensure uniform diameter of the whole catheter· should have holes proximal to the balloon for dye injection· should have a hole at the proximal tip to allow the passage over the wire each unit 837 nrs 478 arterial pressure monitor lines ( 100 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 838 nrs 479 arterial pressure monitor lines ( 150 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 839 nrs 480 arterial pressure monitor lines ( 200 cm long ) us fda + ce / dgci approved· should be soft and kink resistant· should give reliable pressure measurements· should have male luer lock connection at one end and a female luer lock connection at the other end· should meet highest medical industrial standards for arterial pressure lines· quality certification should be provided from authorized agencies. each unit 840 nrs 481 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 841 nrs 482 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 842 nrs 483 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved· 16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 843 nrs 484 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 844 nrs 485 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 845 nrs 486 straight long introducer sheath with hydrophilic introducer guide wire us fda + ce / dgci approved·16 cm and above long length, with 0.035 or 0.038 inch hydrophilic mini guide wire .with plastic cannula for arterial puncture each unit 846 nrs 487 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 847 nrs 488 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 848 nrs 489 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 849 nrs 490 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port· with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 850 nrs 491 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible·with radio opaque tip each unit 851 nrs 492 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port.with 0.035 or 0.038 inch guide wire compatible· with radio opaque tip each unit 852 nrs 493 straight reinforced sheath with hydrophilic coating us fda + ce / dgci approved· more than 60 cm long with side arm port·with 0.035 or 0.038 inch guide wire compatible with radio opaque tip each unit 853 nrs 494 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 4f size with the largest id· should have lengths ranging from 40 110 cm each unit 854 nrs 495 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 5f size with the largest id· should have lengths ranging from 40 110 cm each unit 855 nrs 496 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 6f size with the largest id· should have lengths ranging from 40 110 cm each unit 856 nrs 497 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 7 f size with the largest id· should have lengths ranging from 40 110 cm each unit 857 nrs 498 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 8 f size with the largest id· should have lengths ranging from 40 110 cm each unit 858 nrs 499 long sheath for contra – lateral iliac / femoral access us fda + ce / dgci approved· should be kink resistant with a reinforcement mechanism · should be low friction with inner coating to allow catheter manipulation· should have distal radio opaque tip for enhanced visibility on fluoroscopy· should have smooth transition from dilator to seath· should have a proximal hemostasis valve / provision for tuohyborst valve· should be color coded for size identification· should be available in 9 f size with the largest id· should have lengths ranging from 40 110 cm each unit 859 nrs 500 mullin’s sheath for special dilation us fda + ce / dgci approved should be in septal puncture needle should be in 6f septal puncture needle each unit 860 nrs 501 angio.kit / ptca kit ( 3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce / approved each unit 861 nrs 502 micro catheter for super selective catherization usfda / ce approved each unit 862 nrs 503 micro catheter for super selective catherization usfda / ce approved each unit 863 nrs 504 micro catheter for super selective catherization usfda / ce approved each unit 864 nrs 505 micro catheter for super selective catherization usfda / ce approved each unit 865 nrs 506 multi side port catheter infusion for catheter directed thromobolysis usa / fda / ce approved each unit 866 nrs 507 clot retrieval sheath usa / fda / ce approved aspiration catheter 16 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 867 nrs 508 clot retrieval sheath usa / fda / ce approved aspiration catheter 20 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 868 nrs 509 clot retrieval sheath usa / fda / ce approved aspiration catheter 24 f including flow retriever catheter 19 25 mm, 15 18mm , 11 14 mm each unit 869 nrs 510 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 870 nrs 511 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 871 nrs 512 loadable microsphere for embolisation of tumour super absobent polymer drug eluting microsphere for tace ( trans arterial chemo ambolization ) usa / fda / ce approved each unit 872 nrs 513 pcd set puncture needle 18g, 0.035, j stiff stiff wire 0.035 / 80 cm , dilator set , pig tail / malecot catheter 8 24f each unit 873 nrs 514 ring biliary catheter usa / fda / ce approved catheter 8.5 f / 10 / 3 compatible 0.038 length~40 cm , catheter side ports 32 , side port segment length 8 cm , catheter introducer, stiffening cannula , secured device each unit 874 nrs 515 venaseal closure system for varicose veins usa / fda approved n butyl based adhesive formation 50 / 90 / 105 / 120 cm 145 cm ( 3 / 4 / 6 / 8 f , 014 / 0.35 compatible each unit 875 nrs 516 liver access and biopsy needle set usa / fda approved usa / fda approved 18g / 60 cm biopsy needle , 14 g cannula / 53.5 cm length sheath 7f each unit 876 nrs 517 tran jugular intrahepatic porto sytemic shunt ( tips set ) intoducer 10f / 40 cm , toclar diameter 0.038 legth60 cm , cannula 14 g / 51.5 cm each unit 877 nrs 518 percutaneous gastrostomy balloon retention tube set catheter 12 20 f, length 10 cm , balloon 5 20 ml each unit 878 nrs 519 each unit 879 nrs 520 each unit 880 nrs 521 each unit 881 nrs 522 each unit 882 nrs 523 each unit 883 nrs 524 each unit 884 nrs 525 each unit 885 nrs 526 each unit 886 nrs 527 each unit 887 nrs 528 each unit 888 nrs 529 breast nodule localizationwire should have curved locking element that provide superior migration resistance. the localization wire can be repositioned or removed after placement if required. usfda / ce approved each unit 889 nrs 530 disposable semi automatic core biopsy instrument with compatible coaxial needle. should be available with dual penetration throw of 10 and 20mm in single instrument. should be available with fire ready indicator. should be available with compatible coaxial needle set with a blunt tip needle & trocar needle. should be usfda approved. each unit 890 nrs 531 ultra clip disposable breast tissue marker should be available in coil shape & ribbon shape. should have color coded dual triggers identify different marker shape. should be visible in ultrasound, mri, mammography imaging. should be available in needle size of 17 gauge. should be available in coil shape and ribbon shape. each unit 891 nrs 532 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verification marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 892 nrs 533 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 893 nrs 534 bone marrow biopsy needle with diamond bevel tip & tapered distal canula. disposable bone marrow biopsy needle should have ergonomic t handle design with seprate handle cap. should have trocar / diamond tip for easy coring of bone. should have triple crown cannula tip with 6 facets.should be available with narrow acquition cardle with sample size verfication marking should be available in 8, 11, 13 gauze usfda / ce approved each unit 894 nrs 535 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 895 nrs 536 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 896 nrs 537 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 897 nrs 538 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 898 nrs 539 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 899 nrs 540 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit 900 nrs 541 silicone foleys catheter with three noble metal alloy coating consisting of gold, silver & palladium ( coated internally & externally surfaces ) each unit biopsy guns should be spring loaded disposable automatic biopsy gun. should have one handed cocking mechanism with non roll handle design. should have angled deep sample notch for enhanced needle action. should have choice of two firing buttons / dual triger with size color coding.should have penetration depth of 22mm. should have sharp beveled trocar. should have round ergonomic handle with no fire lock. should have etched needle tip is grit blasted. should be available in different gauge size 14, 16, 18, 20 with length size cm 10, 16, 20, 25. with compatible disposable coaxial needle: should be available in all sizes compatible with disposable core biopsy instrument / gun. should have color coded depth stopper that indicate the size and match with compatible size of disposable automatic core biopsy gun / instrument. should have option of blunt tip & sharp tip trocar 901 nrs 542 cutting & coagulations device with tissue fusion ligasure technology having maryland jaw sealer and divider with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. should have the manual cutting mechanism. and it should have including 7mm cutting and coag with usfda . each unit 902 nrs 543 cutting &coagulations device with tissue fusion ligature technology have small jaw tissue sealing system for open procedures vessel sealing instrument with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. should have the manual cutting mechanism.and its should have including 7mm cutting and coag with usfda . each unit 903 nrs 544 cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer and divider 37 cm long 5mm instrument. wide jaw aperture 14.5 mm with shaft rotation of 180 degrees ; multifunctional laparoscopic device for tissue fusion.and its should have including 7mm cutting and coag with usfda . each unit 904 nrs 545 cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries with instrument length between 18 19cm and electrode length between 16 17cm, having 28 degree curved jaw with contoured tip for blunt dissection and having activation both through hand activation and foot activation with a manually controlled cutting mechanism. each unit 905 nrs 546 cutting &coagulations device with tissue fusion ligasuretechnology have36mm jaw length, 180 degree rotatable instrument with curved blade for large volume tissue. should have the manual cutting mechanism. each unit 906 nrs 547 cutting &coagulations device with tissue fusion ligasuretechnology have vessel sealing instrument for open surgeries with reusable clamp length between 16 18cm, with 12 14 degree jaw curve.and its should have including 7mm cutting and coag with usfda . each unit 907 nrs 548 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 908 nrs 549 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 909 nrs 550 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 910 nrs 551 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 911 nrs 552 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 912 nrs 553 double lumen catheter with kit internal juglar / straight ( catheter should be madeup of flexible radiopaque polyurethane with a radiopaque tip, easy visualization in x ray. accessory should be provided like catheter , dialator , introducer, needle 18 g, guidewire with dispencer and injection caps. catheter should be d to have consistent blood flow with laser cut side slot each unit 913 nrs 554 each unit 914 nrs 555 each unit 915 nrs 556 each unit 916 nrs 557 each unit 917 nrs 558 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 918 nrs 559 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 919 nrs 560 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 920 nrs 561 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit 921 nrs 562 transperant surgical wound dressing wuth a dimensional hydrocellularpad microbicidle proteciton and anti microbial property each unit long term double lumen dialysis catheter with kit accessories should be provided ( catheter, pull apart sheath, dialator, tunneling stylet, guide wire j / s, with disppencer and injection caps, symmetrical tip retrograde and antigrade 922 nrs 563 non fibre optic single use adult scope channel width :2.2 mm insertion tube diameter :5.0mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view : 0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :6 mm illumination method :led complete system should be us fda and european ce certified each unit 923 nrs 564 multi vent mask pediatric, multi vent mask pediatric, air entrainment masks, must be safe, simple delivery of variable oxygen concentrations. each mask to includes color coded diluters: green for low concentration, white for medium concentration. locking ring to secure flow setting. must include adaptor for high humidity entrainment. complete kit with 7 ft oxygen tubing. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification. each unit 924 nrs 565 incentive spirometer incentive spirometer with wide flow range between 200 cc / sec and 1200 cc / sec. must have dual chamber design to help create constant resistance that lifts ball when patient maintains inspiration equal to selected adjustable flow setting & clearly marked flow settings for easy monitoring. manufacturer must be us fda registered & certified with en / eu iso 13485 & applicable 510k & ce certification each unit 925 nrs 566 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 926 nrs 567 closed suction catheter mdi port has isolated turbo cleaning chamber for cleaning catheter tip with mdi port.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version. can be used for 72hr. each unit 927 nrs 568 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 928 nrs 569 closed suction catheter has isolated turbo cleaning chamber for cleaning catheter tip.catheter is made up of medical grade silicon material, catheter has zig zag ports for better suctioning. twin peep seals. available in both endotracheal and tracheostomy version.can be used for 72hr. each unit 929 nrs 570 fenestrated tracheostomy tube cuffed with 2 inner cannula, inner cannula should reduce the id by 1mm of tracheostomy tube one inner cannula is with five fenestration holes and one is without fenestration each unit 930 nrs 571 multifocal iol biconvex, single piece designoptic size 6 mm, overall 12 13 mm sizetwo haptics, modified cuv blocking capability360 degrees square edge, sterile packingfoldable lens with insertion via injector, should able to insert in sub 2.8 m.msterile disposable injector with cartridge along with each iolinjector should be of good quality with smooth injection without damaging ioldiopters required +16 to +25 ddiffractive multifocal design with +3 to +4 dioptre additionshould be iso or ce certifiedmanufacturer should be asked to supply samples for approval3 piece feldable 11 28 d each unit 931 nrs 572 glaucoma drainage implant ( valved ) with silicon tube adult each unit 932 nrs 573 glaucoma drainage implant ( valved ) with silicon tube paediatric each unit 933 nrs 574 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 934 nrs 575 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 935 nrs 576 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 936 nrs 577 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 937 nrs 578 eye sphere implants implantable grade pmma sphere for enclueation and evisceration procedure ( pmma ) size / sphere diameter each unit 938 nrs 579 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 939 nrs 580 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 940 nrs 581 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 941 nrs 582 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 942 nrs 583 eye sphere implants implantable grade silicone sphere for enclueation and evisceration procedure ( silicone ) size / sphere diameter each unit 943 nrs 584 monocanalicular self retaining silicone stent for canalicular repair medical graded silicone implant for reconstructing traumatic canalicular lacerations. silicone rod length40mm, silicone rod diameter 0.64 mm each unit 944 nrs 585 lacrimal intubation set for dcr surgery – bicanalicular lacrimal intubation set comprised of two flexible stainless steel probes attached through a hollow medical tube which is used in conventional dcr procedure. probe length probe diameter silicon tube length silicon tube id silicon tube od 11 cm 0.60 mm ( 23g ) 30 cm 0.30 mm 0.64 mm each unit 945 nrs 586 scleral fixiated intraoccular lense having multifoccal toric , three piece foldable intraoccular lense each unit 946 nrs 587 vibratory pep therapy device for pead . patients , deliver airflow vibrations to the patients from 5 30 hz expiratory resistance / frequency dial to allow therapy to be adjusted to patientss needs each unit 947 nrs 588 tracheostomy tube cuffed with sub glotic suction line and with 2 inner cannula kit, inner cannula should reduce the id by 1mm of tracheostomy tube each unit 948 nrs 589 dry lithium heparin pre filled abg syringe with air removal filter cap 1ml each unit 949 nrs 590 dry lithium heparin pre filled abg syringe with air removal filter cap 3ml each unit 950 nrs 591 epidural and spinal needle kit 16 / 18g should have needle to needle technique without backeye on epidural needle with lenght of 8cm . should have locking mechanism with graduation marking on hub of epidural needle and pencil point spinal needle , should have the marking on the epidural needle with 1 cm distance and marking should starts from 3 cm distance from the tip of the epidural needle . each unit 951 nrs 592 epidural kit with epidural needle marking starts from 3cm from the tip and catheter fixation device with locking mechanism 16 / 18g each unit 952 nrs 593 central line triple lumen with y needle and nitinol guide wire 8.5 fr with 16cm / 20cm catheter with tecoflex material each unit 953 nrs 594 central line quadra lumen with y needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 954 nrs 595 central line quadra lumen with straight needle and nitinol guide wire 8.5 fr with 15cm / 20cm catheter with tecoflex material each unit 955 nrs 596 peripherally inserted central line for high flow / power injection sterile made of polyurethane single 55 cm long, 5 french single, double and triple lumen made of polyutherane with guide wire & microintroducer. should deliever infusion at 5 ml / sec rate and have reverse taper hub to provide kink resitance. introducer needle of 21 g. and used for power injection & monitoring cvp . each unit 956 nrs 597 latex folley balloon catheter each unit 957 nrs 598 latex folley balloon catheter each unit 958 nrs 599 ryle’s tube each unit 959 nrs 600 ryle’s tube each unit 960 nrs 601 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 961 nrs 602 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 962 nrs 603 post operative surgical cover dressings hydrofiber dressings with 1.2% w / w impregnated ionic silver & tripple hydrocolloid matrix dressings with broad spectrum bactricidal efficacy with gel forming technology, ce, iso & fda approved each unit 963 nrs 604 2 pcs flat base ostomy body fit 60 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm, elastic tape in semi circular shape with hydrocolloid adhesive for extra security of base plate. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 964 nrs 605 2 pcs flat base ostomy body fit 70 mm kit 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 965 nrs 606 2 pcs convex base ostomy body fit 60 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 966 nrs 607 2 pcs convex base ostomy body fit 70 mm kit two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) , neutral grey colour standerd size belt compatible for bags having 4 ear hooks each unit 967 nrs 608 1 pcs trasnparent colostomy body fit 60mm kit one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. adhesive remover spray consists of hexamethyldisiloxane and cyclonentasiloxane silicone polymers for easy removal of the base plate, alcohol free, sting free 50 ml. cream to maintain peristomal ph value ( 5.5 ) of skin contain magnesium citrate, glycerine, petrolatum, citric acid to moisturize and prevent damage to skin 60 ml. non alcoholic ostomy paste for filling and sealing the peristomal skin around the stoma contains polyaliphatic hydrocarbon , water base , gaur gum 60 gm. ostomy powder with natural ingredients such as cmc, guar gum and xanthan gum for peristomal skin excoriation 25 gm. cleanser to clean skin exposed to intestinal secretions consist of isopropyl alcohol, allantoin, natural coconut oil . lubricating deodorant to neutralize odour and provide lubricating effect to ensure content at the bottom not around stoma for easier to empty bag 250 ml. skin barrier for healthy peristomal skin or risk of skin damage due to bady secretions or skin damage already developed consist of polyethylene, plasticizer, polyamide, artificial resin, cmc, sis ( 20cm*20cm ) each unit 968 nrs 609 2 pcs flat base ostomy body fit bag 60 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm each unit 969 nrs 610 2 pcs flat base ostomy body fit bag 70 mm 2 piece system base plate with body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock. colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. one side transparent for inspection. 70mm. each unit 970 nrs 611 2 pcs convex base ostomy body fit bag 60 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 60mm. each unit 971 nrs 612 2 pcs convex base ostomy body fit bag 70 mm two piece system 6 mm aperture convex with integrated flex line base plate. body fit additional elastic adhesive technology ( elastic modulus 0.18 n / mm ) , with 4 ears belt lock.colostomy bag, consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. audible click sound locking system with highlighted colour lock button. coupling with wave shaped locking bag. window on bag for inspection 70mm. each unit 972 nrs 613 1 pcs trasnparent colostomy body fit bag 60mm one piece colostomy bag body fit additional elastic adhesive technology ( elastic modulus0.34 n / mm ) , bag consists one barrier foil and a oecotex certified water repellent textile neutral grey colour material. triple layer filter with full circle pre filter and three times fold velcro locking drainage. one side transparent for inspection 60mm. each unit 973 nrs 614 non fibre optic single use large scope channel width :2.8mm insertion tube diameter :5.8 mm. working length :600 mm bending range :180 degree up & 160 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :7 mm illumination method :led complete system should be us fda and european ce certified. each unit 974 nrs 615 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 975 nrs 616 antimicrobial silver dresssing sterile non occulusive wound contact layer consists of silver healing matrix made of polyester mesh impregnated with hydrocolloid particles ( cmc ) , petroleum jelly, polymers and silver salts with demonstrated in vitro antibacterial activity upto 7 days, using patented lipido colloid technology ( tlc ) each unit 976 nrs 617 non fibre optic single use cysto scope for djr & diagnostic cystoscope it should be capable of easy navigation and fast identification of anatomical landmarks the scopes should be sterile packed one cmos camera and two led light source should be integrated at the distal end minimum length of the scope should be 380 400mm working channel should be of 6.5 6.6 fr the control lever on handle for the movement of distal tip up & down in a single plane with 210 degree up and 120 degree down each unit 977 nrs 618 non fibre optic single use paediatrics scope channel width :1.2mm insertion tube diameter :3.8 mm. working length :600 mm bending range :180 degree up & 180 degree down field of view :85 degree or more direction of view :0 degree ( forward view ) depth of field :8 50 mm or better minimum ett inner dia :5 mm illumination method :led complete system should be us fda and european ce certified. each unit 978 nrs 619 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 979 nrs 620 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 980 nrs 621 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 981 nrs 622 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 982 nrs 623 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 983 nrs 624 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 984 nrs 625 sterile self adherent with lipido colloid technology sterile self adherent patented tlc matrix ( lipido colloid technology ) wound contact layer combined with absorbent polyurethane foam pad , a superabsorbent layer , a vapour permeable waterproof outer film with soft silicone adhesive border on the edges for atraumatic removal and repositioning of dressing. each unit 985 nrs 626 100% polysiloxane based scar management in gel form pure poly siloxane based silicone scar management product in sheet form ( we also should mention about the 100% poly siloxane and nylon polyamide mesh ) each unit 986 nrs 627 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 987 nrs 628 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 988 nrs 629 triple hydrocolloid skin barrier where no cutting is required comprised of pectin, gelatin and sodium carboxy methyl cellulose, elastomeric polymers extending turtlenecking effect and rebounding memory technology with audible click and flexible tape collar. each unit 989 nrs 630 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 990 nrs 631 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 991 nrs 632 drainable pouch 12, with filter embeded & 2 sided hydrophobic comfort panel standard, opaque with integrated dotted velcro tail closure each unit 992 nrs 633 sulu stepped cartridges for variable tissue application , fixed anvil , different leg length staples in same cartridge , inbuilt knife , size 60 mm inner to outer side 3.0, 3.5 and 4.0 mm , purple colour code, usfda approved each unit 993 nrs 634 titanium total ossocular replacement prosthesis ( torp ) each unit 994 nrs 635 titanium partial ossocular replacement prosthesis ( porp ) each unit 995 nrs 636 piston titanium ( 0.4mm ) diameter each unit 996 nrs 637 piston titanium ( 0.4mm ) diameter each unit 997 nrs 638 piston titanium ( 0.4mm ) diameter each unit 998 nrs 639 piston titanium ( 0.4mm ) diameter each unit 999 nrs 640 piston titanium ( 0.6mm ) diameter each unit 1000 nrs 641 piston titanium ( 0.6mm ) diameter each unit 1001 nrs 642 piston titanium ( 0.6mm ) diameter each unit 1002 nrs 643 piston titanium ( 0.6mm ) diameter each unit 1003 nrs 644 piston titanium teflon mix ( 0.4mm ) diameter each unit 1004 nrs 645 piston titanium teflon mix ( 0.4mm ) diameter each unit 1005 nrs 646 piston titanium teflon mix ( 0.4mm ) diameter each unit 1006 nrs 647 piston titanium teflon mix ( 0.4mm ) diameter each unit 1007 nrs 648 piston titanium teflon mix ( 0.6mm ) diameter each unit 1008 nrs 649 piston titanium teflon mix ( 0.6mm ) diameter each unit 1009 nrs 650 piston titanium teflon mix ( 0.6mm ) diameter each unit 1010 nrs 651 piston titanium teflon mix ( 0.6mm ) diameter each unit 1011 nrs 652 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1012 nrs 653 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1013 nrs 654 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1014 nrs 655 piston teflon ( ptfe ) ( 0.4mm ) diameter each unit 1015 nrs 656 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1016 nrs 657 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1017 nrs 658 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1018 nrs 659 piston teflon ( ptfe ) ( 0.6mm ) diameter each unit 1019 nrs 660 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.5 mm each unit 1020 nrs 661 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 0.6 mm each unit 1021 nrs 662 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting / 0.8 mm each unit 1022 nrs 663 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 1.6 mm each unit 1023 nrs 664 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.3 mm each unit 1024 nrs 665 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 2.8 mm each unit 1025 nrs 666 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3 mm each unit 1026 nrs 667 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 3.5 mm each unit 1027 nrs 668 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 4 mm each unit 1028 nrs 669 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) cutting 5 mm each unit 1029 nrs 670 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.5 mm each unit 1030 nrs 671 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 0.6 mm each unit 1031 nrs 672 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond / 0.8 mm each unit 1032 nrs 673 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 1.6 mm each unit 1033 nrs 674 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.3 mm each unit 1034 nrs 675 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 2.8 mm each unit 1035 nrs 676 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3 mm each unit 1036 nrs 677 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 3.5 mm each unit 1037 nrs 678 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 4 mm each unit 1038 nrs 679 burr tips ( tungeston carbide material ) round tip ( 70 mm length ) diamond 5 mm each unit 1039 nrs 680 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 1 mm each unit 1040 nrs 681 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 3, mm each unit 1041 nrs 682 burr tips ( tungeston carbide material ) round tip fissure burr 70 mm to 95 mm length 5 mm each unit 1042 nrs 683 sialestic sheet 55*75 mm and thickness 0.5 mm each unit 1043 nrs 684 ear pack / wick ( 12*24 mm length ) each unit 1044 nrs 685 t tube ( silicone ) 9 mm length each unit 1045 nrs 686 nasal haemostatic sponge pack with out airway 8 inch each unit 1046 nrs 687 nasal haemostatic sponge pack with out airway 10 inch each unit 1047 nrs 688 nasal haemostatic sponge pack ( with airway ) 8 inch each unit 1048 nrs 689 tracheostomy tube ( pvc material ) double lumen 3.5 8mm all size each unit 1049 nrs 690 tracheostomy tube ( pvc material ) fenestrated 3.5 8mm all size each unit 1050 nrs 691 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1051 nrs 692 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1052 nrs 693 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1053 nrs 694 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1054 nrs 695 femoral sheath including pott’s needle, j tipped wire, dilator and sheath all sizes each unit 1055 nrs 696 diagnostic catheter ar 1 aka amplatz right each unit 1056 nrs 697 diagnostic catheter ar 1 aka amplatz right each unit 1057 nrs 698 diagnostic catheter vert angled tip 125cm each unit 1058 nrs 699 diagnostic catheter sim 1 aka simmon’s each unit 1059 nrs 700 diagnostic catheter sim 1 aka simmon’s each unit 1060 nrs 701 diagnostic catheter sim 2 aka simmon each unit 1061 nrs 702 diagnostic catheter sim 3 aka simmon each unit 1062 nrs 703 diagnostic catheter h 1 aka headhunter each unit 1063 nrs 704 diagnostic catheter pigtail each unit 1064 nrs 705 guide wire hydrophilic coated angled tip soft regular standard each unit 1065 nrs 706 guide wire hydrophilic coated angled tip extra stiff each unit 1066 nrs 707 guiding catheter braided guiding catheter in various shapes each unit 1067 nrs 708 guiding catheter braided guiding catheter in various shapes each unit 1068 nrs 709 guiding catheter braided guiding catheter in various shapes each unit 1069 nrs 710 guiding catheter braided guiding catheter in various shapes each unit 1070 nrs 711 guiding catheter braided guiding catheter in various shapes each unit 1071 nrs 712 guiding catheter braided guiding catheter in various shapes each unit 1072 nrs 713 guiding catheter balloon tipped guiding catheter size each unit 1073 nrs 714 distal access catheter each unit 1074 nrs 715 distal access catheter each unit 1075 nrs 716 intracranial support catheter with flat soft distal segment each unit 1076 nrs 717 intracranial support catheter with flat soft distal segment each unit 1077 nrs 718 flexometlic tube 3 8.5 with stylet reinforce et tube with wiring from tip to end it should be approved by *us fda each unit 1078 nrs 719 act tubes us fda + ce / dgci approved· disposable act tubes compatible with existing medtronic machines at smsh· should meet highest medical industrial standards· quality certification should be provided from authorized agencies. each unit 1079 nrs 720 high – presure injector lines us fda + ce / dgci approved· should be available in various lengths· should have male and female luer locks· should be transparent and kink resistant· should be able to take high pressure of angiographic injections each unit 1080 nrs 721 disposable transducers for invasive pressure monitoring compatible with available system in cath lab in smsh us fda + ce / dgci approved· disposable transducers for invasive pressure monitoring· should be compatible with available system in cath lab ( iabp – data scope & cath lab transducer ) and iccu at smsh· should meet highest medical industrial standards· quality certification should be provided form authorized agencies each unit 1081 nrs 722 renal double curve catheter us fda + ce / dgci approved· each unit 1082 nrs 723 simmons / sidewinder catheter us fda + ce / dgci approved· each unit 1083 nrs 724 vertebral catheter each unit 1084 nrs 725 coeliac axis catheter us fda + ce / dgci approved· each unit 1085 nrs 726 shepherd’s hook catheter us fda + ce / dgci approved· each unit 1086 nrs 727 vtk diagnostic catheter us fda + ce / dgci approved· each unit 1087 nrs 728 angiographic sizing pigtail catheter 5fr us fda + ce / dgci approved each unit 1088 nrs 729 angiographic sizing pigtail catheter 6fr us fda + ce / dgci approved each unit 1089 nrs 730 angiographic sizing pigtail catheter 7fr us fda + ce / dgci approved each unit 1090 nrs 731 balloon inflation catheter for brto usa / fda / ce approved 9 / 10 f 0.035 compatible , length100 / 120 cm , max volume 30 / 40 cc each unit 1091 nrs 732 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1092 nrs 733 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1093 nrs 734 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1094 nrs 735 dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1095 nrs 736 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1096 nrs 737 pediatric dialyzer ( dialyzer should be synthetic membran ( poly sulfon / poly ethresulfon ) each unit 1097 nrs 738 multirate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate from 1 7 / hr and 2 14ml / hr each unit 1098 nrs 739 single rate elastomeric disposable infusion pump with air vent blue end cap for air bubble removal and with two micro iv filters in 100 ml & 275 ml with flow rate of 2, 5, 8, 10ml / hr each unit 1099 nrs 740 pct kit with griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1100 nrs 741 pct kit without griggs forceps and with subglotic suction line tracheostomy tube with usfda / european ce each unit 1101 nrs 742 double lumen closed suction set for et and tt , with mdi adopter , trach wedge , swiel connector and with reservoir each unit 1102 nrs 743 et tube with yellow subglotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1103 nrs 744 tt tube with yellow sub glotic suction line with inverted and soft seal cuff. with usfda / european ce each unit 1104 nrs 745 catheter stabilization device sterile latex free sutureless with sliding post each unit 1105 nrs 746 titanium maxillofacial fracture fixation miniplate 2.5 mm each unit 1106 nrs 747 titanium maxillofacial fracture fixation miniplate 2.0 mm each unit 1107 nrs 748 titanium maxillofacial fracture fixation miniplate 1.5 mm each unit 1108 nrs 749 titanium maxillofacial fracture fixation miniplate 1.5 mm c plate each unit 1109 nrs 750 titanium maxillofacial fracture fixation miniplate 2.5 mm l plate right and left side each unit 1110 nrs 751 titanium maxillofacial fracture fixation miniplate 2.0 mm l plate right and left side each unit 1111 nrs 752 titanium maxillofacial fracture fixation screws 1.5 mm each unit 1112 nrs 753 titanium maxillofacial fracture fixation screws 2.0 mm each unit 1113 nrs 754 titanium maxillofacial fracture fixation screws 2.5 mm each unit 1114 abdominal suction set each unit 1115 arterial line each unit 1116 av blood line each unit camscanner...

Dr. S.N.Medical College - Rajasthan

33900476 supply of various laboratory items of m.m.n.n.j.y various laboratory items of m.m.n.n.j.y , paraffin wax 60 62°c with ceresinqty ( 1 kg. ) , absolute alcohol ( ethanol ) qty ( 500 ml ) , distilled waterqty ( 5 lit. ) , xylene qty ( 500 ml ) , spirit qty ( 10 liter ) , cotton roll ( item related to schedule 1as per rtpp rules 2013, priority will be given to msme sector hence enclose msme certificate ) qty ( 500gm ) , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 1 pkt.x50 slides ) , chloral hydrateqty ( 500 gm. ) , amonia solutionqty ( 500ml ) , formaldehyde solution 40% qty ( 5 lit. ) , white adhesive tapeqty ( 1 pkt. ) , microtome disposable blade high profile. qty ( 1 pkt. ( 50 blades each ) ) , filter paper round 100x1 pkt qty ( 1 pkt. ) , cassettes3 cm.x2.5cm. ( plastic ) –yellow qty ( 500 in no ) , cassettes3 cm.x2.5cm. ( plastic ) –white qty ( 500 in no ) , latex gloves sterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , latex gloves unsterilized 6.5 / 7.0 / 7.5 no. qty ( 1 pair ) , dextrose qty ( 500 gm. ) , albumin powder qty ( 500 gm. ) , leishman stain qty ( 500 ml ) , sulphur powder qty ( 500 gm. ) , sodium acetate qty ( 500 gm. ) , potassium acetate qty ( 500 gm. ) , potassium nitrate qty ( 500 gm. ) , benedicts solutionqty ( 5 lit. ) , acetone qty ( 500ml. ) , dpx solution qty ( 250 ml ) , cover slip 18x18 0.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x220.1 mm english glass qty ( 1 pack of 50 ) , cover slip22x500.1 mm english glass qty ( 1 pack of 50 ) , glycerine qty ( 500 ml ) , di – ionized water qty ( 10 lit. ) , schiffs reagent qty ( 500 ml ) , bee’s wax qty ( 1 kg. ) , cea ( primary antibodies ) qty ( 7 ml ) , gfap ( primary antibodies ) qty ( 7 ml ) , hmb 45 ( primary antibodies ) qty ( 7 ml ) , desmin ( primary antibodies ) qty ( 7 ml ) , ema ( primary antibodies ) qty ( 7 ml ) , bcl2 ( primary antibodies ) qty ( 7 ml ) , hmwck ( primary antibodies ) qty ( 7 ml ) , ck7 ( primary antibodies ) qty ( 7 ml ) , er ( primary antibodies ) qty ( 7 ml ) , cd30 ( primary antibodies ) qty ( 7 ml ) , cd5 ( primary antibodies ) qty ( 7 ml ) , cd23 ( primary antibodies ) qty ( 7 ml ) , ck20 ( primary antibodies ) qty ( 7 ml ) , ki67 ( primary antibodies ) qty ( 7 ml ) , cd10 ( primary antibodies ) qty ( 7 ml ) , synaptophysin ( primary antibodies ) qty ( 7 ml ) , pr ( primary antibodies ) qty ( 7 ml ) , mpo ( primary antibodies ) qty ( 7 ml ) , pax 5 ( primary antibodies ) qty ( 7 ml ) , cd3 ( primary antibodies ) qty ( 7 ml ) , wt1 ( primary antibodies ) qty ( 7 ml ) , s100 ( primary antibodies ) qty ( 7 ml ) , aei / ae3 ( multi ck ) ( primary antibodies ) qty ( 7 ml ) , sma ( primary antibodies ) qty ( 7 ml ) , inhibin ( primary antibodies ) qty ( 7 ml ) , hpv ( primary antibodies ) qty ( 7 ml ) , p16 ( primary antibodies ) qty ( 7 ml ) , eber ( primary antibodies ) qty ( 7 ml ) , lmp1 ( primary antibodies ) qty ( 7 ml ) , c4d ( primary antibodies ) qty ( 7 ml ) , amyloid ( primary antibodies ) qty ( 7 ml ) , her 2– neu ( primary antibodies ) qty ( 7 ml ) , vimentin ( primary antibodies ) qty ( 7 ml ) , chromogramin ( primary antibodies ) qty ( 7 ml ) , antigens retrival buffer diva decloaker 20x ( for manual ihc staining ) qty ( 250 ml ) , background snipper ( for manual ihc staining ) qty ( 25 ml ) , wash buffer tbs autowash buffer 40x ( for manual ihc staining ) qty ( 250 ml ) , hrp polymer detection kit ( for manual ihc staining ) qty ( 25 ml ) , polylysine coated slides ( for manual ihc staining ) qty ( 1 x 50 ) , peroxidaxed block 1 ( for manual ihc staining ) qty ( 500 ml ) , betazoid dab chromogen ( for manual ihc staining ) qty ( 2 ml ) , betazoid dab substrate buffer ( for manual ihc staining ) qty ( 25 ml ) , cryomatrix ( optimal cooling tool gel coolent ) ( for cryostate ) qty ( 1 x 120 ml ) , sarasil disinfectant ( for cryostate ) qty ( 25 kg ) , chucks for cryostat microtome by thermofisher ( for cryostate ) qty ( 50 pieces ) , microtome blades ( high definition ) qty ( 1 x 50 ) , cell pack dcl qty ( 20 lit. ) , sulfolyser qty ( 5l x 1 ) , lyser cell ( wnr ) qty ( 5l x 1 ) , fluorocell ( wnr ) qty ( 82 ml x 2 ) , lyser cell ( wdf ) qty ( 5l x 1 ) , fluorocell ( wdf ) qty ( 82 ml x 2 ) , cell clean qty ( 50 ml x 1 ) , cell pack dfl ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1.5l x 2 ) , sulfolyser ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 5 lit ) , lyser ( wnr ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 4 lit ) , fluorocell ( ret ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 12 ml x 2 ) , qc xn chesck l / h / n ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 3x3ml ) , xn cal ( calibrator ) ( for 6 part hematology analyzer ( sysmax xn 1000 ) ) qty ( 1x3ml. ) , basic fucshin qty ( 500 ml ) , sodium metabisulfite qty ( 500 gm ) , acetic acid sol. 3% qty ( 500 ml ) , aluminium sulfate qty ( 500 ml ) , nuclear fast red qty ( 500 ml ) , carnime qty ( 500 ml ) , aluminium hydroxide qty ( 500 ml ) , ferric chloride qty ( 500 ml ) , metrial yellow qty ( 25 gm ) , acid fucshin qty ( 25 gm ) , phosphomolybdic acid qty ( 500 gm ) , methyl blue qty ( 25 gm ) , iodine solution qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , koh qty ( 500gm ) , potassium permanganate qty ( 500 gm ) , potassium metabisulfite qty ( 500 gm ) , ( iron alum ) ferric ammmonium sulfateqty ( 100 gm ) , gold chloride qty ( 1 gm ) , oxalic acid qty ( 500 ml ) , aquous phenol qty ( 500 ml ) , toluedene blue qty ( 500 ml ) , silver nitrate qty ( 25 gm ) , safferenine o qty ( 100 gm ) , uristix qty ( 1 pkt of 100 pc ) , sodium hypochioride ( liquid 10% ) solution qty ( 10 lit ) , whatman filter paper no. 42 qty ( 100 sheet ) , combistix qty ( 1 pkt of 100 pc ) , giemsa stain solution qty ( 500 ml ) , ketostix qty ( 1 pkt of 100 pc ) , methanol qty ( 1 lit ) , multistix qty ( 1 pkt of 100 pc ) , uriscan urine test strips qty ( 1 pkt of 100 pc ) , thermometer qty ( 1 pc ) , wbc diluting fluidqty ( 500 ml ) , wbc pipette qty ( 1 pc ) , savlon qty ( 500 ml ) , phenyl qty ( 5 lit ) , glass marking pencil black qty ( 1 pc ) , glass marking pencil red qty ( 1 pc ) , glass marking pencil whiteqty ( 1 pc ) , liquid soap qty ( 1 lit ) , reticulocyte stain solution ( ready to use ) qty ( 1 pkt ) , rbc diluting fluidqty ( 1 lit ) , rbc pipette qty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , semen diluting fluidqty ( 1 ltr ) , slides box plastic for 100 slidesqty ( 1 pc ) , spirit lamp aluminum qty ( 1 pc ) , test tube brushes for cleaning tubesqty ( 1 pc ) , measuring cylinder 50 ml plasticqty ( 1 pc ) , measuring cylinder 100 ml plastic qty ( 1 pc ) , measuring cylinder 500ml plasticqty ( 1 pc ) , measuring cylinder 1000 ml plasticqty ( 1 pc ) , micro centrifuge tubes 2 ml qty ( 1 pc ) , micro centrifuge tubes 1.5 ml qty ( 1 kit ) , measuring cylinder 500 ml glassqty ( 1 pc ) , measuring cylinder 250 mlqty ( 1 pc ) , tips blue ( pack ) size 500 ) qty ( 1 pkt ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt ) , iron stand for stainingqty ( 1 pc ) , plastic cuvettes with stirrer for coagulation analyzer model stastmanufactures by diagnostic stago qty ( 1 pkt ) , pt cuvette of stago with sterrer ( 4*150+1850 ) qty ( 1 pc ) , staining jar 100 ml & 500 ml qty ( 1pc ) , thermal printer paper qty ( 1 pc ) , test tube rack 48 holes for 12 mm + 15mm test tubes qty ( 1 pc ) , disposable sterile container for urine sample / sputum for c / sqty ( 1 pc ) , disposable apron qty ( 1 pc ) , disposable shoe coverqty ( 1 pc ) , disposable caps qty ( 1 pc ) , sodium hypochloride qty ( 5 lit ) , coplin jarqty ( 1 pc ) , diamond pencil qty ( 1 pc ) , drabkin solution with hemoglobin standard qty ( 1 lit ) , dropper plastic 3 ml qty ( 1 pc ) , eosinophil diluting fluidqty ( 1 lit ) , esr pipette disposable qty ( 1 pc ) , field stain a&bqty ( 1 lit ) , flash back needle 22g*1 inch ( for sample collection ) qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , improved neubers glass chamberqty ( 1 pc ) , k3 edta vacutec with 3 ml marking usfda approvedqty ( 1 pc ) , plain vacutte usfda approvedqty ( 1 pc ) , sodium citrate 3.8 % blood collection vacutech with 1.8 ml marking for coagulation analyser qty ( 1 pc ) , safety lock blood collection set with 25g, 0.75 inch needle and tube length ( 12inch ) with luer adapter ( for sample collection ) qty ( 1 pc ) , stretch latex latex free tourniquetqty ( 1 mt ) , sharp collection 1.5 qt ( 1*36 ) qty ( 1 pc ) , sharp collection 5.4 qt ( 1*20 ) qty ( 1 pc ) , thermal paper roll for printing of vasmatic 20 esr machineqty ( 1 pkt. ) , thermal paper roll for vesmatic 20 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , thermal paper roll 5.4qt ( 1.20 ) for uriscan pro ( yd diagnostics ) qty ( 1 pkt ) , thermal paper roll for vesmatic 80 roller 20 , ptmachines ( stago ) qty ( 1 pkt ) , fnac syringe holder , vacutter holderqty ( 1 pkt ) , vacutainer needle 22g flas back qty ( 1 pkt ) , vacutainer needle 22g msn qty ( 1 pkt ) , vacutainer needle 22g eclipse qty ( 1 pkt ) , beaker plastic various size 50 ml qty ( 1 pc ) , beaker plastic various size 100 ml qty ( 1pc ) , beaker plastic various size 250 ml qty ( 1pc ) , beaker plastic various size 500 ml qty ( 1pc ) , beaker plastic various size 1000 ml qty ( 1pc ) , esr stand for disposable esr pipetteqty ( 1pc ) , needle hub cutterqty ( 1pc ) , pt test regent neoptimal qty ( 5 ml x 6 ) , aptt test regents cepha screen qty ( 4 ml x12 ) , fanc syringes holderqty ( 1pc ) , blood roller mixer for sample mixingqty ( 1 pc ) , manual cell counter 5 pointsqty ( 1 pc ) , manual cell counter 10 points qty ( 1pc ) , brilliant cresyl blue ( grade lr ) qty ( 25 gm ) , brilliant cresyl blue solution ( grade lr ) qty ( 100 ml ) , lugol’slodine ( grade lr ) qty ( 100 ml ) , normal saline solution ( grade lr ) qty ( 500 ml ) , oil cedarwood ( grade lr ) qty ( 100 ml ) , uriscan strip ( for urine analyzer pro serial no.ug81202353 yd diagnostics ) qty ( 1 strip ) , choloroform qty ( 1 lit ) , formic acid qty ( 500 ml ) , hematoxylene powder qty ( 25 gm ) , nitric acid solution qty ( 1 lit ) , test tube holder qty ( 1 pc ) , eosin powder qty ( 25 gm ) , sodium fluoride blood collection vacutte usfda approved ( bd ) qty ( 1 pc ) , sodium citrate blood collectin vacutte usfda approved ( bd ) qty ( 1 pc ) , transponder ( 10, 000 ) ( for transasia vasmatic cube 80 ) qty ( 1 pc ) , esbach’s albuminometer qty ( 1 pc ) , stoll occult blood kit qty ( 1 pc ) , pt tk testreagents ck prest ( diagnostica stagoqty ( 2 mlx6 ) , cacl2 0.025 m ( diagnostica stago ) qty ( 2 ml x6 ) , cell pack ( for sysmex xs 800 i ) qty ( 20 ltr ) , stromatolyser 4dl ( for sysmex xs 800 i ) qty ( 5 ltr ) , stromatolyser 4ds ( for sysmex xs 800 i ) qty ( 3x42ml ) , sulpholyser ( for sysmex xs 800 i ) qty ( 5 ltr ) , cell clean ( for sysmex xs 800 i ) qty ( 50ml ) , xse – check control for sysmex xs 800 i ( l1 l2 l3 ) qty ( 4.5 ml x3 ) , esr – control cube ( l1, l2 ) qty ( 1x9ml each ) , coag control ( n+p ) qty ( 12x2xx1ml ) , micropettefixed volume 50u qty ( 1 pc ) , micropettefixed volume 1000u qty ( 1 pc ) , micropettevariablevolume 10 100u qty ( 1 pc ) , micropettevariablevolume 100 1000u qty ( 1 pc ) , finntips for st art li 1.25 ml qty ( 1x100ml ) , test tube holder ( wooden handle with chrome plated material ) qty ( 1 pc ) , microscope led bulb 3.6 volt, 1w qty ( 1 pc ) , picric acidqty ( 500 gm ) , lithium carbonate powder ( sd’s ) qty ( 500gm ) , phloxin powderqty ( 25 gm ) , sodium powderqty ( 500gm ) , sodium nitroprusside powder qty ( 500gm ) , ammonium sulfate qty ( 500gm ) , sulpher powder qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , hydrochloric acid qty ( 500gm ) , potassium alum qty ( 500gm ) , antiseptic solution qty ( 250ml ) , sodium chloride qty ( 500gm ) , per oxidic acidqty ( 10gm ) , potassium aluminium qty ( 500gm ) , three one oil qty ( 1 lit. ) , filter paper full size no. 41 , white cloth ( 22x22 mm ) qty ( 3 mt. ) , rapid pap kit qty ( 1 pkt ) , pas stain kit , v.g.kit , urea qty ( 500gm ) , sodium dihydrogen phosphate qty ( 500gm ) , disodium hydrogen phosphate qty ( 500gm ) , trypsine qty ( 1gm ) , 3 amino prophyl tridthoxysiland ( sigma a3648 ) qty ( 100gm ) , poly l lysine qty ( 25gm ) , hydrogen peroxide liquid qty ( 500ml ) , methanol ch3oh=32.04 purity qty ( 5 lit. ) , boxes for blocks ( 16.5x10.5x2.5 inches ) qty ( 1pc ) , bottles for reagent ( 60ml ) qty ( 1 in no. ) , staining jar 100 ml qty ( 1 pc ) , staining jar 500 ml qty ( 1 pc ) , forceps ( toothes ) 7 inches qty ( 1pc ) , forceps ( toothes ) 5 inches qty ( 1pc ) , poly –l lysine coated glass slides qty ( 1 pkt ) , elite h 580 diluent 20 lit ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 20lit. ) , elite h580 lyse 1 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 2 3x 500 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x500ml ) , elite h580 lyse 3 3x 1000 ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x1000ml ) , elite h580 h clean 50ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 50ml ) , elite h580 control ( l1, l2, l3 ) 3 x 3ml ( reagent for elite 580 hematology analyser ( erba ) ) qty ( 3x3ml ) , calibrator ( erba h cal ) for erba580 1 vial 3ml qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 67021 qty ( 1 vial 3 ml ) , calibrator ssc 1000 xs800i 65835 qty ( 1 vial 3 ml ) , calibrator for vescube 20 / 80 esr analyser qty ( 1 set ) , calibrator for roller 20 esr machine qty ( 1 set ) , diluent ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 20 lit ) , basolyse ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 5 lit ) , nucediff ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , lysebio ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , cleaner ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 1 lit ) , mimoclear ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , fluocyte ( reagent for horiba yumizen h2500 hematology analyser ) qty ( 500 ml ) , horiba quality control l1, l2, l3 qty ( 3 x 3ml ) , horiba quality control reticulocyte count , calibrator forhoriba yumizen h2500 hematology analyser qty ( 1 set ) , calibrator for coagulation analyser sta compact max for all test qty ( 1 set ) , for pt sta neoptimal ( for stago fully automated coagulation analyser sta compact max ) qty ( 10 ml vial ) , for pt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for aptt sta cepha screen ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for aptt sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for aptt sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fibrinogen sta liquid fib ( for stago fully automated coagulation analyser sta compact max ) qty ( 4ml ) , for fibrinogen sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fibrinogen sta coag control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for d dimer sta liatest d dimer plus blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for d dimer sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml vial ) , for d dimer sta liatest control ( for stago fully automated coagulation analyser sta compact max ) qty ( n+p vial ) , for fdp sta liatest fdp blue cap and white cap vial ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta fdp control ( for stago fully automated coagulation analyser sta compact max ) qty ( 1+2 vials ) , for fdp sta owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 15ml ) , for fdp sta fdp calibrator ( for stago fully automated coagulation analyser sta compact max ) , for protein c sta staclot protein c ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x1ml ) , for protein c sta system control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for protein c sta unicalibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for protein s sta staclot protein s ( for stago fully automated coagulation analyser sta compact max ) qty ( 2x1ml ) , for factor v sta deficient 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor v sta neoptimal 10 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x10ml ) , for factor viii sta deficient viii ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for factor viii sta cephascreen ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x4ml ) , for factor viii sta cacl2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor viii owren koller ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , for factor ix sta deficient ix ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for anti thrombin sta deficient at3 ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x3ml ) , for lupus anticoagulant sta stalot drvv screen 2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant sta stalot drvv confirm pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for lupus anticoagulant pool norm ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x1ml ) , for lupus anticoagulant sta stalot la 1+2 ( for stago fully automated coagulation analyser sta compact max ) qty ( 3x2x1ml ) , for vmf sta liatest vwf ag ( for stago fully automated coagulation analyser sta compact max ) qty ( 4x5ml ) , for vmf sta vwf calibrator ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1ml ) , for vmf sta liatest control n+p ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2x1ml ) , for thrombin time sta thrombin time ( for stago fully automated coagulation analyser sta compact max ) qty ( 12x2ml ) , for fdp qualitative fdp plasma ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for d dimer qualitative d di test ( for stago fully automated coagulation analyser sta compact max ) qty ( 1x1.3ml ) , for pttk sta c.k. prest 5 ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x5ml ) , sta cuvettes ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x1000ml ) , sta cleaner ( for stago fully automated coagulation analyser sta compact max ) qty ( 6x2500ml ) , sta desorb u ( for stago fully automated coagulation analyser sta compact max ) qty ( 24x15ml ) , maintenance kit compact ( for stago fully automated coagulation analyser sta compact max ) , yearly maintenance kit ( for stago fully automated coagulation analyser sta compact max ) , white stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , red stirror for pt ( for stago fully automated coagulation analyser sta compact max ) , needle no.1 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.2 compact ( for stago fully automated coagulation analyser sta compact max ) , needle no.3 compact ( for stago fully automated coagulation analyser sta compact max ) , lamp halogen ( for stago fully automated coagulation analyser sta compact max ) , liquid glycol ( for stago fully automated coagulation analyser sta compact max ) , tissue paper qty ( 1 roll ) , cell pack dcl ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 20 lit. ) , sulfolyser ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , lyser cell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5 lit. ) , fluorocell wdf ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 42x2ml ) , cell clean ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 5ml ) , quality control xnl l1, l2, l3 ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , calibrator ( for 6 part hematology analyser xn 550 reagent sysmex ) qty ( 1 set ) , phenol qty ( 500gm ) , potassium ferrocyanide qty ( 500gm ) , ammonium ferrichloride qty ( 500gm ) , iodineqty ( 25gm ) , esbach reagent qty ( 500ml ) , charcoal qty ( 500gm ) , periodic acid qty ( 50gm ) , sodium dithionate qty ( 500gm ) , carbol fuchsin solution qty ( 500ml ) , g6pd card test , concentrated hcl qty ( 500ml ) , concentrated hno3 qty ( 500ml ) , microglass slide 75x25x1.35mm qty ( 50 slides ) , microtome disposable blade low profile qty ( 50 blades ) , napsin a ( ihc antibody and other items ) qty ( 7ml ) , calretinin ( ihc antibody and other items ) qty ( 7ml ) , myod1 ( ihc antibody and other items ) qty ( 7ml ) , uroplakin iii ( ihc antibody and other items ) qty ( 7ml ) , gata 3 ( ihc antibody and other items ) qty ( 7ml ) , cd 117 ( ihc antibody and other items ) qty ( 7ml ) , idh ( ihc antibody and other items ) qty ( 7ml ) , antigen retrivel solution ( high ph ) qty ( 100ml ) , tris edta bufferqty ( 10ml ) , deff quik stain hp qty ( 10ml ) , vii beta thalassaemia bts cat. no.2702154 ( for hplc machine ) qty ( 500 t ) , vii sample vial ( 1.5ml ) with piercable cap of bio rad cat. no.2702149 ( for hplc machine ) qty ( 200 ) , erba protime for erba coagulation analyser qty ( 10x5ml ) , diluent ( for nihon kohden 5 part cell counter ) qty ( 18 lit. ) , lyse 3 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , lyse 5 ( for nihon kohden 5 part cell counter ) qty ( 500ml ) , cleaner green ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , cleaner strong ( for nihon kohden 5 part cell counter ) qty ( 2 lit. ) , controls h l n ( for nihon kohden 5 part cell counter ) qty ( 1 set of 3 ) , diluent ( for horiba abf micro es 3 part cell counter ) qty ( 20 lit. ) , lyse bio ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , cleaner ( for horiba abf micro es 3 part cell counter ) qty ( 1 lit. ) , controls h l n ( for horiba abf micro es 3 part cell counter ) qty ( 1 set of 3 ) , anti sera a 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera b 10ml / anti a monoclonal antibodies qty ( 1 vial ) , anti sera d1 & d2 10ml anti d polyclonal ( igg+igm ) qty ( 1 vial ) , anti sera ab 10ml qty ( 1 vial ) , anti sera a1 10ml qty ( 1 vial ) , anti sera h 10ml qty ( 1 vial ) , bovine albumin 10ml qty ( 1 vial ) , coombs id cards for gel techniques biorad machine 12*4 test pack qty ( 1 pkt. ) , id liss diluent 2 for gel techniques biorad machine 500ml qty ( 500ml ) , cooms sera 10ml ( ahg ) qty ( 1 vial ) , normal saline solution ( grade lr ) qty ( 500ml ) , copper sulphate powder qty ( 500gm ) , sodium hypochlorite solution qty ( 5 lit. ) , de ionized water ( distilled water ) 10 lit qty ( 10 lit. ) , savlone qty ( 500ml ) , spirit lamp , phenyle solution qty ( 5 lit. ) , cell pack ( for sysmex kx 21 cell counter ) qty ( 20 lit. ) , stromatolyser wh ( for sysmex kx 21 cell counter ) qty ( 500ml ) , cell cleaner ( for sysmex kx 21 cell counter ) qty ( 50ml ) , thermal printer paper 57mm ( for sysmex kx 21 cell counter ) qty ( 1 roll ) , hiv rapid test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hiv elisa test iv generation for detection of antigen of hiv in human serum / plasma qty ( 1 test ) , hbsag rapid test card ( 0.1iu / ml ) qty ( 1 test ) , hbsag elisa test qty ( 1 test ) , hcv rapid test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , hcv elisa test iv generation for detection of antigen of hcv in human serum / plasma qty ( 1 test ) , vdrl strips qty ( 1 test ) , m.p.card test qty ( 1 test ) , hemocue microcuvettes qty ( 1 pkt. ) , blood collection bag quadriple cpda sagm 350ml ( should have following specifications 1.quadriple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag triple cpda sagm 350ml ( should have following specifications 1.triple blood bag should have 350ml capacity with 49 ml cpd solution and one satellite transfer bag of 300ml capacity with 80ml.sagm ( 2 ) mother bag should be with 0.39mm thickness to prevent breakage during centrifugation and the inner diameter of tubes should be with 2.95± 0.5mm id ( 3 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 4 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 5 ) should be iso 3826 , blood collection bag single cpda sagm 350ml ( should have following specifications ( 1 ) needle should be 16g with triple bevel design to reduce penetration porse and enabled pain less vein puncture ( 2 ) blood bag should not marking in all tube of the transfer bags to ensure traceability. ( 3 ) should be iso 3826 , fibrinogen assay test kit ( quantitative ) for coagulation meter analyser model start 4 diagnostica stago qty ( 1 kit ) , thermal printer paper roll 110mm for coagulation meter analyser model start 4 diagnostica stago qty ( 1 roll ) , plastic cuvettes for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , balls vials for coagulation meter analyser model start 4 diagnostica stago qty ( 1 pkt. ) , measuring cylinder 500ml , measuring cylinder 250ml , micro pipette, auto pipette ( adjustable ) 10?l , micro pipette, auto pipette ( adjustable ) 50?l , micro pipette, auto pipette ( adjustable ) 100?l , micro pipette, auto pipette ( adjustable ) 1000?l , micro pipette, auto pipette ( multi channel ) 50 300?l , single donor platelet kit ( s5l ) fresenius kabi qty ( 1 kit ) , microscope bulb 6v 15w , bp apparatus without mercury ( dial ) , weight machine ( having following specification ( 1 ) personel with analog display. ( 2 ) measure in kg. ( 3 ) maximum weighing capacity 120kg ) , plastic test tube with sticker , tips blue ( pack ) size 500 ) qty ( 1 pkt. ) , tips yellow ( pack ) size 1000 ) qty ( 1 pkt. ) , disposable vials 5ml , micro slides 75x23 mm thicknesss 1.25 to 1.5 mm ( glass ) qty ( 50 ) , k3 edta blood collection vials vaccunized ( sterility, pyrogenicity and toxicity certificate should be given batch wise and tube must be gamma sterilize and usfda approved. as per clsi guideline needle, holder, vacutainers are from same manufacturer ) , disposable needle 18 no. , disposable needle 22 no. , disposable needle 24 no. , disposable needle 26 no. , beaker 200ml glass , beaker 200ml plastic , dropper plastic 3 ml , exercise rubber ball , n 95 mask , surgical mask , sanitizer qty ( 500 ml ) , single blood bag 100ml ( pediatric ) ( should have following specification ( 1 ) blood collection bag made up of dehp ( di 2 ethylhexyl phthalate ) plasticized pvc ( poly vinyl chloride ) , collapsible non vented sterile containers complete with collecting tube for completely closed system to avoid the chances of contimination. ( 2 ) design & shape should be flexible pre sterilized, pyrogen free, non toxic, non haemolytic, biocompatible material, no risk of contimination and air embolism ( closed system ) with all leaks proof seals ( disposable bags ) , silt on the both sides of the bags should be enough to accommodate 5 10ml volume test tubes, the capacity of the bag should be enough to prevent any ballooning / rupture of the bag from the seam when it is filled up with the requisite volume of blood. tubing of bag should be flexible non kinking, non sticking, transparent, leak proof, the tube should have multiple printed id / segment numbers, the numbers should be legible and clear, a clamp should be provided for closed system. needle should be 16 garge ultra thin walled and straight, sharp regular margins and levelled tip, rust proof, tightly fixed with hub covered with sterile guard, hermetically sealed, the needle should not seperate from the tube while removing it from the vein for donor safety. port should be tamper proof and should not be re capped, easily accessible. package should be protective dual packaging ( individual & aluminium ) eliminating microbial contamination on surface maintaining the contents of the bag, easy to handle anticoagulant and preservative solution, cpda 1 ( 14ml / 100ml of blood ) clear & colourless, no discoloration on storage at room temp., manufacturer to supply anticoagulant quality check certificate. label should be non peel off, heat sealed labels, remain attached between room temp. to 40c with a transparent adhesive, date of manufacturing, date of expiry and lot number must be mentioned on each bag, the expiry date should be at least 2 years from the date of supply of blood bags to the institute. ) , 1000 ?l diti tips part no.10612554 ( consumable for tecan automated elisa reader ) , 7% bsa qty ( 1x5ml ) , ortho bliss qty ( 4x50ml ) , product code: ( 707300 ) ahg anti igg c3d poly specific ( ortho bio vue system ) qty ( 1 sleeves x 120 ) , x ray normal film blue sensitive size 14”x17” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 12”x15” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 10”x12” qty ( 1 pkt of 50 sheets ) , x ray normal film blue sensitive size 8”x10” qty ( 1 pkt of 50 sheets ) , normal x ray cassette size 14”x17” , normal x ray cassette size 12”x15” , normal x ray cassette size 10”x12” , normal x ray cassette size 8”x10” , intensifying screen high speed 14”x17” , intensifying screen high speed 12”x15” , intensifying screen high speed 10”x12” , intensifying screen high speed 8”x10” , digital x ray film for fuji cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for fuji cr system size 11”x14” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 10”x12” qty ( 1 pkt of 150 sheets ) , digital x ray film for fuji cr system size 8”x10” qty ( 1 pkt of 150 sheets ) , digital x ray film for agfa cr system size 14”x17” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 11”x14” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 10”x12” qty ( 1 pkt of 100 sheets ) , digital x ray film for agfa cr system size 8”x10” qty ( 1 pkt of 100 sheets ) , digital x ray film for kodak cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for kodak cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 14”x17” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 11”x14” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 10”x12” qty ( 1 pkt of 125 sheets ) , digital x ray film for konica cr system size 8”x10” qty ( 1 pkt of 125 sheets ) , digital x ray film cassette for fuji cr system size 14”x17” , digital x ray film cassette for fuji cr system size 11”x14” , digital x ray film cassette for fuji cr system size 10”x12” , digital x ray film cassette for fuji cr system size 8”x10” , digital x ray film cassette for agfa cr system size 14”x17” , digital x ray film cassette for agfa cr system size 11”x14” , digital x ray film cassette for agfa cr system size 10”x12” , digital x ray film cassette for agfa cr system size 8”x10” , digital x ray film cassette for kodak cr system size 14”x17” , digital x ray film cassette for kodak cr system size 11”x14” , digital x ray film cassette for kodak cr system size 10”x12” , digital x ray film cassette for kodak cr system size 8”x10” , digital x ray film cassette for konica cr system size 14”x17” , digital x ray film cassette for konica cr system size 11”x14” , digital x ray film cassette for konica cr system size 10”x12” , digital x ray film cassette for konica cr system size 8”x10” , digital x ray film screen for fuji cr system size 14”x17” , digital x ray film screen for fuji cr system size 11”x14” , digital x ray film screen for fuji cr system size 10”x12” , digital x ray film screen for fuji cr system size 8”x10” , digital x ray film screen for agfa cr system size 14”x17” , digital x ray film screen for agfa cr system size 11”x14” , digital x ray film screen for agfa cr system size 10”x12” , digital x ray film screen for agfa cr system size 8”x10” , digital x ray film screen for kodak cr system size 14”x17” , digital x ray film screen for kodak cr system size 11”x14” , digital x ray film screen for kodak cr system size 10”x12” , digital x ray film screen for kodak cr system size 8”x10” , digital x ray film screen for konica cr system size 14”x17” , digital x ray film screen for konica cr system size 11”x14” , digital x ray film screen for konica cr system size 10”x12” , digital x ray film screen for konica cr system size 8”x10” , sonography roll type 1 normal upp 110s, 110mmx20mtr. , sonography jelly. qty ( 250 gm ) , developer for automatic film processor ( liq. soln. ) . qty ( 1 pkt ) , fixer for automatic film processor. ( liq.soln. ) . qty ( 1 pkt ) , flavoured barium sulphate powder for barium processor. , lead number ( 0 to 9 ) . qty ( 1set ) , lead number ( a to z ) qty ( 1set ) , lead number ( r & l ) . qty ( 1set ) , lead divider size 14”x17”. , lead divider size 12”x15”. , tissue paper roll. , red bulb 0 w , stainless steel / fibre processing tank with lid superior quality ( 3 gallon ) , stainless steel / fibre processing tank with lid superior quality ( 5 gallon ) , x ray illuminator superior quality 1 film , x ray illuminator superior quality 2 films , x ray illuminator superior quality 4 films , film drying cabinet for 26 hanger , lead appron coat ( superior quality imported venyl 0.5mm ) , x ray developing hanger stainless steel various sizes 14x17 , x ray developing hanger stainless steel various sizes 12x15 , x ray developing hanger stainless steel various sizes 10x12 , x ray developing hanger stainless steel various sizes 8x10 , chest stand floor type superior quality , lead protection screen 6’x3’ with 8”x10” lead glass window lead equip. 3.0mms , c.t. scan pressure syringe 190ml , y adaptor for c.t.scan without tubing , three way adopter for c.t. scan , adhesive plaster 1” ( cotton ) , idoixanol 50ml vials , idoixanol 100ml vials , usg & ct guided biopsy needles , disposable automatic core biopsy gun, instrument 16 gauze length 15cm , disposable automatic core biopsy gun, instrument 18 gauze length 15cm , disposable automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 20cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 16 gauze 15cm , disposable semi automatic core biopsy gun with blunt tip needle and trocar needle 18 gauze 15cm , disposable bone marrow biopsy needle 11 gauze in 6 inch , disposable bone marrow biopsy needle 13 gauze in 5 inch , dental films qty ( 1 pkt. of 150 films ) , t.m.t.paper thermala 4 size with graph qty ( 1pkt ) , t.m.t. electrode qty ( 1pkt ) , paper for echo machine a 4 size qty ( 1pkt ) , e.c.g.electrodes , e.c.g.jelly ( pack size 250gm ) , e.c.g.paper rollfor bpl make machine8408 view , e.c.g.paper rollfor bpl make machine108t , e.c.g.paper rollfor rms 108 make machine , e.c.g.paper rollfor bpl make machine 6108 t , ecg rolls for schiller make ecg machine cardiovit at 1 90mmx90mmx400 sheets ( 36 mtr ) , hemoconcentrator part a and part b, when diluted 1.34, sodium 85.85, potassium 0.00, calcium 1.75, magnesium 0.75, chloride 90.85, glucose 0.00, acetic acid 4.0=mmol / l qty ( jar 10ltr+powder 2 pouches ) , high concentrator part a, when diluted 1.34 sodium 130, chloride 19.5, calcium 1.75, magnesium 0.50, potassium 2.00, dextrose 5.54, acetate 3.0=mmol / l qty ( jar 10 ltr ) , dry bicarbonate bag 650 gm bibag, compatible with fresenius machine qty ( bag 650gm ) , arterio venous fistula needle sterilized, should be in pair with 16 g needle with back eye length 25 30 mm fixed wings, luer lock qty ( 1 pair ) , plasma filter for plasmapheresis for therupetic plasma pheresis in renal failure patient, sterilized polysulfone membrane with effective surface area 0.5m 0.6m , double lumen catheter kit for hemodialysis 8 fr. x 8 9 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. sterilized. european ce / usfda , double lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle or special syringe for introduction of guide wire. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll sterilized. european ce / usfda , tripple lumen catheter kit for hemodialysis 11 fr. 12 fr. x 13 14 cm. flexible radiopaque polyurethane material with j end guide wire. y shaped double entry introducer needle. vessel dialator with arterial and venous port caps. syringe 5 10 cc ll. antimicrobial coated. sterilized. european ce / usfda , citrosteril 5 ltr each 100 gm citro should have 21 gm citric acid. 1 hydrate lactic acid and malic acid. ph value in between 1.7 to 2.0 and have excellent removal of lime scale and have disinfection and decalcification in one process. qty ( 5 ltr can ) , purosterilqty ( 5 ltr can ) , disafe , dialyzer single use with blood line. adult having synthetic hollow fiber of polysulfone membrane. sterilized with steam to bear blood flow of minimum 200ml / min and dialasate flow rate of 500ml / min with surface area 1.4. blood line latex freemedical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by the same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with non ethylene oxide method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.3 to 1.4 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer reusable with blood line. adult having synthetic hollow fiber of polysulfone / polyethersulfone membrane. sterilized with steam sterilization method able to bear blood flow of minimum 200ml / min and dialysate flow rate of 500ml / min with surface area 1.8 blood line latex free medical grade tubing. priming volume 145 155ml with arterial chamber. both products manufactured by same manufacturer. ce / fda approved. qty ( dialyzer with tubing ) , dialyzer paediatric, polysulfone hollow fiber surface area 0.8m sterilized with steam sterilization qty ( each dialyzer ) , paediatric blood line. latex free with arterial chamber. venous chamber with respective arterial and venous ll and injection port in the tubing and end of tubing fitted with suitable connection. qty ( each line ) , high concentrate sodium citrate vial 23 46.7% qty ( 10ml vial ) , 6% sodium hypochlorite 5 ltr can qty ( 5 ltr can ) , acetic acid glacial 5 ltr can qty ( 5 ltr can ) , citric acid monohrdrate 500gm qty ( 500gm ) , hydrochloric acid 5 ltr can qty ( 5 ltr can ) , elastic adhesive bandage 10cmx 4 / 6 mtr , elastic adhesive bandage 10cmx 1 mtr , oxalic acid ( powder ) qty ( 500gm ) , sodium hypochlorite ( liquid 10% ) solution qty ( 35ltr ) , acetoneqty ( 500ml ) , liquid ammonia qty ( 500ml ) , absolute alcohol qty ( 500ml ) , ammonium sulphate qty ( 500gm ) , glacial acetic acid qty ( 500ml ) , urea powder qty ( 500gm ) , paradimethyl amino benzaldehyde qty ( 100 gm ) , ammonium oxalate crystals qty ( 500 gm ) , actidioneqty ( 1 gm ) , phenyl crystalqty ( 500 gm ) , ferric ammonium sulphate qty ( 100 gm ) , di sodium hydrogen phosphate ( na2hpo4 ) qty ( 100 gm ) , sodium hydrogen phosphate ( nah2po4 ) qty ( 100 gm ) , sulphuric acid conc. qty ( 5 lt ) , nnnn tetramethylparaphenylenediaminedihydrochloride ( oxidase powder ) qty ( 5 gm ) , basic carbolfuschin powder ( practical grade ) qty ( 100 gm ) , barium chlorideqty ( 100 gm ) , glycerol qty ( 500 ml ) , glucose anhydrous qty ( 500 gm ) , iso amyl alcohol qty ( 500 ml ) , malachite green ( practical grade ) qty ( 100 gm ) , sodium nitrite qty ( 100 gm ) , sulphanililc acid qty ( 100 ml ) , toluidine blue qty ( 100 gm ) , magnesium sulphate ( mgso4.7h2o ) qty ( 100 gm ) , n acetyl l cystine qty ( 25 gm ) , formaldehyde solution 40 % qty ( 5 lt ) , nigrocin ( himedia ) qty ( 100 gm ) , koh pallets qty ( 500 gm ) , naohpallets qty ( 500 gm ) , concentrated hcl qty ( 500 ml ) , albert’s stain a and b for diphtheria ( staining solution ) qty ( 2x100ml ) , brilliant cresyl blueqty ( 100 ml ) , liquid paraffin qty ( 500 ml ) , sodium acetateqty ( 500 gm ) , sodium sulphiteqty ( 500 gm ) , sodium carbonateqty ( 500 gm ) , potassium bromideqty ( 500 gm ) , sodium thiosulphate qty ( 500 gm ) , spirit qty ( 500ml ) , poly vinyl alcohol qty ( 250ml ) , ammonium chlorideqty ( 500 gm ) , sodium meta bisulphiteqty ( 500 gm ) , sodium bicarbonate extra pureqty ( 500 gm ) , crystal violet ( practical grade ) qty ( 100 gm ) , bromothymol blue powder qty ( 25 gm ) , cetylpyridinium chloride qty ( 100 gm ) , alpha naphthylamine qty ( 100 gm ) , sodium deoxycholate qty ( 100 gm ) , magnesium citrate qty ( 500 gm ) , asparagine qty ( 5 gm ) , sodium citrate qty ( 500 ml ) , lactophenol ( cotton blue ) qty ( 100 ml ) , omera reagent / v p reagent qty ( 100 ml ) , potassium tellurite qty ( 25 gm ) , ferric chloride qty ( 500 gm ) , cyanogen bromide qty ( 100 gm ) , andrade’s indicator qty ( 125 ml ) , dimethyl sulphoxide ( dmso ) qty ( 500 ml ) , iodine crystalqty ( 500 gm ) , potassium idodide qty ( 250 gm ) , safarnine qty ( 100 gm ) , neutral red qty ( 100 gm ) , dpx mount qty ( 250 ml ) , paradimethylaminocinnamaldehyde qty ( 100 gm ) , hydrogen peroxide ( h2o2 ) qty ( 100 ml ) , alpha – naphthalamine qty ( 100 gm ) , sodium hippurate qty ( 100 gm ) , alpha – naphthol qty ( 100 gm ) , creatinine qty ( 100 gm ) , l – pyrolidonyl b – nephthalamide qty ( 50 gm ) , gelatin qty ( 500 gm ) , sodium borohydride qty ( 100 gm ) , cobalt chloride qty ( 100 gm ) , agarrose with high eeoqty ( 100 gm ) , dextrose anhydrous qty ( 500 gm ) , lactoseqty ( 500 gm ) , maltose qty ( 500 gm ) , mannitol qty ( 500 gm ) , dulcitol qty ( 500 gm ) , sucroseqty ( 500 gm ) , xylose qty ( 500 gm ) , arabinoseqty ( 500 gm ) , sorbitolqty ( 500 gm ) , schaudinns solution qty ( 250 ml ) , microsporidiatrichome blue stain qty ( 250 ml ) , merthiolate iodine formalin qty ( 250 ml ) , chloroform qty ( 500 ml ) , formamide qty ( 500 ml ) , methylene blue qty ( 25 gm ) , nonidet p 40 qty ( 100 ml ) , phosphoric acid qty ( 500 ml ) , potassium di hydrogen phosphate qty ( 500 gm ) , potassium permanganate qty ( 500 gm ) , isopropanol qty ( 500 ml ) , sodium bicarbonateqty ( 500 gm ) , giemsa stain solutoin qty ( 500ml ) , methanol qty ( 500 ml ) , potassium iodide qty ( 500 gm ) , congo red stain qty ( 25 gm ) , citric acid anhydrous qty ( 500gm ) , disposable syringe 5ml with needle , disposable syringe 10mlwith needle , disposable syringe 20mlwith needle , disposable syringe 50 ml with needle , measuring cylinder 50ml plastic , measuring cylinder 100ml plastic , measuring cylinder 500ml plastic , measuring cylinder 1000 ml plastic , test tube racks 48 holes for 12 mm+ 15 mm test tubes , nitril gloves medium size & small size each , latex gloves 6.5 no.unsterilized , latex gloves 7.5no.unsterilized , disposable needle 18 gauge , staining jars 100 ml , plastic dropping bottle 125 ml , plastic dropping bottles 500 ml , sterile disposable petri dish 90mm individual pack per petridish , disposable container for urine sample / sputum for c / s sterile ( individually packed ) , disposable container for staining ( non sterile ) , disposable plastic test tubes 75 x12 mm , beaker plastic various size 50ml. , beaker plastic various size 100ml. , beaker plastic various size 250ml. , beaker plastic various size 500 ml , beaker plastic various size 1000 ml. , thumb press disposable dropper , screw cap plastic vial 3 ml disposablewith label self standing , autoclavable tubes ( pw 1162 ) 150 x 18 mm diameter , vacutainer ( 5 ml without edta ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required , autoclavable petri plates, polycarbonate, clear transparent unbreakable, 90 mm x 15 mm. , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 75x12mm , sterile cotton swab ( in screw caped polythen tube with coated with polytropylen stick size 150x12mm. , micropipette tips for elisa ( size 0.5 10?l ) , eppendorp tubes 2ml , wash bottle ( 100 ml ) , 96 well flat bottom sterile tissue culture platewith lid , falcon tube ( 50 ml ) , microslide 75 x25 x1.25 mm to 1.5 mm ( glass ) 50 slides pkt qty ( 1 pkt ) , beaker 50ml glass borosil ( cornig ) , beaker 100ml glass borosil ( cornig ) , beaker 250ml glass borosil ( cornig ) , beaker 500ml glass borosil ( cornig ) , beaker 1000 ml glass borosil ( cornig ) , flat bottom conical flask 100mlborosil ( cornig ) , flat bottom conical flask 200mlborosil ( cornig ) , flat bottom conical flask 500mlborosil ( cornig ) , flat bottom conical flask 1000mlborosil ( cornig ) , round flat bottom flask 100mlborosil ( cornig ) , round flat bottom flask 250mlborosil ( cornig ) , round flat bottom flask 500 mlborosil ( cornig ) , test tubes 12x100mmborosil , durham’s tube 25 mm x 6 to 7 mm dia. , bijou bottle with aluminium cap and silicon rubber washer , petri dish 110 mm borosil ( cornig ) , petri dish 90mm borosil ( cornig ) , glass cover slips 18 x 18mm, 8 x 0.1 mm english glass , glass funnel with 10 cm dia. ( small & medium ) , glass cover slip 22 x 22 mm x 0.1 mm, english glass , glass slide with concavities qty ( 1pkt ) , test tube glass 12 x75 mm ( borosil ) , reagent bottle with cap ( borosil ) ( clear ) size 50 ml , reagent bottle with cap ( borosil ) ( clear ) size 100 ml , reagent bottle with cap ( borosil ) ( clear ) size 500 ml , reagent bottle with cap ( borosil ) ( clear ) size 1000 ml , reagent bottle with cap ( borosil ) ( brown ) size 50 ml , reagent bottle with cap ( borosil ) ( brown ) size 100 ml , reagent bottle with cap ( borosil ) ( brown ) size 500 ml , reagent bottle with cap ( borosil ) ( brown ) size 1000 ml , 150 x 15 mm dia., glass borosil , pasteur pipette with rubber bulbscapacity of 1 ml , pasteur pipette with rubber bulbscapacity of 2 ml , candle jar , antifungal enzyme strips ( e strip ) amphotericin b 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) micafungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) caspofungin 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) posaconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) fluconazole 0.016 256 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) voriconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) flucytosine 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) ketoconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , antifungal enzyme strips ( e strip ) itraconazole 0.002 32 mcg / ml qty ( 10 st x1 ) , carbohydrate fermentation test discs adonitol qty ( 1x25 disc ) , carbohydrate fermentation test discs arabinose qty ( 1x25 disc ) , carbohydrate fermentation test discs cellobiose qty ( 1x25 disc ) , carbohydrate fermentation test discs dextrose qty ( 1x25 disc ) , carbohydrate fermentation test discs dulcitol qty ( 1x25 disc ) , carbohydrate fermentation test discs galactose qty ( 1x25 disc ) , carbohydrate fermentation test discs fructose qty ( 1x25 disc ) , carbohydrate fermentation test discs inositol qty ( 1x25 disc ) , carbohydrate fermentation test discs inulin qty ( 1x25 disc ) , carbohydrate fermentation test discs lactoseqty ( 1x25 disc ) , carbohydrate fermentation test discs maltose qty ( 1x25 disc ) , carbohydrate fermentation test discs mannitol qty ( 1x25 disc ) , carbohydrate fermentation test discs mannose qty ( 1x25 disc ) , carbohydrate fermentation test discs melibiose qty ( 1x25 disc ) , carbohydrate fermentation test discs raffinose qty ( 1x25 disc ) , carbohydrate fermentation test discs rhamnose qty ( 1x25 disc ) , carbohydrate fermentation test discs salicin qty ( 1x25 disc ) , carbohydrate fermentation test discs sorbitol qty ( 1x25 disc ) , carbohydrate fermentation test discs sucrose qty ( 1x25 disc ) , carbohydrate fermentation test discs trehalose qty ( 1x25 disc ) , carbohydrate fermentation test discs xylose qty ( 1x25 disc ) , carbohydrate fermentation test discs d arabitol qty ( 1x25 disc ) , colistin 25?g qty ( 1x100 disc ) , fusidic acid 30 ?g qty ( 1x100 disc ) , polymyxin b 300 units qty ( 1x100 disc ) , nitrofuratoin 300 ?g qty ( 1x100 disc ) , nalidixic acid 30 ?g qty ( 1x100 disc ) , cefixime 10 ?g qty ( 1x100 disc ) , cefpodoxime 10 ?g qty ( 1x100 disc ) , doxycycline 30 ?g qty ( 1x100 disc ) , co trimoxazole 30 ?g qty ( 1x100 disc ) , erythromycin 15 ?g qty ( 1x100 disc ) , sulphadiazine 100 ?g qty ( 1x100 disc ) , griseofulvin qty ( 1x100 disc ) , terbinafine qty ( 1x100 disc ) , imipenem+ edta 10 / 750 qty ( 1x100 disc ) , novobiocin 5 ?g qty ( 1x100 disc ) , bacitracin 8 ?g qty ( 1x100 disc ) , ampicillin 10 ?g qty ( 1x100 disc ) , cefaperazone 75 ?g qty ( 1x100 disc ) , ceftazidime 30 ?g qty ( 1x100 disc ) , amoxycilin 10 ?g qty ( 1x100 disc ) , cefapim 30 ?g qty ( 1x100 disc ) , cephadroxil 30 ?g qty ( 1x100 disc ) , cefdinir 5 ?g qty ( 1x100 disc ) , azithromycin 30 ?g qty ( 1x100 disc ) , vancomycin 10 ?g qty ( 1x100 disc ) , methicillin 5 ?g qty ( 1x100 disc ) , lincomycin 30 ?g qty ( 1x100 disc ) , linezolid 30 ?g qty ( 1x100 disc ) , doripenem 10?gqty ( 1x100 disc ) , faropenem 5 ?g qty ( 1x100 disc ) , fosfomycin 200qty ( 1x100 disc ) , piperacillin + tazobactam100 / 10 ?gqty ( 1x100 disc ) , cefoxitin 30 ?g qty ( 1x100 disc ) , meropenem 10 ?g qty ( 1x100 disc ) , nystatin100 units qty ( 1x100 disc ) , chloramphenicol 30 mcgqty ( 1x100 disc ) , penicillin 10 unit qty ( 1x100 disc ) , gentamycin120 ?g qty ( 1x100 disc ) , polymyxin –b 50 unitsqty ( 1x100 disc ) , daptomycin qty ( 1x100 disc ) , ciprofloxacin 5 ?g qty ( 1x100 disc ) , oxacillin 1 ?g qty ( 1x100 disc ) , pipracillin 100 ?g qty ( 1x100 disc ) , tobramycin 10 ?g qty ( 1x100 disc ) , ticarcillin – 75 ?g qty ( 1x100 disc ) , gatifloxacin 5 / 10 ?g qty ( 1x100 disc ) , levofloxacin 5 ?g qty ( 1x100 disc ) , clindamycin 2 ?g qty ( 1x100 disc ) , cloxacillin 10 ?g qty ( 1x100 disc ) , aztreonan 30 ?g qty ( 1x100 disc ) , netilmicin 30 ?g qty ( 1x100 disc ) , clathromycin 15 ?g qty ( 1x100 disc ) , neomycin 30 ?g qty ( 1x100 disc ) , norfloxacin 10 ?g qty ( 1x100 disc ) , cefotaxime 30 ?g qty ( 1x100 disc ) , amikacin 30 ?g qty ( 1x100 disc ) , amoxyclave 10 ?g qty ( 1x100 disc ) , cefazolin 30 ?g qty ( 1x100 disc ) , ceftizoxime 30 ?g qty ( 1x100 disc ) , ceftriaxone 30 ?g qty ( 1x100 disc ) , imipenum 10 ?g qty ( 1x100 disc ) , lomefloxacin 10 ?g qty ( 1x100 disc ) , ofloxacin 5 ?g qty ( 1x100 disc ) , tetracycline 40 ?g qty ( 1x100 disc ) , itraconazole 10& 30 ?g qty ( 1x100 disc ) , ketoconazole 10 ?g qty ( 1x100 disc ) , amphotericin b 20, 50 &100 ?g qty ( 1x100 disc ) , fluconazole 25 ?g qty ( 1x100 disc ) , clotrimmazole 10 ?g qty ( 1x100 disc ) , mecillinam 10 ?gqty ( 1x100 disc ) , mezocillin 75 ?gqty ( 1x100 disc ) , mupirocin 200 ?gqty ( 1x100 disc ) , ampicilline + clavulinic acid 10 / 10 ?gqty ( 1x100 disc ) , mupirocin 5 ?g qty ( 1x100 disc ) , ceftaroline 30 ?g qty ( 1x100 disc ) , miconazole 50 mcg qty ( 1x100 disc ) , tigecycline 15 mcgqty ( 1x100 disc ) , voriconazole1µg qty ( 1x100 disc ) , fluconazole10 ?g qty ( 1x100 disc ) , rifampicin 30 ?g qty ( 1x100 disc ) , gentamycin 30 ?g qty ( 1x100 disc ) , clotrimazole 10 ?g qty ( 1x100 disc ) , amoxycilin&clavulanic acid 20 / 10 mcg qty ( 5x100 disc ) , amoxycilin&sulbactum 10 / 10 mcg qty ( 5x100 disc ) , ceftazidime&clavulanic acid 30 / 10 mcg qty ( 5x100 disc ) , ticarcillin&clavulanic acid 75 / 10 mcg qty ( 5x100 disc ) , cefaperazone&sulbactum 75 / 10 mcg qty ( 5x100 disc ) , ceftazidime&tazobactam 30 / 10 mcg qty ( 5x100 disc ) , parafloxin&mezulate qty ( 5x100 disc ) , imipenam&cilastatin 10 / 10 mcg qty ( 5x100 disc ) , piperacillin&tazobactam 30 / 60 mcg qty ( 5x100 disc ) , clavulanic acid 10 mg &cefotaxime 30 mg qty ( 5x100 disc ) , ampicillin &cloxacillin10 / 10 mcg qty ( 5x100 disc ) , imipenem& edta 10 / 750 mcg qty ( 5x100 disc ) , lysine hydrochloride qty ( 1x25 disc ) , arginine hydrochloride qty ( 1x25 disc ) , ornithine hydrochloride qty ( 1x25 disc ) , onpg disc qty ( 1x50 disc ) , oxidase disc qty ( 1x50 disc ) , bacitracin disc qty ( 1x50 disc ) , optochine disc qty ( 1x50 disc ) , plain disc qty ( 1x50 disc ) , nitrate reagent disc qty ( 1x50 disc ) , x factor disc qty ( 1x50 disc ) , v factor disc qty ( 1x50 disc ) , x / v factor disc qty ( 1x50 disc ) , vibrio 0129 differential disc qty ( 1x50 disc ) , pyr disc qty ( 1x50 disc ) , bile esculin disc qty ( 1x50 disc ) , kovac’s reagent disc qty ( 1x25 disc ) , lead acetate paper strip for h2s qty ( 1x25 disc ) , spore strips qty ( 1x25 disc ) , cefepime / cefepime+clavulanic acid ( range ?g / ml cpm 0.25 16 to cpm+ca 0.064 4 ) qty ( 1x10 st ) , cefotaxime / cefotaxime+clavulanic acid ( range ?g / ml ctx 0.25 16 to ctx+ca 0.016 1 ) qty ( 1x10 st ) , ceftazidime / ceftazidime+clavulanic acid ( range ?g / ml caz 0.5 32 to caz+ca 0.064 4 ) qty ( 1x10 st ) , ceftriaxone / ceftriaxone+clavulanic acid ( range ?g / ml ctr 0.025 16 to caz+ca 0.016 1 ) qty ( 1x10 st ) , esbl and ampc detection strip ( range ?g / ml caz, ctx, cpm & clo with ca & taz 0.032 4 to caz, ctx, cpm & clo 0.125 16 ) qty ( 1x10 st ) , rapidec carba np qty ( 1x10 st ) , amikacin ( concentration range ?g / ml 256–0.15 ) qty ( 1x10 st ) , amoxycillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , amoxycillin / clavulanic acid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ampicillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , cefotaxime ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftaroline ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ceftazidime† ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , ceftriaxone ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , ciprofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , clindamycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , daptomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , erythromycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , polymixine ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , cefoxitin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , levofloxacin ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , linezolid ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , meropenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , metronidazole ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , oxacillin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , penicillin g ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , teicoplanin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tetracycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , tigecycline ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , vancomycin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , gentamicin ( concentration range ?g / ml 256–0.015 ) qty ( 1x10 st ) , imipenem ( concentration range ?g / ml 32–0.002 ) qty ( 1x10 st ) , colistin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , fosfomycin ( concentration range ?g / ml 256 .016 ) qty ( 1x10 st ) , combi 94 for gram positive bacteria ( code od 298 ) qty ( 1x10ring ) , combi 92 for gram negative bacteria ( code od 293 ) qty ( 1x10 ring ) , combi 512 for highly resistant pseudomonas ( code od 88 ) qty ( 1x10 ring ) , combi 677 for highly resistant staph aureus ( code od 277 ) qty ( 1x10 ring ) , meropenem with & without edta ( range ?g / ml mpm+edta 1 64 mpm 4 256 ) qty ( 1x10 st ) , rapideccarba np ( code no.415418 ) qty ( 1x10 st ) , widal kit 4x5ml rapid slide test kit qty ( 1kit ) , mp card test ( for antigen pan, pf & pv detection ) it should be based on pldh & hrp antigen detection on plastic cassette ( not dipstick ) , infection / cases at 50 parasite per ul of blood and higher at higher parasite density., it should be who approved. qty ( 1test ) , ra test kitqty ( 1 test ) , aso test kitqty ( 1 test ) , crp test kitqty ( 1 test ) , rpr 3rd generation / vdrlqty ( 1 test ) , hbs ag card test kit ( it should be immunoassay / capture detect ad’ and ay’ sub should have inbuilt quality should have detection limit 0.5ng / ml / 0.1iu should be nib / naco / who approved. ) qty ( 1test ) , hcv card test kit ( it should be 4th generation should be based on flow through must have a long shelf life & only in the form of card not in the form of should be approved and evaluated by should be short interpretation time not more than 3 to 5 minutes should have specificity an sensitivity of 100%. ) qty ( 1test ) , rapid test for detection of igg&igm antibodies against salmonella infection ( lam test ) qty ( 1test ) , rapid specific test for syphilis ( igg / igm / iga card ) kit 3rd generation qty ( 1test ) , indirect haemagglutination inhibition test for diagnosis of amoebiasis test kit qty ( 1test ) , hepatitis a card test rapid card antibody test with control qty ( 1test ) , rotavirus detection of rotavirus ag of all serotypes ( rapid card test ) qty ( 1test ) , h. pylori detection of all isotypes ( igg, igm, iga ) qty ( 1test ) , brucella antibody slide agglutination test b.abortus 5 ml b. mclitersis 5 ml qty ( each 5ml ) , rapid card test for troponin i for acute mi qty ( 1test ) , rapid dengue card test for ns antigen igm and igg qty ( 1test ) , latex agglutination for cryptococcalneoformans.qty ( 1test ) , hiv rapid card test 3rd generation ( it should be based on flow through technology with dual detection system ( synthetic peptie & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per must have a long shelf life & only in the form of card not in the form of should be short inter preparation time 3 to 5 minutes should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , hiv rapid card test 4th generation ( it should be based on flow through technology with dual detection system ( synthetic peptide & recombinent ) it should be able for the detection of hiv 1 and hiv 2 seperately as per must have a long shelf life & only in the form of card not in the form of should be short inter preparation time 3 to 5 minutes should be approved and evaluated bynib / nari and who ( naco ) ) qty ( 1test ) , rapid test kit device for toxoplasma infection with built in control test device qty ( 1test ) , rapid card test for strip pneumonia antigen hbsag 0.1id / ml qty ( 1test ) , strepto coccus pneumoniae antigen card test. ( provide accurate detection of the specific antigen in urine.sensitivity and specificity should be more then 95% ) qty ( 1 test ) , peptone water powderqty ( 500gm ) , macconkey agar qty ( 500gm ) , hichrome uti agar qty ( 500gm ) , nutrient agar qty ( 500gm ) , muller hinton agarqty ( 500gm ) , alkaline peptone water powderqty ( 500gm ) , hichrome candida differential agarqty ( 500gm ) , sda with cycloheximide qty ( 500gm ) , sda with chloramphenicol qty ( 500gm ) , sda plain qty ( 500gm ) , potato dextrose agar base qty ( 500gm ) , rpmi 1640 qty ( 500gm ) , glucose phosphate brothqty ( 500gm ) , simmons citrate agar qty ( 500gm ) , urease base agar ( christensen ) qty ( 500gm ) , c.zapekdox agar qty ( 500gm ) , triple sugar iron agar qty ( 500gm ) , phenyl pyruvic acid agar qty ( 500gm ) , bile esculin agarqty ( 500gm ) , hugh leifson oxidation fermentation media qty ( 500gm ) , stuart transport mediumqty ( 500gm ) , dnaase agar mediaqty ( 500gm ) , l arginine dihydrolasehiveg mediumqty ( 500gm ) , lysine decarboxylase hiveg brothqty ( 500gm ) , ornithine decarboxylase hiveg brothqty ( 500gm ) , cetrimide agar qty ( 500gm ) , anaerobic hiveg agarqty ( 500gm ) , thioglycolate broth qty ( 500gm ) , brain heart infusion brothqty ( 500gm ) , agar – agar powderqty ( 500gm ) , bact alert blood culture bottle ( adult ) , selenite f brothqty ( 500gm ) , tetra thionate brothqty ( 500gm ) , yeast extract “cr 027” qty ( 500gm ) , bacto peptone ( peptone ) “rm 015” qty ( 500gm ) , tryptose soya brothqty ( 500gm ) , carry blair w / o charcoal qty ( 500gm ) , tcbs agar qty ( 500gm ) , dca aagr qty ( 500gm ) , bile salt agar qty ( 500gm ) , coagulase manitol broth base qty ( 500gm ) , soyabincasin digest brothqty ( 500gm ) , l.j. medium base qty ( 500gm ) , miu mediumqty ( 500gm ) , xylose lysine deoycholate agar qty ( 500gm ) , c.l.e.d. agar with andrde indicatorqty ( 500gm ) , cooked meat medium brothqty ( 500gm ) , mannitol salt agar qty ( 500gm ) , phenol phthelinediphosphate agar qty ( 500gm ) , gelatin agar qty ( 500gm ) , sugar assimilation media ( nitrogen base ) 500gm ( 1pkt ) qty ( 500gm ) , cetrimide agar qty ( 500gm ) , hi combi dual performance media ( blood culture ) qty ( 1x10 nos ) , yeast nitrogen baseqty ( 500gm ) , muller decarboxylaseqty ( 500gm ) , corn meal agar qty ( 500gm ) , wilson blair agar with bg qty ( 500gm ) , macconkey sorbitol agar qty ( 500gm ) , gas pack for anaerobic culture , deionised triple distilled waterreagentgrade with conductivity<1.0 qty ( 1 ltr ) , liquidsoapdettolqty ( 1 ltr ) , teasing needle for fungus qty ( 1 pc ) , markers blue red and black, finetip qty ( 1 pc ) , nichrome wire 26g qty ( 1 pc ) , nichrome inoculating loop qty ( 1 pc ) , adjustable loop holderqty ( 1 pc ) , self adhesive autoclvable tape ( 18mmx50mt ) qty ( 1 pc ) , self adhesive dry heat tape ( a8mmx50mt ) qty ( 1 pc ) , hand guard disinfectant gel qty ( 500 ml ) , hi spark alkaline clear solution biodegradableqty ( 500 ml ) , filter paper full size 46x57 cm qty ( 1 pkt ) , spirit lamp glass with batti qty ( 1 pc ) , slide boxes wooden / plasticqty ( 1 pc ) , sterile polyester tipped swab qty ( 1 pc ) , para film ( sealing film for glassware ) 2”qty ( 1 pc ) , short range ph paper sticks ( 3 to 9 ) qty ( 1 pc ) , ( grinded vessel ) 5ml qty ( 1 pc ) , ( grinded vessel ) 10ml qty ( 1 pc ) , ( grinded vessel ) 20ml qty ( 1 pc ) , halogen bulb for microscope 6 v, 20w qty ( 1 pc ) , stainless steel forceps blunt ( rust resistant ) qty ( 1 pc ) , stainless steel forceps printed ( rust resistant ) qty ( 1 pc ) , disposable plastic glovesqty ( 1 pc ) , broomqty ( 1 pc ) , disposable apronqty ( 1 pc ) , disposable shoe cover qty ( 1 pc ) , disposable capsqty ( 1 pc ) , aluminum tray for slide horizontal & vertical qty ( 1 pc ) , phenyl solutionqty ( 500 ml ) , glass marking pencil white & redqty ( 1 pc ) , test tube brush for cleaning tubes small / large qty ( 1 pc ) , diamond pencilqty ( 1 pc ) , rubber tourniquetqty ( 1 mtr ) , triple layer surgical mask with elastic earband qty ( 1 pc ) , microscope bulb ( projection lamp type 7388 6v 20w g4 409867 ( helozen bulb ) qty ( 1 pc ) , ph indicator paper qty ( 1 pc ) , aluminium foil qty ( 1 mtr ) , deionised triple distilled water with conductivityless than 1 qty ( 1 ltr ) , disposable sterile, leak proof air tight individually packed container with 50ml capacity for urine sample / sputum for c / s qty ( 1 pc ) , disposable plastic test tube 75x12mm qty ( 1x100 nos ) , falcons tubes 50ml qty ( 1 pc ) , falcons tubes 15ml qty ( 1 pc ) , hand sanitizer qty ( 500 ml ) , hand lens qty ( 1 pc ) , antibiotic zone scale qty ( 1 pc ) , gtocotts methenamine silver stain , havigm qty ( 96 well ( 1kit ) ) , hevigm qty ( 96 well ( 1kit ) ) , anti hbs ag qty ( 96 well ( 1kit ) ) , anti adenovirus iga qty ( 96 well ( 1kit ) ) , anti rotavirus antigen in stool elisa & serum qty ( 96 well ( 1kit ) ) , anti ebv igm qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igg qty ( 96 well ( 1kit ) ) , anti herpes simplex 2 igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigg qty ( 96 well ( 1kit ) ) , anti parainfluenza iga qty ( 96 well ( 1kit ) ) , rubella igm qty ( 96 well ( 1kit ) ) , anti varicella zoster igg qty ( 96 well ( 1kit ) ) , anti varicella zoster igm qty ( 96 well ( 1kit ) ) , elisa ns1 antigen for dengue qty ( 96 well ( 1kit ) ) , anti respiratory syncitial virus igm qty ( 96 well ( 1kit ) ) , anti measles igg, igm qty ( 96 well ( 1kit ) ) , anti parainfluenzaigm qty ( 96 well ( 1kit ) ) , mumps igm qty ( 96 well ( 1kit ) ) , anti nmda receptor encephalitis qty ( 96 well ( 1kit ) ) , elisa for enterovirus qty ( 96 well ( 1kit ) ) , anti varicella zoster iga qty ( 96 well ( 1kit ) ) , hcvigm elisa qty ( 96 well ( 1kit ) ) , anti ds dna qty ( 96 well ( 1kit ) ) , ( apla ) antiphospholipid antibodyigg, igm qty ( 96 well ( 1kit ) ) , ttg iga qty ( 96 well ( 1kit ) ) , chikunguniyaigm elisa qty ( 96 well ( 1kit ) ) , anti h. pylori iga qty ( 96 well ( 1kit ) ) , anti h. pylori igg elisa qty ( 96 well ( 1kit ) ) , anti japanese b encephalitis igm qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igg qty ( 96 well ( 1kit ) ) , anti paravovirus 19 igm qty ( 96 well ( 1kit ) ) , anti sm qty ( 96 well ( 1kit ) ) , anti rnp qty ( 96 well ( 1kit ) ) , anti panca, canca qty ( 96 well ( 1kit ) ) , scrub typhus qty ( 96 well ( 1kit ) ) , anti cardilopinigg qty ( 96 well ( 1kit ) ) , anti cardilopinigm qty ( 96 well ( 1kit ) ) , anti echinococcaligg qty ( 96 well ( 1kit ) ) , anti hbs elisa qty ( 96 well ( 1kit ) ) , anti hsv 1 igm qty ( 96 well ( 1kit ) ) , anti hsv 1 igg qty ( 96 well ( 1kit ) ) , cmv igm qty ( 96 well ( 1kit ) ) , cmv –igg qty ( 96 well ( 1kit ) ) , anti brucellaigg qty ( 96 well ( 1kit ) ) , anti brucellaigm qty ( 96 well ( 1kit ) ) , west nile igm elisa qty ( 96 well ( 1kit ) ) , hbeag elisa qty ( 96 well ( 1kit ) ) , hbs ag elisa qty ( 96 well ( 1kit ) ) , anti neulear antibody ( elisa ) qty ( 96 well ( 1kit ) ) , hbc antigen qty ( 96 well ( 1kit ) ) , anti hbc qty ( 96 well ( 1kit ) ) , elisa igm for dengue qty ( 96 well ( 1kit ) ) , nucleic acid extraction kit ( rna & dna both ) qty ( 250 rxn ) , nucleic acid extraction kits ( from blood & bacterial culture ) qty ( 250 rxn ) , viral rna extraction kit qty ( 250 rxn ) , viral dna extraction kit qty ( 250 rxn ) , pcr master mix kit , one step rt pcr master mix kit qty ( 96 tests ) , gel extraction / purification kit qty ( 250 rxn ) , dna ladder ( marker ) 1kb , dna ladder ( marker ) 100bp , dna ladder ( marker ) 50bp , dna ladder ( marker ) l dna / hind iii , loading dye , for dna / for rna / forprotein , proteinladder , rna ladder , quantitative estimation rt pcr kits for hbv , quantitative estimation rt pcr kits for hcv , quantitative estimation rt pcr kits for hpv 16 , quantitative estimation rt pcr kits for hpv 18 , quantitative estimation rt pcr kits for hev , quantitative estimation rt pcr kits for hev , rt pcrkits for japanese enchephalitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr kit for zika virus. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for viral meningitis ( ( ftd neuro 9 ) ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcr multiplexkits for neonatal meningitis ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for respiratory tract virus ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , rt pcrmultiplexkits for gestroentritis. ( must be compatible with step one rt pcr abi system , quant studio 5 andabi 7500 fast dx ) , influenza primer probe ( niv pune recommended ) infa forward ( sequence ( 5’>3’ ) gac cra tcc tgt cac ctc tga c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infa reverse ( sequence ( 5’>3’ ) agg gca tty tgg aca aak cgt cta ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 forward ( sequence ( 5’>3’ ) ned / vic gtg cta taa aca cca gcc tcc catt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 reverse ( sequence ( 5’>3’ ) ned / vic aga ygg gac att cct caa tcc tg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) pdm h1 probe ( sequence ( 5’>3’ ) ned / vic fam ata cat ccr atc aca att ggr aaa tgt cca aa mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 forward ( sequence ( 5’>3’ ) ned / vic aag cat tcc yaa tga caa acc ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 reverse ( sequence ( 5’>3’ ) ned / vic att gcr ccr aat atg cct cta gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) ah3 probe1 ( sequence ( 5’>3’ ) ned / vic vic cag gat cac ata tgg gsc ctg tcc cag mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb forward ( sequence ( 5’>3’ ) ned / vic tcc tca ayt cac tct tcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb reverse ( sequence ( 5’>3’ ) ned / vic cgg tgc tct tga cca aat tgg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) infb probe1 ( sequence ( 5’>3’ ) ned / vic ned / vic cca att cga gca gct gaa act gcg gtg mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p forward ( sequence ( 5’>3’ ) aga ttt gga cct gcg agc g ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p reverse ( sequence ( 5’>3’ ) gag cgg ctg tct cca caa gt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) rnase p probe1 ( sequence ( 5’>3’ ) fam ttc tga cct gaa ggc tct gcg cg ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 188f ( sequence ( 5’>3’ ) aga cca gag gga aac tat gcc c ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) b ha bha 270r ( sequence ( 5’>3’ ) tcc gga tgt aac agg tct gac tt ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b victoria1 ( sequence ( 5’>3’ ) vic cagaccaaaatgcacggggaahatacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) type b yamagata1 ( sequence ( 5’>3’ ) fam cagrccaatgtgtgtggggaycacacc mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw f ( sequence ( 5’>3’ ) 5’ gaa cac arg agt ctg aat gtg 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) dr sw r: ( sequence ( 5’>3’ ) 5’ cat gcc agt tat ccc tgc 3’ ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw h2751 ( sequence ( 5’>3’ ) fam ccc cta mtt atc act a mgbnfq ) qty ( 1000rxn ) , influenza primer probe ( niv pune recommended ) sw 275y1 ( sequence ( 5’>3’ ) vic ccc cta mtt att act a mgbnfq ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1f ( caa aag gaa gtc gyg caa ta ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd1r ( ctg agt gaa ttc tct ctg ctr aac ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2f ( cag gct atg gca cyg tca cga t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd2r ( cca tyt gca gca rca cca tct c ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3f ( gga ctr gac aca cgc acc ca ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcd3r ( cat gtc tct acc ttc tcg act tgy ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 1 p ( 5 fam catgtggytgggagcrcgc 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 2p ( 5hex ctcyccragaacgggcctcgacttcaa 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , dengue primer probe ( niv pune recommended ) d1, d2 and d3 primers ( santiago et al., 2013 ) cdc assay cdcdenv 3p ( 5texas red acctggatgtcggctgaaggagcttg 3bhq2 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 10?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4fp ( gct gay gtc agg aay gac at ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4rp ( tct tct ttr tcc cat ttr tct cc ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chfp ( cga aaa rga rcc gga gra a ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chrp ( gat agt acc crg gkc tca tga cgt t ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin fp ( ggc acc cag cac aat gaa g ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin rp ( gcc gat cca cac gga gta ct ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) d4probe ( 5 cat ccc cca ccg tat gat atc 3 taqman mgb probe with texas red label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) chik probe ( 5 ccc trc gca tgc ttg a 3taqman mgb probe with vic label ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , d4, chik and actin primers ( patil ja et al 2018; cecilia d et al., 2015 ) actin probe ( 5fam tca aga tca ttg ctc ctc ctg aga gcg c 3bhq1 ) ( must be compatible with step one rt pcr abi system, quant studio abi, abi 7500fast dx, working concentration 40?m ) qty ( 1000rxn ) , acrylamide qty ( 500gm ) , agarose for rna ( >500bp ultrapure molecular grade ) qty ( 500 gm ) , ammonium acetate qty ( 500 gm ) , ammonium chloride qty ( 500 gm ) , ammonium per sulphate qty ( 100 gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 05gm ) , antibioticspure powder ampicillin / streptomycin / kanamycin qty ( 25gm ) , borate qty ( 500 gm ) , bisacrylamide qty ( 500 gm ) , beta mercapto ethanol qty ( 100 ml ) , calcium chloride ( cacl2 ) qty ( 500 gm ) , depc ( diethyl pyrocarbonate ) qty ( 100 ml ) , edta powder qty ( 500 gm ) , ethidiumbromide qty ( 10 gm ) , glucoseqty ( 500 gm ) , lithium chloride ( 3m / 5m ) qty ( 50 ml ) , lysozymeqty ( 15 gm ) , magnesium chloride qty ( 500 gm ) , mops buffer qty ( 1 kg. ) , phenol qty ( 500 ml ) , phosphate buffer saline ( ph 7.4, 7.2 ) powder form ( 1x ) qty ( 10 pouch / 1 pk. ) , pmsf ( phenylmethanesulfonyl fluoride ) qty ( 10gm ) , poly ethylene glycol – 8000 qty ( 500 gm ) , potassium acetate qty ( 500 gm ) , potassium chloride qty ( 500 gm ) , sds ( sodium dodicyl sulphate ) qty ( 500 gm ) , sodium acetate powder qty ( 500 gm ) , sodium acetate 3m / 5 m qty ( 50 ml ) , sodium chloride qty ( 500 gm ) , sodium deoxycholate qty ( 500 gm ) , sodium lauryl sulphate qty ( 500 gm ) , sodium nitrite qty ( 500 gm ) , sodium sulphate qty ( 500 gm ) , temed qty ( 100 ml ) , tri sodium citrate qty ( 500 gm ) , tris base powder qty ( 500 gm ) , tris buffer qty ( 500 gm ) , tris hydro chloride qty ( 500 gm ) , tris saturated phenol qty ( 500 ml ) , triton x 100 qty ( 100 ml ) , trizol reagent qty ( 100 ml ) , tween 20 qty ( 100 ml ) , tween 80 qty ( 25x 10 ml ) , water saturated phenol qty ( 500 ml ) , xyelinecyanol qty ( 10 gm ) , whatman filter paper no. 42, preferably qty ( 100 pc, sheet ) , syringe filter ( 0.22 mm ) , ( 0.45 mm ) qty ( 50 / 1 pk. ) , nitrocellulose membrane qty ( 3 mt. sheet ) , isopropyl alcohol molecular grade. qty ( 500 ml. ) , rnase awayqty ( 4 lit ) , dnase away qty ( 250 ml. ) , nuclease eliminator qty ( 500 ml. ) , horse serumqty ( 100 ml. ) , falcons tubes 50ml qty ( 100 pc. / pkt. ) , falcons tubes 15ml qty ( 100 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 2ml qty ( 500 pc. / pkt. ) , micro centrifuge tubes ( conical bottom attached hinged cap autoclavable ) 1.5ml qty ( 500 pc. / pkt. ) , micro pipette tips for pcr 0.5 10 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 10 100 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 20 200 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 10x96 qty ( 1 box ) , micro pipette tips for pcr 100 1000 ?l ( specification – made of 99.9% virgin poly proplylene sterile air filter made up of carboxy methyl cellulose of hydrophobic polyethylene, not containing self sealing additions autoclavable, free of lubricant, dyes, heavymetals, fillers, certified for human dna, rnase, pcr, inhibitor, dnase, endotoxin free, pyogen free, 100% inert with batch related certificate ) 6x96 qty ( 1 box ) , screw cap plastic vial 2 ml disposablewith label self standing, autoclavable qty ( 500 pc / pkt. ) , blood collection vacationer with gel ( yellow cap ) usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt ) , k3 edta blood collection vials vacutainized usfda / european ce approved batch wise non toxic and non pyrogenic certificate required qty ( 100 pc / pkt. ) , pcr tubes autoclavable, pp, sterile conical bottom 0.2ml with attached flat capqty ( 500 pc / pkt ) , pcr tubes with flat lid, autoclavable, sterile, pp, conical bottom 0.5 ml qty ( 500 pc / pkt. ) , micro amp fast reaction tubes 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction caps 0.2ml ( 8 tubes / strips ) compatible in use with quants studio ( abi ) system , micro amp fast reaction tubes 0.1ml ( 8 tubes / strips ) compatible in use with 7500 fast dx system, stepone, steponeplus system , micro amp fast reactioncaps 0.1ml ( 8 tubes / strips ) 7500 fast dx system, stepone, steponeplus system , antisera for salmonella , antisera for vibrio cholera , antisera for shigella , antisera for escherichia coli. o157 , anti ccp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , toxo igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , rub igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igg elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cmv igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 1 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hsv 2 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ige cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , cea cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 19.9 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ca 125 cal set elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , afp elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa elecsys lit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , pct elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ana elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , ttg iga elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbsag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , hbeag elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbs elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbc igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hbe elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hcv elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , anti hav igm elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , il 6 elecsys kit ( for cobas e 441 chemi assay system ) qty ( 100 tests ) , psa eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 19.9 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , afp eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , cea eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , ca 125 eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , pct ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , psa cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 19.9 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , afp cal set kit eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , cea cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , ca 125 cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct cal set eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , pct control eci consumables ( for vitros 3600 chemi assay system ) qty ( 1 pack ) , hbsag es ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , hbeag eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbs eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbc eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hbe eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hcv eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , anti hav igm eci consumables ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , il 6 reagent pack ( for vitros 3600 chemi assay system ) qty ( 100 tests ) , signal reagent ( for vitros 3600 chemi assay system ) qty ( 1 pack / 2 set ) , maintenance pk box / 2 packs ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 pack ) , wash reagent box / 2 bottles ( for vitros 3600 chemi assay system ) qty ( 1 box / 2 bottles ) , ampliseq sars cov2 research panel ( pool 1 & pool 2 each ) ( for gene sequencing lab ) qty ( 125*6 ) , ion xpress barcode adapters ( 1 16 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 17 32 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 33 48 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 49 64 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 65 80 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion xpress barcode adapters ( 81 96 ) ( ) ( for gene sequencing lab ) qty ( 17*1 tubes ) , ion ampliseq library kit plus ( ) ( for gene sequencing lab ) qty ( 1*96 rxn ) , ion 530 chip kit ( cat. no.a27764 ) ( for gene sequencing lab ) qty ( 1*8 ) , ion 510 / 520 & 530 kit chef ( cat. no.a34461 ) ( for gene sequencing lab ) qty ( 1*8 rxn ) , ampure xp reagent 60ml ( ) ( for gene sequencing lab ) qty ( 1*60ml ) , qubit ds dna hs assay kit 500 assays ( ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , qubit ds rna hs assay kit 500 assays ( ) ( for gene sequencing lab ) qty ( 1*500 rxn ) , superscript vilo c dna synthesis kit 250 rxn ( ) ( for gene sequencinf lab ) qty ( 1*250 rxn ) , qubit assay tubes ( ) ( for gene sequencing lab ) qty ( 1*500 no.s ) , dynamag 16 positions magnetic stand ( for gene sequencing lab ) qty ( 1*1 ) , dynamag 96 side magnet ( for gene sequencing lab ) qty ( 1*1 ) , automated rna extration kit for thermofisher kingfisher ( not prefilled ) ( for gene sequencing lab ) qty ( 1*2000 ) , pcr optical 8 tube strip without cap ( 0.2ml ) qty ( 1*125 ) , pcr optical 8 cap flat cap strip qty ( 1*300 ) , micropipette tips 10?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 20?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 100?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 200?l compatible with thermofisher qty ( 1*96*10 ) , micropipette tips 1000?l compatible with thermofisher qty ( 1*96*6 ) , molecular grade ethanol qty ( 500ml ) , ethanol analytical grade qty ( 500ml ) , nuclease free waterqty ( 100ml ) , microcentrifuge tube conical bottom with snap cap ( 1.5 / 1.7ml ) qty ( 500 ) , microcentrifuge tube u bottom with snap cap ( 2 ml ) qty ( 500 ) , 0.2 ml pcr plate low profile optical clear compatible with abi qty ( 1*10 ) , pcr plate adhesive qty ( 1*10 ) , cryo box ( 100 places ) ( plastic ) qty ( 1*4 ) , reversible rack for microcentrifuge tubes ( 0.5ml, 1 ml, 1.5ml ) qty ( 1*10 ) , ast n 280 ( for vitek 2 cards for automated culture sensitivity ) , ast n 281 ( for vitek 2 cards for automated culture sensitivity ) , ast n 235 ( for vitek 2 cards for automated culture sensitivity ) , ast p 628 ( for vitek 2 cards for automated culture sensitivity ) , ast 4508 ( for vitek 2 cards for automated culture sensitivity ) , ast s t03 ( for vitek 2 cards for automated culture sensitivity ) , ast n 363 ( for vitek 2 cards for automated culture sensitivity ) , ast n 364 ( for vitek 2 cards for automated culture sensitivity ) , gp id ( for vitek 2 cards for automated culture sensitivity ) , gn id ( for vitek 2 cards for automated culture sensitivity ) , yst id ( for vitek 2 cards for automated culture sensitivity ) , salmonella antisera polyvalent 0 , salmonella antisera group 09 , salmonella antisera h d , salmonella antisera h polyvalent phase 1 & 2 , salmonella antiserah:a , salmonella antisera h:b , shihella flexneri ( polyvalent b ) , shihellapolyvalent c , shihellapolyvalent d , v. cholera antisera polyvalent inaba & ogawa , v. cholera antisera ogawa , v.cholera antisera inaba , micropipette tips 10?l ( art ) qty ( 1*96*10 ) , micropipette tips 20?l ( art ) qty ( 1*96*10 ) , micropipette tips 100?l ( art ) qty ( 1*96*10 ) , micropipette tips 200?l ( art ) qty ( 1*96*10 ) , micropipette tips 1000?l ( art ) qty ( 1*96*6 ) , 0.2 ml optical clear pcr tube strip of 8 compatible with abi & biorad system qty ( 125*8 ) , 0.2 ml optical clear pcr tube strip of 8qty ( 125*8 ) , 0.2ml pcr plate low profile optical clear compatible with abi & biorad qty ( 1*10 ) , analytical grade ethanol qty ( 500ml ) , isopropyl alcohol molecular grade. qty ( 1000ml ) , cryo vial 2 ml screw capped leak proof with o seal self standing with label qty ( 1*1000 ) , triple distilled water qty ( 5 lit. ) , rna eliminator qty ( 500ml ) , disposable gown full cover qty ( 500 ) , depc ( diethyl pyrocarbonate ) qty ( 1 lit. ) , uracil n glycosylase ( ung ) qty ( 100 rxn ) , dutp mm ( 250?l ) , autoclave indicator sticker qty ( 1*10 ) , ohp marker pen ( red, blue & black ) , d 125 qty ( 1 lit. ) , glucose / dextrose qty ( 500 gm ) , lactose qty ( 500 gm ) , maltose qty ( 500 gm ) , fructose qty ( 500 gm ) , sucrose qty ( 500 gm ) , starch qty ( 500 gm ) , dextrin qty ( 500 gm ) , peptone qty ( 500 gm ) , casein qty ( 500 gm ) , gelatin qty ( 500 gm ) , egg albumin cd fine powder qty ( 500 gm ) , sulphuric acid ( concentrated ) qty ( 5 ltr ) , hydrochloric acid ( concentrated ) qty ( 5 ltr ) , nitric acid ( concentrated ) qty ( 5 ltr ) , glacial acetic acid qty ( 5 ltr ) , benedict’s reagent for carbohydrateqty ( 5 ltr ) , barfoed reagent for carbohydrate qty ( 5 ltr ) , sodium hydroxide qty ( 500 gm ) , ammonia ( liquid / concentrated ) qty ( 500 ml ) , hydrogen peroxide qty ( 500 ml ) , distilled waterqty ( 5 ltr ) , formalin qty ( 500 ml ) , glycerol qty ( 500 ml ) , benzidine powder qty ( 100 mg ) , benzidine reagent for blood qty ( 500 ml ) , phenyl hydrazine hydrochloride qty ( 500 gm ) , ninhydrin qty ( 100 gm ) , bilirubin qty ( 10 gm ) , mercuric sulphateqty ( 500 gm ) , mercuric chloride qty ( 500 gm ) , sodium tungstate qty ( 500 gm ) , alpha naphthol qty ( 100 gm ) , solid ammonium sulphate qty ( 500 gm ) , resorcinolqty ( 500 gm ) , lead acetate qty ( 500 gm ) , sodium acetate qty ( 500 gm ) , sodium carbonate qty ( 500 gm ) , sodium nitrite nano2 qty ( 500 gm ) , sodium nitroprussideqty ( 500 gm ) , sodium citrate qty ( 500 gm ) , phenolphthalein qty ( 100 gm ) , borax ( sodium borate ) qty ( 250 gm ) , iodine qty ( 100 gm ) , copper sulphate qty ( 500 gm ) , picric acid qty ( 500 gm ) , o toluidine reagent for blood sugar ( bdh ) qty ( 2x 500 ml ) , o toluidine ( bdh ) qty ( 1000 ml ) , potassium permanganate ( kmno4 ) qty ( 500 gm ) , trichloroacetic acidqty ( 500 ml ) , orthophosphoric acid qty ( 500 ml ) , ethanol ( absolute ) qty ( 500 ml ) , methanol ( absolut ) qty ( 500 ml ) , acetone ( absolute ) qty ( 500 ml ) , sulphosalicylic acid qty ( 500 gm ) , hypochloriteqty ( 5 ltr. ) , spiritqty ( 5 ltr. ) , lab wash qty ( 5 ltr. ) , phenyl qty ( 5 ltr. ) , hand sanitizerqty ( 500 ml ) , hand wash qty ( 500 ml ) , filter paper 46x57 cm qty ( 100 sheets ) , dark bottle ( glass amber colour ) qty ( 125 ml ) , dark bottle ( glass amber colour ) qty ( 500 ml ) , dark bottle ( glass amber colour ) qty ( 2000 ml ) , palin bottle ( glass ) qty ( 125 ml ) , palin bottle ( glass ) qty ( 500 ml ) , conical flaskqty ( 100 ml ) , conical flask qty ( 250 ml ) , conical flask qty ( 500 ml ) , conical flask qty ( 1000 ml ) , conical flask qty ( 2500 ml ) , beakerqty ( 25 ml ) , beakerqty ( 50 ml ) , beakerqty ( 100 ml ) , beakerqty ( 250 ml ) , beakerqty ( 500 ml ) , beakerqty ( 1000 ml ) , beakerqty ( 2000 ml ) , volumetric flaskqty ( 100 ml ) , volumetric flaskqty ( 250 ml ) , volumetric flaskqty ( 500 ml ) , measuring cylinderqty ( 100 ml ) , measuring cylinderqty ( 500 ml ) , measuring cylinderqty ( 1000 ml ) , measuring cylinderqty ( 20000 ml ) , amber colour dropping bottle ?? qty ( 125 ml ) , plain colour dropping bottle ?? qty ( 125 ml ) , wide mouth bottleqty ( 250 gm ) , wide mouth bottleqty ( 500 gm ) , test tubes 15ml qty ( 100 ) , test tubes 10ml qty ( 100 ) , test tubes 5ml qty ( 100 ) , automated chemical dispenser bottle ( for acid ) has a good quality dispenser with high accuracy 500ml , ph meter , centrifuge machine ( remi 304 / remi 303 ) , centrifuge machine ( remi r8c+neya 6 ) , remi rotor head with 32 tube buckets ( sv4 100 with 9b 5 / 7 ) , surgical gloves ( powdered ) qty ( 1 pair ) , plastic gloves ( disposables ) qty ( 1 pair ) , sample collection racks ( plastic / aluminum / ss ) ( for holding of 5 ml / 10ml / 15 ml test tube ) , sample cup ( plastic ) : 2 mlqty ( 1000 ) , sample cup ( plastic ) : 0.5 mlqty ( 1000 ) , aliquots ( plastic ) : 1 ml qty ( 1000 ) , pipette tips ( blue / white ) : 1 ml qty ( 1000 ) , pipette tips ( yellow / white ) : 0.1 ml qty ( 1000 ) , pipette ( variable ) 100 500 ?l , pipette ( variable ) 10 50?l , pipette ( variable ) 10 100 ?l , pipette ( variable ) 100 1000 ?l , pipette ( variable ) with 500 tips 1000 5000 ?l , pipette ( fixed volume ) 10 ?l qty ( 10 ml ) , pipette ( fixed volume ) 20 ?l qty ( 20 ml ) , pipette ( fixed volume ) 25 ?l qty ( 25 ml ) , pipette ( fixed volume ) 50 ?l qty ( 50 ml ) , pipette ( fixed volume ) 100 ?l qty ( 100 ml ) , pipette ( fixed volume ) 200 ?l qty ( 200 ml ) , pipette ( fixed volume ) 250 ?l qty ( 250ml ) , pipette ( fixed volume ) 500 ?l qty ( 500ml ) , pipette ( fixed volume ) 1000 ?l qty ( 1000ml ) , pipette ( fixed volume ) with 500 tips 5000 ?l qty ( 5000 ml ) , ada with standard ( pnp xod multipoint kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ammonia with standard ( gldh fixed kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , glucose / sugar with standard ( god pod kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , urea / bun with standard ( berthlot end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , creatinine with standard ( jaffes two point kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , total protein with standard ( biuret end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , albumin with standard ( bcg end point method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , bilirubin total and direct ( modified j.gorfs end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgot / ast ( mod. ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , alp ( mod.ifcc uv kinetic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 500ml ) , cholesterol with standard ( chod pap, enzymatic ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 1000ml ) , hdl cholesterol with standard ( peg chod end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 300ml ) , uric acidwith standard ( uricase end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 600ml ) , calcium with standard ( arsenazo iii end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , phosphorus with standard ( uv phosphomolybdate ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , serum mg++ with standard ( colorimetry end point ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 200ml ) , amylase ( cnp g single rgt kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , lipase ( methyl resorufin ester based kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ck nac ( mod. ifcc uv ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ggt ( mod. kinetic method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable open kits for semi automated chemistry analyzers ) qty ( 100ml ) , ada ( adenosine deaminase ) with calibrator ( pnp xod multipoint kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ammonia with calibrator ( gldh fixed kinetic ) qty ( 1ml ) , iron with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uibc with calibrator ( ferrozine based ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , transferrin with calibrator ( fluid stable ag ab kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ferritin with calibrator ( colorimetry based ag ab method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , crp quantitative with calibrator ( fluid stable ag ab uv ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , d dimer with calibrator ( fluid stable ag ab ls method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , glucose / sugar ( hk uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , urea / bun ( gldh uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , creatinine with calibrator ( crt pap enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , total protein ( biuret mono ep ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , albumin ( bcg method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( direct ) with calibrator ( bil dca method dichloroaniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , bilirubin ( total ) with calibrator ( bil dca method dichloraniline ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgot / ast ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , sgpt / alt ( mod.ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , alp ( mod. ifcc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , triglycerides ( gpo pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , cholesterol ( chod pap, enzymatic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , hdl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldl cholesterol with calibrator ( direct enzymatic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , uric acid ( uricase end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calcium ( arsenazo iii end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , phosphorus ( uv phosphomolybdate ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , serum mg++ ( colorimetry end point ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , amylase ( cnp g single reagent kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , lipase with calibrator ( methyl resorufin ester based kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ldh ( pyruvate dgkc uv kinetic ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck mb with calibrator ( immunoinhibition based ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ck nac with calibrator ( mod.ifcc uv ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , ggt ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , acid phosphatase with calibrator ( mod. kinetic method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , microprotein with calibrator ( pgr ep method ) ( liquid stable system pack for fully automated chemistry analyzers must suitable for analysis on backman coulter au680, sys 1000, xl 1000, xl 640, em 360 analyzers ) qty ( 1ml ) , calibrator ( third party system calibrator of 20x5ml size may from randox / biorad / beckman coulter / erba / diasys can used for calibration of kits that not mentioned as parameter with calibrator ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , control ( third party system control low / 1 & third party system control high / 2 of 20x5ml size may cover wide rages of parameters ( may from randox / biorad / beckman coulter / erba / diasys can used for ioq of parameters. ) ( for used with reagent on fully automated chemistry analyzers like beckman coulter au680, sys 1000, xl 1000, xl 640, em 360 etc ) , wash solution for beckman coulter qty ( 12 ltr ) , contamination avoidance solution for beckman coulter qty ( 216ml ) , erba xl wash: auto wash qty ( 10x100ml ) , erba xl wash ac / al qty ( 5 / 5x44ml ) , cleaning solution for beckman coulter qty ( 2700ml ) , alkaline cleaner for sys qty ( 2ltr ) , anti bacterial for sysqty ( 500ml ) , ise buffer for beckman coulter au 680 qty ( 8 ltr ) , ise mid standard for beckman coulter au 680 qty ( 8 ltr ) , ise reference for beckman coulter au 680 qty ( 4 ltr ) , ise high for beckman coulter au 680 qty ( 400ml ) , ise low for beckman coulter au 680 qty ( 400ml ) , ise selectivity check for beckman coulter au 680 qty ( 50ml ) , ise internal ref. for beckman coulter au 680 qty ( 50ml ) , ise reagent for enlite ( accurex ) qty ( 870ml ) , ise diluent for sys 1000 qty ( 2 ltr ) , ise internal standard for sys 1000 qty ( 2 ltr ) , ise reference for sys 1000 qty ( 2 ltr ) , ise high for sys 1000 qty ( 30ml ) , ise low for sys 1000 qty ( 30ml ) , ise selectivity check for sys 1000 qty ( 100ml ) , ise pack for xl series , ise reagent for pci lyte , reference electrode for beckman coulter au 680 , sodium electrode for beckman coulter au 680 , potassium electrode for beckman coulter au 680 , chloride electrode for beckman coulter au 680 , calcium electrode for beckman coulter au 680 , lithium electrode for beckman coulter au 680 , ph electrode for beckman coulter au 680 , reference electrode for xl 1000 , sodium electrode for xl 1000 , potassium electrode for xl 1000 , chloride electrode for xl 1000 , calcium electrode for xl 1000 , lithium electrode for xl 1000 , ph electrode for xl 1000 , reference electrode for xl 640 , sodium electrode for xl 640 , potassium electrode for xl 640 , chloride electrode for xl 640 , calcium electrode for xl 640 , lithium electrode for xl 640 , ph electrode for xl 640 , reference electrode for sys 1000 , sodium electrode for sys 1000 , potassium electrode for sys 1000 , chloride electrode for sys 1000 , calcium electrode for sys 1000 , lithium electrode for sys 1000 , ph electrode for sys 1000 , reference electrode for enlite ( accurex ) , sodium electrode for enlite ( accurex ) , potassium electrode for enlite ( accurex ) , chloride electrode for enlite ( accurex ) , calcium electrode for enlite ( accurex ) , lithium electrode for enlite ( accurex ) , ph electrode for enlite ( accurex ) , reference electrode for pc ilyte , sodium electrode for pc ilyte , potassium electrode for pc ilyte , chloride electrode for pc ilyte , calcium electrode for pc ilyte , lithium electrode for pc ilyte , ph electrode for pc ilyte , electrode refilling solution for beckman coulter au 680 , cleaning solution for beckman coulter au 680 , deproteinizer ( renin ) for beckman coulter au 680 , controls for beckman coulter au 680 , calibrator for beckman coulter au 680 , electrode refilling solution for xl 1000 , cleaning solution for xl 1000 , deproteinizer ( renin ) for xl 1000 , controls for xl 1000 , calibrator for xl 1000 , electrode refilling solution for xl 640 , cleaning solution for xl 640 , deproteinizer ( renin ) for xl 640 , controls for xl 640 , calibrator for xl 640 , electrode refilling solution for sys 1000 , cleaning solution for sys 1000 , deproteinizer ( renin ) for sys 1000 , controls for sys 1000 , calibrator for sys 1000 , electrode refilling solution for enlite ( accurex ) , cleaning solution for enlite ( accurex ) , deproteinizer ( renin ) for enlite ( accurex ) , controls for enlite ( accurex ) , calibrator for enlite ( accurex ) , electrode refilling solution for pc ilyte , cleaning solution for pc ilyte , deproteinizer ( renin ) for pc ilyte , controls for pc ilyte , calibrator for pc ilyte , hba1c test kit with calibrator for hb vario qty ( 2x100 test kit ) , hba1c control for hb vario qty ( 2x0.5ml ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 300 tests ) , sensor casettes sc90 ( for abl 90 flex make radiometer ) qty ( 600 tests ) , abl90 flex solution pack ( for abl 90 flex make radiometer ) qty ( 980 tests ) , thermal paper 110mmx20mtr. ( for abl 90 flex make radiometer ) , ada ( adenosine deaminase ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , macroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , crp quantitative with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs crp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , d dimerwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ferritin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , transferrinwith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , hs trop i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , trop t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , myoglobin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , nt pro bnp with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cpk mb with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , t4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ft4 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , thyroglobulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti – tg ( thyroglobulin ) ab with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti tpo antibodywith calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , lh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fsh with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prl ( prolactin ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ? hcg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , progestrone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , testosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , estradiol ( e ii ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin d with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , vitamin b12 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , folate / folic acid with calibratopr ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , insulin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , c peptide with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , anti ccp test with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , osteocalcin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , calcitonin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , procalcitonin ( pct ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , human growth hormone ( hgh ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , para thyroid hormone ( pth ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cortisol with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , direct renin with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , aldosterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , androstenedione with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , acth with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , dhea s with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , shbg with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , 17 oh progesterone with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , amh ( anti mullerian hormone ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ttg ig a ( transglutaminase ig a ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , prostate specific antigen ( psa ) t with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , free psa with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , carcinoembryonic antigen ( cea ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , alfa feto – protein ( afp ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf i with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , igf bp3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , fgf 23 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , tnf a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca 125 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 19.9with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , ca – 15.3 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 1b with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 6 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , cytokine il 10 with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( minor ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , bcrabl ( major ) with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig a with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig e with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig g with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , total ig m with calibrator ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 1 test ) , immuno assay controls ( lyophilized ) level 1, 2, 3 ( randox / biorad / b. coulter / ortho. diag. / biomerieux ) prefer that cover wide range of hormones and others ) ( clia based ) ( liquid stable system pack with calibrator for immunoassay analyser system make by beckman / ortho diagnostic / biomerieux vidas etc. must suitable for analysis on beckman coulter access ii, vitros 3600, vidas blue / nsh analyzers ) qty ( 12x5ml / level ) , substrate for access ii ( used on analyzer beckman coulter access ii ) , wash buffer for access ii ( used on analyzer beckman coulter access ii ) , sample diluent a for access ii ( used on analyzer beckman coulter access ii ) , reaction vessels for access ii ( used on analyzer beckman coulter access ii ) , system check solution for access ii ( used on analyzer beckman coulter access ii ) , access contrad 70 ( used on analyzer beckman coulter access ii ) , access citranox ( used on analyzer beckman coulter access ii ) , waste bags for access ii ( used on analyzer beckman coulter access ii ) , signal reagent for vitros 3600 , universal wash buffer for vitros 3600 qty ( 2x5000 ml ) , maintenance kit for vitros 3600 qty ( 2x100 mv ) , versa tips for vitros 3600 qty ( 1x1000 ) , sample cups ( 0.5 ml ) qty ( 1x1000 ) , pm kit for transasia em 360 ( 1 kit / analyzer / year ) , pm kit for xl 1000 ( 1 kit / analyzer / year ) , pm kit for xl 640 ( 1 kit / analyzer / year ) , pm kit for diasys 1000 ( 1 kit / analyzer / year ) , pm kit for beckman coulter au 680 ( 1 kit / analyzer / year ) , pm kit for beckman coulter access ii ( 1 kit / analyzer / year ) , pm kit for ortho diag. vitros 3600 ( 1 kit / analyzer / year ) , pm kit for vidas ( 1 kit / analyzer / year ) , pm kit for hb vario ( 1 kit / analyzer / year ) , pm kit for pc ilyte ( 1 kit / analyzer / year ) , pm kit for enlite ( 1 kit / analyzer / year ) , pm kit for erba chem 5x / plus ( 1 kit / analyzer / year ) , lamp ( 2 lamps / analyzer / year ) ( for transasia em 360 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for xl 640 ) , lamp ( 2 lamps / analyzer / year ) ( for diasys 1000 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter au 680 ) , lamp ( 2 lamps / analyzer / year ) ( for beckman coulter access ii ) , lamp ( 2 lamps / analyzer / year ) ( for ortho diag. vitros 3600 ) , cuvette ( hard quartz ) ( for transasia em 360 ) , cuvette ( hard quartz ) ( for xl 1000 ) , cuvette ( hard quartz ) ( for xl 640 ) , cuvette ( hard quartz ) ( for diasys 1000 ) , cuvette ( hard quartz ) ( for beckman coulter au 680 ) , sample probe ( for transasia em 360 ) , sample probe ( for xl 1000 ) , sample probe ( for xl 640 ) , sample probe ( for diasys 1000 ) , sample probe ( for beckman coulter au 680 ) , sample probe ( for beckman coulter access ii ) , sample probe ( for ortho. diag. vitros 3600 ) , sample probe ( for hb vario ) , sample probe ( for pci lyte ) , sample probe ( for enlite ) , sample probe ( for radiometer abl 90 flex ) , reagent probe r1 and r2 ( for transasia em 360 ) , reagent probe r1 and r2 ( for xl 1000 ) , reagent probe r1 and r2 ( for xl 640 ) , reagent probe r1 and r2 ( for diasys 1000 ) , reagent probe r1 and r2 ( for beckman coulter au 680 ) , reagent probe r1 and r2 ( for beckman coulter access ii ) , reagent probe r1 and r2 ( for ortho. diag. vitros 3600 ) , sample mixture ( for transasia em 360 ) , sample mixture ( for xl 1000 ) , sample mixture ( for xl 640 ) , sample mixture ( for diasys 1000 ) , sample mixture ( for beckman coulter au 680 ) , sample mixture ( for beckman coulter access ii ) , sample mixture ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for transasia em 360 ) , complete tubing set internal, external ( for xl 1000 ) , complete tubing set internal, external ( for xl 640 ) , complete tubing set internal, external ( for diasys 1000 ) , complete tubing set internal, external ( for beckman coulter au 680 ) , complete tubing set internal, external ( for beckman coulter access ii ) , complete tubing set internal, external ( for ortho. diag. vitros 3600 ) , complete tubing set internal, external ( for hb vario ) , complete tubing set internal, external ( for pci lyte ) , complete tubing set internal, external ( for enlite ) , complete tubing set internal, external ( for vidas ) , complete tubing set internal, external ( for erba chem 5x / plus ) ...

North Western Railway - Rajasthan

33891437 supply of sterile disposable needle size 26gx0.5%u2019%u2019sterile disposable needle size 26gx0.5%u2019%u2019, sterile disposable needle size 26gx0.5?? ( irp_no 80253 as per 80253.0 => limited...

Sardar Patel Medical College - Rajasthan

33793805 supply of reagents and chemicals 3 4 cbc fluid: erba 1.diluent ( 201 ) 2. aeaner ( 500 ml ) 3.lyse ( 50 ml ) glass shdes 5 leishman stain powder ( 25 gm ) methanol ( 5 1 ) m.p. card ( malaria card ) 6 7 8 sodium citrate powder ( 5oogm ) 9 disposable esrpipettes 10. capillary tubes 1i. dengue combo card ( nsigm, igg ) 12. widal test 13 r.a. test 1. 2. conc. hcl ( 50oml ) distell water ( 5 l ) , 14 crp test 15 aso test an a, anti b, anti d, antisera 17. hiv card test 18. vrdi card test 19. hbsag card test 20. urine pregnancy card test 21. uristic ror albumin&sugar 22 uristic for ketone bodies 23. sulphur powder disposable urine container 24. 25. disposable syringe ( 5ml ) 26. disposable syringe ( 2ml ) 27 disposable needle ( 24g ) glass tube 28., 29. edtak3vial 30. clot acti vator vials 31 plain vials 32. riya vials 33 lugo”s iodine solution — 34 test tube stand plastic 35 blood sugar kit . ( erba / coral / randox / ag d ) vimek / m icromaste r 36. blood urea kit ( e rba / coral / ra ndox / ag d ) vimek / micromaster 37 serum creatinine kit ( erba / cora 1 / ra ndox / ag d ) vimek / micromaster 38. serum bilirubin kit ( erba / coral / randox / ag 0 ) vimek / micromaster 39. sgot kit ( erba / coral / randox / ag d ) vimnek / micromaster, uric acid kit ( erba / coral / randox / agd ) vimek / micromaster erum prot&n kit ( e rba / coral / ra ndox / agd ) vimek / micromaster serum albumin kit ( erba / coral / ra ndox / ag d ) vimek / micromaster serum cholestrol kit ( e rba / coral / ra ndox / agd ) vimek / micromaster serum triglyceride kit ( erba / coral / randox / agd ) vimek / micromaster serum calcium kit ( e rba / coral / ra ndox / ag d ) vimek / micromaster 1’, 48. auto pipette ( 5 50 micron ) ( 100 1000 micron ) 49 blue tips 50. yellow / white tips 51. tourniquet 52. crc roll 53 fieldstaina 54 field stain b 55. filter paper whatman 56. blood sugar strip with meter 57. cover slips....

National Institute Of Ayurveda - Rajasthan

33785908 rate contract for hospital consumables , injection : , inj.n.s. 100ml , inj.n.s. 500ml , inj. dns 500 ml , inj.d5% 500ml , inj. d 10% 500 ml , inj. d 25% 100 ml , inj.rl 500ml , inj dexa , inj genta , inj piloearpine , inj adrenaline (1 ml) (1x50 ampuls) , inj.xylocaine2%withadrenaline , inj.xylocaine2%(lox) , inj. anawin heavy(bupivacaine) , inj. lox heavy(lignocaine) , inj atropine (1x50 ampuls) , inj. dexona(dexamethasone) , inj.avil(pheniraminemaleate) , inj.thiopentone(thiopentalsodium) 0.5gm , inj.succinylcholine(sueol) , inj.perinorn2m(metoclopramide) , inj.emeset2ml(ondansetron) , inj.rantac2ml(ranitidine) , inj.ketamine5ml , inj.t.t.5ml (inj. tetanus toxide 0.5ml) , inj.neostigmine 1ml , inj.atracuriumbesylate 10ml , inj.midazolam 10ml.10mg , inj.dynapar 1ml/(diclofenec) , inj.gentamycin 2ml 80 mg , inj.maczone plus 1.5gms/(ceftrixone + salbectam) , inj.tramadol2ml , inj. vit. k , inj. deriphyllin , inj. hydrocort/(hydrocortisone) , inj. lasix 2ml (furosemide) , inj. paracetamol (150 mg) , inj. buscopan (hyoscine) , inj. tranexa 5ml (tranexamic) , inj. magnesium sulphate 50% 2ml , inj. hydrocortison , inj. metrogyl 100ml , inj. ketamin/ aneket vial , inj. haemaccel 500 ml , inj. labetatol , inj. carbetocin , inj. perinorm/metoclopramide 2ml , inj. epidosin , inj. drotin , inj. phenargan , inj. carboprost , inj. fevastin/neomol , inj. betnesol , inj. amikacin 2ml 500 mg , inj. dexomethosne , inj. kaplin 10mg , inj. botropase , inj. iron sucrose , sterile water 10ml , sterile water 5ml , sepguard 100ml , halothane liquid 250ml , mannitol 100ml , povidine iodine 7.5% (500ml) , povidine iodine 10% (100ml) , povidine iodine 5% (100ml) , solution asthalin 15ml , omnipaque dye 50ml , abgel foam , betadine ointment 250gm , inj. methergin , xylocaine jelly 2% 50gm , pc enema 100ml , justin suppository 25mg , betadine 5% 1 ltr , xylocaine jelly 2% 50gm , tablet : , tab. paracetamol (500 mg) , tab. ranitidine (150 mg) , tab. meftal spas (1x10) , tab. sorbitrat , cap. nicardia 5mg , tab. formaline (100 pcs) , items(suture) : , barbours thread surgical linen no. 20 , barbours thread surgical linen no. 40 , chromic catgut 1.1 (110cm45mm needle) 2crb , chromic catgut 1.1 (40mm needle) 2crb , chromic catgut 0.0 (zero) 2crb , chromic catgut 1.0 (110cm45mm needle) 1/2crb , chromic catgut 2.0 1/2crb , chromic catgut 3.01/2crb , vicryl no. 0.0 (zero) , vicryl no. 1.0 (110cm45mmneedle) , vicryl no. 1.1 (110cm45mmneedle) , vicryl no. 1 0/2crb , vicryl no. 1 1/2crb , vicryl 2.0 round body 1/2 crb , vicryl 3.0 1/2 crb , monocryl suture 3 0 with needle , prolene no. 1 , prolene no. 1 , prolene no. 1.0 , prolene 2.0 , monoglyde 3.0 , ethilono 1 3/8 cce , ethilono 1.0 3/8 cce , ethilono 2.0 3/8 cce , ethilono 3.0 3/8 cce , surgical sature 4.0 , surgical sature 5.0 , surgical sature 8.0 , surgical sature 10.0 , surgical items : , n 95 , surgical masks 3 layers , clinical surgical spirit 5 ltr , hand sanitizer 5 ltr , surgical gloves (sterile+ packed) 6 no. , surgical gloves (sterile+ packed) 6.5 no. , surgical gloves (sterile+ packed) 7 no. , surgical gloves (sterile+ packed) 7.5 no. , examination gloves (latex) small size , examination gloves (latex) medium size , examination gloves (latex) large size , surgical gowns ( green cloth) , patient ot gown (disposable) (size standard) , surgical caps , surgical absorbant cotton (500gm) , cotton roll 500gms , cotton roll bandages 15cmx3mtr. (deluxe) , cotton roll bandages 10cmx3mtr. (deluxe) , cotton roll bandages 5cmx3mtr. (deluxe) , soft roll 15cmx3mtr , soft rolll 10cm x 3 mtr , surgical gauze cloth (than) 90cmx180mtr. (deluxe) , surgical gauze piece 10cmx10cmx8ply , surgical gauze piece 2inchx2inch , pop bandages 15cmx2.7 mtr , pop bandages 10cmx2.7 mtr , disposable syringes with hypodermic needles 1ml , disposable syringes with hypodermic needles 2ml , disposable syringes with hypodermic needles 5ml , disposable syringes with hypodermic needles 10ml , disposable syringes with hypodermic needles 50ml , disposable hypodermic needles 18no. , disposable hypodermic needles 20no. , disposable hypodermic needles 22no. , disposable hypodermic needles 24no. , disposable hypodermic needles 25 no. , disposable hypodermic needles 26no. , iv cannula 20 no. , iv cannula 22 no. , iv cannula 18 no. , iv cannula three way 20 no. , iv sets , uro bags standard , folleys catheter 18 , folleys catheter 16 , folleys adaptors (standard size) , ultrasound jelly , paper tape 2.5 cm x 9 mtr , paper tape 5 cm x 9 mtr , paper tape 7.5 cm x 9 mtr , paper tape 10 cm x 9 mtr , ampule cutter , disposable needle cutter (electric) , elastic band tourniques adjustable free size , k 90 size f.c. 14 (urethral catheter) , surgical blade no. 24 , surgical blade no.15 , surgical blade no.11 , surgical needles cutting edge 1/2 circle no. 10 , surgical needles cutting edge 1/2 circle no. 08 , surgical needles cutting edge 1/2 circle no. 06 , surgical needles round body 1/2 circle no. 08 , plastic box 8x10 , plastic containers 500gm , disposable suction tube with tip , abdominal drainage kit no. 12 , ryles tube 16 no. , infant feeding tubes 6 no. , infant feeding tubes 8 no. , endotracheal tube (disposable) 3mm , endotracheal tube (disposable) 3.5mm , endotracheal tube (disposable) 6mm , endotracheal tube (disposable) 6.5mm , endotracheal tube (disposable) 7mm , spinal needle 25 no. , mops sponge cotton 25x25x12 ply (with x ray) , mops sponge cotton 30x30x12 ply (with x ray) , macintosh sheet(1 roll=20mtr.) , plastic aprons standard , hernia kit with polypropylene mesh suze 4x6 with polypropylene sutures 1 0, polypropylene sutures 2 0, polygalectin 1 0, sounds closure suture material preferred monoglide or nylon. , surgical cautery pencil unipolar , blood transfusion set (bt set) adult , blood transfusion set (bt set) paediatric , iv cannula 20g triway pink , eye drap sheet 100 cm x 120 cm , trolley sheet 100 cm x 200 cm (preferably green & blue) , pocket mask adult , pocket mask child , ecg jelly 5ltr , ecg paper (cardiart 9108 d) , miscellaneous items : , lyzol solution for pharmacy grade , formaline liquid 5ltr , hydrogen peroxide 400 ml , anticeptic liquid 1 ltr , hypochlorite solution 5% 5 ltr , anticeptic handwash 5 ltr , anticeptic soaps 125 gm , anticeptic liquid 1 ltr , slipper (ot m/f)...

Government Medical College - Rajasthan

33780704 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 , 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) , 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) , 3rd generation recombinant f viii 1000 iu with diluent , 3rd generation recombinant f viii 250 iu with diluent , 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) , abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) , abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) , abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) , abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) , absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) , absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 , absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 , absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm , absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed , absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm , absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) , absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) , absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) , absorbent cotton wool ip 500 gm , acebrophylline tablet / capsule 100 mg , aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg , acenocoumarol tab ip / nicoumalone tab ip 2 mg , acetazolamide tab ip 250mg , acetylcystine solution usp ( injection ) 200 mg / ml , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir cream 5% , acyclovir eye ointment ip 3% w / w 5gm size , acyclovir intravenous infusion ip 250mg , acyclovir intravenous infusion ip 500mg , acyclovir oral suspension ip 400mg / 5ml , acyclovir tab ip 200 mg , acyclovir tab ip 800 mg , adenosine injection ip 6 mg / 2ml , adrenaline injection ip 1mg / ml im / iv use , albendazole oral suspension ip 400 mg / 10ml , albendazole tablets ip 400 mg ( detail in rc ) , alendronate sodium tablets usp / bp 35 mg , alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) , allopurinol tablets ip 100 mg , alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit , alprazolam tab ip 0.25 mg , alprazolam tab ip 0.5mg , amikacin inj ip 100 mg , amikacin inj ip 250 mg , amikacin inj ip 500 mg , amino acid 10% injection 100ml size , aminophylline inj ip 25 mg / ml , amiodarone hydrochloride inj 50 mg / ml , amiodarone tab ip 100 mg , amiodarone tab ip 200 mg , amitriptyline tab ip 25mg film coated , amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) , amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) , amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg , amlodipine tab ip 2.5 mg , amlodipine tablets ip 5 mg , amoxicillin and potassium clavulanate inj ip 1.2gm , amoxicillin and potassium clavulanic ip inj 600mg , amoxycillin and cloxacillin cap 250 + 250 mg , amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg , amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) , amoxycillin cap ip 250mg , amoxycillin cap ip 500mg , amoxycillin dispersible tablets ip 125 mg , amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml , amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg , amphotericin b inj ip 50 mg , ampicillin cap ip 500mg , ampicillin injection ip 500 mg , antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg , antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil , anti a blood grouping serum ip ( anti a monoclonal serum ) , anti b blood grouping serum ip ( anti b mono clonal serum ) , anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip , anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) , anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg , artemether and leumefantrine tablet ( 40 mg and 240 mg ) , artemether and leumefantrine tablet ( 80 mg and 480 mg ) , artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) , ascorbic acid tab ip 500 mg , asepto syringe with transparent bulb sterile, 60 ml , aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) , aspirin tablet ip ( gastro resistant ) 150 mg , atenolol tab ip 25 mg , atenolol tab ip 50 mg , atorvastatin tab ip 10mg , atorvastatin tablets ip 40 mg , atracurium inj 10 mg / ml , atropine eye ointment ip 1% , atropine sulphate injection 0.6mg / ml , atropine sulphate ophthalmic solution usp 1% , azathioprine tab ip 50 mg , azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) , azithromycin tab ip 500 mg , azithromycin tablets ip 250mg , aztreonam injection 1gm , aztreonam injection usp 500 mg , b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) , b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) , baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) , beclomethasone inhalation ip 200 mcg / dose , beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) , bendamustine injection 100 mg , benzathine benzylpenicillin inj ip 12 lac units , benzathine benzylpenicillin inj ip 6 lac units , betahistine tab ip 16 mg , betahistine tab ip 8 mg , betamethasone dipropionate cream ip 0.05% , betamethasone lotion ip 0.05 o / o , betamethasone sod phos inj ip 4mg / ml , betamethasone tab ip 0.5mg , betaxolol eye drops 0.5 o / o , bevacizumab injection 100 mg , bevacizumab injection 400 mg , bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) , biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) , bisacodyl tab ip 5 mg , black disinfectant fluid ( phenyl ) as per schedule o grade iii , bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) , blood administration set blood transfusion set ( details in rc ) , bone cement , bone wax sterilised , bortezomib injection 2mg , brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% , bromocriptine tablets ip 2.5 mg , budesonide nebulizer suspension 0.25mg / ml , budesonide powder for inhalation 200 mcg , bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg , bupivacaine inj ip 0.5% , butorphanol tartrate injection usp 1mg / ml 1ml size , cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) , caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size , calamine lotion ip 100ml , calcitriol capsules ip 0.25 mcg , calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) , calcium gluconate inj ip 10% ( iv use ) , calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) , capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) , carbamazepine oral suspension usp 100 mg / 5ml , carbamazepine tab ip 100 mg , carbamazepine tab ip 200 mg ( film coated ) , carbimazole tabs ip 5 mg ( film coated ) , carboplatin injection ip 150 mg , carboplatin injection ip 450 mg , carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml , carboxymethylcellulose eye drops ip 0.5% , carvedilol tablet 3.125 mg , catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) , cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) , cefadroxil tablet 500 mg , cefepime injection ip 500 mg , cefixime oral suspension ip 25mg / ml ( paediatric drops ) , cefixime tab ip 100 mg , cefixime tab ip 200 mg , cefoperazone and sulbactum for inj ( cefoperazone sodium cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) , cefotaxime inj ip 250 mg , cefotaxime injection ip 1 g , cefpodoxime dispersible tab 50 mg , ceftazidime inj ip 1g , ceftazidime inj ip 250 mg , ceftazidime inj ip 500 mg , ceftriaxone 1 gm + tazobactum 125 mg injection , ceftriaxone inj ip 1g / vial , ceftriaxone inj ip 250 mg / vial , ceftriaxone inj ip 500mg / vial , cefuroxime axetil tab ip 250 mg , cephalexin cap ip 250 mg , cephalexin cap ip 500 mg , cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml , cephalexin tablets 125 mg ( dispersible tablets ) , ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o , cetirizine syrup ip 5mg / 5 ml , cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab , cetrimide cream ip 15 gm , chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) , chemotherapy port and non coring needles ( adult ) ( detail in rc ) , chlorambucil tab ip 5 mg , chloramphenicol 1% w / w eye ointment ip, 3gm size , chloramphenicol eye drops ip 0.5 0 / 0 , chlordiazepoxide tablets ip 10mg , chlorhexidine gluconate solution 5% 250 ml , chlorhexidine mouthwash ip 0.2 o / o , chloroquine phosphate inj ip 40 mg / ml , chloroquine phosphate suspension ip 50 mg / 5ml , chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated , chlorpheniramine maleate tab ip 4mg , chlorpromazine inj. ip 25mg / ml , chlorpromazine tablets ip 100 mg ( coated tablet ) , chlorpromazine tablets ip 25 mg ( sugar coated ) , chlorpromazine tablets ip 50 mg ( coated tablets ) , chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) , cholecalciferol granules 60, 000 iu / gm , chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) , chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) , cinnarizine tablet ip 75 mg , cinnarizine tablets ip 25 mg , ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp , ciprofloxacin eye drops ip 0.3 o / o w / v , ciprofloxacin injection ip 200mg / 100ml , ciprofloxacin ophthalmic ointment usp 0.3% , ciprofloxacin tablet ip 500 mg film coated , ciprofloxacin tablets ip 250 mg film coated , cis atracurium besylate injection 2 mg / ml in 5 ml vial , cisplatin inj ip 10 mg / 10 ml , cisplatin inj ip 50 mg / 50 ml , clindamycin capsule ip 150mg , clindamycin capsule ip 300 mg , clindamycin phosphate gel usp 1 o / o , clindamycin phosphate injection ip 300 mg , clobazam tablet / capsule 10 mg , clobazam tablet / capsule 5 mg , clobetasol propionate cream ip 0.05 o / o , clomifene tab ip 25 mg , clomiphene tab ip 50 mg , clonazepam tablet 0.5 mg , clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) , clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg , clopidogrel tab ip 75 mg , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) , close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) , clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops , clotrimazole cream ip 2% w / w , clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) , clotrimazole vaginal tab ip 500mg , cloxacillin sodium inj ip 500mg , coal tar 6% & salicylic acid 3% ointment , colistimethate injection ip 1m iu powder for solution , compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o , compound benzoin tincture ip , compound sodium lactate inj. ip , conc haemodialysis fluid b.p acetate concentrate 10 litre can , concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans , conjugated estrogen tabs usp 0.625 mg. , corrugated drainage sheet all sizes ( details in rc ) , co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg , co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) , co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg , cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. , cough syrup / expectorant ( 50 ) ml , cyclophosphamide inj ip 200 mg , cyclophosphamide inj ip 500 mg , cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) , cyclosporin capsule usp / ip 50 mg , cytarabine injection bp 500mg , dacarbazine injection 500 mg usp / bp , danazol cap ip 50 mg , dasatinib tab 100 mg , daunorubicin inj ip 20 mg , deferasirox tab 100 mg , deferasirox tab 500 mg , deferiprone cap 250 mg , deferiprone cap 500 mg , dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , dexamethasone inj ip 8mg / 2ml , dexamethasone tab ip 0.5 mg , dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) , dextromethorphan hbr syrup ip 13.5mg / 5ml , dextrose inj ip 10% , dextrose inj ip 25% w / v , dextrose inj ip 5% , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam inj ip 10mg / 2ml ( 1m / iv use ) , diazepam tab ip 5 mg , diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) , diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% , diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg , diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use , diclofenac sodium inj ip 25 mg / ml ( im / iv use ) , diclofence prolonged release tablet ip 100 mg , dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets , dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg , dicyclomine hydrochloride oral solution ip 10mg / 5ml , dicyclomine inj ip 10 mg / ml , dicyclomine tab ip 10 mg , diethylcarbamazine tab ip 100 mg , digoxin inj ip 0.25 mg / ml , digoxin tab ip 0.25 mg. , diltiazem tabs ip 30 mg film coated , dinoprostone cream / gel 0.5 mg dinoprostone in syringe , diphtheria antitoxin 10000 iu , disposable sterile surgical rubber gloves size 8 inches, powder free , disposable sterile surgical rubber gloves size 8 inches, powdered , divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) , dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) , domperidone oral drops 10mg / ml ( 10ml ) , domperidone suspension ip 5mg / 5ml , domperidone tab ip 10 mg , dopamine hydrochloride inj ip 40 mg / ml , double j stent, sterile, both ends open size 4f, length 16 cm , double j stent, sterile, both ends open, size 5f, length 20 cm , double j stent, sterile, one end closed size 4f, length 16 cm , double j stent, sterile, one end closed, size 5f, length 20 cm , doxorubicin inj ip 50 mg / 25 ml , doxycycline cap ip 100 mg , doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg , drotaverine hydrochloride inj 40 mg / 2 ml , drotaverine tab ip 40 mg , dutasteride tablet 0.5 mg , each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg , ecg electrode ( detail in rc ) , elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) , enalapril maleate tab ip 2.5mg , enalapril maleate tab ip 5mg , enalapril maleate tablets ip 10 mg , endotracheal tube, cuff size 4.5 ( details in rc ) , endotracheal tube, cuff size 5 details in rc , endotracheal tube, cuff size 6 ( details in rc ) , endotracheal tube, cuff size 7 ( details in rc ) , endotracheal tube, cuff size 7.5 ( details in rc ) , endotracheal tube, cuff size 8 ( details in rc ) , endotracheal tube, cuff size 8.5 ( details in rc ) , endotracheal tube, cuff size 9 ( details in rc ) , endotracheal tube, cuff size 6.5 ( details in rc ) , endotracheal tube, cuffed size 4 ( details in rc ) , endotracheal tube, plain size 2.5 ( details in rc ) , endotracheal tube, plain size 3 ( details in rc ) , endotracheal tube, plain size 3.5 ( details in rc ) , endotracheal tube, plain size 4 ( details in rc ) , endotracheal tube, plain size 4.5 ( details in rc ) , endotracheal tube, plain size 5 ( details in rc ) , endotracheal tube, plain size 5.5 ( details in rc ) , endotracheal tube, plain size 6 ( details in rc ) , endotracheal tube, plain size 7 ( details in rc ) , endotracheal tube, plain size 7.5 ( details in rc ) , endotracheal tube, plain size 8 ( details in rc ) , endotracheal tube, plain size 8.5 ( details in rc ) , endotracheal tube, plain size 6.5 ( details in rc ) , enoxaparin sodium inj ip 60 mg , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) , escitalopram tab ip 10 mg , esmolol hydrochloride injection 10mg / ml 10ml size , ethamsylate inj 250 mg / 2ml ( im / iv ) , ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) , ethinyloestradiol tabs ip 50 mcg , etoposide inj ip 100 mg , etoricoxib tab ip 120mg , etoricoxib tablet 90 mg , eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size , face mask, disposable ( details in rc ) , factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) , faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) , fenofibrate capsules / tab ip 200 mg , fentanyl citrate injection 50mcg / ml , fentanyl citrate injection ip 2 ml , feracrylum 1% w / v sterile solution 100 ml , ferric carboxymaltose injection 50 mg / ml 10 ml size , ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg , ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg , filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg , finasteride tablets ip 5 mg , flavoxate tablets ip 200 mg ( coated tablet ) , fluconazole eye drops 0.3% , fluconazole tablets ip 150mg , flunarizine tab 5 mg , fluorouracil inj ip 250 mg / 5ml , fluoxetine cap ip 20 mg , flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v , foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 , foldable intra ocular lense with injector ( details in rc ) 18 to 24 , foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 , foleys catheter no. 14 ( detail in rc ) , folic acid tab ip 5 mg , formaldehyde solution ( 34.5 per. 38 per. ) , formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg , framycetin sulphate cream 1 o / o 100 gm pack , framycetin sulphate cream 1 o / o 30gm pack , frusemide tab ip 40 mg , furosemide injection ip 10mg / ml ( im and iv use ) , fusidic acid cream ip 2% , gabapentine tablet / capsule 100mg , gabapentine tablet / capsule 300mg , gadodiamide inj. 0.5mml / ml vial , gamma benzene hexachloride lotion 1% ( lindane lotion usp ) , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) , gemcitabine for injection 200 mg , gemcitabine for injection ip 1gm , gentamycin injection ip 80mg / 2ml ( im / iv use ) , gentian violet topical solution usp 1o / o , glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) , glibenclamide tab ip 5 mg , gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) , gliclazide tab ip 40 mg , glimepiride tab ip 1mg , glimepiride tab ip 2 mg , glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg , glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) , glipizide tab ip 5mg , gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) , glucagon for injection usp 1 mg / ml , gluteraldehyde solution 2% , glycerin ip 100 ml , glycerin ip 400 gm , glyceryl trinitrate tablets 2.6 mg controlled release tablets , glycopyrrolate inj ip 0.2 mg / ml , griseofulvin tab ip 125 mg , gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% , haloperidol inj ip 5 mg / ml , haloperidol tab ip 1.5 mg , haloperidol tab ip 5 mg , halothane bp , heparin sodium inj ip 5000 iu / ml ( im / iv use ) , hepatitis b immunologlobin injection ip 200 i.u , homatropine eye drops ip 2% , human albumin solution ip 20% , human anti d immunoglobulin 150 mcg , human anti d immunoglobulin injection 300mcg ( im use ) , human chorionic gonadotropin injection ip 5000 i.u. , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , human rabies immunoglobulin inj 150 iu / ml , hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. , hydrochlorthiazide tab ip 12.5 mg , hydrochlorthiazide tab ip 25mg , hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) , hydrogen peroxide solution ip 6 o / o ( 20 vol ) , hydroxychloroquine sulphate tablets 200mg , hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion , hydroxyprogesterone inj ip 250mg / ml , hydroxypropylmethyl cellulose solution 20 mg / ml , hydroxyzine tab ip 25 mg , hyoscine butyl bromide tablets ip 10mg , hyoscine butylbromide inj ip 20 mg / ml , ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg , ibuprofen oral suspension bp / usp 100 mg / 5 ml , ibuprofen tab ip 200 mg ( coated ) , ibuprofen tab ip 400 mg ( coated ) , ifosfamide injection ip / bp / usp 1gm , imatinib tab ip 400mg , imipenem + cilastatin injection 500mg / 500mg ip powder for solution , imipramine tab ip 25 mg ( coated tab ) , imipramine tab ip 75 mg ( coated ) , indomethacin cap ip 25 mg , infant feeding tube size 10fg ( details in rc ) , infant feeding tube size 5fg ( details in rc ) , infant feeding tube size 8fg ( details in rc ) , infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) , inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) , insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle , insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges , insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) , insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 , intravenous fat emulsion 20% w / v 250ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. , ipratropium bromide nebulizer solution 250 mcg / ml , ipratropium powder for inhalation ip 40 mcg , iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg , iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg , isoflurane usp , isophane insulin inj ip 40 iu / ml , isoprenaline injection ip 2mg / ml , isosorbide dinitrate tab ip 5 mg , isosorbide mononitrate tabs ip 20 mg , isoxsuprine inj ip 5 mg / ml , isoxsuprine tab ip 20 mg , itraconazole cap 100 mg , k wire, length 375 mm; 1.6mm ( details in rc ) , k wire, length 375 mm; 1.8mm ( details in rc ) , k wire, length 375 mm; 1mm ( details in rc ) , ketamine inj ip 50 mg / ml , ketoconazole cream 2% , ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) , labetalol hcl inj ip 20mg / 4ml , labetalol tab ip 100mg , lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) , lactic acid bacillus tab 60 million spores , lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml , lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) , l asparaginase inj 10000 iu , leflunomide tablets ip 10mg ( film coated ) , leflunomide tablets ip / usp 20mg ( film coated ) , letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) , leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) , levetiracetam injection 500mg / 5ml , levetiracetam oral solution / suspension 100mg / ml , levetiracetam tablet ip 500 mg , levoceitrizine tablet 5mg , levodopa and carbidopa tab 250 mg+ 25 mg , levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg , levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) , levofloxacin tablets ip 250 mg , levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) , lidocaine hcl topical solution usp 4% , lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine gel ip 2% , lignocaine inj ip 2 o / o , lignocaine ointment 5 o / o , linezolid inj 200mg / 100ml , linezolid tablets ip 600 mg , liposomol amphotericine injection b 50mg , liquid medical oxygen ( lmo ) , liquid paraffin ip 100 ml , liquid paraffin ip 400 ml , lisinopril tab ip 2.5 mg , lisinopril tab ip 5 mg , lisinopril tablets ip 10 mg , lithium carbonate tab ip 300 mg , lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) , loperamide tab ip 2 mg , lorazepam inj ip 2 mg / ml , lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) , losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) , losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) , losartan tab ip 25 mg , losartan tab ip 50 mg , lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) , magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) , mannitol inj ip 20% w / v , mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) , mecobalamin inj 500 mcg / ml , medroxyprogesterone acetate tablets ip 10 mg , mefenamic acid tablets bp 500 mg , mefloquine tablets ip 250 mg , melphalan tab ip 5 mg , mercaptopurine tab ip 50 mg , meropenem inj ip 500 mg , meropenem inj. ip 1gm , meropenem injection ip 250 mg , mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) , metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg , metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) , metformin hydrochloride ( sustained release tablets ip 1000 mg , metformin tab ip 500 mg ( film coated ) , methotrexate inj ip 50 mg / 2 ml , methotrexate tab ip 2.5 mg , methotrexate tablets ip 10 mg , methyl cobalmine tablet 1500mcg , methyl cobalmine tablet 500mcg , methyl prednisolone sodium succinate for injection usp 500 mg , methyldopa tab ip 250mg film coated , methylergometrine inj ip 0.2 mg / ml , methylergometrine tab ip 0.125 mg , metoclopramide hydrochloride syrup ip 5 mg / 5ml , metoclopramide inj ip 10mg / 2ml , metoclopramide tab ip 10 mg , metoprolol succinate extended release tablets ip 50 mg , metoprolol tablets ip 25 mg , metronidazole 1% and chlorhexidine gluconade 0.25% gel , metronidazole benzoate oral suspension ip 100 mg of base / 5ml , metronidazole inj ip 500 mg / 100ml , metronidazole tablets ip 200 mg ( film coated ) , metronidazole tablets ip 400 mg ( film coated ) , miconazole nitrate cream ip 2% , midazolam inj ip 1 mg / ml , mifepristone tab ip 200mg , misoprostol tab ip 200 mcg , mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg , montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) , morphine sulphate inj ip 10mg / ml , mucus extractor sterile ( details in rc ) , multi vitamin syrup , multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) , multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) , multistix test strip , multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg , multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg , mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) , mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) , n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size , naloxone inj ip 0.4mg / ml , naproxen tablet ip 250mg , naproxen tablet ip 500mg , nasal oxygen set, twin bore all sizes adult ( details in rc ) , nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) , nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) , natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) , nebulization mask adult ( detail in rc ) , nebulization mask paediatric ( detail in rc ) , nelaton catheter size 14 fg ( detail in rc ) , neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) , neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp , neostigmine inj ip 0.5 mg / ml , neostigmine injection ip 2.5mg / 5ml , neostigmine tab ip 15 mg , nifedipine cap ip 5mg , nifedipine tablets ip 10 mg ( sustained release ) , nitrofurantoin tab ip 100mg , nitroglycerin inj 5 mg / ml , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) , niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm , non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) , non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) , non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) , non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) , non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) , non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) , noradrenaline injection ip 2 mg / ml , norethisterone tab ip 5 mg , norfloxacin tab ip 400mg film coated , normal human intravenous immunoglobulin 5g / 100ml , octreotide injection 50 mcg / ml , ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg , ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) , ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size , ofloxacin oral suspension ip 50mg / 5ml , ofloxacin tab ip 200 mg , ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o , oitment mupirocin ip 2% , olanzapine tab ip 5 mg , olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size , omeprazole cap ip 20 mg , ondansetron inj ip 2mg / ml , ondansetron orally disintegrating tablets ip 4mg , ors powder ip , oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) , oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) , oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) , oxaliplatin injection usp 50 mg , oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) , oxygen mask ( adult ) , oxygen mask ( pediatric ) , oxytocin inj ip 5 iu / ml , paclitaxel inj ip 100 mg , paclitaxel inj ip 260 mg , pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets , paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape , paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) , paracetamol infusion ip 1% w / v 100ml size , paracetamol inj. 150 mg / ml , paracetamol syrup ip 125 mg / 5ml ( detail in rc ) , paracetamol tab ip 500 mg , pentazocine inj ip 30mg / ml ( im / iv use ) , pentoprazole inj 40 mg , perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) , perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) , peritonial dialysis solution ip , permethrin cream 5% , permethrin lotion 5% , phenazopyridine tablet 5 mg , pheniramine inj ip 22.75mg / ml , phenobarbitone inj ip 200mg / ml , phenobarbitone tab ip 30 mg , phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% , phenytoin injection bp 50mg / ml , phenytoin oral suspension ip 25mg / ml , phenytoin tab ip 100 mg ( film coated ) , pioglitazone tab ip 15 mg , piperacillin + tazobactum for injection ip 4gm+500mg , piperacillin injection 2 gm + tazobactom 250mg ip , plaster of paris bandage 10cm x 2.7mts , plaster of paris bandage 15cm x 2.7 mts / roll , polygeline 3.5% solution with electrolytes for i.v. infusion , polymixin sulphate b injection usp 5 lac i.u. , polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm , polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm , potassium chloride inj. 0.15 gm / ml , potassium chloride oral solution u.s.p 500mg / 5ml , povidone iodine ointment 5% 15 gm , povidone iodine ointment usp 250 gm , povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) , povidone iodine solution ip 10 % , povidone iodine solution ip 5 % 500 ml , povidone iodine solution ip 5% 100ml bottle , powder clotrimazole 1% w / w 30 gm , pralidoxime chloride injection ip 25 mg / ml / 500 mg , prazosin tablets ( extended release ) 2.5 mg , prednisolone tab ip 20 mg , prednisolone tab ip 5 mg , prednisolone tablet ip 10 mg , pregabalin cap ip 75 mg , pressure monitoring line / high pressure extension line ( details in rc ) , primaquine tab ip 2.5 mg , primaquine tab ip 7.5 mg , probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) , procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) , prochlorperazine mesylate injection 12.5mg / ml 5ml size , progesterone inj 200 mg / 2ml , promethazine inj ip 25mg / ml , promethazine syrup ip 5 mg / 5ml , promethazine tab ip 25 mg , propofol inj ip 10 mg / ml , propranolol tab ip 40 mg , pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) , pyridoxine tablet ip 10 mg , pyridoxine tablet ip 40mg , quetiapine tablet ip 25mg , quetiapine tablet ip 50mg , quinine dihydrochloride inj ip 300 mg / ml , quinine sulphate tablets ip 300 mg ( film coated ) , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) , rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu , rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose , ramipril tablets ip 2.5 mg , ranitidine hcl injection ip 50mg / 2ml , ranitidine tab ip 150mg film coated , ranitidine tab ip 300mg film coated , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , rh erythropoetin inj 4000 iu , rh erythropoetin inj ip 10000 iu , rh erythropoetin inj ip 2000iu , ringer acetate infusion 500 ml , risperidone tab 1 mg , risperidone tab 2mg , rosuvastatin tablet 10 mg , rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) , rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) , rubber examination gloves, non sterile, extra small ( details in rc ) , rubber examination gloves, size medium ( details in rc ) , rubber examination gloves, size small ( details in rc ) , ryles tube / nasogastric tube size: 10 ( details in rc ) , ryles tube / nasogastric tube size: 12 ( details in rc ) , ryles tube / nasogastric tube size: 16 ( details in rc ) , ryles tube / nasogastric tube size: 18 ( details in rc ) , ryles tube / nasogastric tube size:14 ( details in rc ) , sacubitril 24 mg and valsartan 26 mg tablet , salbutamol inhalation 100 mcg / dose , salbutamol nebuliser solution bp 5 mg / ml , salbutamol syrup ip 2mg / 5ml , salbutamol tab ip 2 mg , salbutamol tablet ip 4 mg , saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) , sanitary napkin beltless with wings ( details in rc ) , sanitary napkin beltless ( details in rc ) , sanitary pads belt type ( details in rc ) , savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) , scalp vein set ( disposable ) size 18g ( details in rc ) , scalp vein set ( disposable ) size 20g ( details in rc ) , scalp vein set ( disposable ) size 22g ( details in rc ) , scalp vein set ( disposable ) size 24 g ( details in rc ) , sertraline tab ip 50 mg , sevoflurane , silver sulphadiazine cream ip 1% 500 gm jar , silver sulphadiazine cream ip 1% 50gm tube , skin graft knife blade ( sterile ) ( details in rc ) , snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) , sodium bicarbonate inj ip 7.5% w / v , sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) , sodium chloride 0.45% w / v polypack 500 ml , sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o , sodium chloride inj ip 500 ml , sodium chloride injection ip 100 ml , sodium nitroprusside injection 25mg / ml 2ml size , sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o , sodium valproate gastro resistant tablets ip 200 mg , sodium valproate inj 100 mg / ml , sodium valproate oral solution ip 200 mg / 5 ml , sodium valproate tablet ( gastro resistant ) ip 500mg , sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) , spironolactone tab ip 25mg , spironolactone tablets ip 50 mg , standard pama intra ocular lenses ( details in rc ) 11 to 17.5 , standard pama intra ocular lenses ( details in rc ) 18 to 24 , standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 , sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) , sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) , sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) , sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) , sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) , sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) , sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) , streptokinase injection 15 lac units ip , succinylcholine inj. ip 50 mg / ml ( iv use ) , suction catheter, sterile. size: f g 10 ( details in rc ) , suction catheter, sterile. size: f g 12 ( details in rc ) , suction catheter, sterile. size: f g 14 ( details in rc ) , suction catheter, sterile. size: f g 16 ( details in rc ) , suction catheter, sterile. size: f g 18 ( details in rc ) , suction catheter, sterile. size: f g 20 ( details in rc ) , suction catheter, sterile. size: f g 22 ( details in rc ) , suction catheter, sterile. size: f g 6 ( details in rc ) , suction catheter, sterile. size: f g 8 ( details in rc ) , suction catheter, sterile.size: fg 5 ( details in rc ) , sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , surgical blade sterile, size 11 ( details in rc ) , surgical blade sterile, size 15 ( details in rc ) , surgical blade sterile, size 22 ( details in rc ) , surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) , surgical cap disposable ( for surgeons ) ( details in rc ) , surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) , surgical spirit ip ( 100 ml ) , surgical spirit ip ( 500 ml ) , suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) , suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) , suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) , suture needles curved and cutting size 1 5 ( details in rc ) , syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) , syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) , tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) , tamoxifen tab ip 10 mg , tamsulosin hcl tablets / capsule 0.4 mg , telmisartan tablets ip 40 mg , temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) , temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm , tenaligliptin tablet ip 20mg , terbinafine cream 1%w / w ( 10 gm tube ) , terbinafine hydrochloride tablet 250 mg , terbutaline tablets ip 2.5 mg , tetanus immunoglobulin ip 250 iu / vial , tetanus vaccine ( adsorbed ) ip 5 ml vial , thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) , theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) , theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) , theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) , thiamine tablets ip 100 mg , thiopentone inj ip 0.5 g , thyroxine sodium tablets ip 100mcg , thyroxine tablets ip 50 mcg , timolol eye drops ip 0.5 o / o w / v , tinidazole tab ip 300 mg ( film coated ) , tinidazole tab ip 500 mg ( film coated ) , tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) , tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o , tobramycin eye drops 0.3% [ 331 ] , tobramycin ophthalmic ointment usp 0.3% , tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) , topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) , torsemide inj 10 mg / ml , torsemide tab 10 ip mg , tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) , tracheostomy tube, plain all sizes ( details in rc ) , tramadol cap ip 50 mg , tramadol inj 50 mg / ml , tranexamic acid injection ip 100mg / ml 5ml size , tranexamic acid tablets ip 500 mg , travoprost eye drops ip 0.004 o / o , tretenoin cream usp 0.025% , trifluperazine tab ip 5 mg coated , trihexyphenidyl hcl tab ip 2 mg , tropicamide eye drop ip 1o / o , t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) , umbilical catheter for new born, all sizes ( details in rc ) , umbilical cord clamp ( details in rc ) , urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) , urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) , urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) , urine collecting bag, disposable 2000 ml ( details in rc ) , urokinase injection 5 lac unit ( lyophilized ) , ursodeoxycholic acid tablets ip 300 mg , vaccum suction set, 2.5 meter length ( detail in rc ) , valethamate bromide inj 8mg / ml , valganciclovir tablet 450 mg , vancomycin for intravenous infusion ip 1 gm , vancomycin for intravenous infusion ip 500 mg , vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) , vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) , vdrl antigen ( with + ve and ve control ) / rpr slide kit , vecuronium bromide for injection 4mg ( freeze dried ) , verapamil tab ip 40 mg film coated , vinblastine inj ip 10mg / 10ml , vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) , vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu , vitamin b complex inj nfi , vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) , vitamin d3 oral solution 60000 iu , vitamin e capsule 400 mg , vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) , vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) , voriconazole injection 200mg / vial , warfarin sodium. tab ip 5mg , water for inj ip , xylometazoline nasal drops ip 0.1% , zinc sulphate dispersible tablets ip elemental zinc 10 mg , zoledronic acid injection ip 4mg vial , zolpidem tablet 5 mg , amino acid drop , amino acid inj. ( astamin ) , aminorich drop / astymen c / amenovik , amoxycillin and potassium clavulanate drop , ampilox 250 ml inj. , aquasop inj. , arichitol inj. , arodesin solution , augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. , augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. , auto clave tape ( stera tape ) , b.p. instument with mercuary , b.p. instument with mercuary standing , b.p. instument without mercuary , bains circuit adult , bains circuit pediatric , betnisol inj. , biotax 125 mg ( ceftoxyn ) inj. , cabergolin 0.25 mg tab. , candid lotion , citric acid , dettol 100 ml , disposable baby kit , disposable needle no 16 11 / 2inch , disposable razor , dressing drum all sizes , drop sodabicarb , erofer l drops 15 ml , evion drop , ezithromycin 15ml sy , formalin 1 ltr , formalin 5 ltr , glucometer strip , gluco one strip ( dr. morepen ) , hand sanitizer , inj. citicholin , inj. hepamerz , inj. nootrophil , inj. strocit , intralipid inj. , k 90 catheter , lactodex lbw with micronutrients , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium , latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small , lilan thread 40 , lilan thread 60 , mackintosh , mucus sucker set , multivitamin with zinc syp. , multizec trop 15 ml , neasphine oint. , needle no. 211 / 2 , needle order , neosprin eye oint. , netromycine 10 mg. inj. ( netromax 10 mg inj. ) , nuclovate cream 15 gm , oxygen double stage ragulator , pedia set 100 ml , pepericilline + tezobactum 1.125 mg inj. , pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml , prochlorpertine tab. , re breathing bag adult , re breathing bag pediatric , rubber face mask 0 5 , sevlon lotion 100 ml. , simyl mct powder , star plast ( adhesive plaster ) , caffeine citrate 20 mg / ml injection 2 ml vial , vit. a syp. , vit. c drop , vit. c syp. , vit. c tab. , zinc 200 ml syp , zinc 60 ml / 100 ml sy. , zincovit syp. , zincula drop , mouth airway ( all size ) , inj. n.s.500 m.l. ( in glass bottle ) , inj. n.s.100 m.l. ( in glass bottle ) , cidex 5 ltr , blanisol plus , alcohal based hand rub , surgical hand & skin disinfactent , antiseptic surgical hand rub , povidine iodine 5% & 10% , high level instrument disinfactent , multi eyzymetic instrument cleaner , surgical instrument rust, spot & stain remover , rejuventate dialysis reprocessing , disinfectent & decalcification of haemodialysis machine , d 125 disinfectent 1 ltr. , 5 fu 500 mg , capcetabin 500 mg , carboplatin 150 mg , carboplatin 450 mg , cisplatin 10 mg , codon iv set , cyclophosphamide 500mg , danazole 50 mg cap. , docetaxel 120 mg , docetaxel 80 mg , doxorubicine 10 mg , doxorubicine 50 mg , epirubicine 50 mg , filgrastin 300 mg , inj. gemcitabin 1 gm , inj. gemcitabin 2 mg , ieucovorin 50 mg , tab. imatinib 400 mg , inj. mesna 100 mg , inj. botrezumib , inj. bleomycin , oxaliplatin 50 mg , pacletaxel 260 mg , tamoxifen 10 mg , zolidronic acid 4 mg , inj. vetneuren 2 ml , inj. vanomycin , inj. surfactant , human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) , three way adopter , inj. milriuon , inj. decarbazine ( dtic ) ...

Medical And Health Services - Rajasthan

33776214 supply of medicine and surgical items in bangur hospital pali for the year 2022 23 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) each piece 2 s122 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) each piece 3 s120 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) each piece 4 s123 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) each piece 5 s121 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) each piece 6 750 3rd generation recombinant f viii 1000 iu with diluent vial with diluent 7 749 3rd generation recombinant f viii 250 iu with diluent vial with diluent 8 742 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) each piece 9 s47.a abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) each piece 10 s124 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) each piece 11 s125 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) each piece 12 s47.b abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) each piece 13 s47.c abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) each piece 14 731 abiraterone acetate tablet ip 250 mg ( each uncoated tablet contains abiraterone acetate ip 250 mg ) bottle of 30 tablets 15 s1 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) piece 16 s95 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) each pcs. 17 r2 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 1x12 foils 18 r4 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 1x12 foils mndy tender list 2022 19 r3 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 20 r5 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 1x12 foils 21 r7 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 1x12 foils 22 r6 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 1x12 foils 23 r1 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 1x12 foils 24 r8 absorbable surgical suture ( sterile catgut ) , needled suture chromic size 3 / 0 ( 3 / 8 cir rcutting needle 26mm, length 76 cm ) 1x12 foils 25 r72 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 1x12 foils 26 r70 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 1x12 foils 27 r71 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 1x12 foils 28 r73 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 1x12 foils 29 r10 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 30mm length 90 cm 1x12 foils 30 r16 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size2 / 0 1 / 2 cir rb needle 40mm l 90cm 1x12 foils 31 r65 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 ( 1 / 2 circle reverse cutting 50 mm length 90cm ) 1x12 foils 32 r67 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 1x12 foils 33 r66 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 2 / 0 ( 1 / 2 circle rb 31mm needle, length 70cm ) 1x36 foils 34 r11 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 1x12 foils 35 r9 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 1x12 foils 36 r13 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 1x12 foils 37 r17 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 1x12 foils 38 r15 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 1x12 foils 39 r18 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm 1x12 foils 40 r74 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 1x12 foils 41 r12 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide col lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 1x12 foils 42 r68 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 43 r69 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 1x12 foils 44 r14 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 1x12 foils 45 r19 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 1x12 foils 46 r62 absorbable surgical sutures sterilised needled monofilament polyglecaprone / polyglyconate, size 3 / 0 ( 1 / 2 circle ovalrb contrast needle 26mm, suture length 70cm ) 1x12 foils 47 r64 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 1x12 foils 48 r63 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 4 / 0 ( 1 / 2 circle cutting 16mm needle, suture length 70cm ) 1x12 foils 49 r61 absorbable surgical sutures, sterilised needled polyglecaprone / polyglyconate, monofilament sutures size 2 / 0 ( 1 / 2 circle oval rb needle 26mm needle, suture length of 70cm ) 1x12 foils 50 s2 absorbent cotton wool ip 500 gm each pcs. 51 780 acebrophylline tablet / capsule 100 mg 10x10 tablets 52 492 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg each pcs. 53 163 acenocoumarol tab ip / nicoumalone tab ip 2 mg 10x10 tab strip 54 253 acetazolamide tab ip 250mg 10x10 tab blister 55 500 acetylcystine solution usp ( injection ) 200 mg / ml each pcs. 56 647 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) one combi blister pack 57 648 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 58 645 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) one combi blister pack 59 646 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) one combi blister pack 60 213 acyclovir cream 5% each pcs. 61 769 acyclovir eye ointment ip 3% w / w 5gm size 5 gm tube 62 502 acyclovir intravenous infusion ip 250mg each pcs. 63 503 acyclovir intravenous infusion ip 500mg vial 64 62 acyclovir oral suspension ip 400mg / 5ml 60 ml bottle ( with measuring cap ) 65 63 acyclovir tab ip 200 mg 10x10 tab blister 66 64 acyclovir tab ip 800 mg 10x10 tab strip 67 547 adenosine injection ip 6 mg / 2ml each pcs. 68 34 adrenaline injection ip 1mg / ml im / iv use 1ml amp ( ambercolor ) 25 amp 69 65 albendazole oral suspension ip 400 mg / 10ml 10 ml bottle 70 66a albendazole tablets ip 400 mg ( detail in rc ) each pcs. 71 631 alendronate sodium tablets usp / bp 35 mg 4 tablets ( 20 *4tablet ) 72 788 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) 1 73 598 allopurinol tablets ip 100 mg 10x10 tablets 74 525 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit each pcs. 75 339 alprazolam tab ip 0.25 mg each pcs. 76 340 alprazolam tab ip 0.5mg 10x10 tab blister 77 67 amikacin inj ip 100 mg 2 ml vial 78 504 amikacin inj ip 250 mg vial 79 68 amikacin inj ip 500 mg 2 ml vial 80 794 amino acid 10% injection 100ml size 100 ml bottle 81 365 aminophylline inj ip 25 mg / ml 10 ml amp 25 ampoules 82 183 amiodarone hydrochloride inj 50 mg / ml 3 ml amp ( 10 amp ) 83 181 amiodarone tab ip 100 mg 10x10 tablets 84 182 amiodarone tab ip 200 mg 10x10 tab strip 85 341 amitriptyline tab ip 25mg film coated 10x10 tab strip 86 461 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 10x10 tab blister 87 457 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 10x10 tab strip 88 460 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 10x10 tab strip / blister 89 184 amlodipine tab ip 2.5 mg each pcs. 90 185 amlodipine tablets ip 5 mg 10x10 tab blister 91 506 amoxicillin and potassium clavulanate inj ip 1.2gm vial 92 505 amoxicillin and potassium clavulanic ip inj 600mg each pcs. 93 69 amoxycillin and cloxacillin cap 250 + 250 mg 10x10 cap strip 94 70 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg each pcs. 95 507 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) each pcs. 96 71 amoxycillin cap ip 250mg 10x10 cap strip / blister 97 72 amoxycillin cap ip 500mg 10x10 cap strip / blister 98 73 amoxycillin dispersible tablets ip 125 mg 10x10 tab strip 99 473 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml each pcs. 100 706 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 10x10 tablets 101 74 amphotericin b inj ip 50 mg vial 102 412 ampicillin cap ip 500mg 10x10 cap blister 103 75 ampicillin injection ip 500 mg vial 104 261a antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 60 ml bottle ( with measuring cap ) 105 260a antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 10x10 tab blister 106 225 anti a blood grouping serum ip ( anti a monoclonal serum ) each pcs. 107 226 anti b blood grouping serum ip ( anti b mono clonal serum ) each pcs. 108 227 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip each pcs. 109 407 anti inhibitor coagulation complex ( human plasma protein with a factor viii inhibitor bypassing activity of 500 i.u. per vial ) each pcs. 110 497 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg each pcs. 111 686 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 1x6 tablet blister 112 651 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 1x6 tablet blister 113 508a artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) each combo pack in a unit carton 114 387 ascorbic acid tab ip 500 mg 10x10 tab strip 115 s3 asepto syringe with transparent bulb sterile, 60 ml each pcs. 116 444 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 117 679 aspirin tablet ip ( gastro resistant ) 150 mg 14x10 tablet 118 462 atenolol tab ip 25 mg each pcs. 119 186 atenolol tab ip 50 mg each pcs. 120 187 atorvastatin tab ip 10mg each pcs. 121 548 atorvastatin tablets ip 40 mg each pcs. 122 311 atracurium inj 10 mg / ml 2.5 ml amp ( 10 ampoules ) 123 319 atropine eye ointment ip 1% each pcs. 124 654 atropine sulphate injection 0.6mg / ml each pcs. 125 320 atropine sulphate ophthalmic solution usp 1% 5 ml. vial with sterilized dropper, or squeeze vial 126 133 azathioprine tab ip 50 mg 10x10 tab strip 127 78a azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 128 80a azithromycin tab ip 500 mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 129 79a azithromycin tablets ip 250mg 10x3x3 tab strip / blister ( strip / blister of 3 tab ) 130 683 aztreonam injection 1gm vial 131 509 aztreonam injection usp 500 mg vial 132 r79 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 1x12 foils 133 r78 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 1x12 foils 134 698 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 10x10 tablets 135 366 beclomethasone inhalation ip 200 mcg / dose each pcs. 136 445 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) each pcs. 137 726 bendamustine injection 100 mg vial 138 81 benzathine benzylpenicillin inj ip 12 lac units vial 139 82 benzathine benzylpenicillin inj ip 6 lac units vial 140 542 betahistine tab ip 16 mg 10x10 tablets 141 541 betahistine tab ip 8 mg 10x10 tablets 142 558 betamethasone dipropionate cream ip 0.05% 15gm tube in a unit carton 143 559 betamethasone lotion ip 0.05 o / o each pcs. 144 418 betamethasone sod phos inj ip 4mg / ml each pcs. 145 35 betamethasone tab ip 0.5mg each pcs. 146 612 betaxolol eye drops 0.5 o / o each pcs. 147 735 bevacizumab injection 100 mg vial 148 734 bevacizumab injection 400 mg vial 149 741 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 10x10 tablets 150 279 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) each pcs. 151 262 bisacodyl tab ip 5 mg 10x10 tab strip 152 398 black disinfectant fluid ( phenyl ) as per schedule o grade iii 5 ltrs can 153 134 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) each pcs. 154 s4 blood administration set blood transfusion set ( details in rc ) unit 155 s98 bone cement each pcs. 156 s80 bone wax sterilised 2.5 gram / packet 157 730 bortezomib injection 2mg vial 158 487 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% each pcs. 159 540 bromocriptine tablets ip 2.5 mg 10x10 tab strip 160 367 budesonide nebulizer suspension 0.25mg / ml each pcs. 161 617 budesonide powder for inhalation 200 mcg 30 capsules 162 2 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 4ml amp ( 10 ampoules ) 163 4 bupivacaine inj ip 0.5% each pcs. 164 694 butorphanol tartrate injection usp 1mg / ml 1ml size each pcs. 165 773 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 10x10 tablets 166 793 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 3ml vial 167 671 calamine lotion ip 100ml 100 ml bottle 168 630 calcitriol capsules ip 0.25 mcg 10x10 cap strip / blister 169 441 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 100 ml bottle ( with measuring cap ) 170 388 calcium gluconate inj ip 10% ( iv use ) 10 ml amp 25 ampoules 171 622 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) each pcs. 172 727 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 10x10 tablets 173 474 carbamazepine oral suspension usp 100 mg / 5ml 100 ml bottle ( with measuring cap ) 174 54 carbamazepine tab ip 100 mg 10x10 tab strip / blister 175 53 carbamazepine tab ip 200 mg ( film coated ) each pcs. 176 280 carbimazole tabs ip 5 mg ( film coated ) each pcs. 177 526 carboplatin injection ip 150 mg 15 ml vial 178 527 carboplatin injection ip 450 mg 45 ml vial 179 281 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 1 ml amp / vials ( 25 ampoule / vial ) 180 613 carboxymethylcellulose eye drops ip 0.5% each pcs. 181 755 carvedilol tablet 3.125 mg 10x10 tablets 182 s9.b catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 183 s9.c catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 184 s9.d catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 185 s9.e catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 186 s9.f catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 187 s9.g catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 188 s9.a catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) each piece 189 709 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 10x10 tablets 190 710 cefadroxil tablet 500 mg 10x10 tablets 191 510 cefepime injection ip 500 mg vial 192 511 cefixime oral suspension ip 25mg / ml ( paediatric drops ) each pcs. 193 84 cefixime tab ip 100 mg 10x10 tab strip 194 85 cefixime tab ip 200 mg each pcs. 195 86 cefoperazone and sulbactum for inj ( cefoperazone sodium cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) vial 196 88 cefotaxime inj ip 250 mg each pcs. 197 87 cefotaxime injection ip 1 g each pcs. 198 475 cefpodoxime dispersible tab 50 mg each pcs. 199 89 ceftazidime inj ip 1g vial 200 90 ceftazidime inj ip 250 mg each pcs. 201 91 ceftazidime inj ip 500 mg each pcs. 202 708 ceftriaxone 1 gm + tazobactum 125 mg injection each pcs. 203 93 ceftriaxone inj ip 1g / vial vial ( packed in monocarton ) 204 94 ceftriaxone inj ip 250 mg / vial each pcs. 205 95 ceftriaxone inj ip 500mg / vial vial ( packed in monocarton ) 206 512 cefuroxime axetil tab ip 250 mg 10x10 tab strip 207 96 cephalexin cap ip 250 mg 10x10 cap blister 208 97 cephalexin cap ip 500 mg 10x10 cap blister 209 427 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 30 ml bottle with measuring cap 210 476 cephalexin tablets 125 mg ( dispersible tablets ) each pcs. 211 589 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 212 499 cetirizine syrup ip 5mg / 5 ml each pcs. 213 498 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 10x10 tablets 214 215a cetrimide cream ip 15 gm 15gm tube in a unit carton 215 s137 chemotherapy port & non coring needles ( pediatric ) ( detail in rc ) each piece 216 s136 chemotherapy port and non coring needles ( adult ) ( detail in rc ) each piece 217 136 chlorambucil tab ip 5 mg each pcs. 218 771 chloramphenicol 1% w / w eye ointment ip, 3gm size 3 gm tube 219 321 chloramphenicol eye drops ip 0.5 0 / 0 each pcs. 220 342 chlordiazepoxide tablets ip 10mg 10x10 tab strip 221 447 chlorhexidine gluconate solution 5% 250 ml 250 ml bottle 222 580 chlorhexidine mouthwash ip 0.2 o / o each pcs. 223 98 chloroquine phosphate inj ip 40 mg / ml 5 ml amp ( 25 amp ) 224 100a chloroquine phosphate suspension ip 50 mg / 5ml 60 ml bottle ( with measuring cap ) 225 99 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 10x10 tab strip / blister 226 37 chlorpheniramine maleate tab ip 4mg each pcs. 227 346 chlorpromazine inj. ip 25mg / ml each pcs. 228 343 chlorpromazine tablets ip 100 mg ( coated tablet ) 10x10 tab strip 229 344 chlorpromazine tablets ip 25 mg ( sugar coated ) 10x10 tab strip 230 345 chlorpromazine tablets ip 50 mg ( coated tablets ) 10x10 tab strip 231 610 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) each pcs. 232 623 cholecalciferol granules 60, 000 iu / gm each pcs. 233 r77 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) each pcs. 234 r80 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 1x12 foils 235 r76 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 1x12 foils 236 544 cinnarizine tablet ip 75 mg 10x10 tab blister 237 543 cinnarizine tablets ip 25 mg 10x10 tab blister 238 585 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp 5 ml. vial with sterilized dropper, or squeeze vial 239 322 ciprofloxacin eye drops ip 0.3 o / o w / v 5 ml squeeze vial 240 101 ciprofloxacin injection ip 200mg / 100ml 100 ml ffs / bfs bottle 241 323 ciprofloxacin ophthalmic ointment usp 0.3% 5 gm tube in unit carton 242 103 ciprofloxacin tablet ip 500 mg film coated each pcs. 243 102 ciprofloxacin tablets ip 250 mg film coated each pcs. 244 768 cis atracurium besylate injection 2 mg / ml in 5 ml vial 5 ml vial 245 528 cisplatin inj ip 10 mg / 10 ml each pcs. 246 137 cisplatin inj ip 50 mg / 50 ml each pcs. 247 513 clindamycin capsule ip 150mg each pcs. 248 514 clindamycin capsule ip 300 mg each pcs. 249 560 clindamycin phosphate gel usp 1 o / o 20gm tube in mono carton 250 714 clindamycin phosphate injection ip 300 mg vial / ampoules 251 663 clobazam tablet / capsule 10 mg 10x10 tablet / capsule blister 252 662 clobazam tablet / capsule 5 mg 10x10 tablet / capsule blister 253 561 clobetasol propionate cream ip 0.05 o / o each pcs. 254 282 clomifene tab ip 25 mg 10x10 tab strip 255 283 clomiphene tab ip 50 mg each pcs. 256 678 clonazepam tablet 0.5 mg each pcs. 257 751 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) each pcs. 258 549 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg each pcs. 259 188 clopidogrel tab ip 75 mg 10x10 tab strip 260 s96.a close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) each piece 261 s96.b close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) each piece 262 586 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 5 ml ear drops 263 104 clotrimazole cream ip 2% w / w 15gm tube in a unit carton 264 443 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) each pcs. 265 105 clotrimazole vaginal tab ip 500mg single tablet ( 10 tabs with an applicator ) 266 417 cloxacillin sodium inj ip 500mg vial 267 670 coal tar 6% & salicylic acid 3% ointment 20gm 268 718 colistimethate injection ip 1m iu powder for solution vial 269 106 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 15gm tube in mono carton 270 244 compound benzoin tincture ip 500 ml bottle 271 377 compound sodium lactate inj. ip 500 ml ffs / bfs bottle 272 399 conc haemodialysis fluid b.p acetate concentrate 10 litre can each pcs. 273 687 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans each pcs. 274 284 conjugated estrogen tabs usp 0.625 mg. each pcs. 275 s48 corrugated drainage sheet all sizes ( details in rc ) each pcs. 276 107 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 50 ml bottle ( with measuring cap ) 277 669 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) each pcs. 278 108 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 10x10 tab blister 279 368 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 50 ml bottle ( with measuring cap ) 280 692 cough syrup / expectorant ( 50 ) ml 50 ml bottle ( with measuring cap ) 281 138 cyclophosphamide inj ip 200 mg 10 ml glass vial 282 139 cyclophosphamide inj ip 500 mg 25ml glass vial 283 736 cyclophosphamide tablet ip 50 mg ( each sugar coated tablet contains cyclophosphamide ip 53.5 mg equivalent to anhydrous cyclophosphamide 50 mg ) each pcs. 284 677 cyclosporin capsule usp / ip 50 mg 50 caps pack 285 141 cytarabine injection bp 500mg each pcs. 286 529 dacarbazine injection 500 mg usp / bp each pcs. 287 142 danazol cap ip 50 mg 10x10 cap blister 288 797 dasatinib tab 100 mg each pcs. 289 143 daunorubicin inj ip 20 mg 10 ml glass vial 290 165 deferasirox tab 100 mg each pcs. 291 166 deferasirox tab 500 mg 30 tablets 292 167 deferiprone cap 250 mg 50 caps 293 168 deferiprone cap 500 mg 50 caps 294 581 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 295 169 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) vial 296 39 dexamethasone inj ip 8mg / 2ml 2 ml vial ( usp type i vial ) 297 40 dexamethasone tab ip 0.5 mg 10x10 tab strip 298 700 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 10x10 tablets 299 440 dextromethorphan hbr syrup ip 13.5mg / 5ml 30 ml. bottle 300 379 dextrose inj ip 10% 500 ml ffs / bfs bottle 301 378 dextrose inj ip 25% w / v 100 ml ffs / bfs bottle 302 380 dextrose inj ip 5% 500 ml ffs / bfs bottle 303 232 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 20 ml vial / ampoule 304 233 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 20 ml ampoule 305 349 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 2 ml amp 25 ampoules 306 350 diazepam tab ip 5 mg 10x10 tab strip / blister 307 20 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) each pcs. 308 493 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 20 gm tube in unit carton 309 483 diclofenac sod + paracetamol tablets ip diclofenac sod 50 mg + paracetamol 325 mg each pcs. 310 695 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 1 ml. ampoule 311 19 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 3 ml amp ( 10 amp ) 312 437 diclofence prolonged release tablet ip 100 mg 10x10 tab strip 313 439a dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 10x10 tab blister 314 438 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 315 265 dicyclomine hydrochloride oral solution ip 10mg / 5ml 30 ml bottle with measuring cap 316 264 dicyclomine inj ip 10 mg / ml 2 ml amp 25 ampoules 317 263 dicyclomine tab ip 10 mg each pcs. 318 110 diethylcarbamazine tab ip 100 mg 10x10 tab blister 319 189 digoxin inj ip 0.25 mg / ml each pcs. 320 190 digoxin tab ip 0.25 mg. 10x10 tab strip 321 191 diltiazem tabs ip 30 mg film coated each pcs. 322 285 dinoprostone cream / gel 0.5 mg dinoprostone in syringe syringe 323 480 diphtheria antitoxin 10000 iu vial 324 s89.b disposable sterile surgical rubber gloves size 8 inches, powder free pair 325 s89.a disposable sterile surgical rubber gloves size 8 inches, powdered pair 326 702 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 10x10 tablets 327 192 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) each pcs. 328 590 domperidone oral drops 10mg / ml ( 10ml ) 10 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 329 266 domperidone suspension ip 5mg / 5ml each pcs. 330 267 domperidone tab ip 10 mg each pcs. 331 193 dopamine hydrochloride inj ip 40 mg / ml 5 ml amp ( amber colour ) 25 ampo 332 s41.a double j stent, sterile, both ends open size 4f, length 16 cm each pcs. 333 s41.b double j stent, sterile, both ends open, size 5f, length 20 cm each pcs. 334 s42.a double j stent, sterile, one end closed size 4f, length 16 cm each pcs. 335 s42.b double j stent, sterile, one end closed, size 5f, length 20 cm each pcs. 336 144 doxorubicin inj ip 50 mg / 25 ml each pcs. 337 111 doxycycline cap ip 100 mg 10x10 cap strip / blister 338 763 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 10x10 tablets 339 689 dried factor viii fraction ip ( iv use ) 1000 iu / vial vial with diluent 340 688 dried factor viii fraction ip ( iv use ) 500 iu / vial each pcs. 341 171 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) each pcs. 342 591 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 10x10 tablets 343 5 drotaverine hydrochloride inj 40 mg / 2 ml 2 ml amp 10 ampoules 344 415 drotaverine tab ip 40 mg each pcs. 345 787 dutasteride tablet 0.5 mg 10x10 tablets 346 649 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg one combi blister pack 347 s104 ecg electrode ( detail in rc ) each piece 348 s127 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) each piece 349 195 enalapril maleate tab ip 2.5mg 10x10 tab strip 350 194 enalapril maleate tab ip 5mg 10x10 tab strip 351 463 enalapril maleate tablets ip 10 mg 10x10 tab strip 352 s44.b endotracheal tube, cuff size 4.5 ( details in rc ) each piece 353 s44.c endotracheal tube, cuff size 5 details in rc each piece 354 s44.d endotracheal tube, cuff size 6 ( details in rc ) each piece 355 s44.f endotracheal tube, cuff size 7 ( details in rc ) each piece 356 s44.g endotracheal tube, cuff size 7.5 ( details in rc ) each piece 357 s44.h endotracheal tube, cuff size 8 ( details in rc ) each piece 358 s44.i endotracheal tube, cuff size 8.5 ( details in rc ) each piece 359 s44.j endotracheal tube, cuff size 9 ( details in rc ) each piece 360 s44.e endotracheal tube, cuff size 6.5 ( details in rc ) each piece 361 s44.a endotracheal tube, cuffed size 4 ( details in rc ) each piece 362 s43.a endotracheal tube, plain size 2.5 ( details in rc ) each piece 363 s43.b endotracheal tube, plain size 3 ( details in rc ) each piece 364 s43.c endotracheal tube, plain size 3.5 ( details in rc ) each piece 365 s43.d endotracheal tube, plain size 4 ( details in rc ) each piece 366 s43.e endotracheal tube, plain size 4.5 ( details in rc ) each piece 367 s43.f endotracheal tube, plain size 5 ( details in rc ) each piece 368 s43.g endotracheal tube, plain size 5.5 ( details in rc ) each piece 369 s43.h endotracheal tube, plain size 6 ( details in rc ) each piece 370 s43.j endotracheal tube, plain size 7 ( details in rc ) each piece 371 s43.k endotracheal tube, plain size 7.5 ( details in rc ) each piece 372 s43.l endotracheal tube, plain size 8 ( details in rc ) each pcs. 373 s43.m endotracheal tube, plain size 8.5 ( details in rc ) each piece 374 s43.i endotracheal tube, plain size 6.5 ( details in rc ) each piece 375 172 enoxaparin sodium inj ip 60 mg each pcs. 376 723 entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) 10x10 tablets 377 s110 epidural minipack 18g, 80mm 90mm, metal stylet for single use only, sterile ( detail in rc ) each piece 378 351 escitalopram tab ip 10 mg 10x10 tab strip / blister 379 753 esmolol hydrochloride injection 10mg / ml 10ml size 10 ml vial 380 173 ethamsylate inj 250 mg / 2ml ( im / iv ) each pcs. 381 745 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 10x10 tablets 382 286 ethinyloestradiol tabs ip 50 mcg 10x10 tab strip 383 146 etoposide inj ip 100 mg 5 ml glass vial 384 495 etoricoxib tab ip 120mg 10x10 tab blister 385 658 etoricoxib tablet 90 mg 10x10 tablets 386 770 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 5 ml. vial with sterilized dropper, or squeeze vial 387 s85 face mask, disposable ( details in rc ) piece 388 406 factor ix concentrate ( purified ) ip 600 i.u. ( human coagulation factor ix ) each pcs. 389 713 faropenem tablet sodium 200 mg ( each film tablet contains faropenem sodium equivalent to faropenem sodium 200 mg ) 10x10 tablets 390 550 fenofibrate capsules / tab ip 200 mg each pcs. 391 655 fentanyl citrate injection 50mcg / ml 10ml vial / amp 392 21 fentanyl citrate injection ip 2 ml 2 ml amp 10 ampoules 393 746 feracrylum 1% w / v sterile solution 100 ml 100ml 394 789 ferric carboxymaltose injection 50 mg / ml 10 ml size 10 ml vial 395 391 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 10x10 tab strip / blister 396 390 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg each pcs. 397 530 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg each pcs. 398 575 finasteride tablets ip 5 mg 10x10 tab strip / blister 399 579 flavoxate tablets ip 200 mg ( coated tablet ) each pcs. 400 425 fluconazole eye drops 0.3% 5 ml. vial with sterilized dropper, or squeeze vial 401 114a fluconazole tablets ip 150mg strip of 1 tablet ( 10x10x1 tab ) 402 147 flunarizine tab 5 mg each pcs. 403 148 fluorouracil inj ip 250 mg / 5ml 5 ml ampoule 404 352 fluoxetine cap ip 20 mg 10x10 cap strip / blister 405 421 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 5 ml squeeze vial 406 s87.a foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 each piece 407 s87.b foldable intra ocular lense with injector ( details in rc ) 18 to 24 each piece 408 s87.c foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 each piece 409 s102 foleys catheter no. 14 ( detail in rc ) each piece 410 392 folic acid tab ip 5 mg each pcs. 411 245 formaldehyde solution ( 34.5 per. 38 per. ) each pcs. 412 616 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 30 capsules 413 685 framycetin sulphate cream 1 o / o 100 gm pack 100gm pack 414 684 framycetin sulphate cream 1 o / o 30gm pack 30gm pack 415 254 frusemide tab ip 40 mg 10x10 tab strip 416 255 furosemide injection ip 10mg / ml ( im and iv use ) 2 ml ampoule 417 216a fusidic acid cream ip 2% 10gm tube in mono carton 418 667 gabapentine tablet / capsule 100mg 10x10 tablet / capsule blister / strip 419 668 gabapentine tablet / capsule 300mg 10x10 tablet / capsule blister / strip 420 235 gadodiamide inj. 0.5mml / ml vial 10 ml vial 421 446 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 100 ml bottle 422 724 ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) vial 423 737 gefitinib tablet ip 250 mg ( each film coated tablet contains gefitinib ip 250 mg ) 10x10 tablets 424 531 gemcitabine for injection 200 mg vial 425 532 gemcitabine for injection ip 1gm vial 426 116 gentamycin injection ip 80mg / 2ml ( im / iv use ) 2 ml amp 50 ampoules 427 246 gentian violet topical solution usp 1o / o 200 ml bottle 428 453 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) each pcs. 429 287 glibenclamide tab ip 5 mg 10x10 tab strip / blister 430 603 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 10x10 tablets 431 288 gliclazide tab ip 40 mg 10x10 tab strip / blister 432 290 glimepiride tab ip 1mg 10x10 tab strip / blister 433 289 glimepiride tab ip 2 mg each pcs. 434 456 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 10x10 tab blister 435 452 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 10x10 tab blister 436 291 glipizide tab ip 5mg 10x10 tab blister 437 s5.b gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 438 s5.a gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 439 s7.b gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) pair 440 s6.b gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 441 s6.a gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 442 s7.a gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) pair 443 604 glucagon for injection usp 1 mg / ml vial 444 247 gluteraldehyde solution 2% each pcs. 445 564 glycerin ip 100 ml each pcs. 446 217 glycerin ip 400 gm each pcs. 447 650 glyceryl trinitrate tablets 2.6 mg controlled release tablets 30 tab bottles 448 312 glycopyrrolate inj ip 0.2 mg / ml 1 ml 10 ampoules 449 117 griseofulvin tab ip 125 mg each pcs. 450 583 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 15 ml squeeze vial 451 353 haloperidol inj ip 5 mg / ml 1 ml 10 ampoules 452 354 haloperidol tab ip 1.5 mg 10x10 tab strip 453 355 haloperidol tab ip 5 mg 10x10 tab strip 454 6 halothane bp 250 ml in amber colour bottle 455 174 heparin sodium inj ip 5000 iu / ml ( im / iv use ) each pcs. 456 767 hepatitis b immunologlobin injection ip 200 i.u each pcs. 457 485 homatropine eye drops ip 2% 5 ml squeeze vial 458 175 human albumin solution ip 20% 100 ml bottle / flexible closed system bag 20o / o 100 ml 459 304 human anti d immunoglobulin 150 mcg pre filled syringe / vial 460 303 human anti d immunoglobulin injection 300mcg ( im use ) human chorionic gonadotropin injection ip 5000 i.u. vial 462 798 human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) 10ml vial ( 0.5gm ) 463 305 human rabies immunoglobulin inj 150 iu / ml each pcs. 464 423 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. vial 465 256 hydrochlorthiazide tab ip 12.5 mg 10x10 tab strip 466 464 hydrochlorthiazide tab ip 25mg 10x10 tab strip 467 42 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) vial 468 248 hydrogen peroxide solution ip 6 o / o ( 20 vol ) each pcs. 469 599 hydroxychloroquine sulphate tablets 200mg 10x10 tablets 470 416 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 500 ml plastic bottle / 500 ml free flex 471 293 hydroxyprogesterone inj ip 250mg / ml 1ml amp 25 ampoules 472 324 hydroxypropylmethyl cellulose solution 20 mg / ml 2ml glass syringe ( with cannula ) 473 43 hydroxyzine tab ip 25 mg 10x10 tab strip / blister 474 414 hyoscine butyl bromide tablets ip 10mg 10x10 tab blister 475 268 hyoscine butylbromide inj ip 20 mg / ml each pcs. 476 22 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 10x10 tab blister 477 477 ibuprofen oral suspension bp / usp 100 mg / 5 ml 60 ml bottle ( with measuring cap ) 478 23 ibuprofen tab ip 200 mg ( coated ) 10x10 tab blister 479 24 ibuprofen tab ip 400 mg ( coated ) each pcs. 480 533 ifosfamide injection ip / bp / usp 1gm vial 481 534 imatinib tab ip 400mg each pcs. 482 715 imipenem + cilastatin injection 500mg / 500mg ip powder for solution vial 483 356 imipramine tab ip 25 mg ( coated tab ) 10x10 tab blister 484 357 imipramine tab ip 75 mg ( coated ) 10x10 tab blister 485 436 indomethacin cap ip 25 mg 10x10 cap strip 486 s10.a infant feeding tube size 10fg ( details in rc ) each piece 487 s10.c infant feeding tube size 5fg ( details in rc ) each piece 488 s10.b infant feeding tube size 8fg ( details in rc ) each piece 489 s13 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) unit 490 796 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 1.5ml vial 491 693 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 10 ml vial 492 680 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 3ml vial 493 300 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 10 ml vial 494 s14 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 unit 495 791 intravenous fat emulsion 20% w / v 250ml 250 ml bottle 496 482 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 20 ml pack 497 672 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 50ml 498 369 ipratropium bromide nebulizer solution 250 mcg / ml 15 ml glass bottle 499 618 ipratropium powder for inhalation ip 40 mcg each pcs. 500 448 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 100 ml bottle in a unit carton with a separate dropper ( details in rc ) 501 488 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 5 ml ampoule ( amber colour ) 502 7 isoflurane usp each pcs. 503 294 isophane insulin inj ip 40 iu / ml 10 ml vial 504 551 isoprenaline injection ip 2mg / ml each pcs. 505 197 isosorbide dinitrate tab ip 5 mg 10x10 tab blister 506 198 isosorbide mononitrate tabs ip 20 mg 10x10 tab strip 507 333 isoxsuprine inj ip 5 mg / ml 2 ml amp 10 ampoules 508 334 isoxsuprine tab ip 20 mg 10x10 tab strip 509 118 itraconazole cap 100 mg 10x4 cap strip 510 s84.b k wire, length 375 mm; 1.6mm ( details in rc ) each pcs. 511 s84.c k wire, length 375 mm; 1.8mm ( details in rc ) each pcs. 512 s84.a k wire, length 375 mm; 1mm ( details in rc ) each pcs. 513 8 ketamine inj ip 50 mg / ml 10 ml vial 514 565 ketoconazole cream 2% 15gm tube in mono carton 515 697 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 10x10 tablets 516 411 labetalol hcl inj ip 20mg / 4ml 4 ml ampules 517 410 labetalol tab ip 100mg each pcs. 518 704 lacosamide tablet 100 mg ( each film coated tablet contains lacosamide 100 mg ) each pcs. 519 592 lactic acid bacillus tab 60 million spores 10x10 tablets 520 593 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml each pcs. 521 701 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) 10x10 tablets 522 149 l asparaginase inj 10000 iu vial 523 600 leflunomide tablets ip 10mg ( film coated ) 10x10 tablets 524 601 leflunomide tablets ip / usp 20mg ( film coated ) 10x10 tablets 525 728 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 10x10 tablets 526 150 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml each pcs. 527 776 leurprolide acetate depot 11.25 mg vial 528 775 leurprolide acetate depot 3.75 mg vial 529 785 levamisol hydrochloride tablet ip 50 mg ( each uncoated tablet conatin levamisol hydrochloride ip 50 mg ) 10x10 tablets 530 666 levetiracetam injection 500mg / 5ml vial 531 665 levetiracetam oral solution / suspension 100mg / ml 100ml 532 664 levetiracetam tablet ip 500 mg 10x10 tab blister 533 659 levoceitrizine tablet 5mg 10x10 tablets 534 161 levodopa and carbidopa tab 250 mg+ 25 mg 10x10 tab strip 535 160 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg each pcs. 536 712 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 10x10 tablets 537 515 levofloxacin tablets ip 250 mg each pcs. 538 777 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 10x10 tablets 539 424 lidocaine hcl topical solution usp 4% each pcs. 540 10 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 30 ml vial 541 11 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg each pcs. 542 12 lignocaine gel ip 2% 30gm tube in a unit carton 543 13 lignocaine inj ip 2 o / o 30 ml vial 544 9 lignocaine ointment 5 o / o 10 gm tube in unit carton 545 517 linezolid inj 200mg / 100ml each pcs. 546 516 linezolid tablets ip 600 mg 10x10 tablets 547 800 liposomol amphotericine injection b 50mg vial 548 799 liquid medical oxygen ( lmo ) each pcs. 549 594 liquid paraffin ip 100 ml each pcs. 550 218 liquid paraffin ip 400 ml each pcs. 551 466 lisinopril tab ip 2.5 mg 10x10 tab strip / blister 552 199 lisinopril tab ip 5 mg each pcs. 553 465 lisinopril tablets ip 10 mg 10x10 tab strip / blister 554 358 lithium carbonate tab ip 300 mg 10x10 tab strip 555 732 lomustine capsule ip 40 mg ( each capsule contains lomustine ip 40 mg ) each pcs. 556 269 loperamide tab ip 2 mg 10x10 tab strip 557 359 lorazepam inj ip 2 mg / ml each pcs. 558 778 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 10x10 tablets 559 458 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 10x10 tab strip / blister 560 459 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 10x10 tab blister 561 467 losartan tab ip 25 mg 10x10 tab blister 562 200 losartan tab ip 50 mg each pcs. 563 249 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 5 ltrs can 564 201 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 2 ml amp 25 ampoules 565 257a mannitol inj ip 20% w / v each pcs. 566 632 mannitol with glycerin injection 10 o / o + 10 o / o w / v ( for intravenous infusion ) 100 ml ffs / bfs bottle 567 624 mecobalamin inj 500 mcg / ml 1 ml. ampoule 568 605 medroxyprogesterone acetate tablets ip 10 mg 10x10 tablets 569 496 mefenamic acid tablets bp 500 mg each pcs. 570 518 mefloquine tablets ip 250 mg each pcs. 571 151 melphalan tab ip 5 mg 25 tab bottle 572 152 mercaptopurine tab ip 50 mg 10x10 tab strip 573 119 meropenem inj ip 500 mg each pcs. 574 481 meropenem inj. ip 1gm each pcs. 575 717 meropenem injection ip 250 mg vial 576 766 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 10x10 tablets 577 454 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg each pcs. 578 455 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 10x10 tab blister 579 451 metformin hydrochloride ( sustained release tablets ip 1000 mg each pcs. 580 295 metformin tab ip 500 mg ( film coated ) 10x10 tab blister 581 153 methotrexate inj ip 50 mg / 2 ml each pcs. 582 154 methotrexate tab ip 2.5 mg each pcs. 583 536 methotrexate tablets ip 10 mg 10x10 tab strip 584 653 methyl cobalmine tablet 1500mcg 10x10 tab strip / blister 585 652 methyl cobalmine tablet 500mcg 10x10 tab strip / blister 586 44 methyl prednisolone sodium succinate for injection usp 500 mg vial 587 202 methyldopa tab ip 250mg film coated each pcs. 588 335 methylergometrine inj ip 0.2 mg / ml 1ml amp ( ambercolor ) 25 amp 589 336 methylergometrine tab ip 0.125 mg 10x10 tab strip 590 478 metoclopramide hydrochloride syrup ip 5 mg / 5ml 30 ml bottle ( with a seperate dropper which should be able to screw & cap the bottle ) in unit carton 591 270 metoclopramide inj ip 10mg / 2ml 2 ml amp ( amber colour ) ( 25 ampoules ) 592 271 metoclopramide tab ip 10 mg 10x10 tab blister 593 553 metoprolol succinate extended release tablets ip 50 mg 10x10 tablets 594 552 metoprolol tablets ip 25 mg 10x10 tablets 595 584 metronidazole 1% and chlorhexidine gluconade 0.25% gel 10 gm tube in unit carton 596 121 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 60 ml bottle ( amber colour ) with measuring cap 597 120 metronidazole inj ip 500 mg / 100ml 100 ml ffs / bfs bottle 598 122 metronidazole tablets ip 200 mg ( film coated ) each pcs. 599 123 metronidazole tablets ip 400 mg ( film coated ) each pcs. 600 220 miconazole nitrate cream ip 2% 15gm tube in a unit carton 601 313 midazolam inj ip 1 mg / ml 5 ml vial 602 615 mifepristone tab ip 200mg each pcs. 603 337 misoprostol tab ip 200 mcg each pcs. 604 537 mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg each pcs. 605 660 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 10x10 tablet blister / strip / alu alu pack 606 25 morphine sulphate inj ip 10mg / ml 1 ml 10 ampoules 607 s16 mucus extractor sterile ( details in rc ) unit 608 790 multi vitamin syrup each pcs. 609 381 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 500 ml ffs / bfs bottle 610 382 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 500 ml ffs / bfs bottle 611 801 multistix test strip each pcs. 612 393 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 613 394 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vitb2 2 mg niacinamide 25mg folic acid 0.2 mg 10x10 tab strip / blister 614 738 mycophenolate mofetil capsule / tablets ip 250 mg ( each capsule / tablets conatin mycophenolate mofetil ip 250 mg ) 10x10 caps / tab 615 740 mycophenolate sodium tablet 360 mg ( each enteric coated tablet conatin mycophenolate sodium 360 mg ) each pcs. 616 744 n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size each pcs. 617 51 naloxone inj ip 0.4mg / ml 1 ml 10 ampoules 618 657 naproxen tablet ip 250mg 10x10 tab blister 619 656 naproxen tablet ip 500mg 10x10 tab blister 620 s17.a nasal oxygen set, twin bore all sizes adult ( details in rc ) each piece 621 s17.b nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) each piece 622 s126 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) each piece 623 772 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 10x10 tablet / capsule blister / strip 624 s134 nebulization mask adult ( detail in rc ) each piece 625 s135 nebulization mask paediatric ( detail in rc ) each piece 626 s103 nelaton catheter size 14 fg ( detail in rc ) each piece 627 223 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 10 gm plastic bottle with nozzle to sprinkle powder 628 588 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 5 ml vial / bottle with a seperate dropper 629 314 neostigmine inj ip 0.5 mg / ml 1 ml 10 ampoules 630 638 neostigmine injection ip 2.5mg / 5ml 5 ml amp ( 10 ampoules ) 631 316 neostigmine tab ip 15 mg each pcs. 632 203 nifedipine cap ip 5mg 10x10 cap strip 633 204 nifedipine tablets ip 10 mg ( sustained release ) 10x10 tab blister 634 413 nitrofurantoin tab ip 100mg each pcs. 635 205 nitroglycerin inj 5 mg / ml 5 ml amp ( 10 ampoules ) 636 s131 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) each piece 637 s129 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) each piece 638 s132 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) each piece 639 s130 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) each piece 640 s133 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) each piece 641 r55 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 / 0 1 / 2 circle taper cut, 17mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 642 r56 non absorbable surgical suture sterilized needled polybutylate / silicon coated with polyster braided ( green / blue ) size 2 0 1 / 2 circle taper cut, 25mm double armed needle, suture length of 90cm with pledgets size 6 x 3 x 1.5mm 1x6 foils 643 r22 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 1x12 foils 644 r20 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 1x12 foils 645 r21 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 1x12 foils 646 r57 non absorbable surgical suture, sterilised needled coated polyster braided, green / white or blue / white coated polyster braided ( green / blue ) with size 3 / 0 1 / 2 circle tapercut double needle 25mm, suture length 90 cm 1x12 foils 647 r45 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 1x12 foils 648 r46 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir reverse cutting, 45 mm needle length 100 cm ) 1x12 foils 649 r34 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 1x12 foils 650 r33 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 1x12 foils 651 r38 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 1x12 foils 652 r50 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 circle tapercut needle 17mm suture length of 90cm ) double arm 1x12 foils 653 r40 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir tapercut needle, 25 mm length 90 cm ) double arm 1x12 foils 654 r37 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 1x12 foils 655 r51 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, suture length of 75cm ) double arm 1x12 foils 656 r44 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 1x12 foils 657 r36 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir tapercut double needle 17mm length 70 cm ) ( detail in rc ) 1x12 foils 658 r48 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 circle tapercut 13mm double needle 70cm ) 1x12 foils 659 r29 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb 13 mm needle, length 75cm ) double arm 1x12 foils 660 r35 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 cir rb double needle 17mm length 90 cm ) ( detail in rc ) 1x12 foils 661 r32 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 1x12 foils 662 r42 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir rb 13mm needle, length 90 cm double arm 1x12 foils 663 r75 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 10 / 0 ( 3 / 8 cutting spatulated edge needle, double arm needle 6 mm, suture length 30 42 cm 1x12 foils 664 r23 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 1x12 foils 665 r28 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 666 r27 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 1x12 foils 667 r24 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 1x12 foils 668 r25 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 4 / 0 ( 3 / 8 conventional cutting needle 19mm length 60 cm. ) 1x12 foils 669 r53 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided white size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) 1x12 foils 670 r52 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 4 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 75 cm ) each pcs. 671 r54 non absorbable surgical suture, sterilised needled polybutylate / silicon coated polyster braided green / blue size 2 / 0 ( 1 / 2 cir tapercut , 17 mm double needle, length 90 cm ) ( detail in rc ) 1x12 foils 672 r30 non absorbable surgical suture, sterilised needled monofilament polypropylene blue ( 3 / 8cir rb 16 mm needle, length 90 cm ) size 6 / 0 1x12 foils 673 r39 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir tapercut needle 17mm length 75 cm ) double arm 1x12 foils 674 r43 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 4 / 0 ( 1 / 2 cir rb needle 16 mm length 70 cm ) 1x12 foils 675 r49 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 1 / 2 circle cc 13mm needle, suture length of 70cm ) double arm 1x12 foils 676 r41 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 6 / 0 ( 3 / 8 cir conventional cutting pc 3needle 15mm length 60cm ) 1x12 foils 677 r31 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 7 / 0 ( 3 / 8cir rb double 8mm needle, length 60 cm ) 1x12 foils 678 r47 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 8 / 0 ( 3 / 8 cir rb , 8mm double needle, suture length of 70cm ) 1x12 foils 679 r26 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 5 / 0 ( 3 / 8 cir slim blade cutting needle 15mm length 70 cm ) 1x12 foils 680 554 noradrenaline injection ip 2 mg / ml each pcs. 681 296 norethisterone tab ip 5 mg each pcs. 682 124 norfloxacin tab ip 400mg film coated 10x10 tab blister 683 633 normal human intravenous immunoglobulin 5g / 100ml 100 ml vial 684 608 octreotide injection 50 mcg / ml 1 ml. ampoule 685 520 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 10x10 tab blister 686 521 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) each pcs. 687 711 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 30 ml. bottle 688 428 ofloxacin oral suspension ip 50mg / 5ml 30 ml. bottle 689 125 ofloxacin tab ip 200 mg 10x10 tab blister 690 219 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o each pcs. 691 762 oitment mupirocin ip 2% 5 gm tube 692 360 olanzapine tab ip 5 mg each pcs. 693 761 olopatadine hydrochloride ophthalmic solution 0.1% w / v ip ( e / d ) 5ml size 5ml bottle 694 272 omeprazole cap ip 20 mg each pcs. 695 273 ondansetron inj ip 2mg / ml 2 ml amp 10 ampoules 696 595 ondansetron orally disintegrating tablets ip 4mg 10x10 tab strip 697 274 ors powder ip each pcs. 698 641 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) each pcs. 699 640 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) strip / blister of 10 capsule 700 639 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) strip / blister of 10 capsule 701 642 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 75 ml bottle with measuring cap 702 642a oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) each pcs. 703 538 oxaliplatin injection usp 50 mg 25 ml vial 704 703 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 10x10 tablets 705 s100 oxygen mask ( adult ) 706 s101 oxygen mask ( pediatric ) unit 707 338 oxytocin inj ip 5 iu / ml each pcs. 708 156 paclitaxel inj ip 100 mg 16.7 ml vial 709 155 paclitaxel inj ip 260 mg each pcs. 710 596 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets each pcs. 711 s18 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 712 s19 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 713 s20 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape unit 714 26 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 15 ml bottle ( with dropper which should be able to screw and cap the bottle ) in a unit carton 715 696 paracetamol infusion ip 1% w / v 100ml size 100 ml bottle 716 29 paracetamol inj. 150 mg / ml 2 ml amp 50 ampoules 717 27 paracetamol syrup ip 125 mg / 5ml ( detail in rc ) 60 ml bottle ( with measuring cap ) 718 28 paracetamol tab ip 500 mg 10x10 tab blister 719 30 pentazocine inj ip 30mg / ml ( im / iv use ) 1ml amp 25 ampoules 720 275 pentoprazole inj 40 mg each pcs. 721 s12 perfusion set ( infusion set ) with airway and needle ( paediatric use ) sterile disposable ( details in rc ) unit 722 s11 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) unit 723 401 peritonial dialysis solution ip 1000 ml ffs / bfs pack 724 569 permethrin cream 5% 30gm tube in a unit carton 725 568 permethrin lotion 5% 30 ml 726 786 phenazopyridine tablet 5 mg each pcs. 727 45 pheniramine inj ip 22.75mg / ml 2 ml amp 25 ampoules 728 420 phenobarbitone inj ip 200mg / ml each pcs. 729 56 phenobarbitone tab ip 30 mg 10x10 tab strip 730 614 phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% each pcs. 731 57 phenytoin injection bp 50mg / ml 2 ml amp ( amber colour ) ( 25 ampoules ) 732 58 phenytoin oral suspension ip 25mg / ml 100 ml glass bottle with measuring cap 733 59 phenytoin tab ip 100 mg ( film coated ) each pcs. 734 297 pioglitazone tab ip 15 mg 10x10 tab blister 735 468 piperacillin + tazobactum for injection ip 4gm+500mg vial 736 707 piperacillin injection 2 gm + tazobactom 250mg ip vial 737 s22 plaster of paris bandage 10cm x 2.7mts unit 738 s21 plaster of paris bandage 15cm x 2.7 mts / roll unit 739 405 polygeline 3.5% solution with electrolytes for i.v. infusion each pcs. 740 716 polymixin sulphate b injection usp 5 lac i.u. vial 741 s74 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm piece 742 s73 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm piece 743 383 potassium chloride inj. 0.15 gm / ml 10 ml amp 10 ampoules 744 384 potassium chloride oral solution u.s.p 500mg / 5ml 200ml bottle ( amber color ) 745 221 povidone iodine ointment 5% 15 gm each pcs. 746 571 povidone iodine ointment usp 250 gm 250 gm pack 747 250 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 500 ml bottle 748 572 povidone iodine solution ip 10 % 100 ml bottle 749 222 povidone iodine solution ip 5 % 500 ml 500 ml bottle 750 450 povidone iodine solution ip 5% 100ml bottle each pcs. 751 759 powder clotrimazole 1% w / w 30 gm 30 gm bottle 752 52 pralidoxime chloride injection ip 25 mg / ml / 500 mg vial 753 555 prazosin tablets ( extended release ) 2.5 mg 10x15 tablet strip / blister 754 470 prednisolone tab ip 20 mg 10x10 tab strip / blister 755 47 prednisolone tab ip 5 mg 10x10 tab strip / blister 756 469 prednisolone tablet ip 10 mg 10x10 tab strip / blister 757 634 pregabalin cap ip 75 mg 10 x 10 capsule 758 s91 pressure monitoring line / high pressure extension line ( details in rc ) each piece in blister pack 759 128 primaquine tab ip 2.5 mg 10x10 tab strip / blister 760 129 primaquine tab ip 7.5 mg 10x10 tab strip / blister 761 765 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 1 gm each sachet 762 725 procarbazine hydrochloride capsule usp 50 mg ( each capsule contains procarbazine hydrochloride usp 50 mg ) each pcs. 763 764 prochlorperazine mesylate injection 12.5mg / ml 5ml size each pcs. 764 298 progesterone inj 200 mg / 2ml 2 ml amp 10 ampoules 765 49 promethazine inj ip 25mg / ml 2 ml amp ( amber color ) ( 10 ampoules ) 766 48 promethazine syrup ip 5 mg / 5ml 60 ml bottle ( with measuring cap ) 767 50 promethazine tab ip 25 mg 10x10 tab strip 768 14 propofol inj ip 10 mg / ml each pcs. 769 207 propranolol tab ip 40 mg each pcs. 770 792 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 10x10 tablets 771 626 pyridoxine tablet ip 10 mg each pcs. 772 627 pyridoxine tablet ip 40mg 10x10 tab strip 773 675 quetiapine tablet ip 25mg 10x10 tab blister 774 674 quetiapine tablet ip 50mg 10x10 tab blister 775 131 quinine dihydrochloride inj ip 300 mg / ml each pcs. 776 132 quinine sulphate tablets ip 300 mg ( film coated ) 10x10 tab blister 777 408 rabies antiserum ip ( equine ) 300 units per ml contains equine antirabies immunoglobulin fragments ( i.m. / sc use ) 5 ml vial 778 306 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 1 ml vial with 1.0 ml diluent 779 307 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose single dose vial with diluent and syringe with needle 780 636 ramipril tablets ip 2.5 mg 10x10 tablets 781 276 ranitidine hcl injection ip 50mg / 2ml each pcs. 782 277 ranitidine tab ip 150mg film coated each pcs. 783 433 ranitidine tab ip 300mg film coated each pcs. 784 690 recombinant coagulation factor viia 1mg vial 785 691 recombinant coagulation factor viia 2mg each pcs. 786 748 recombinant f ix 500 iu with diluent vial with diluent 787 179 rh erythropoetin inj 4000 iu vial / pfs 788 176 rh erythropoetin inj ip 10000 iu vial / pfs 789 177 rh erythropoetin inj ip 2000iu vial / pfs 790 781 ringer acetate infusion 500 ml 500 ml bottle 791 362 risperidone tab 1 mg 10x10 tab strip / blister 792 361 risperidone tab 2mg each pcs. 793 757 rosuvastatin tablet 10 mg 10x10 tablets 794 756 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 10x10 tablets 795 s90.d rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) dispenser box of100 gloves 796 s90.a rubber examination gloves, non sterile, extra small ( details in rc ) dispenser box of100 gloves 797 s90.c rubber examination gloves, size medium ( details in rc ) dispenser box of100 gloves 798 s90.b rubber examination gloves, size small ( details in rc ) dispenser box of100 gloves 799 s23.a ryles tube / nasogastric tube size: 10 ( details in rc ) each piece 800 s23.b ryles tube / nasogastric tube size: 12 ( details in rc ) each piece 801 s24.b ryles tube / nasogastric tube size: 16 ( details in rc ) each piece 802 s24.c ryles tube / nasogastric tube size: 18 ( details in rc ) each piece 803 s24.a ryles tube / nasogastric tube size:14 ( details in rc ) each piece 804 758 sacubitril 24 mg and valsartan 26 mg tablet 14x2 tablets 805 371 salbutamol inhalation 100 mcg / dose 200metered dose container 806 372 salbutamol nebuliser solution bp 5 mg / ml 10 ml vial 807 432 salbutamol syrup ip 2mg / 5ml 100 ml bottle ( with measuring cap ) 808 373 salbutamol tab ip 2 mg 10x10 tab strip / blister 809 370 salbutamol tablet ip 4 mg each pcs. 810 442 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) each pcs. 811 s99.p sanitary napkin beltless with wings ( details in rc ) each pcs. 812 s99.a sanitary napkin beltless ( details in rc ) 6 napkin / pack 813 s99.b sanitary pads belt type ( details in rc ) 6 napkin / pack 814 783 savelamer carbonate tablet 400 mg ( each film coated tablet contains savelamer carbonate 400 mg ) 10x10 tablets 815 s25.a scalp vein set ( disposable ) size 18g ( details in rc ) each piece 816 s25.b scalp vein set ( disposable ) size 20g ( details in rc ) each piece 817 s25.c scalp vein set ( disposable ) size 22g ( details in rc ) each piece 818 s25.d scalp vein set ( disposable ) size 24 g ( details in rc ) each piece 819 363 sertraline tab ip 50 mg each pcs. 820 491 sevoflurane each pcs. 821 573 silver sulphadiazine cream ip 1% 500 gm jar 500 gm jar 822 224 silver sulphadiazine cream ip 1% 50gm tube each pcs. 823 s82 skin graft knife blade ( sterile ) ( details in rc ) one pack each 824 308 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) vial 825 402 sodium bicarbonate inj ip 7.5% w / v 10 ml amp 25 ampoules 826 784 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 10x10 tablets 827 782 sodium chloride 0.45% w / v polypack 500 ml 500 ml bottle 828 385 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 500 ml ffs / bfs bottle 829 386 sodium chloride inj ip 500 ml 500 ml ffs / bfs bottle 830 621 sodium chloride injection ip 100 ml each pcs. 831 754 sodium nitroprusside injection 25mg / ml 2ml size 2ml vial / ampoule 832 278 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 100 ml polypropylene pack 833 61 sodium valproate gastro resistant tablets ip 200 mg 10x10 tab strip 834 60 sodium valproate inj 100 mg / ml each pcs. 835 479 sodium valproate oral solution ip 200 mg / 5 ml 100 ml bottle ( with measuring cap ) 836 661 sodium valproate tablet ( gastro resistant ) ip 500mg 10x10 tab strip 837 752 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 10x10 tablets 838 258 spironolactone tab ip 25mg each pcs. 839 574 spironolactone tablets ip 50 mg each pcs. 840 s88.a standard pama intra ocular lenses ( details in rc ) 11 to 17.5 each piece 841 s88.b standard pama intra ocular lenses ( details in rc ) 18 to 24 each piece 842 s88.c standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 each piece 843 s128 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) each pcs. 844 s15.e sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) each piece 845 s15.a sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) each piece 846 s15.c sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) each piece 847 s15.d sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) each piece 848 s15.b sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) each piece 849 s39.a sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) each piece 850 s39.b sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) each piece 851 s106 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) each piece 852 s79 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) each piece 853 209 streptokinase injection 15 lac units ip vial 854 317 succinylcholine inj. ip 50 mg / ml ( iv use ) 10 ml vial 855 s8.d suction catheter, sterile. size: f g 10 ( details in rc ) each piece 856 s8.e suction catheter, sterile. size: f g 12 ( details in rc ) each piece 857 s8.f suction catheter, sterile. size: f g 14 ( details in rc ) each piece 858 s8.g suction catheter, sterile. size: f g 16 ( details in rc ) each piece 859 s8.h suction catheter, sterile. size: f g 18 ( details in rc ) each piece 860 s8.i suction catheter, sterile. size: f g 20 ( details in rc ) each piece 861 s8.j suction catheter, sterile. size: f g 22 ( details in rc ) each piece 862 s8.b suction catheter, sterile. size: f g 6 ( details in rc ) each piece 863 s8.c suction catheter, sterile. size: f g 8 ( details in rc ) each piece 864 s8.a suction catheter, sterile.size: fg 5 ( details in rc ) each piece 865 602 sulfasalazine delayed release tablets usp / gastroresistant sulfasalazine tablets bp 500 mg 10x10 tablets 866 635 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 4ml vial 867 s30.a surgical blade sterile, size 11 ( details in rc ) 100 blades / packet 868 s30.b surgical blade sterile, size 15 ( details in rc ) 100 blades / packet 869 s30.c surgical blade sterile, size 22 ( details in rc ) 100 blades / packet 870 s105 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) each piece 871 s86.a surgical cap disposable ( for surgeons ) ( details in rc ) piece 872 s86.b surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) piece 873 449 surgical spirit ip ( 100 ml ) 100ml opaque white bottle with inner cap 874 252 surgical spirit ip ( 500 ml ) 500 ml opaque white bottle with inner cap 875 s31 suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) each pcs. 876 s32 suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) each pcs. 877 s33 suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) each pcs. 878 s34 suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) each pcs. 879 s35 suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) each pcs. 880 s36 suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) each pcs. 881 s37 suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) each pcs. 882 s38 suture needles curved and cutting size 1 5 ( details in rc ) each pcs. 883 s28 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 884 s26 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 885 s29 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) unit 886 s27 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) unit 887 739 tacrolimus capsule ip 0.5 mg ( each hard gealtin capsule tacrolimus ip 0.5 mg ) 10 x 10 capsule 888 157 tamoxifen tab ip 10 mg each pcs. 889 576 tamsulosin hcl tablets / capsule 0.4 mg each pcs. 890 556 telmisartan tablets ip 40 mg 10x10 tablets 891 729 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) strip of 5 cap / bottele of 5 cap 892 s81 temporary cardiac pacing wire ( electrode ) sterile ½ cir, tapercut, 26 mm; reverse cutting 60 mm each pcs. 893 682 tenaligliptin tablet ip 20mg 10x10 tablet blister / alu alu pack 894 760 terbinafine cream 1%w / w ( 10 gm tube ) 10 gm tube 895 721 terbinafine hydrochloride tablet 250 mg 10x10 tablets 896 619 terbutaline tablets ip 2.5 mg 10x10 tablets 897 309 tetanus immunoglobulin ip 250 iu / vial vial / ampoules 898 310 tetanus vaccine ( adsorbed ) ip 5 ml vial each pcs. 899 733 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) each pcs. 900 374 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 2 ml amp 25 ampoules 901 375 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 902 376 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 10x10 tab blister 903 629 thiamine tablets ip 100 mg 10x10 tab strip 904 15 thiopentone inj ip 0.5 g each pcs. 905 301 thyroxine sodium tablets ip 100mcg 100 tablet in a bottle 906 607 thyroxine tablets ip 50 mcg 100 tablet in a bottle or 10x10 tablet 907 484 timolol eye drops ip 0.5 o / o w / v 5 ml squeeze vial 908 430 tinidazole tab ip 300 mg ( film coated ) 10x10 tab blister 909 431 tinidazole tab ip 500 mg ( film coated ) 10x10 tab blister 910 699 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 10x10 tablets 911 330 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o each pcs. 912 331 tobramycin eye drops 0.3% [ 331 ] 5 ml. vial with sterilized dropper, or squeeze vial 913 332 tobramycin ophthalmic ointment usp 0.3% each pcs. 914 582 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 50 gm tube in unit carton 915 705 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) each pcs. 916 471 torsemide inj 10 mg / ml each pcs. 917 259 torsemide tab 10 ip mg 10x10 tab strip / blister 918 s46 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) each piece 919 s45 tracheostomy tube, plain all sizes ( details in rc ) each piece 920 32 tramadol cap ip 50 mg each pcs. 921 33 tramadol inj 50 mg / ml each pcs. 922 747 tranexamic acid injection ip 100mg / ml 5ml size 5ml vial / amp 923 545 tranexamic acid tablets ip 500 mg 10x6 tablet blister 924 486 travoprost eye drops ip 0.004 o / o 3 ml squeeze vial 925 570 tretenoin cream usp 0.025% 20 gm tube in unit carton 926 364 trifluperazine tab ip 5 mg coated 10x10 tab strip / blister 927 162 trihexyphenidyl hcl tab ip 2 mg 10x10 tab blister 928 241 tropicamide eye drop ip 1o / o 5 ml. vial with sterilized dropper, or squeeze vial 929 s97 t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) each pcs. 930 s93 umbilical catheter for new born, all sizes ( details in rc ) each piece 931 s94 umbilical cord clamp ( details in rc ) each piece 932 s107 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) each piece 933 s108 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) each piece 934 s92 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) each piece 935 s40 urine collecting bag, disposable 2000 ml ( details in rc ) unit 936 557 urokinase injection 5 lac unit ( lyophilized ) vial 937 597 ursodeoxycholic acid tablets ip 300 mg each pcs. 938 s109 vaccum suction set, 2.5 meter length ( detail in rc ) each piece 939 318 valethamate bromide inj 8mg / ml each pcs. 940 722 valganciclovir tablet 450 mg 10x10 tablets 941 524 vancomycin for intravenous infusion ip 1 gm vial 942 523 vancomycin for intravenous infusion ip 500 mg each pcs. 943 s115 vascular catheter with metal guide no. 16 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 944 s111 vascular catheter with metal guide no. 16, double lumen size 30 cm ( longline iv ) ( detail in rc ) each pcs. 945 s112 vascular catheter with metal guide no. 18 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 946 s116 vascular catheter with metal guide no. 18 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 947 s113 vascular catheter with metal guide no. 20 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 948 s117 vascular catheter with metal guide no. 20 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 949 s114 vascular catheter with metal guide no. 22 double lumen size 30 cm ( longline iv ) ( detail in rc ) each piece 950 s118 vascular catheter with metal guide no. 22 double lumen size 45 cm ( longline iv ) ( detail in rc ) each pcs. 951 242 vdrl antigen ( with + ve and ve control ) / rpr slide kit 100 test kits 952 419 vecuronium bromide for injection 4mg ( freeze dried ) each pcs. 953 211 verapamil tab ip 40 mg film coated 10x10 tab strip 954 158 vinblastine inj ip 10mg / 10ml vial 955 159 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) vial / ampoules 956 409 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 100 ml bottle and spoon with marking 1 ml / 2ml in unit carton 957 395 vitamin b complex inj nfi 10 ml vial 958 397 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 10x10 tab strip / blister 959 676 vitamin d3 oral solution 60000 iu 5ml glass bottle in unit carton 960 795 vitamin e capsule 400 mg 10x10 tablets 961 180 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 1ml amp ( ambercolor ) 25 amp 962 644 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) each pcs. 963 720 voriconazole injection 200mg / vial vial 964 546 warfarin sodium. tab ip 5mg 10x10 tablets 965 404 water for inj ip 10 ml ampoule 50 ampoules 966 620 xylometazoline nasal drops ip 0.1% each pcs. 967 472 zinc sulphate dispersible tablets ip elemental zinc 10 mg 10x10 tab strip / blister 968 743 zoledronic acid injection ip 4mg vial each pcs. 969 779 zolpidem tablet 5 mg 10x10 tablets 970 amino acid drop each piece 971 amino acid inj. ( astamin ) each piece 972 aminorich drop / astymen c / amenovik each piece 973 amoxycillin and potassium clavulanate drop each piece 974 ampilox 250 ml inj. each piece 975 aquasop inj. 1000 ml 976 arichitol inj. one 977 arodesin solution one 978 augpen 150 mg ( amoxycilline + pot. clavulanate ) inj. 979 augpen 300 mg ( amoxycilline + pot. clavulanate ) inj. 1 piece 980 auto clave tape ( stera tape ) 1 piece 981 b.p. instument with mercuary 1 piece 982 b.p. instument with mercuary standing 983 b.p. instument without mercuary 984 bains circuit adult each 985 bains circuit pediatric each piece 986 betnisol inj. 02 tab strip / blister 987 biotax 125 mg ( ceftoxyn ) inj. each piece 988 cabergolin 0.25 mg tab. 5 ltr. 989 candid lotion each piece 990 citric acid 1 piece 991 dettol 100 ml each piece 992 disposable baby kit each piece 993 disposable needle no 16 11 / 2 inch each piece 994 disposable razor each piece 995 dressing drum all sizes each piece 996 drop sodabicarb each piece 997 erofer l drops 15 ml each piece 998 evion drop 999 ezithromycin 15ml sy 1000 formalin 1 ltr each piece 1001 formalin 5 ltr each piece 1002 glucometer strip each piece 1003 gluco one strip ( dr. morepen ) 1004 hand sanitizer 1005 inj. citicholin 1006 inj. hepamerz 1007 inj. nootrophil each piece 1008 inj. strocit each piece 1009 intralipid inj. 1 tin ( 400 gm ) 1010 k 90 catheter dispenser box of 100 gloves 1011 lactodex lbw with micronutrients dispenser box of 100 gloves 1012 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. extra small dispenser box of 100 gloves 1013 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. large dispenser box of 100 gloves 1014 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. medium 1015 latex examination gloves made of natural rubber latex. non sterile, ambidextous, aql 1.5 micro textured powdered with absorbable dusting powder usp. small 1016 lilan thread 40 3 x 4.5 feet 1017 lilan thread 60 each piece 1018 mackintosh each piece 1019 mucus sucker set each piece 1020 multivitamin with zinc syp. each piece 1021 multizec trop 15 ml each piece 1022 neasphine oint. 1023 needle no. 211 / 2 1024 needle order each piece 1025 neosprin eye oint. each piece 1026 netromycine 10 mg. inj. ( netromax 10 mg inj. ) 1027 nuclovate cream 15 gm 1028 oxygen double stage ragulator each 1029 pedia set 100 ml piece 1030 pepericilline + tezobactum 1.125 mg inj. each piece 1031 pressure monitoring line / high pressure extension line ( pmo line ) length 150 cm, prime volume 1.40 ml 1032 prochlorpertine tab. 1033 re breathing bag adult 1034 re breathing bag pediatric 1035 rubber face mask 0 5 1 tin ( 400 gm ) 1036 sevlon lotion 100 ml. 1037 simyl mct powder each piece 1038 star plast ( adhesive plaster ) 100 ml bottle 1039 caffeine citrate 20 mg / ml injection 2 ml vial 1040 vit. a syp. 1041 vit. c drop 1042 vit. c syp. 1 bottle 1043 vit. c tab. 1044 zinc 200 ml syp each piece 1045 zinc 60 ml / 100 ml sy. 1 bottle 1046 zincovit syp. 1047 zincula drop 1 bottle 1048 mouth airway ( all size ) 1 bottle 1049 inj. n.s.500 m.l. ( in glass bottle ) 01 tin 1050 inj. n.s.100 m.l. ( in glass bottle ) 01 bottle 1051 cidex 5 ltr 01 pcs. 1052 blanisol plus 01 pcs. 1053 alcohal based hand rub 01 pcs. 1054 surgical hand & skin disinfactent 01 pcs. 1055 antiseptic surgical hand rub 01 pcs. 1056 povidine iodine 5% & 10% 01 pcs. 1057 high level instrument disinfactent 01 pcs. 1058 multi eyzymetic instrument cleaner 01 pcs. 1059 surgical instrument rust, spot & stain remover 01 pcs. 1060 rejuventate dialysis reprocessing 01 pcs. 1061 disinfectent & decalcification of haemodialysis machine 01 pcs. 1062 d 125 disinfectent 1 ltr. 01 pcs. 1063 5 fu 500 mg 01 pcs. 1064 capcetabin 500 mg 01 pcs. 1065 carboplatin 150 mg 01 pcs. 1066 carboplatin 450 mg 01 pcs. 1067 cisplatin 10 mg 01 pcs. 1068 codon iv set 01 pcs. 1069 cyclophosphamide 500mg 01 pcs. 1070 danazole 50 mg cap. 01 pcs. 1071 docetaxel 120 mg 01 pcs. 1072 docetaxel 80 mg 01 pcs. 1073 doxorubicine 10 mg 01 pcs. 1074 doxorubicine 50 mg 01 pcs. 1075 epirubicine 50 mg 01 pcs. 1076 filgrastin 300 mg 01 pcs. 1077 inj. gemcitabin 1 gm 01 pcs. 1078 inj. gemcitabin 2 mg 01 pcs. 1079 ieucovorin 50 mg 01 pcs. 1080 tab. imatinib 400 mg 01 pcs. 1081 inj. mesna 100 mg 01 nos. 1082 inj. botrezumib 01 pcs. 1083 inj. bleomycin 01 pcs. 1084 oxaliplatin 50 mg 01 pcs. 1085 pacletaxel 260 mg 01 pcs. 1086 tamoxifen 10 mg 01 nos. 1087 zolidronic acid 4 mg 01 nos. 1088 inj. vetneuren 2 ml 01 nos. 1089 inj. vanomycin 01 nos. 1090 inj. surfactant 01 nos. 1091 human hepatitis b immunoglobulin 100 i.u. injection ( 100 i.u. / 0.5 ml ) 01 nos. 1092 three way adopter 01 nos. 1093 inj. milriuon 01 nos. 1094 inj. decarbazine ( dtic ) etc...

Medical And Health Services - Rajasthan

33729619 tender for blood bank reagents in d.b. hospital tender for blood bank reagents abd set, anti ab, blood bag tripal, bar code stationary carbon roll, bar code stationary plain, blood bag, blue micro, copper sulphate powder, disposable needles, filter paper, glass micro, hcv elisa, hcv rapid, mico pipet cacli micro1ips fllow(20() microhier) 1000/ multistix ixiop vacutainer k2edta blood ioopc collection tube x c1 iannel variai1l.l i 0 100 micro , .34 li. 35 aedla1ric tr.tnsi ’er bag too ml. 6 pael)i:jric’ transi er hag . 1s0ml ix 101 ix 101 37 rapid malaria antigen card each 3s sample plain vial plastic w1th cover 10 ml 100/p 39 sponge ball 40 sterile banded i0wp 41 sterile pricking lancet 100 . 42e stickers for sample vail 1000 43 stickers for sample vail 2000 4$ test tube (10 ml. )plastic l00m 45j tjestibe glass ioml without rim 100/pc 46njp tissue paper roll to/pc 47 tourniquet each vacutainer k2edta blood collection tube vdrl rpr test etc ...

Medical Health And Family Welfare - Rajasthan

33726081 medicine, surgical, lab item purchase at district hospital hanumangarh medicine, surgical, lab item purchase at district hospital hanumangarh , medicine surgical lab item purchase , act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) , act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) , act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) , acyclovir suspension 400 mg / 5ml ( 60ml. bottle ) , alendronate sodium tablets usp / bp 35 mg , amino acid 10% injection 100ml size , amphotericin b inj ip 50 mg , atropine sulphate ophthalmic solution usp 1% , bendamustine injection 100 mg , benzathine benzylpenicillin 12 lac units injection ( vial ) , benzathine benzylpenicillin 6 lac units injection ( vial ) , benzathine benzylpenicillin injection 10 lac units ( 600 mg benzylpenicillin ) ( vial ) , bevacizumab injection 400 mg , bicalutamide 50 mg tablet , bortezomib injection 2mg , bupernorphine injection , calcium dobeslate 0.25% lignocaine 3%, hydrocortisone 0.25% zinc 5% cream ( 30gm ) , camylofin hcl 25mg / ml injection ( 2ml ) , carbamazepine oral suspension 100 mg / 5ml ( 100 ml bottle ) , chlorhexidine gluconate solution 2% ( 250ml ) , chloroquine 50 mg / 5ml syrup ( 60ml ) , chloroquine phosphate 40 mg / ml injection ( 5 ml amp ) , chloroquine suspension 50 mg / 5ml ( 60ml ) , co trimoxazole oral suspension 40mg + 200mg per 5ml ( 50ml ) , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 160mg + 800mg tablet , co trimoxazole tablets ds [ trimethoprim + sulfamethoxazole ] 80mg + 400mg tablet , co trimoxazole tablets p [ trimethoprim + sulfamethoxazole ] 20 mg + 100mg tablet , co trimoxazole tablets ss [ trimethoprim + sulfamethoxazole ] 40mg + 200mg tablet , cyanocobalamine 100 mcg / ml injection ( 2 ml amp ) , cyclophosphamide 500mg injection , cytarabine 500mg injection , desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) , diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) , diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) , diazepam 10 mg / 2ml injection ( 2ml amp ) , diazepam 5 mg tablet , diptheria antitoxin 10000 iu injection , dried factor viii fraction ip ( iv use ) 1000 iu / vial , dried factor viii fraction ip ( iv use ) 500 iu / vial , dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) , entecavir tablet ip 0.5 mg ( each film coated tablet conatins entecavir ip 0.5 mg ) , ethinyloestradiol 50mcg tablet , factor ix concentrate 600 iu injection , fentanyl citrate 50mcg / ml injection 2ml , finasteride 5mg tablet , fluorouracil 250mg / 5ml injection , fluorouracil 500mg / 5ml injection , formalin tablet , gadodiamide inj. 0.5mml / ml vial , ganciclovir sodium injection 500mg ( lyophilized powder for reconstitution ) , glucagon for injection usp 1 mg / ml , granisetron injection 1mg. / ml. 3ml. amp. , heparin sodium 5000 i.u. / ml injection , human immunoglobulin inj with 12%igm, 12%iga, 76%igg in pack of 10ml ( 0.5gm ) , hydroxyethyl starch ( 130 / 0.4 ) 6% w / v with sodium chloride 0.9% w / v intravenous infusion ( 500 ml bottle ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 2ml ) , hydroxypropylmethyl cellulose solution 20 mg / ml ( 5ml ) , hyoscine butylbromide 10 mg tablets , hyoscine butylbromide 20 mg / ml injection ( 1 ml amp ) , imiatinib 100mg tablet , imiatinib 400mg tablet , insulin glargine 10 ml vial ( 100 iu / ml ) , insulin glargine 3 ml vial ( 100 iu / ml ) , intravenous fat emulsion 20% w / v 250ml , intravenous immunoglobulin ( ivig ) injection ip 10gm / 100 ml , intravenous immunoglobulin ( ivig ) injection ip 5gm / 100 ml , iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml , ipratropium bromide nebulizer 250 mcg / ml solution ( 15 ml vial ) , ipratropium powder for inhalation ip 40 mcg ( rotocap 30 capsule ) , leurprolide acetate depot 11.25 mg , leurprolide acetate depot 3.75 mg , lidocaine hydrochloride topical solution 4% , lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg , lignocaine hcl 2% injection ( 50ml i.v. ) , lignocaine hcl and dextrose injection ( 2ml ) , lincomycin 600mg / 2ml injection , lisinopril 10 mg tablets , lisinopril 2.5 mg tablet , lisinopril 5 mg tablet , medroxyprogestrone acetate 10mg tablet , medroxyprogestrone acetate 10mg tablet , melphalan 5mg tablet , methotrexate inj ip 50 mg / 2 ml , micronized purified flavonoid fraction 500 mg ( diosmin 450mg+hesperidin 50 mg ) , mifepristone tab ip 200mg , misoprostol 200 mcg tablets , morphine sulphate 10mg / ml injection , naloxone inj ip 0.4mg / ml ( 1ml ) , natural micronised progesterone 200 mg ( capsule ) , nicotinamide 50mg tablet , nicoumalone 4mg tablet , nifedipine 10 mg ( sr ) tablets , nifedipine 5 mg ( sr ) tablets , nitroglycerin inj 5 mg / ml ( 1ml amp ) , oseltamivir phosphate for oral suspension ip 12 mg / ml ( 75ml ) , peritoneal dialysis solution ip ( 1000ml pack ) , phenazopyridine tablet 5 mg , pheniramine maleate 15 mg / 5ml syrup ( 30ml bottle ) , phenobarbitone 20mg / 5ml ( 60 mlsyrup ) , phenoxymethylpenicillin potassium 125 mg tablets , phenoxymethylpenicillin potassium 250 mg tablets , phenytoin 25 mg / ml oral suspension ( 100ml bottle ) , polygeline 3.5% solution with electrolytes for i.v. infusion , potassium chloride 500 mg / 5ml oral solution ( 200 ml bottle ) , procaine penicillin with benzylpenicillin 3 + 1 lac units ( vial ) , prostaglandin e1 500mcg / ml injection , prostaglandin e2 0.5mg / 2.5ml injection , rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments , rabies vaccine human ( cell culture ) ( intradermal ) 2.5 iu ( 1 ml vial with 1.0 ml diluent ) , rabies vaccine human ( cell culture ) ( intramuscular ) 2.5 iu / dose ( single dose vial with 0.5 / 1.0 ml diluent and syringe with needle ) , recombinant coagulation factor viia 1mg , recombinant coagulation factor viia 2mg , recombinant f ix 500 iu with diluent , savlon / dettol soap ( 100 gm ) , savlon / dettol soap ( 75 gm ) , sevoflurane for inhalation 250ml , sevoflurane for inhalation 50ml , sodium valproate ( 200 mg / 5ml ) oral solution ( 100ml bottle ) , sodiumbicarbonate 1gm tablet , streptomycin1 gm injection with diluent , streptomycin 0.75 gm injection with diluent , sulfadoxine 500mg+ pyrimethamine 25 mg+artesunate 100 mg kit ( per kit ) tablet , surfactant for intratrecheal instillation ( natural bovine lung surfactant ) , swine flu vaccine injection , tetanus immunoglobulin 250 iu injection , tetanus vaccine ( adsorbed ) ip 5 ml vial , tocilizumab 20 mg / ml 10ml vial , tocilizumab 20 mg / ml 20ml vial , tocilizumab 20 mg / ml 4ml vial , tranexamic acid 500 mg tablet , travoprost eye drops ip 0.004 o / o 5ml , turpentine oil ( 100 ml ) , verapamil 40mg tablet , abacavir 60mg + lamivudine 30mg ( al pedia ) ( for art center ) , abacavir 600mg + lamivudine 300mg ( al adult ) , atazanavir 300mg + ritonavir 100mg ( atv / rtv ) , dolutegravir 50mg ( dtg ) , efavirenz 200mg ( efa ) , lopinavir 200mg + ritonavir 50mg ( lpv / rtv ) , syp nevirapine , syp zidovudine , tenofovir 300mg + lamivudine 300mg ( tl ) , tenofovir 300mg + lamivudine 300mg + dolutegravir 50mg ( tld ) , zidovudine 300mg + lamivudine 150mg ( zl ) , formula milk type i for above 2.5 kg baby ( 400gm pack size ) ( sncu ) , formula milk lbw / spacial care for below 2.5 kg baby ( 400 gm pack size ) ( sncu ) , abdominal hysterectomy kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] ( surgical item ) , adult id tag , ammonia liquid 5 ltr. pack , artery curved large , artery curved medium , artery curved short , artery straight large , artery straight medium , artery straight short , baby weight machine , bed screen , bed screen with folding , bp instrument bladder , bp instrument bulb , bp instrument cuff , bp instrument d clock type , bp instrument valve , bp instrument watch , bpl ecg roll 80mm*20meter , bugie , caesar bas kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , cdr morophin / allmedicus / caressers , cetrimide solution 20% , cetrimide solution light , chital forcep , conical flask glass 500 ml , disposable dead body cover , ecg blub , ecg leed , ecg paper 6108 bpl ecg machine single channel ( automatic ) , ecg paper roll ( medicat ) 20*105 mm , ecg roll 210mm*20meter , electric plastic cuttar , electrical plastic cutter , elisa plate reader with automatic washer , et stylate 3.3mm , et stylate 4.3mm , ett fixer , fast absorbing polyglactin 910 1 0 / 2 0, suture , general surgery kit [ polyglactin 910 coated with triclosan and rapid absorbable suture ] , graduated jar glass 1 ltr , hand sanitizer 5 ltr , hand sanitizer 500ml , instrument trolly , kidney tray , knife handle , laryngoscope adult , laryngoscope blade adult , laryngoscope blade pedia , laryngoscope blub , laryngoscope pedia , liq. halothane 200 ml , liq. halothane 450 ml , liq. halothane 50 ml , mattress cover with chain 2*6 feet , mattress cover with chain 3*6 feet , medicine trolly , micropore surgical with cutter adhesive 10 , mother feeding chair , multiparameter gulf / cuff , multiparameter valve , nasal packing , nebulizer machine , niv mask adult , niv mask pediatric , oxygen mask adult , paper adhesive tape 0.5 , paper adhesive tape 1.0 , paper adhesive tape 2.0 , paper adhesive tape 3.0 , paraffin gauze for dressing , patient trolly wheels / tyre , plastic swab box 500 gm , roll ( ptinr machine ) 110mm*20meter , spacer polistatic ( large ) , spacer polistatic ( medium ) , spacer polistatic ( small ) , spoung holder forcep , ss baby tray , ss dressing tray large , ss dressing tray medium , ss dressing tray small , ss drum large , ss drum medium , ss drum small , ss small bowl , steel wire for wiring 18 to 30 no , sterlizing solution for instrument 500 ml pack , stokinet 8cm , strature patient trolly , suction canula , suction machine , surgical scissor long , surgical scissor medium , suture cutting scissor , tailor scissor , tooth forcep , tryptan blue ofphail solution ( visiblue ) , under water drain seal sheet , urine collection bag pediatric , ventilator sensor , venturi mask adult , venturi mask pediatric , weight machine 150kg , wheel chair , autoclavable drums, size 8x8 inch ( dental ) , calsium hydroxide + idoform root canal paste ( meta biomed ) , calsium hydroxide + idoform root canal paste ( orikam ) , calsium hydroxide paste form ( prevest ) , calsium hydroxide paste form ( ammedent ) , carbide metal cutting burs long shank ( mani ) , carbide metal cutting burs long shank ( ss white ) , cement mixing spatula ( plastic ) , cement mixing spatula ( stainless steel ) , diomond round burs, br 43 ( mani ) , diomond round burs, br 43 ( ss white ) , flame shaped burs ( ss white ) , flame shaped burs ( mani ) , gic ( plastic ) filling instruments , glass ionomer cement ( restorative ) ( 3m ) , glass ionomer cement ( restorative ) ( gc fuji ) , gutta percha points ( 2% ) size 15 40 ( dent sply ) , gutta percha points ( 2% ) size 15 40 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( meta biomed ) , gutta percha points ( 2% ) size 45 80 ( dent sply ) , inverted cone burs ( ss white ) , inverted cone burs ( mani ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 15, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 20, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 25, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 30, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 35, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 40, length 21 & 25 mm ( mani ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( dent sply ) , k files ( 2% taper ) size 45 80, length 21 & 25 mm ( mani ) , nsk air rotors supra torque push button , nsk air rotors supra torque push button cartridge , nsk air rotors supra torque push button led , nsk air rotors supra torque push button led cartridge , pmt set ( probe mirror twizzer ) ( api ) , pmt set ( probe mirror twizzer ) ( gdc ) , root canal preparation gel ( edta ) ( ammedent ) , root canal preparation gel ( edta ) ( meta biomed ) , root canal sealants ( dent sply ) , root canal sealants ( kerr ) , rotary files protaper gold, size f1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size f1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size f2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size f3, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size f3, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( dent sply ) , rotary files protaper gold, size s1, length 21mm & 25mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( neoendo ) , rotary files protaper gold, size s2, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( dent sply ) , rotary files protaper gold, size sx, length 17mm & 19mm ( neoendo ) , rotary gutta percha points, size f1, f2, f3 ( meta biomed ) , rotary gutta percha points, size f1, f2, f3 ( diadent ) , scaller tips ( nsk ) , sodium hypocloride 3%, 500ml , sprit lamp , surgical instruments artery forcep ( api ) , surgical instruments artery forcep ( gdc ) , surgical instruments b.p. handle size 3 number ( api ) , surgical instruments b.p. handle size 3 number ( gdc ) , surgical instruments niddle holder ( api ) , surgical instruments niddle holder ( gdc ) , surgical instruments scissors ( api ) , surgical instruments scissors ( gdc ) , surgical instruments scissors suture cutting ( api ) , surgical instruments scissors suture cutting ( gdc ) , surgical instruments tooth forcep ( api ) , surgical instruments tooth forcep ( gdc ) , taper fissure burs ( ss white ) , taper fissure burs ( mani ) , temporary filling material ( ammedent ) , temporary filling material ( prevest ) , tooth extraction kit cryers ( api ) , tooth extraction kit cryers ( gdc ) , tooth extraction kit elevators ( api ) , tooth extraction kit elevators ( gdc ) , tooth extraction kit forceps ( api ) , tooth extraction kit forceps ( gdc ) , tooth extraction kit luxator ( gdc ) , tooth extraction kit luxator ( api ) , zinc oxide powder & eugenol liquied , anti a1 lectin , 10 ml pack , anti ab blood grouping sera, 10 ml pack , anti abd, 10 ml pack , anti d ( rh ) biclonal ( igg+igm ) blood grouping sera, 10 ml pack , anti d ( rh ) monoclonal blood grouping sera, 10 ml pack , anti h, 10 ml pack , banchtop blood bag tube sealer with battery backup , blood bag 100 ml cpda , blood bag 350 ml cpda ( single ) , blood bag 350 ml double cpda , blood bag 350 ml triple ( sagm ) , blood bag 350 ml triple ( without sagm ) cpda , blood bag 450ml ( sagm ) tripple bag , blood bag 450ml ( without sagm ) tripple bag cpda , blood component centrifuge machine , blood component weighing machine , blood donor couch , bovine albumin 22% 10 ml pack , calcium chewable tablets ( 30 tablets / per pack ) , coombs antisera, 10 ml / pack , copper sulphate of 1.053 specific gravity, 100gm / pack , copper sulphate solution of 1.053 specific gravity, 500ml / pack , cryofuse bucket 350 ml , cryofuse bucket 450 ml , double pan balance , elisa plate reader , elisa plate washer , elisa reader printer roll ( multiscan ) , elisa reader printer roll ( robonic ) , fistula canula 16 no. , fully automated blood collection monitor , fully automated elisa plate reader with washer , gel card centrifuge , gel card centrifuge machine , gel card for blood grouping ( forward & reverse typing ) ( biorad ) , gel card for cross match ( biorad ) , graph bbr round 2°c to 8° c , graph thermal round for 40°c refridgrator , graph thermal round for 80°c refridgrator , graph thermal round for platlets agitator , hb strips of hemocue ( per strip ) , hb strips of mission ( per strip ) , insulated box , liss solution 500ml pack , lyoplastin kit. , plasma expressor , platelet agitator cum incubator , portable tube sealer with battery backup , red circuler chart recorder pen ( 10 piece per pack ) , sdp acd solution 500 ml pack , sdp kit double needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp kit single needle with acd solution 500 ml with normal saline solution 1000 ml ( fresinius kabi ) , sdp ns solution 1000 ml pack , semi automated elisa plate reader & washer , squeeze ball for donors ( per piece ) , tscd cutting blade / wafers ( 10 / pack ) terumo penpol , calibration for biochemistry semi auto analyzer , chemiluminescence immunoassay analyzer , fully automated biochemistry analyzer , fully automated immunoassay analyzer , s. albumin kit ( semi auto analyzer ) ( 50 / 250 / 500ml ) , s. alkaline phosphate ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. amylase kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. bilirubin kit direct ( semi auto analyzer ) ( 100 / 200 / 1000ml ) , s. bilirubin kit total ( semi auto analyzer ) ( 50 / 100 / 200 / 1000 ml ) , s. blood sugar kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. blood urea kit end point ( semi auto analyzer ) ( 100 / 200 / 500 / 1000 ml ) , s. calcium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ck nac kit ( semi auto analyzer ) ( 10 ml / pack ) , s. ck mb kit ( semi auto analyzer ) ( 10 ml / pack ) , s. creatinine kit ( semi auto analyzer ) ( 100 / 200 / 1000 ml ) , s. hdl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. ldh kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. ldl ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. magnesium ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. potasium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. sgot kit ( semi auto analyzer ) ( 50 / 200 / 500 ml ) , s. sgpt kit ( semi auto analyzer ) ( ( 50 / 200 / 500 ml ) , s. sodium kit ( semi auto analyzer ) ( 50 / 100 / 200 ml ) , s. total cholsterol kit ( semi auto analyzer ) ( 5x20 ml / pack ) , s. total protein kit ( semi auto analyzer ) ( 50 / 100 / 250 / 500ml ) , s. triglyceride kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s. vldl kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , s.uric acid kit ( semi auto analyzer ) ( 25 / 50 / 100 ml ) , semi automated biochemistry analyzer , amies media 500 gm / pack , blood agar 500gm / pack , cary blair’s transport media 500 gm / pack , lowenstein jensen media. 500 gm / pack , peptone water , absolute ethanol 500ml pack , absorbent cotton wool 1x 5 / pack , acetic acid 100ml / pack , albert`s metachromatic stains kit , albert’s stain a 500ml pack , albert’s stain b 500ml pack , anaerobic gas pack 6set , anaerobic system mark ii , andrades ( indicator ) 125ml / pack , arabinose 10gm / pack , aslo quantitative test kit ( 50 test / kit ) , autoclave biological indicator 250 / pack , automated bacterial and yeast identification system , automated blood culture system , automated identification & susceptibility testing system , automated media preprator , automated viral load machine , bacl210% 500ml / pack , bacteroides bile esculin agar 500 gm / pack , bcitracin 1vial=50 discs , blood agar plate , blood culture bottle , cavity slide ( 10 per pack ) , cedarwood oil 125gm / pack , cetrimide agar 500 gm / pack , chemical indicator , chocolate agar 500 gm / pack , crp quantitative test kit ( 50 test / kit ) , cryo centrifuge , cryo precipitate plasma thawing bath , cryo water bath , cytological centrifuge , deoxycholate agar 500 gm / pack , disposable mask 100 / pack , dry incubator , durham tube 100 piece / box , elisa chickungunya kit ( 48 test ) ( dghs approved ) , elisa chickungunya kit ( 96 test ) ( dghs approved ) , elisa dengue igg ( 48 test / kit ) ( dghs approved ) , elisa dengue igg ( 96 test / kit ) ( dghs approved ) , elisa dengue igm ( 48 test / kit ) ( dghs approved ) , elisa dengue igm ( 96 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 48 test / kit ) ( dghs approved ) , elisa dengue ns 1 ( 96 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 48 test / kit ) ( dghs approved ) , elisa dengue ns1, igg, igm ( 96 test / kit ) ( dghs approved ) , elisa hbsag 48 tests kit ( dghs approved ) 3rd generation , elisa hbsag 48 tests kit ( dghs approved ) 4th generation , elisa hbsag 96 tests kit ( dghs approved ) 3rd generation , elisa hbsag 96 tests kit ( dghs approved ) 4th generation , elisa hcv 48 tests kit ( dghs approved ) 3rd generation , elisa hcv 48 tests kit ( dghs approved ) 4th generation , elisa hcv 96 tests kit ( dghs approved ) 3rd generation , elisa hcv 96 tests kit ( dghs approved ) 4th generation , elisa hiv 48 test / kit ( dghs approved ) 3rd generation , elisa hiv 48 test / kit ( dghs approved ) 4th generation , elisa hiv 96 test / kit ( dghs approved ) 3rd generation , elisa hiv 96 test / kit ( dghs approved ) 4th generation , elisa igm for hepatitis a ( 48 test ) , elisa igm for hepatitis a ( 96 test ) , elisa igm for hepatitis e ( 48 test ) , elisa igm for hepatitis e ( 96 test ) , elisa igm for leptospirosis ( 48 test ) , elisa igm for leptospirosis ( 96 test ) , elisa igm for measles ( 48 test ) , elisa igm for measles ( 96 test ) , elisa scrub typhus kit ( 48 tests ) ( dghs approved ) , elisa scrub typhus kit ( 96 tests ) ( dghs approved ) , falcon tube 20ml ( 1x100 pack ) , falcon tube 50ml ( 1x100 pack ) , ferric chloride 1kg pack , fully automated cd4 count analyzer , gluteraldehyde 100ml / pack , gram stain kit ( gram’s crystal violet 500ml, gram’s decolourizer 1000ml, gram’s iodine 500 ml, safranin 0.5% w / v ) , handrub ( alcohol hand rub with moisturizer ) 500ml / pack , hbv viral load kit •kits should be able to detect and quantify ( quant ) hbv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hcv viral load kit •kits should be able to detect and quantify ( quant ) hcv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standard.kit should be ivd marked for use of in vitro diagnostic test. kit should be fully validated on cfx 96 realtime pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , hi chrome uti 500gm , hiv diagnostic rt pcr kit•kits should be able to detect and quantify ( quant ) hiv rna. •ready to use kit, one step rt pcr kit, including internal control and quantification standards ( minimum 4 standards ) . •kit should be ivd marked for use of in vitro diagnostic test. •kit should be fully validated on cfx 96 real time pcr. •kit should be supplied with its validated sample prep ( spin column ) .minimum 4 standards for quant assays which should be validated with who standards. internal control ( should be used either during extraction or amplification ) . •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. •preferred make thermo / gbiosciences / altona , hot air oven , hot plate , hsv viral qualitative rt pcr kit •kits should be able to detect and quantify ( quant ) hsv dna. •ready to use kit, including internal control and quantification standards •kit should be ivd marked for use of in vitro diagnostic test. •kit should be validated on cfx 96. kit should be supplied with its validated sample prep ( column extraction only ) . •minimum 4 standards for quant assays which should be validated with who standards.internal control ( should be used either during extraction or amplification. •kit should come with pcr grade water. •kit should be supplied with master a and master b to carry easy to use reaction set up. / •preferred make thermo / gbiosciences / altona , iodine 10gm / pack , koh 500gm pack , kovacs’ indole reagent 100ml / pack , loeffler’s medium 500 gm / pack , lpcb stain 1 kit , mac cartney bottle 100ml ( for blood culture ) / pack , mac conkey agar plate , mannitol 25 gm / pack , mannitol salt agar 500 gm / pack , mannitol salt agar 500 gm / pack , mcfarland standard set ( each set contains 1 tube of 0.5, 1, 2, 3, 4 mcfarland standard ) , metal loops holder ( ( w / o loop ) brass rod holder with heat resistant handle where any size of nichrome wire can be inserted ) 1 x 8 / pack , methyl red 125ml / pack , micro centrifuge machine , mueller hinton agar 500 gm / pack , nichrome loop d 4 ( diameter : 4 mm, double wound, calibrated to 0.01ml. ) 10x10 / pack , nutrient agar 500 gm / pack , oxidase discs 1vial=50 discs , parafilmd m250* thermoplastic, colourless & semi transparent film, used as all purpose laboratory self sealing film which is flexible, mouldable and a barrier to moisture loss, roll size : 2” x 250’ on 1” dia. core , ph electrode , ph paper ( range 2 to 10.5 ) 200 / pack , phenol red indicator 125ml / pack , potassium hydroxide 500gm / pack , ppa broth and ppa reagent 500gm / pack , pyr broth500gm / pack , pyr reagent 500gm / pack , r.f. quantitative test kit ( 50 tests / kit ) , raffinose 10gm / pack , rapid ag test for backterial meningitis ( menigococci ) ( 10 / pack ) , rapid h&e stain kit 250 smear / kit , rapid test aslo qualitative test kit ( 35 test / kit ) , rapid test chickungunya card , rapid test covid 19 antigen card , rapid test crp qualitative test kit ( 35 test / kit ) , rapid test dengu antigen card , rapid test dengue card lgg, lgm , rapid test dengue card ns1, igg, igm , rapid test for sickle cell anatomia ( 10 tests / pack ) , rapid test hbsag card , rapid test hcv card , rapid test hcv tridot card , rapid test hiv comb test 100 card / pack , rapid test hiv comb test 100 card / pack , rapid test hiv rapid card , rapid test hiv rapid card 4th generation , rapid test hiv tri dot card , rapid test kala azar 2k39 ( 10 tests / pack ) , rapid test malaria card test antigen ( pv / pf ) , rapid test r.f. qualitative test kit ( 35 tests / kit ) , rapid test scrub typhus card , rapid test toxoplasma card rapid digmostic kit ( 100 test / kit ) , rapid test troponin i rapid test card ( 100 test / kit ) , rapid test troponin t rapid test card ( 100 test / kit ) , rapid test vdrl card test , rapid test vdrl strip , rapid test vdrl / rpr kit ( 1x100 tests ) , rapid test widal card igg / igm , rapid test widal test kit ( slide ) 2x25test , rapid test widal test kit ( slide ) 4x5ml , rapid test widal test kit ( tube ) 4x5ml , rcm broth 100gm / pack , safranin 0.5% w / v 500ml / pack , salmonella shigella agar 500gm / pack , sda agar 500gm / pack , selenite f broth 500gm / pack , semi automated cd4 count analyzer , sodium chloride 500gm / pack , sodium hydroxide 500gm / pack , sodium hypochlorite ( 4% w / v solution ) 5 litre / pack , sorbitol 500gm / pack , sterile cotton swab w / wooden stick mounted in blue capped polypropylene tube, size : 150 mm, packed in 12 mm diameter tube, individually packed100 / pack , sterile cotton swab w / wooden stick, size : 150 mm x 2.5 mm, individuallypacked. ( gamma irradiated ) 500 / pack , sterile disposable petri plates polystyrene, size 120x15 mm 100 / pack , stock vial 5ml 50 / pack , sucrose500gm / pack , sulphanilic acid 100ml / pack , tcbs agar 500gm / pack , thioglycolate broth 500gm / pack , thumb press dispensing dropper / pasteur volume upto 3 ml. 500 / pack , tinsdale agar for diphtheria500gm , tissue roll 6 / pack , toothpick 100 / pack , universal container , vdrl rotator shaker , vdrl strip , vibro tcbs agar 500gm , vtm kit , z.n. stain for afb ( 2x100 ml pack ) , zinc dust 500gm / pack , ? napthol 100gm / pack , ? napthylamine 25gm / pack , amikacin 30 ?g , amoxicillin + clavulanic acid 20 +10 ?g , amoxicillin 25 ?g , ampicillin + sulbactam 10 +10 ?g , ampicillin 10 ?g , ampicillin 2 ?g , azithromycin 15?g , aztreonam 30 ?g , bacitracin 130 ?g / 10 ui , carbenicillin 100 ?g , cefaclor 30 ?g , cefalexin 30 ?g , cefamandole 30 ?g , cefazolin 30 ?g , cefepime 30 ?g , cefixime sµg 10 ?g , cefoperazone + sulbactam 75 +30 ?g , cefoperazone 30 ?g , cefoperazone 75 ?g , cefotaxime 30 ?g , cefotaxime 5 ?g , cefotetan 30 ?g , cefoxitin 30 ?g , cefpirome 30 ?g , cefpodoxime 10 ?g , cefprozil 30 ?g , cefsulodin 30 ?g , ceftazidime 10 ?g , ceftazidime 30 ?g , ceftibuten 30 ?g , ceftriaxone 30 ?g , cefuroxime 30 ?g , cephalotin 30 ?g , chloramphenicol 30 ?g , ciprofloxacin 5 ?g , clarithromycin 15 ?g , clindamycin 2 ?g , colistin 10 ?g , colistin 50 ?g , doripenem 10 ?g , doxycycline 30 ?g , ertapenem 10 ?g , erythromycine 15 ?g , flumequine 30 ?g , fosfomycin 200?g , fosfomycin 50 ?g , fusidic acid 10 ?g , gentamicin ( high load ) 120 ?g , gentamicin ( high load ) 500 ?g , gentamicin 10 ?g , gentamicin 15 ?g / 10 ui , gentamicin 30 ?g , imipenem 10 ?g , isepamicin 30 ?g , kanamycin ( high load ) 1mg , kanamycin 30 ?g , levofloxacin 5 ?g , lincomycin 15 ?g , linezolid 10 ?g , linezolid 30 ?g , mecillinam 10 ?g , meropenem 10 ?g , metronidazole 4 ?g , mezlocillin 75 ?g , minocycline 30 ?g , moxalactam 30 ?g , moxifloxacin 5 ?g , mupirocin 5 ?g , nalidixic acid 30 ?g , neomycin 30 ui , netilmicin 10 ?g , netilmicin 30 ?g , nitrofurantoin 100 ?g , nitrofurantoin 300 ?g , nitroxolin 20 ?g , norfloxacin 10 ?g , norfloxacin 5 ?g , ofloxacin 5 ?g , oxacillin 1 ?g , oxacillin 5 ?g , oxolinic acid 10 ?g , pefloxacin 5 ?g , penicillin 1 iu , penicillin 6 ?g / 10 iu , pipemidic acid 20 ?g , piperacillin + tazobactam 100 + 10 ?g , piperacillin + tazobactam 30 + 6 ?g , piperacillin + tazobactam 75 + 10 ?g , piperacillin 100 ?g , piperacillin 30 ?g , piperacillin 75 ?g , polymixin 50 ?g / 300 ui , pristinamycin 15 ?g , quinupristin dalfopristin 15 ?g , rifampicin 30 ?g , rifampicin 5 ?g , sparfloxacin 5 ?g , spectinomycin 100 ?g , spiramycin 100 ?g , streptomycin ( high load ) 300 ?g , streptomycin ( high load ) 500 ?g , streptomycin 10 ?g , sulfonamides 200 ?g , sulfonamides 300 ?g , teicoplanin 30 ?g , telithromycin 15 ?g , tetracycline 30 ?g , ticarcillin + clavulanic acid 75 + 10 ?g , ticarcillin 75 ?g , tigecycline 15 ?g , tobramycin 10 ?g , tobramycin 30 ?g , trimethoprim + sulfamethoxazole 1.25 + 23.75 ?g , trimethoprim 5 ?g , vancomycin5 ?g , vancomycin 30 ?g , 100x lens for binocular microscope , 10x lens for binocular microscope , 3.8% sodium citrate solution for esr, 500ml pack , 40x lens for binocular microscope , automated blood gas analyzer , automated electrophoresis machine , automated hplc ( high performance liquid chromatography ) machine , automated semen analyzer , automated tissue processor , benedicts reagent 500 ml pack , blood cell counter 8 key + 1 totaliser , blood mixer , bone marrow aspiration needle ( 16gx50mm ) autoclavable, stainless steel , bone marrow biopsy needle ( jamshidi ) , bt / ct capillary tube, 100 / pack , carbol fuchsin ( powder ) 100gm pack , carbol fuchsin ( strong ) 500ml pack , centrifuge machine ( 08 tubes ) , centrifuge machine ( 16 tubes ) , centrifuge machine ( 24 tubes ) , centrifuge machine ( 36 tubes ) , colorimeter cuvette glass , colorimeter digital 8 filter , conical flask glass 250ml , conical flask glass 500ml , container ( plastic ) , 1 liter , coplins jar ( vertical ) plastic with cap , cotton roll 500 gm. , cotton swab ( 50 piece pack ) , cover slip 18x18 mm ( 50 / pack ) , cover slip 18x36 mm ( 50 / pack ) , cover slip 22x22 mm ( 50 / pack ) , cover slip 22x50 mm ( 50 / pack ) , crystal violet stain 100 gm pack , csf diluting fluid 100 ml pack , diamond marker for glass marking , diamond pencil for glass marking , digital hemoglobinometer , dpx mount for sickling ( 30 ml / pack ) , drabkins solution 500 ml pack , dropper plastic 1 ml, ( 100 / pack ) , dropper plastic 2 ml, ( 100 / pack ) , dropper plastic 3 ml, ( 100 / pack ) , dropper plastic 5 ml, ( 100 / pack ) , dry bath incubator 12 tube , ecg bulb for esr ( 1x10 / pack ) , edta powder 100gm pack , electonic analytical balance for laboratory, capacity 200gm , electrophoresis machine / hplc machine , eosin 2% ( 125ml / pack ) , eosinophil diluting fluid ( 100 ml pack ) , esbachs albuminometer , esbachs reagent ( 125ml pack ) , esr fluid ( 500ml pack ) , esr pipette , esr stand ( westergreen iron 6 key ) , esr stand ( westergreen plastic 6 key ) , esr tube ( 0 200 ) westergreen glass, 2ml , esr tube ( disposable ) , esr tube with cap , esr tube with cap reusable , esr vial ( 3.8% sodium citrate solution ) 100 / pack , ethanol ( 95% ) ( 500ml pack ) , field stain a ( 500ml pack ) , field stain b ( 500ml pack ) , filter paper ( round ) 125 mm ( 1x50 pack ) , fouchet reagent ( 100ml / pack ) , fouchet reagent ( 125ml / pack ) , fully atutomated coagulation analyzer , fully automated cbc + esr analyzer , fully automated cbc analyzer ( 3 part ) , fully automated cbc analyzer ( 5 part ) , fully automated cbc analyzer ( 6 part ) , fully automated elecrolyte analyzer , fully automated esr analyzer , fully automated urine analyzer , funnel ( conical ) keep plastic transparent , g 6 pd dificiency quantitative test kits ( 12 tests / kit ) , giemsa stain solution 500ml pack , glacial acetic acid 10 % solution, 500ml pack , glass slide box ( 75x25x1.35 mm ) ( 50 / pack ) , glass stirring rod , glass test tube ( 12x100 mm ) , glass test tube ( 12x75 mm ) , glass test tube ( 15x100mm ) , glass test tube ( 15x150mm ) , glucometer , glucometer strips, 100 strips per pack , haem test for ocult blood in stool, 200 test / kit , hb estimation kit ( drabkin solution with standard solution by colorimter method, hemoglobinometer ) , hb meter ( top square ) , hb pipette top square , hb tube round , hb tube square , hbac analyzer , hcl ( 3% ) 100ml pack , hcl concentrated ( 100ml / pack ) , hcl n / 10 500ml / pack , hydrometer ( for specific gravity ) , immersion oil for microscopy 250 ml / pack , j.s.b stain 1, j.s.b. stain 2 for malaria parasite, 500ml / pack , k2 edta vial 5 ml ( 100 / pack ) with blue cap , k3 edta vial 5 ml ( 100 / pack ) with blue cap , lancet ( 100 / pack ) , lbc machine ( liquid based cytology , leishman powder 25gm pack , leishman stain 500ml pack , mantux 10tu 10ml pack , mantux 5tu 10ml pack , methylene blue ( 0.3%, w / v, aqueous ) 25gm pack , methylene blue 100ml pack , micro albumin strip for urine ( 100 / pack ) , micro protien reagent ( csf ) 25ml pack , microscope binocular with led illumination with battery backup , microscope bulb ( low voltage halogen lamp & led ) , microscope lens cleaner 100 ml pack , neubaurer counting chamber with improved silver line , new methylene blue for recticulocute count ( 50gm / pack ) , oil immersin for binoculer microscope ( 30ml / pack ) , pap stain kit ( 1x250 test ) , pasteur pipette ( dropper ) , pcv tube ( wintrobe tube ) , ph / litmus paper ( acidic & basic ) ( 20 piece / pack ) , ph meter machine , ph paper packet ( 20 piece / pack ) , phenol ( 5%w / v, aqueous ) 500 gm / pack , pistol handle ( for fnac ) , plain test tube 5 ml plastic with red cap ( 100 / pack ) , plain test tube 5 ml plastic with red cap with clot activator ( 100 / pack ) , plain test tube 5 ml plastic without cap ( 100 / pack ) , plastic slide storage box for 50 slides , plastic test tube 3 inch ( 100 / pack ) , plastic tray for lab , platelet diluting fluid 100ml / pack , potassium iodide 50 gm pack , powder sulphur ( 500gm / pack ) , ppd syringe 100 / pack , pt vial ( 100 / pack ) , r.b.c pipette , rbc diluting fluid ( 100 ml / pack ) , rotary microtome , screening and detection of occult blood in stool card ( 50 test / kit ) , semen diluting fluid 100ml pack , semen / sputum / urine / stool container plastic30 ml , semi atutomated coagulation analyzer , semi automated cbc + esr analyzer , semi automated cbc analyzer , semi automated elecrolyte analyzer , semi automated esr analyzer , semi automated urine analyzer , sodium hypochloride 10%, 5 liter / pack , sodium hypochloride 5%, 5 liter / pack , sodium nitropruside crystal 50gm pack , spatula with brush , spirit lamp , sprit rectified clinical / surgical sprit ( 500ml / pack ) , staining jar trough glass for 10 slides each , strong carbol fuchsin 500ml pack , sudan black stain solution ( 500ml / pack ) , sulphuric acid ( 20 25% ) , v / v in water 500 ml pack , syringe holder for 20ml syringe , table top centrifuge 16 , thermal printer roll for 3 part cbc horiba ( 57mm x 10 meter ) , thermal printer roll for 3 part cbc vector ( 50mm x 20 meter ) , thermal printer roll for sd 120 urine analyzer ( 55mm x 20 meter ) , thermal printer roll for stago coagulation analyzer ( 110mm x 25 meter ) , total eosinophil count fluid 125 ml / pack , trichrome stain solution , urine ketone strips ( 100 strips / pack ) , urine pregnancy card , urine pregnancy strips , urine strips 11 parameter with creatinine & albumin blood, ascorbic acid, creatinin, microalbumin, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips multipleparameter for sd urometer 120 ( 100 strips / pack ) , urine strips with 10 parameter blood, bilirubin, urobilinogen, ketons, nitrite, leucocytes, glucose, protein, ph & sg ( 100 strips / pack ) , urine strips with 2 parameter glucose & protein ( 100 strips / pack ) , urine strips with 3 parameter glucose, protein & ketons ( 100 strips / pack ) , urine strips with 4 parameter glucose, protein, ph & sg ( 100 strips / pack ) , urinometer , uristicks ( albumin sugar ) ( 100 / pack ) , vaccutainer 10 ml , vaccutainer 5 ml with blue cap , vaccutainer 5 ml with green cap , vaccutainer 5 ml with red cap , vaccutainer 5 ml withyellow cap , vaccutainer needle , vacutainer pack , vector probe cleaner ( 100 ml / pack ) , w.b.c diluting fluid 500ml pack , w.b.c pipette , wooden slide storage box for 50 slides , xylene ( sulphur free ) ar 2.5 liter pack , zip lock plastic bag small ( 100 piece / pack ) , absolute alcohol 99.5%, 500ml pack , acetone ar 500 ml pack , ammonium oxalate 100 gm pack , ammonium solution ( 25% ) , 500ml pack , autoclave horizontal , autoclave vertical double dome , autoclave vertical single dome , b.p. instrument digital , b.p. instrument mercury , band aid adhesive strip , barium chloride 500gm pack , beaker glass 1000 ml , beaker glass 250 ml , beaker glass 500 ml , bouins liquid 1 liter pack , buffer solution 500ml pack , buffer tablets, ph 4.0 8.0, 10 tablets / pack , buffer tablets, ph 6.8 7.0, 10 tablets / pack , butterfly needle ( 100 / pack ) , di ethyl ether 500ml pack , disposable glove size 6 , disposable glove size 6.5 , disposable glove size 7 , disposable glove size 7.5 , disposable needle no. 22 , disposable needle no. 23 , disposable needle no. 24 , disposable syringe 10 ml , disposable syringe 2 ml , disposable syringe 20 ml , disposable syringe 5 ml , distilled water 10 ml pack , distilled water 5 ltr. pack , distilled water 5 ml pack , dressing drum , dressing drum stainless steal , glass dropper 100 ml , glass pipette with bulb 1ml , glass pipette with bulb 5ml , glutaraldehyde ( 5 liter / pack ) , h2so4 20% ( 100ml / pack ) , h2so4 25% ( 100ml / pack ) , h2so4 5% ( 100ml / pack ) , hand wash liquid soap ( 100ml / pack ) , icebox ( 2liter capacity ) , iodine 100 gm pack , lens paper kit ( 50 sheets pack ) , liquid ammonia 500 ml pack , liquid soap ( 1liter / pack ) , lugols iodine 100 ml pack , measuring cylinder 0 to 1000ml graduated glass , measuring cylinder 0 to 100ml graduated glass , measuring test tube glass 0 10 ml graduated conical , methanol 500 ml pack , micro tips blue ( 1000 / pack ) , micro tips stand plastic ( large ) , micro tips stand plastic ( small ) , micro tips white ( 1000 / pack ) , micro tips yellow ( 1000 / pack ) , micropipette 0 10 ul capacity , micropipette 100 1000 ul capacity , micropipette 100ul fix volume , micropipette 10 100 ul capicity , micropipette 50ul fix volume , micropipette 5 50 ul capacity , multi calibrator for biochemistry analyser , multi channel pipette ( 8 key ) 0 10 ul , multi channel pipette ( 8 key ) 100 1000 ul , multi channel pipette ( 8 key ) 10 100 ul , n 95 mask with ear loop , naoh concentrated ( 250ml / pack ) , normal saline solution ( 0.9% ) ( 500ml / pack ) , normal saline technical ( 5 liter / pack ) , pipette stand plastic for 5 pipette , refrigerator blood bank 300 bag capacity , refrigerator deep fridge 40°c , refrigerator deep fridge 80°c , refrigerator kit storage ( 350 liter capacity ) , refrigerator lab300 liter , slide stain rack ( 20 slidess ) , slide stain stand ( 20 slide ss ) , slide stain tray ( 20 slide ss ) , stethoscope , sticker ( 50 / pack ) , stop watch racer ( plastic ) , test tube holder , test tube stand 24 hole plastic with numbering , test tube stand 48 hole plastic with numbering , test tube stand 96 hole plastic with numbering , test tube stand stainless steel ( 12x75 mm ) , test tube stand stainless steel ( 15x100 mm ) , test tube stand stainless steel ( 15x150 mm ) , test tube washing brush each , thermocal box ( 5liter capacity ) , tincher iodine ( 5liter / pack ) , tissue paper ( 50 / pack ) , torniquet heavy , tube holder for 10 ml tubes , tube holder for 20 ml tubes , tube holder for 5ml tubes , vertical autoclave large size , weighin machine 500 gm ( manual type ) , weighing machine 100 kg. electronic , weighing machine 100 kg. manual , weighing scale 1 kg manual , weight machine 150kg electronic , weight machine 150kg manual...

Medical Health And Family Welfare - Rajasthan

33724703 supply of mnjy_labrejants_pmosuj mnjy_labrejants_pmosuj , blood sugar kit , blood sugar kit , blood sugar kit , blood urea kit , blood urea , blood urea kit kinetic , urea end point , s. creatnine r1 2*60 ml , r2 2*60 ml , s. creatnine r1 2*50 ml , s. creatnine , s. bilirubine (t) , s. bilirubin d & t , s. bilirubine (t) , s. bilirubine t&d r1 2*60 ml ,r2 2*60 ml , s. bilirubine t&d , sgot , sgot , sgot , sgpt , sgpt , sgpt , s. alk. phosphate , s. alk. phosphate , s. alk. phosphate , total protein , total protein , total protein , s. albunum , s. albunum , s.albumin , s. calcium r1 1*50 ml, r2 1*50 ml , s. calcium , s.calcium , s. ck nac r1 2*8 ml, r2 2*2 ml , s. ck nac , ck mb , ck mb , s.ldh r1 4*8 ml, r2 1*8 ml , s. ldh , s.amylase , s. amylase , s.amylase , s. uric acid , s. uric acid , s. uricacid , s.uric acid , s. t. cholesterol , s.t. cholesterol , s.t. cholesterol , s. trigly ceride , s. trigly ceride , s. trigly ceride , s.hdl , dirrecthdl , s.hdl direct , s.hdl , ldl cholestrol , ldl cholestrol , csf dilution fluid , plueural dilution fluid , acetic dilution fluid , semen dilution fluid , urine strip for alb & sugar(uristix) , urine strip for sugar & ketone(ketodiastic) , multistrip10 para for accurex urine analyser ( express 10) , urine strip 4 para (alb,sugar,ph,sp. gravity) , pregnancy test card , sulphur powder , edta powder , nitric acid , glacial acetic acid , eosino dilution fluid , ligeul iodine for stool exam , anti abd set , anti d (igg & igm) , total rbc dilution fluid , field stain i , field stain ii , platelest dilution fluid , fouchest reagent , liesman stain , tissue paper roll , filter paper 0 no. , mp card(antigen) , dengue card antigen (day 1) ns1 iggigm , vdrl strip , jsb i stain , jsb ii stain , liquid parafine oil , crp kit , ra kit , aslo kit , widal , bovine album 22% , hiv tridols , esr tube glass , hb meter squer , hb meter round , hb tube round , hb pipate , distilled water , n/10 hcl , glass slide , riya vial , urine container with label (non sterilized 30 ml) , tips stand for yellowtips , tips stand blue tips , iron esr stand 6 tube capicity , throm bo span ls , test tube glass , test tube glass , measuring pipalte glasss 1ml , measuring pipalte glasss 2ml , measuring pipalte glasss 5ml , measuring pipalte glasss 10 ml , hbsag card , sodium citrate vial for pt test , mearing flask 250 ml , mearing flask 500 ml , mearing flasic 1 lit , glass funnel , glass beaker 50ml , glass beaker 100ml , tlc dilution fluid , 3.1% sodium citrat , for ceff steel , combs sera , cbc vial mixer , hb tube squar , syringe needle distoryed maschine , thermal paper 50mm*20 mtr , thermal paper 110mm*20 mtr , alluminiumtest tube stand 4*8 holl , new bar chamber , urine container with label(sterilized) 50 ml , cover glass , cover slip , bt ct capiliry tube , esrite esr stand , droper bottle plastic 60ml , wash bottle plastic 250ml , washbottel plastic 500 ml , blue tips , yello tips , slide box plastic (big size) , slide box plastic (smallsize) , kidney tray plastic , alluminumtest tube stand 3*8 holl , alluminum tast tube stand 3*4 holl , blood sugarstrip for glucometer , biochemistry reagent for rendox fully auto analyser , blood uria kit birthload method , gram stain , giemsa stain with fixative , sodium hypocloride solution 5% , hiv sd card , micro pipet veriable , micro pipet veriable , micro pipet veriable , stop watch , tunicate belt , disposable esr tube ( 1 to 200 mm.) , disposable serum vial , lense cleaning paper , dengu kit for alisa mathed ns1 , dengu kit for alisa mathed igg , dengu kit for alisa mathed igm , anti ab vial , centrifuse machine [ r 8cdx] , centrifuse machine , rotator machine , j.s.b. firststain , j.s.b.second stain , sterile disposable needle no 22 , sterile disposable needle no 23 , sterile disposable needle no 24 , sterile disposable needle no 26 , dispovan 5ml syringe , edta k3 non vccum blood collection tube 1 to 4 ml withtray paking , clot activator non vccum blood collection tube 1 to 4 mlwithtray paking , floride non vccum blood collection tube 1 to 4 ml withtray paking , citrate 3.2 % non vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % non vccum blood collection tube 1 to 4 mlwithtray paking , lithium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin non vccum blood collection tube 1 to 4 mlwithtray paking , gel non vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 1 to 4 mlwithtray paking , edta k3 vccum blood collection tube 5 to 6 mlwithtray paking , clot activator vccum blood collection tube 1 to 4 mlwithtray paking , clot activator vccum blood collection tube 5 to 6 mlwithtray paking , floride vccum blood collection tube 1 to 4 mlwithtray paking , floride vccum blood collection tube 5 to 6 mlwithtray paking , citrate 3.2 % vccum blood collection tube 1 to 4 mlwithtray paking , citrate 3.8 % vccum blood collection tube 1 to 4 ml , gel vccum blood collection tube 1 to 4 mlwithtray paking , gel vccum blood collection tube 5 to 6 ml , lithium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , sodium heptarin vccum blood collection tube 1 to 4 mlwithtray paking , needle for vaccume tube , iron ball for prothombin test , cuvet for prothrombine test , dengue ns 1 elisa test , dengue igg elisa test , dengue igm elisa test , hbsag elisa test , hb test strip for hemocue hb 301 , cleaning solution , de ionised water , stool container , typhi dot rapid test , t3 for elisa reader , t4 for elisa reader , tsh for elisa reader , wash solution for elisa reader , typhoid test repid test kit , haem test for occult blood kit for stool , lancet for glucometer , methanol for fixative , slide fixative spray , sonographyroll , sonography jelly , ecg roll for single channel bpl(6108 t) , ecg roll for six channel allengers , ecg roll for twelve channel cp 200 welch allyn , ecg jelly , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray filmdigital(kodak carestream) , x ray film blue base (conventional) , x ray film blue base (conventional) , x ray film blue base (conventional) , esr tube stand , x ray dental film...

Medical And Health Services - Rajasthan

33713870 supply of laboratory reagents, x ray, ecg, sonography material supply blood sugar kit ,blood urea kit,blood urea, blood urea kit kinetic,7 urea end point,s. creatnine r1 2*60 ml , r2 2*60 ml,s. creatnine,s. bilirubine,s. alk. phosphate,total protein,s.albumin, s.amylase,s. uric acid,s.t. cholesterol,plueural dilution fluid, urin strip, urin strip, pregnancy test card, edta powder, sulphur powder, nitric acid, glacial acetic acid, eosino dilution fluid, ligeul iodine, anti abd set, tissue paper roll, dengue card antigen, vdrl strip, widal, riya vial, measuring pipalte glass, hbsag card, glass beaker, glas funnel, thermal paper, sterile disposable needle, dispovan syringe, sodium heptarin non vaccum blood collection tube, clot activator vcum blood collection tube, needle, iron ball, cuvet, dengue ns , dengue igm elisa, de ionised water, stool container, typhi dot rapid test, haem test, x ray film digital, x ray film blue base, x ray dental film. etc ...

Rajasthan Medical Services Corporation Limited - Rajasthan

33692946 surgical e bid for rate contract cum supply and empanelment of surgicals ( drug items ) , nonabsorbable polypropylene light weight macroporous mesh , three dimensional monofilament polyester marking size 15 cm circular , three dimensional monofilament polyester marking size 12 cm circular , three dimensional monofilament polyester marking size 20x15 cm circular , absorbable 5 mm hernia mesh fixation device 30 screw shaped , absorbable 5 mm hernia mesh fixation device 15 screw shaped , non absorbable 5 mm hernia mesh fixation device , nonabsorbable helical fastener 5mm with 15 fasteners , nonabsorbable helical fastener 5mm with 30 fasteners , light weight monofilament polypropylene mesh size large left10.8*16cm / 15*10 cm , light weight monofilament polypropylene mesh size large right 10.8*16cm / 15*10 cm , light weight monofilament polypropylene mesh size extra large left12.4cm * 17.3 / 16*12 cm , light weight monofilament polypropylene mesh size extra large right 12.4cm * 17.3 / 16*12 cm , battery operated 60mm articulatingendo cutter with a disposable battery pack , linear cutter 55mm with six rows , linear cutter 75mm with six rows , universal linear cutter cartridge 75mm , universal linear cutter cartridge 55mm , curved cutter stapler 40 mm linear cutter , curved green cartridge having close staple height of 2.0 mm , powered circular stapler 29 mm , powered circular stapler 31mm , circular stapler 33mm , laparoscopic cartridge for stapler 60 mm blue, 1.5 mm , laparoscopic cartridge for stapler 60 mm green, 2.0 mm , hemorrhoidal stapler kit consists of 33mm , optically guided bladeless trocar 12mmlength 150mm , optically guided bladeless trocar 12mmlength 100mm , facial closure device contain , varied staple height reloads / cartridges for 60 mm gia instruments , varied staple height reloads / cartridges for 80 mm gia , linear cutter with varied staple height tri staple gia 60 mm , eea circular stapler purple colour medium thick , linear cutter with varied staple height tri staple gia 80 mm , wound protector small 2.5 6 cm usfda approved , wound protector medium 5 9 cm , wound protectorlarge in size 9 14 cm usfda approved , endo catch specimen removal kit: with 34.5 cm shaft length , disposable laparoscopic clip applier with 16 clips, 5mm diameter , laparoscopic liner cutter with cartridges in sizes of 30mm , laparoscopic liner cutter with cartridges in sizes of 45mm , laparoscopic liner cutterwith cartridges in sizes of 60mm , hand activated curved taper tip coagulating shears compatible focus 9 , hand activated curved taper tip coagulating shears compatible focus 17 , advance bipolar hand activated probe with 5mm shaft diameter and 35 cm shaft length with 5 mm wide , advance bipolar hand activated probe with 5mm shaft diameter and 45 cm shaft length with 5 mm wide , advance bipolar hand activated probe for open surgery with 13mm shaft diameter and 20 cm shaft length , laparoscopic shears 5mm diameter, 36cm long, 15mm curved coated blade , advanced bipolar tissue sealer 25 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , advanced bipolar tissue sealer 37 cms, with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , advanced bipolar tissue sealer 45 cms with 5mm shaft diameter, 24 mm jaw length, 21.8 mm cut length and 13.4 mm , laparoscopic shears 5mm diameter, 36cm long, 18mm curved coated blade , connecting cable for ultrasonic harmonic scalpel for open energy with focus plus shear hp blue , connecting cable for ultrasonic harmonic scalpel for lap energy withace plus shear hp054 , laparoscopic shears 5mm diameter, 45cm long, 15mm curved coated blade , nasal haemostatic sponge pack ( with airway ) 10inch , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness ( 2*2 ) hole , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness ( 1*2 ) hole , platting for maxillary swing and mandibular fixation surgeries plates 2 mm thickness ( 1*1 ) hole , platting for maxillary swing and mandibular fixation surgeries screw ( 2 mm ) , platting for maxillary swing and mandibular fixation surgeries screw ( 1.5 mm ) , platting for maxillary swing and mandibular fixation surgeries screw ( 2.5 mm ) , platting for maxillary swing and mandibular fixation surgeries screw ( 3 mm ) , speech prosthesis for laryngectomy 17fr ( 4 mm ) , speech prosthesis for laryngectomy 17fr ( 6 mm ) , speech prosthesis for laryngectomy 17fr ( 8 mm ) , speech prosthesis for laryngectomy 17fr ( 10 mm ) , speech prosthesis for laryngectomy 17fr ( 12.5 mm ) , speech prosthesis for laryngectomy 20fr ( 4 mm ) , speech prosthesis for laryngectomy 20fr ( 6 mm ) , speech prosthesis for laryngectomy 20fr ( 8 mm ) , speech prosthesis for laryngectomy 20fr ( 10 mm ) , speech prosthesis for laryngectomy 20fr ( 12.5 mm ) , speech prosthesis for laryngectomy 22.5fr ( 6 mm ) , speech prosthesis for laryngectomy 22.5fr ( 8 mm ) , speech prosthesis for laryngectomy 22.5fr ( 10 mm ) , speech prosthesis for laryngectomy 22.5fr ( 12.5 mm ) , speech prosthesis for laryngectomy 22.5fr ( 4 mm ) , block used in thyroplasty ( sialestic and gortex ) 70*50 mm with 20 mm thickness , disposable needle 16g x 1 inch , curved tip & stepped cartridges face from inner to outer side 2.0, 2.5 and 3.0 mm , curved tip & stepped cartridges face from inner to outer side 3.0, 3.5 and 4.0 mm , varied staple height reloads / cartridges for 60 mm gia , disposable laparoscopic clip applier preloaded with 16 clips, 5mm diameter , synthetic oxidised re generated cellulose double layered with peg and trilysine size 2*4cm , synthetic oxidised re generated cellulose double layered with peg and trilysine size 5*10cm , disposable 10 mm endoscopic clip applier medium / large size , disposable 10 mm endoscopic clip applier large size , endo liner cutterwithout integrated fresh knife cartridges in sizes of 30mm , endo liner cutterwithout integrated fresh knifecartridges in sizes of 45mm , endo liner cutterwithout integrated fresh knifecartridges in sizes of 60mm , disposable clip applier preloaded with 20 clipsmedium , disposable clip applier preloaded with 20 clips small , sterile hypodermic syringe 2ml , sterile hypodermic syringe 5ml , biological glue with thrombin & aprotinin 1ml , biological glue with thrombin & aprotinin 2ml , close wound drainage device under negative pressure ( closed wound suction unit ) 8 no , close wound drainage device under negative pressure ( closed wound suction unit ) 10 no , close wound drainage device under negative pressure ( closed wound suction unit ) no. 14 , close wound drainage device under negative pressure ( closed wound suction unit ) no. 12 , sterile oxidized regenerated cellulose hemostating agent , urine collecting bag, disposable 2000 ml with uroflow meter , central neck line double lumen ( 3 nobel metal coated ( gold, silver, palladium ) central lumen catheter, double lumen ) , microcatheter selective infusion microcatheters for intra cranial aneurysm treatment with 2 tip markers , microcatheter selective infusion microcatheters for deploying intracranial device: stent deployment , microcatheter selective infusion microcatheters for flow diverter delivery with single tip markers 0.027inch , microcatheterflow dependent , micro guide wirefor microcatheter shapable distal end and with torque 0.014inch , bare platinum coil complex shape, soft, electrolytic detachable 1 to 25mm , bare platinum coil complex shape, soft, mechanically detachable 1 to 25mm , bare platinum coil helical shape, soft, electrolytic detachable 1 to 25mm , bare platinum coil helical shape, soft, mechanically detachable 1 to 25mm , aortic punch 2.5 , aortic punch 3 , aortic punch 3.5 , aortic punch 4 , aortic punch 4.5 , aortic punch 5 , aortic punch 5.5 , aortic punch 3.6 , folleys catheter fixation divice 18 to 24 fr , tur set , laproscopic port with trocar , bipsy gun with compitible co axial needle 12gx11cm , bipsy gun with compitible co axial needle 12gx15cm , bipsy gun with compitible co axial needle 12gx20cm , bipsy gun with compitible co axial needle 14gx11cm , bipsy gun with compitible co axial needle 14gx15cm , bipsy gun with compitible co axial needle 14gx20cm , bipsy gun with compitible co axial needle 16gx11cm , bipsy gun with compitible co axial needle 16gx15cm , bipsy gun with compitible co axial needle 16gx20cm , bipsy gun with compitible co axial needle 18gx11cm , bipsy gun with compitible co axial needle 18gx15cm , bipsy gun with compitible co axial needle 18gx20cm , bipsy gun with compitible co axial needle 20gx11cm , bipsy gun with compitible co axial needle 20gx15cm , bipsy gun with compitible co axial needle 20gx20cm , patient pre operative skin prepration solution 26 ml , rem and non remsingle use, corded patient return electrodes , chlorhexidine impregnated paraffin gauze30x10cm , chlorhexidine impregnated paraffin roll15 cm x 1 , surgical gloves 6.5 puncture indicator technology , surgical gloves 7 puncture indicator technology , surgical gloves 7.5puncture indicator technology , ionic silver dressings for low to high exuding wounds5 cms x 5 cms , ionic silver dressings for low to high exuding wounds10 cms x 10 cms , self adherent moist wound dressing10 cms x 10 cms , stich bonded hydrofiber burns dresssingsin gel form 23 x 100 cms , double wall resuscitator with peep valve in adult , double wall resuscitator with peep valve in paediatrics , single patient use sebs resuscitator ( spur ii with peep valve in adult ) , single patient use sebs resuscitator ( spur ii with peep valve inpaed ) , single patient use sebs resuscitator ( spur ii with peep valve in neonatal ) , pre formed sga with gastric access & intubation sizes – 1 , pre formed sga with gastric access & intubation sizes – 1.5 , pre formed sga with gastric access & intubation sizes – 2 , pre formed sga with gastric access & intubation sizes – 2.5 , pre formed sga with gastric access & intubation sizes – 3 , pre formed sga with gastric access & intubation sizes – 4 , pre formed sga with gastric access & intubation sizes – 5 , pre formed sga with gastric access & intubation sizes – 6 , silicone pre formed sgasizes – 1 , silicone pre formed sgasizes – 1.5 , silicone pre formed sgasizes – 2 , silicone pre formed sgasizes – 2.5 , silicone pre formed sgasizes – 3 , silicone pre formed sgasizes – 4 , silicone pre formed sgasizes – 5 , silicone pre formed sgasizes – 6 , cervical collar with 12 sizes settings , cervical collar with 16 sizes settings , offset connector cardio sensor electrodessizes –adult , offset connector cardio sensor electrodessizes –paediatrics , offset connector cardio sensor electrodessizes –neonatal , anatomical face mask sizes 0a , anatomical face mask sizes 0 , anatomical face mask sizes 2 , anatomical face mask sizes 3 , anatomical face mask sizes 4 , anatomical face mask sizes 5 , anatomical face masksizes 6 , disposable sga anatomical curve sizes – 1 , disposable sga anatomical curve sizes – 1.5 , disposable sga anatomical curve sizes – 2 , disposable sga anatomical curve sizes – 2.5 , disposable sga anatomical curve sizes – 3 , disposable sga anatomical curve sizes – 4 , disposable sga anatomical curve sizes – 5 , disposable sga anatomical curve sizes – 6 , rhinolaryngo single patient use slim scope , rhinolaryngo single patient use invtervention scope , ultrasorbs ap disposable drypads , elastic head strap cannulas pediatric , over the ear nasal cannula50 tubing , pediatric nasal cannula 7 star lumen tubing , infant nasal cannula7 star lumen tubing , volumetric incentive spirometer ( adult ) , volumetric incentive spirometer ( pediatric ) , inspiratory exerciser with 3 color coded balls , adult mask for tracheostomy , pardiatric mask for tracheostomy , elongated aerosol mask adult , elongated aerosol mask pediatric , elongated three in one adult mask , adult conventional single water trap , adult ventilator circuit single limb portable , adult ventilator circuit single water trap , adult conventional dual limb water trap , infant prong cpap cannula , fhme heat and moisture exchangers with bacteria viral filters , tracheostomy hme: , double lumen endobronchial tube left:size 28fr , double lumen endobronchial tube left:size 32fr , double lumen endobronchial tube left:size 35fr , double lumen endobronchial tube left: size 37fr , double lumen endobronchial tube left:size 39fr , double lumen endobronchial tube left:size 41fr , double lumen endobronchial tube right: size 35fr , double lumen endobronchial tube right: size 37fr , double lumen endobronchial tube right: size 39fr , sub glottic tube taper guard evac: sizes 6mm , sub glottic tube taper guard evac: sizes 6.5mm , sub glottic tube taper guard evac: sizes 7mm , sub glottic tube taper guard evac: sizes 7.5mm , sub glottic tube taper guard evac: sizes 8mm , sub glottic tube taper guard evac: sizes 8.5mm , sub glottic tube taper guard evac: sizes 9mm , inflation device in 30atm & 20ml , manifold manifolds in 2, 3, 5 port , high pressure tube 25cm with braided , high pressure tube 51cm with braided , high pressure tube 76, cm with braided, , high pressure tube 122, cm with braided , high pressure tube183cm with braided , torque device for .014 to .038 standard and hydrophilic guide wires with squeeze load release mechanism , radial bandradial hemostatis band in 24 cm , radial bandradial hemostatis band in 29 cm , angiography needle 18g , angiography needle 19g , angiography needle 20g , angiography needle21g , angiography wireptfe guidewire in .035, .038, in regular length , angiography wire long length ptfe guidewire in .035, .038, , amplatz wireptfe amplatz type wire in .035 and .038, length of 75cm, 145cm, 180cm , hydrophilic wire hydrophilic guidewire of .018, .025, .035, .038 in 80cm, 150cm , hydrophilic wire long lengthhydrophilic guidewire of .018, .025, .035, .038 in 180cm, 220cm, 260cm length , hydrophillic braided sheath 4f to 7f , femoral sheath with needle 5f to 8f , angiography catheter 4f 6f , angiography radial catheters4 6f , one loop & triple loop snare , ptca kit , closed suction catheter for paediatrics 5fr , closed suction catheter for paediatrics 6fr , closed suction catheter for paediatrics 7fr , closed suction catheter for paediatrics 8fr , closed suction catheter for paediatrics 10fr , closed suction catheter for paediatrics 12fr , paediatric endotracheal tube sizes are 3mm. , paediatric endotracheal tube sizes are 3.5mm. , paediatric endotracheal tubesizes are 5.5mm. , adult endotracheal sizes 5.5mm. , adult endotracheal sizes 10mm. , kimvent bal cath13fr , kimvent bal cath16fr , disposable spo2 sensor , catheter mount , gastrostomy feeding tube size – 12 , gastrostomy feeding tube size – 14 , gastrostomy feeding tube size – 16 , gastrostomy feeding tube size – 18 , gastrostomy feeding tube size – 20 , gastrostomy feeding tube size – 24 , percutaneous endoscopic gastrostomy ( peg ) 14fr , percutaneous endoscopic gastrostomy ( peg ) 20fr , percutaneous endoscopic gastrostomy ( peg ) 24fr , silk protein based sterile surgical pu foam dressing non adhesive , silk protein & antimicrobial nanosilver based sterile surgical pu foam dressing , silk protein & antimicrobial silver based sterile surgical mesh wound dressing , silk protein & antimicrobial nanosilver based sterile surgical wound dressing sheet , silk protein derived sterile surgical meshed wound dressing , silk protein based sterile surgical wound dressing sheet , silk protein based antimicrobial wound healing ointment loaded with asiaticoside and silver , silk protein and nanosilver based microbicidal sterile surgical wound dressing , silk protein based sterile surgical wound dressing sprinkling powder bottle , centella asiatica extract based skin moisturization and antiscar gel , silk protein based sterile surgical particle wound dressing , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 5ml , silk protein and antimicrobial nanosilver based sterile surgical particle wound dressing 10ml , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing 10*20cm, , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing10*25cm , silk protein based non woven backed with pad & self adhesive border, water repellent sterile surgical dressing15*15cm , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management10*20cm , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*25cm , silk protein and pu foam pad with self adhesive border, water proof dressing for post operative scar or any scar management 10*21.5cm , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 9*21.5cm , silk protein, nanosilver and asiaticoside based pu film backed with pad & self adhesive border, water proof sterile surgical dressing 10*25cm , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing 10*10cm , silk protein and antimicrobial nanosilver impregnated non adherent leno gauze sterile surgical wound dressing10*25cm , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*10cm , silk protein impregnated non adherent leno gauze sterile primary surgical wound dressing 10*25cm , papain urea & silk protein based wound debriding ointment and cream 25gm , papain urea & silk protein based wound debriding ointment and cream 50gm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment 25gm , silk protein, asiaticoside and povidone iodine based broad spectrum topical antiseptic and antimicrobial wound healing ointment50gm , anti microbial gloves , anti microbial gloves , anti microbial gloves , anti microbial gloves , anti microbial gloves , anterior chamber iol , capsular tension ring , iris hooks / retractors , silicone rod for ptosis repair , reusable anaesthetia face mask fo siliconesize 0 , reusable anaesthetia face mask fo siliconesize 1 , reusable anaesthetia face mask fo siliconesize 2 , reusable anaesthetia face mask fo silicone size 3 , reusable anaesthetia face mask fo silicone size 4 , reusable anaesthetia face mask fo siliconesize 5 , flow regulator extension set flow rate 2ml to 350ml per hour , sterile disposable hypodermic needle no. 18x1½ , sterile disposable hypodermic needleno. 21x1½ , sterile disposable hypodermic needle no. 23x1½ , neonatal single heated wire breathing system , paed. single heated wire breathing system , adult single heated wire breathing system , neonatal high flow nasal cannula having8 litre flow , pur xro catheter 20 cm , pur xro catheter 30 cm , dead body bag 7x3 ft size , introducer sheath with puncture needle for adultssize 4 fr. , introducer sheath with puncture needle for adultssize 9 fr. , intoducer sheath for adults ( size 10 fr. ) , intoducer sheath for adults ( size 11 fr. ) , long introducer sheath ( 20 30 cm long ) ( size 5fr. ) , long introducer sheath ( 20 30 cm long ) ( size 6fr. ) , long introducer sheath ( 20 30 cm long ) ( size 7fr. ) , long introducer sheath ( 20 30 cm long ) ( size 8fr ) , long introducer sheath ( 20 30 cm long ) ( size 9fr ) , long introducer sheath ( 20 30 cm long ) ( size 10fr ) , long introducer sheath ( 20 30 cm long ) ( size 11fr ) , trans radial introducer sheeths 4f , trans radial introducer sheeths 5f , trans radial introducer sheeths 6f , steerable introducer sheeths 5f , steerable introducer sheeths 6f , steerable introducer sheeths 7f , steerable introducer sheeths 8f , steerable introducer sheeths 9f , steerable introducer sheeths 10f , steerable introducer sheeths 11f , steerable introducer sheeths 12f , long braded introducer sheath sizes 6fr , long braded introducer sheath sizes 7fr , long braded introducer sheath sizes 8fr , long braded introducer sheath sizes 9fr , long braded contra lateral introducer sheath sizes 6fr , long braded contra lateral introducer sheath sizes 6fr , long braded contra lateral introducer sheath sizes 8fr , long braded contra lateral introducer sheath sizes 9fr , long introducer sheath ( 30 50 cm long ) ( size 5fr.. ) , long introducer sheath ( 30 50 cm long ) ( size 6 fr.. ) , long introducer sheath ( 30 50 cm long ) ( size 7fr. ) , long introducer sheath ( 30 50 cm long ) ( size 8fr. ) , long introducer sheath ( 30 50 cm long ) ( size 8fr. ) , long introducer sheath ( 30 50 cm long ) ( size 10fr.. ) , long introducer sheath ( 30 50 cm long ) ( size 11fr. ) , long introducer sheath dedicated for transradial accesssize 4fr , long introducer sheath dedicated for transradial accesssize 5fr , long introducer sheath dedicated for transradial accesssize 6fr , long introducer sheath dedicated for transradial accesssize 7fr , long introducer sheath size 5fr , long introducer sheath size 6fr , long introducer sheath size 7fr , long introducer sheath size 8fr , ptfe coated diagnostic guide wire ( regular length, regular stiffness ) 0.025 inches size , ptfe coated diagnostic guide wire ( regular length, regular stiffness ) 0.032 inches size , ptfe coated diagnostic guide wire ( regular length, regular stiffness ) 0.035 inches size , ptfe coated diagnostic guide wire ( regular length, regular stiffness ) 0.038 inches size , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) 0.025, inches , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) 0.032 inches , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) 0.035inches , ptfe coated diagnostic guide wire – ( exchange length, regular stiffness ) 0.038 inches , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type , ptfe coated diagnostic 0.032 inch guide wire – ( exchange length, extra stiff shaft strength ) amplatz type , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) 0.025 inches , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) 0.032 inches , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) 0.035inches , hydrophilic diagnostic guide wire – radifocus tarumo type ( regular length, regular stiffness ) 0.038 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.025 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.032 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.035inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.038 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.025 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.032 inches , radiofocus miniplastic guidewire ( , regular stiffness ) 0.038 inches , judkins catheter ( jr ) 4fr , judkins catheter ( jr ) 5fr , judkins catheter ( jr ) 6fr , judkins catheter ( jr ) 7fr , judkins catheter ( jr ) 8fr , judkins catheter ( jl ) us fda + ce / dgci approved4fr , judkins catheter ( jl ) us fda + ce / dgci approved5fr , judkins catheter ( jl ) us fda + ce / dgci approved6fr , judkins catheter ( jl ) us fda + ce / dgci approved7fr , judkins catheter ( jl ) us fda + ce / dgci approved 8fr , judkins catheter pigtail 4fr , judkins catheter pigtail 5fr , judkins catheter pigtail 6fr , judkins catheter pigtail 7fr , judkins catheter pigtail 8fr , multipurpose catheter4fr , multipurpose catheter5fr , multipurpose catheter6fr , multipurpose catheter7fr , multipurpose catheter8fr , amplatz catheteramplatz left ( al ) 4fr , amplatz catheter amplatz left ( al ) 5fr , amplatz catheter amplatz left ( al ) 6fr , amplatz catheter amplatz left ( al ) 7fr , amplatz catheter amplatz left ( al ) 8fr , amplatz catheter amplatz right ( ar ) 4fr , amplatz catheter amplatz right ( ar ) 5fr , amplatz catheter amplatz right ( ar ) 6fr , amplatz catheter amplatz right ( ar ) 7fr , amplatz catheter amplatz right ( ar ) 8fr , nternal mammary catheter 4fr , nternal mammary catheter 5fr , nternal mammary catheter 6fr , nternal mammary catheter 7fr , nternal mammary catheter 8fr , by pass graft catheter 4fr , by pass graft catheter 5fr , by pass graft catheter 6fr , by pass graft catheter 7fr , by pass graft catheter 8fr , transradial diagnostic coronary catheter tiger type4fr , transradial diagnostic coronary catheter tiger type5fr , transradial diagnostic coronary catheter tiger type6fr , transradial diagnostic coronary catheter tiger type7fr , transradial diagnostic coronary catheter tiger type8fr , nih catheter 4fr , nih catheter 5fr , nih catheter 6fr , nih catheter 7fr , nih catheter 8fr , cournard catheter 4 french , cournard catheter 5 french , cournard catheter6 french , cournard catheter 7 french , cournard catheter 8french , introducer sheaths for pediatric use ( size 4 fr. ) , introducer sheaths for pediatric use ( size 5 fr. , introducer sheaths for pediatric use ( size 6 fr. ) , judkins catheter ( pediatric ) 4 french , judkins catheter ( pediatric ) 5 french , judkins catheter ( pediatric ) 6 french , special judkins coronary catheter4 french , special judkins coronary catheter5 french , special judkins coronary catheter6 french , angiographic double leumen tracking catheter 4 french , angiographic double leumen tracking catheter 5 french , angiographic double leumen tracking catheter 6 french , 3 ‘french’ diagnostic catheters for neonatal use 3 fr. , swan ganz catheter 6f , swan ganz catheter 7f , balloon tipped angiography catheter 5f , balloon tipped angiography catheter 6f , balloon tipped angiography catheter 7f , berman catheter4 french , berman catheter5 french , berman catheter6 french , berman catheter7 french , reverse berman catheter4 french , reverse berman catheter5 french , reverse berman catheter6 french , reverse berman catheter7 french , arterial pressure monitor lines ( 100 cm long ) , arterial pressure monitor lines ( 150 cm long ) , arterial pressure monitor lines ( 200 cm long ) , straight long introducer sheath with hydrophilic introducer guide wire 4 french , straight long introducer sheath with hydrophilic introducer guide wire 5 french , straight long introducer sheath with hydrophilic introducer guide wire 6 french , straight long introducer sheath with hydrophilic introducer guide wire 7 french , straight long introducer sheath with hydrophilic introducer guide wire 8 french , straight long introducer sheath with hydrophilic introducer guide wire 9 french , straight reinforced sheath with hydrophilic coating6 french , straight reinforced sheath with hydrophilic coating7 french , straight reinforced sheath with hydrophilic coating8 french , straight reinforced sheath with hydrophilic coating9 french , straight reinforced sheath with hydrophilic coating10 french , straight reinforced sheath with hydrophilic coating11 french , straight reinforced sheath with hydrophilic coating12 french , long sheath for contra – lateral iliac / femoral access4f , long sheath for contra – lateral iliac / femoral access5f , long sheath for contra – lateral iliac / femoral access6f , long sheath for contra – lateral iliac / femoral access7f , long sheath for contra – lateral iliac / femoral access8f , long sheath for contra – lateral iliac / femoral access9f , mullin’s sheath for special dilation 6fr , angio.kit / ptca kit ( 3 port many fold with attached tubing one pressure line + two iv set connecting tube and two leurlock syringe ) us fda / ce / approved , micro catheter 2.7 fwith 130 cm , micro catheter 2.9 fwith 130 cm , micro catheter 2.7 fwith 150 cm , micro catheter 2.9 fwith 130 cm , multi side port catheter , clot retrieval sheath 16fr , clot retrieval sheath 20fr , clot retrieval sheath 24fr , loadable microsphere 30 60 micorn , loadable microsphere 50 100micron , loadable microsphere 100 300 micron , pcd set puncture needle 18g 24fr , ring biliary catheter usa / fda / ce approvedcatheter 8.5 f , venaseal closure system , liver access and biopsy needle set , tran jugular intrahepatic porto sytemic , percutaneous gastrostomy balloon , biopsy guns 14g 10cm , biopsy guns 14g 16cm , biopsy guns 16g 10cm , biopsy guns 16g 16cm , biopsy guns 18g 10cm , biopsy guns 18g 16cm , biopsy guns 18g 20cm , biopsy guns 18g 25cm , biopsy guns 20g 10cm , biopsy guns 20g 16cm , breast nodule localizationwire , disposable semi automatic core biopsy instrument , ultra clipdisposable breast tissue marker , bone marrow biopsy needle 8g 4” & 6” , bone marrow biopsy needle 11g 4” & 6” , bone marrow biopsy needle 13g 3.5” , silicone foleys catheter sizes 8fr , silicone foleys catheter sizes 10fr , silicone foleys catheter sizes 12fr , silicone foleys catheter sizes 14fr , silicone foleys catheter sizes 16fr , silicone foleys catheter sizes 18fr , silicone foleys catheter sizes 20fr , cutting & coagulations device with with wide jaw aperture 13mm and cut length 18.5mm with shaft rotation of 350 degrees and with one step sealing mechanism. , cutting &coagulations device with with cut length of 14.7 mm, seal length of 16.5mm, jaw angle 28 degrees. , cutting &coagulations device with tissue fusion ligature technology laparoscopic blunt tipped vessel sealer , cutting &coagulations device with tissue fusion ligasure technology instrument for open surgeries , cutting &coagulations device with tissue fusion ligasure technology , cutting &coagulations device with tissue fusion ligasuretechnologyhave vessel sealing instrument for open surgeries , double lumen catheter size 11.5 frx13.5 cm , double lumen catheter size 12 frx13 cm , double lumen catheter size 8 frx9 cm , double lumen catheter size 10 frx12 cm , double lumen catheter size 12 frx16 cm , double lumen catheter size 12 frx13 cm , long term double lumen dialysis catheter size 14.5 frx19 cm , long term double lumen dialysis cathetersize 14.5 frx23 cm , long term double lumen dialysis cathetersize 15 fr x 19 cm , long term double lumen dialysis cathetersize 15 fr x 23 cm , transperant surgical wound dressing size 6x 7 , transperant surgical wound dressingsize 10x15 , transperant surgical wound dressingsize 20x25 , transperant surgical wound dressingsize 10x30 , transperant surgical wound dressing size 10x40 , non fibre optic single use adult scope , multi vent mask pediatric, , incentive spirometer , closed suction catheter mdi port 12 fr. , closed suction catheter mdi port 14 fr. , closed suction catheter has isolated turbo cleaning chamber 12 fr. , closed suction catheter has isolated turbo cleaning chamber14 fr. , fenestrated tracheostomy tube cuffed with 2 inner cannula , multifocal iol , glaucoma drainage implant adult , glaucoma drainage implant paediatric , eye sphere implantsimplantable gradepmma sphere 14mm , eye sphere implantsimplantable gradepmma sphere 16mm , eye sphere implantsimplantable gradepmma sphere 18mm , eye sphere implantsimplantable gradepmma sphere 20mm , eye sphere implantsimplantable gradepmma sphere 22mm , eye sphere implantsimplantable grade siliconesphere 14mm , eye sphere implantsimplantable grade siliconesphere 16mm , eye sphere implantsimplantable grade siliconesphere 18mm , eye sphere implantsimplantable grade siliconesphere 20mm , eye sphere implantsimplantable grade siliconesphere 22mm , monocanalicular self retaining silicone stent for canalicular repair , lacrimal intubation set for dcr surgery , scleral fixiated intraoccular lense , vibratory pep therapy device , tracheostomy tube cuffed , dry lithium heparin pre filled abg syringe with airremoval filter cap 1ml , dry lithium heparin pre filled abg syringe with airremoval filter cap 3ml , epidural and spinal needle kit 16 / 18g , epidural kit , central line triple lumen 8.5 fr with 16cm / 20cm catheter , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , central line quadra lumen 8.5 fr with 15cm / 20cm catheter , peripherally inserted central line for high flow / power injection , latex folley balloon catheter 6no , latex folley balloon catheter 12no , ryle’s tube 6no , ryle’s tube 8no , post operative surgical cover dressings hydrofiber dressings 9x25 cm , post operative surgical cover dressings hydrofiber dressings 9x30cm , post operative surgical cover dressings hydrofiber dressings 9x35 cm , 2 pcs flat base ostomy body fit60 mm kit , 2 pcs flat base ostomy body fit 70 mm kit , 2 pcs convex base ostomy body fit60 mm kit , 2 pcs convex base ostomybody fit70 mm kit , 1 pcs trasnparent colostomy body fit60mm kit , 2 pcs flat base ostomy body fit bag 60 mm , 2 pcs flat base ostomy body fit bag 70 mm , 2 pcs convex base ostomy body fit bag 60 mm , 2 pcs convex base ostomybody fit bag 70 mm , 1 pcs trasnparent colostomy body fit bag 60mm , non fibre optic single use large scope , antimicrobial silver dresssingsterile sizes:10x12cm , antimicrobial silver dresssingsterile15x20cm , non fibre optic single use cysto scope for djr & diagnosticcystoscope , non fibre optic single use paediatrics scope , sterile self adherent with lipido colloid technology 8x8cm , sterile self adherent with lipido colloid technology13x13cm , sterile self adherent with lipido colloid technology15x20cm , sterile self adherent with lipido colloid technology 20x20cm, , sterile self adherent with lipido colloid technology6.5x10cm, , sterile self adherent with lipido colloid technology8 x15cm, , sterile self adherent with lipido colloid technology 10x25cm , 100% polysiloxane based scar management , triple hydrocolloid skin barrier where no cutting 45mm, , triple hydrocolloid skin barrier where no cutting 57mm, , triple hydrocolloid skin barrier where no cutting 70mm , drainable pouch 45mm, , drainable pouch57mm, , drainable pouch70mm...

Rajasthan Mobile Surgical Unit - Rajasthan

33645272 supply of lab and x ray items etc. s. bilirubin kit ( 6 *50 ml ) drect reagent: 1o0 ml toa m.algfwnt 100 d red nit s ml motaantr4e sml l_ 2 s. ooiestroi kit ( 1 *10 ml ) 3__— s. creatinine kit ( 1*10o ml ) _ 4 hdi kit 5 ldlkit 6 t.gkit 7 v.ld.l kit 8 — s. urea kit ( 1 *10o ml ) ( urease bun kinetic dry powder ) . dry powder base urea ( bun ) urea reagent 5 x 20 ml aqua 4 1x 100 ml standard 5o me / dla 9 sgot kit ( kinetic dry powder ) ( ix10o ml ) . dry powder vial 10 sgpt kit ( kinetic dry powder ) ( 1*100 ml ) __ dry powder vial 11 s. glucose kit ( 1x 100 ml ) ( god pod dry powder ) 12 uric acid test ( 1 *5o ml ) r13 ra factor test ( 1 x 3o test ) 14 capillary tubes 15 glass slide gold coin 16 filter paper ( whatman no.1 ) 17 cedar wood oil ( 1x1o0 ml ) 18 disposable needle no.22 ( lxloo ) 19 n / b hci. ( 1x50o ) 20 semen diluting fluid ( 125 ml ) 21 micro pipette tips ( yeliow or white ) ( 1x1o0o ) 22 micro pipette tips ( blue ) ( 1x 50o ) 23 sodium citrate 3.8% ( 1 x50o ml ) 24 disposable blood collection tube with screw ( lx 10o ) 2s edta vials powder coated ( 1x 1oo ) plain ( analysing tubes ) ( 1x 1oo ) urine collection vial ( 1x 1oo ) 26 28 w.b.c. fluid ( 1 xsoo ml ) l29 r.b.c. fluid ( 1 xsoo ml ) hbsag kit ( rapid ) ( 1 x3o test ) — i — a1 malarea antigen card test ( 1 xso test ) 32 urine pregnancy test kit xaup? 33 vdrl rapid test kit ( 1 x 1.0 test ) 34 widal slide test kit ( 1 30 ) 3s giuco strips ( glucose strips ) 1x50 36 disposable esr tubes plastic ( n. x 1o0 pa ) nestimaton cuveteschenocuiijijj himo smarking pen ( blue red ) jjssueiapr roll reporung ) n 41 sodium hypocti0rite salution s itr . :.u 42 1trwfdmfcf powder ( 9 w _ ‘43 x raw film deweloper powder ( 9lirs ) _ 44 hblac 4s flow cwalfer oluton for semi auto analyser i j ( 1*50m1 ) 46 mjnocjalr solution for cbc machine 0.5 ltr b cbc minidil2o ltr ( for horiba mic ) 48 cbc lysebeo one ltr ( for horiba m / t ) 49 cbc cleaner 1 ltr ( for horiba m / c ) so control for 3 part hematology analyserhoriba _ ( smallest pacu s_ml ) si cbc diatro dpiuent2o ltr ( ior abacus m / c ) 52 cbc lysebio one itr ( for abacus m / c ) cbc cleaner 1 ltr ( for abacus m / c ) 4 54 control for 3 part hematology analyser abacus 380 ( smallest pack 3 ml ) 55 control for seml auto analyser clinical chemistry analyse ( 1 x5o ml ) $6 antiaub&d0 multistix ( 1 x 100 ) 57 58 uristix ( lx1oo ) 59 hemocheck hemoglobin color scale who 60 i x ray films blue sensutive polyster base — size: / 12”xlso 61 x ray fiims blue sensitive polyster base size:1o’rxlyo 62 63 65 m 66 x ray rilms blue sensitive polyster base size: 8’ x 10 carestream digital film 11 x14 carestream digital film io”x12 carestream digital film 8 x1o dispo syringe 2ml m z distilled water ampules ecg gel ecg paper roll 80 mm 106 mm etc...

Medical And Health Services - Rajasthan

33545384 supply of hdu icu otoscope 2 ophthamoscope 3 glucometer 4 ambu bag 500 ml 5 ambu bag 750 ml 6 ambu bag 1000 ml pediatric fiberoptic laryngoscope with handle and blade set 8 oxygen hood ( head box ) bone marrow biopsy needle / intra osscous needle 10 bone marrow aspiration needle ( pediatric size ) 11 pulse oximeter ( finger tip ) _ | 12 thermometer nibp instrument with pediatric cuff ( small, *medium & larze size ) 14 torch 15 algorithms / flow charts 16 x ray view box 17 printed drug dosages for children | 18 |measuring tape 19 bed side bench 20 bed side locker table 21 over head table 22 iv stands 23 infant / nconatal weighing machine 24 stethoscope 25 table and chair for staff 26 needle cutters / hub cutter endotracle tubes 2.5 7mm, pediatric size mask, laryngeal mask airway , rebreather mask, non rebreather mask, nasal cannula, nasogastric tubes, multilumen central catheters, cannula for intravenous access and arterial lines, chest tubes, bio medical waste, bandages, adhesives, pediatric 27 drip set, venturl mask, iv infusion sets / dosiflow, adhesive tape, syringes, disposable needles, suction catherters, spacers and mask, gloves, trachesoty kits, blood infusion sets, lp needles, icd tubes, bags, closed suction catherters, urine catheters and bags, arterial line transducers, petitioneal dialysis catheters, pd dialysis fluid, air mattresses etc....

Medical And Health Services - Rajasthan

33454063 supply of medicine for eye ot 1. blurex blue dye 2. injection . pilocar 3. disposable needle 26g 1/2” — 4. black goggles — 5. proparacaine eye drop — 6. moxifloxacin+prednisolonle eye drop 7. phenylephrine and tropicamide. eye drop — 8. suture 5 0 vicryl ...

Medical Health And Family Welfare - Rajasthan

33421671 supply of generic medicine in district saadat hospital at tonk ( annual contract ) 1 bupivacaine hydochloride in dextrose injection usp each ml contains bupivacaine hydrochloride 5.0 mg dextrose 80.0 mg 2 bupivacaine inj ip 0.5% 3 halothane bp 4 isoflurane usp 5 ketamine inj ip 50 mg / ml 6 lignocaine ointment 5 o / o 7 lignocaine and adrenaline inj ip each ml. contains lignocaine hydrochloride ip 20 mg adrenaline ip 0.01 mg 8 lignocaine and dextrose injection ip each ml contains lignocaine 50 mg and dextrose ( monohydrate ) 75 mg 9 lignocaine gel ip 2% 10 lignocaine inj ip 2 o / o 11 propofol inj ip 10 mg / ml 12 thiopentone inj ip 0.5 g 13 sevoflurane 14 atropine sulphate injection 0.6mg / ml 15 liquid medical oxygen ( lmo ) 16 diclofenac sodium inj ip 25 mg / ml ( im / iv use ) 17 diclofenac gastro resistant tablet ip 50 mg ( enteric coated ) 18 fentanyl citrate injection ip 2 ml 19 ibuprofen and paracetamol tablets ip ibuprofen 400 mg+paracetamol 325 mg 20 ibuprofen tab ip 200 mg ( coated ) 21 ibuprofen tab ip 400 mg ( coated ) 22 morphine sulphate inj ip 10mg / ml 23 paracetamol drops paediatric paracetamol oral suspension ip ( each ml contains paracetamol 150mg ) 24 paracetamol syrup ip 125 mg / 5ml 25 paracetamol tab ip 500 mg 26 paracetamol inj. 150 mg / ml 27 pentazocine inj ip 30mg / ml ( im / iv use ) 28 tramadol cap ip 50 mg 29 tramadol inj 50 mg / ml 30 indomethacin cap ip 25 mg 31 diclofence prolonged release tablet ip 100 mg 32 ibuprofen oral suspension bp / usp 100 mg / 5 ml 33 diclofenac sod 50 mg + paracetamol 325 mgtablets ip 34 aceclofenac and paracetamol tablets aceclofenac 100 mg and paracetamol 325 mg 35 diclofenac gel: diclofenac diethylamine 1.16%, methyl salicylate 10%, linseed oil 3%, menthol 5% 36 etoricoxib tab ip 120mg 37 mefenamic acid tablets bp 500 mg 38 fentanyl citrate injection 50mcg / ml 39 naproxen tablet ip 500mg 40 naproxen tablet ip 250mg 41 etoricoxib tablet ip 90 mg 42 aspirin tablet ip ( gastro resistant ) 150 mg 43 butorphanol tartrate injection usp 1mg / ml 1ml size 44 diclofenac sodium aqueous injection 75mg / ml 1ml size, iv & im use 45 paracetamol infusion ip 1% w / v 100ml size 46 ketorolac tromethamine dispersible tablet 10 mg ( each uncoated dispersible tablet contains ketorolac tromethamine 10 mg ) 47 baclofen tablet ip 10 mg ( each uncoated tablet contains baclofen ip 10 mg ) 48 tizanidine hydrochloride tablet ip 2 mg ( each uncoated tablet contains tizanidine hydrochloride ip 2 mg ) 49 adrenaline injection ip 1mg / ml im / iv use 50 betamethasone tab ip 0.5mg 51 chlorpheniramine maleate tab ip 4mg 52 dexamethasone inj ip 8mg / 2ml 53 dexamethasone tab ip 0.5 mg 54 hydrocortisone sodium succinate injection ip 100 mg base / vial ( im / iv use ) 55 hydroxyzine tab ip 25 mg 56 methyl prednisolone sodium succinate for injection usp 500 mg 57 pheniramine inj ip 22.75mg / ml 58 prednisolone tab ip 5 mg 59 promethazine syrup ip 5 mg / 5ml 60 promethazine inj ip 25mg / ml 61 promethazine tab ip 25 mg 62 betamethasone sod phos inj ip 4mg / ml 63 prednisolone tablet ip 10 mg 64 prednisolone tab ip 20 mg 65 anticold syrup each 5 ml contains phenylephrine hydrochloride 2.5mg , chlorpheniramine maleate 1 mg, and paracetamol 125 mg 66 cetirizine, phenylephrine & paracetamol tablets cetirizine 5 mg, phenylephrine 10 mg & paracetamol 325 mg tab 67 cetirizine syrup ip 5mg / 5 ml 68 levoceitrizine tablet 5mg 69 montelucast ( 10mg ) + levocetrizine tablet ( 5mg ) 70 dexamethasone tablet ip 4 mg ( each uncoated tablet contains dexamethasone ip 4 mg ) 71 naloxone inj ip 0.4mg / ml 72 pralidoxime chloride injection ip 25 mg / ml / 500 mg 73 acetylcystine solution usp ( injection ) 200 mg / ml 74 carbamazepine tab ip 200 mg 75 carbamazepine tab ip 100 mg 76 phenobarbitone tab ip 30 mg 77 phenytoin injection bp 50mg / ml 78 phenytoin oral suspension ip 25mg / ml 79 phenytoin tab ip 100 mg ( film coated ) 80 sodium valproate inj 100 mg / ml 81 sodium valproate gastro resistant tablets ip 200 mg 82 phenobarbitone inj ip 200mg / ml 83 carbamazepine oral suspension usp 100 mg / 5ml 84 sodium valproate oral solution ip 200 mg / 5 ml 85 sodium valproate tablet ( gastro resistant ) ip 500mg 86 clobazam tablet / capsule 5 mg 87 clobazam tablet / capsule 10 mg 88 levetiracetam tablet ip 500 mg 89 levetiracetam oral solution / suspension 100mg / ml 90 levetiracetam injection 500mg / 5ml 91 gabapentine tablet / capsule 100mg 92 gabapentine tablet / capsule 300mg 93 lamotrigine tablet ip 50 mg ( each sustained releasetablet contains lamotrigine ip 50 mg ) 94 divalproex extended release tablet ip 250 mg ( each extended release film coated tablet contains divalproex sodium ip equivalent to valproic acid 250 mg ) 95 oxcarbazepine tablet ip 150 mg ( each film coated tablet contains oxcarbazepine ip 150 mg ) 96 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) 97 acyclovir oral suspension ip 400mg / 5ml 98 acyclovir tab ip 200 mg 99 acyclovir tab ip 800 mg 100 albendazole oral suspension ip 400 mg / 10ml 101 albendazole tablets ip 400 mg ( detail in rc ) 102 amikacin inj ip 100 mg 103 amikacin inj ip 500 mg 104 amoxycillin and cloxacillin cap 250 + 250 mg 105 amoxycillin and potassium clavulanate tabs ip 500 mg + 125 mg 106 amoxycillin cap ip 250mg 107 amoxycillin cap ip 500mg 108 amoxycillin dispersible tablets ip 125 mg 109 ampicillin injection ip 500 mg 110 azithromycin tab 100 mg dispersible tabs ( 3 tab strip 10x3x3 ) 111 azithromycin tablets ip 250mg 112 azithromycin tab ip 500 mg 113 benzathine benzylpenicillin inj ip 12 lac units 114 benzathine benzylpenicillin inj ip 6 lac units 115 cefixime tab ip 100 mg 116 cefixime tab ip 200 mg 117 cefoperazone and sulbactum for inj ( cefoperazone sodium cefoperazone 1gm and sulbactum sodium eq. to sulbactum 0.5gm ) ( im / iv use ) 118 cefotaxime injection ip 1 g 119 cefotaxime inj ip 250 mg 120 ceftazidime inj ip 1g 121 ceftazidime inj ip 250 mg 122 ceftazidime inj ip 500 mg 123 ceftriaxone inj ip 1g / vial 124 ceftriaxone inj ip 250 mg / vial 125 ceftriaxone inj ip 500mg / vial 126 cephalexin cap ip 250 mg 127 cephalexin cap ip 500 mg 128 chloroquine phosphate inj ip 40 mg / ml 129 chloroquine phosphate tab. ip 250mg eq to 155 mg of chloroquine base film coated 130 chloroquine phosphate suspension ip 50 mg / 5ml 131 ciprofloxacin injection ip 200mg / 100ml 132 ciprofloxacin tablets ip 250 mg film coated 133 ciprofloxacin tablet ip 500 mg film coated 134 clotrimazole cream ip 2% w / w 135 clotrimazole vaginal tab ip 500mg 136 co trimoxazole oral suspension ip each 5 ml contains trimethoprim 40 mg and sulphamethoxazole 200 mg 137 co trimoxazole tablets ip trimethoprim 40 mg and sulphamethoxazole 200 mg 138 diethylcarbamazine tab ip 100 mg 139 doxycycline cap ip 100 mg 140 fluconazole tablets ip 150mg 141 gentamycin injection ip 80mg / 2ml ( im / iv use ) 142 griseofulvin tab ip 125 mg 143 itraconazole cap 100 mg 144 meropenem inj ip 500 mg 145 metronidazole inj ip 500 mg / 100ml 146 metronidazole benzoate oral suspension ip 100 mg of base / 5ml 147 metronidazole tablets ip 200 mg ( film coated ) 148 metronidazole tablets ip 400 mg ( film coated ) 149 norfloxacin tab ip 400mg film coated 150 ofloxacin tab ip 200 mg 151 primaquine tab ip 2.5 mg 152 primaquine tab ip 7.5 mg 153 quinine dihydrochloride inj ip 300 mg / ml 154 quinine sulphate tablets ip 300 mg ( film coated ) 155 ampicillin cap ip 500mg 156 nitrofurantoin tab ip 100mg 157 cloxacillin sodium inj ip 500mg 158 cephalexin oral suspension ip ( cephalexin dry syrup ip ) 125mg / 5 ml 159 ofloxacin oral suspension ip 50mg / 5ml 160 tinidazole tab ip 300 mg ( film coated ) 161 tinidazole tab ip 500 mg ( film coated ) 162 piperacillin + tazobactum for injection ip 4gm+500mg 163 amoxycillin oral suspension ip ( dry syrup ) 125 mg / 5ml 164 cefpodoxime dispersible tab 50 mg 165 cephalexin tablets 125 mg ( dispersible tablets ) 166 meropenem inj. ip 1gm 167 acyclovir intravenous infusion ip 250mg 168 acyclovir intravenous infusion ip 500mg 169 amikacin inj ip 250 mg 170 amoxicillin and potassium clavulanic ip inj 600mg 171 amoxicillin and potassium clavulanate inj ip 1.2gm 172 amoxycillin and potassium clavunate oral suspension ip 200 mg +28.5 mg / 5 ml ( 30ml bottle ) 173 artesunate injection 60 mg ( i.m. i.v.use ) each combo pack contains artesunate injection 60 mgvial, sodium bicarbonate injection ip 5 o / o w / v ( 1ml ampoule ) , sodium chloride injection ip 0.9o / o w / v ( 5ml ampoule ) 174 cefepime injection ip 500 mg 175 cefixime oral suspension ip 25mg / ml ( paediatric drops ) 176 cefuroxime axetil tab ip 250 mg 177 clindamycin capsule ip 150mg 178 clindamycin capsule ip 300 mg 179 levofloxacin tablets ip 250 mg 180 linezolid tablets ip 600 mg 181 linezolid inj 200mg / 100ml 182 ofloxacin and ornidazole tablets ofloxacin 200 mg and ornidazole 500 mg 183 ofloxacin infusion ip 200mg / 100 ml ( in nacl inj ) 184 vancomycin for intravenous infusion ip 500 mg 185 artemether and leumefantrine tablet ( 80 mg and 480 mg ) 186 co trimoxazole tablet ip ( trimethoprim 160mg+sulphamethoxazole 800mg ) 187 framycetin sulphate cream 1 o / o 30gm pack 188 framycetin sulphate cream 1 o / o 100 gm pack 189 artemether and leumefantrine tablet ( 40 mg and 240 mg ) 190 amoxycillin tablet 250 mg+calvulanic acid 125 mg ip each film coated tab conatin amoxycillin trihydrate ip 250 mg & potassium clavulanate ip 125 mg 191 ceftriaxone 1 gm + tazobactum 125 mg injection 192 cefadroxil dispersible tablet 250 mg ( each uncoated dispersible tablet contain cefadroxil equivalent to anhydrous cefadroxil 250 mg ) 193 cefadroxil tablet 500 mg 194 ofloxacin oral suspension ip ( each 5ml contains ofloxacin ip 100 mg ) 30 ml size 195 levofloxacin tablet ip 500 mg ( each film coated tablet contains levofloxacin hemihydrate ip 500 mg ) 196 clindamycin phosphate injection ip 300 mg 197 terbinafine hydrochloride tablet 250 mg 198 azathioprine tab ip 50 mg 199 bleomycin injection ip 15mg ( bleomycin sulphate injection 15 units ) 200 chlorambucil tab ip 5 mg 201 cisplatin inj ip 50 mg / 50 ml 202 cyclophosphamide inj ip 200 mg 203 cyclophosphamide inj ip 500 mg 204 cytarabine injection bp 500mg 205 danazol cap ip 50 mg 206 daunorubicin inj ip 20 mg 207 doxorubicin inj ip 50 mg / 25 ml 208 etoposide inj ip 100 mg 209 fluorouracil inj ip 250 mg / 5ml 210 l asparaginase inj 10000 iu 211 leucovorin calcium inj ip / calcium folinate inj ip 10 mg / ml 212 melphalan tab ip 5 mg 213 mercaptopurine tab ip 50 mg 214 methotrexate inj ip 50 mg / 2 ml 215 methotrexate tab ip 2.5 mg 216 paclitaxel inj ip 260 mg 217 paclitaxel inj ip 100 mg 218 tamoxifen tab ip 10 mg 219 vinblastine inj ip 10mg / 10ml 220 vincristine inj ip 1mg ( vial ) / vincristin injection usp 1mg / ml ( amp ) 221 alpha interferon injection interferon alpha 2 concentrated solution ip 3 million unit 222 carboplatin injection ip 150 mg 223 carboplatin injection ip 450 mg 224 cisplatin inj ip 10 mg / 10 ml 225 dacarbazine injection 500 mg usp / bp 226 filgrastim injection ip ( granulocyte colony stimulating factor ) ( sc / iv use ) 300 mcg 227 gemcitabine for injection 200 mg 228 gemcitabine for injection ip 1gm 229 ifosfamide injection ip / bp / usp 1gm 230 imatinib tab ip 400mg 231 methotrexate tablets ip 10 mg 232 mitomycine injection ip 10 mg / mitomycine for injection usp 10 mg 233 oxaliplatin injection usp 50 mg 234 cyclosporin capsule usp / ip 50 mg 235 capecitabine tablet ip 500 mg ( each film coated tablet contains capecitabine ip 500 mg ) 236 letrozole tablet ip 2.5 mg ( each film coated tablet contains letrozole ip 2.5 mg ) 237 temozolomide capsule ip 100 mg ( each hard gelatin capsule contains temozolomide ip 100mg ) 238 thalidomide capsule usp 100 mg ( each hard gelatin capsule contains thalidomide usp 100 mg ) 239 bicalutamide tablet ip 50 mg ( each film tablet contains bicalutamide ip 50 mg ) 240 6 thioguanine tablet usp 40 mg ( each uncoated tablet contains 6 thioguanine usp 40 mg ) 241 zoledronic acid injection ip 4mg vial 242 levodopa and carbidopa tablets ip levodopa 100 mg + carbidopa 10 mg 243 levodopa and carbidopa tab 250 mg+ 25 mg 244 trihexyphenidyl hcl tab ip 2 mg 245 acenocoumarol tab ip / nicoumalone tab ip 2 mg 246 deferasirox tab 100 mg 247 deferasirox tab 500 mg 248 deferiprone cap 250 mg 249 deferiprone cap 500 mg 250 desferrioxamine injection ip 500 mg / vial ( for i.m. inj and i.v s.c. infusion ) 251 dried human anti haemophlic fraction ip ( dried factor viii fraction ip ) 250 iu / vial ( iv use ) 252 enoxaparin sodium inj ip 60 mg 253 ethamsylate inj 250 mg / 2ml ( im / iv ) 254 heparin sodium inj ip 5000 iu / ml ( im / iv use ) 255 human albumin solution ip 20% 256 rh erythropoetin inj ip 10000 iu 257 rh erythropoetin inj ip 2000iu 258 rh erythropoetin inj 4000 iu 259 vitamin k injection each ml contains menadione sodium bisulphite 10mg equivalent to 5.2 mg of menadione. ( aqueous solution ) 260 polygeline 3.5% solution with electrolytes for i.v. infusion 261 factor ix concentrate ( purified ) ip 500 600 i.u. ( human coagulation factor ix ) 262 hydroxyethyl starch ( 130 / 0.4 ) 6 o / o w / v with sodium chloride 0.9 o / o w / v intravenous infusion / balanced electrolyte solution of sodium chloride, sodium acetate, potassium chloride, magnesium chloride intravenous infusion 263 tranexamic acid tablets ip 500 mg 264 warfarin sodium. tab ip 5mg 265 vitamin k 1 ( phytomenadione ) ip 1mg / 0.5ml injection ( detail in rc ) 266 dried factor viii fraction ip ( iv use ) 500 iu / vial 267 dried factor viii fraction ip ( iv use ) 1000 iu / vial 268 n butyl alcohol injection 0.26mg / 5ml, citric acid 2.5mg / 5ml and sod. chloride solution 5 ml size 269 ethamsylate tablet 500 mg ( each uncoated coated tablet contains ethamsylate 500 mg ) 270 feracrylum 1% w / v sterile solution 100 ml 271 tranexamic acid injection ip 100mg / ml 5ml size 272 recombinant f ix 500 iu with diluent 273 3rd generation recombinant f viii 250 iu with diluent 274 3rd generation recombinant f viii 1000 iu with diluent 275 amiodarone tab ip 100 mg 276 amiodarone tab ip 200 mg 277 amiodarone hydrochloride inj 50 mg / ml 278 amlodipine tab ip 2.5 mg 279 amlodipine tablets ip 5 mg 280 atenolol tab ip 50 mg 281 atorvastatin tab ip 10mg 282 clopidogrel tab ip 75 mg 283 digoxin inj ip 0.25 mg / ml 284 digoxin tab ip 0.25 mg. 285 diltiazem tabs ip 30 mg film coated 286 dobutamine inj ip 50mg / ml / 250mg ( vial / ) dobutamine inj ip 250 mg / 5ml ( amp ) 287 dopamine hydrochloride inj ip 40 mg / ml 288 enalapril maleate tab ip 5mg 289 enalapril maleate tab ip 2.5mg 290 isosorbide dinitrate tab ip 5 mg 291 isosorbide mononitrate tabs ip 20 mg 292 lisinopril tab ip 5 mg 293 losartan tab ip 50 mg 294 magnesium sulphate inj. ip 500mg / ml ( 50%w / v ) 295 methyldopa tab ip 250mg film coated 296 nifedipine cap ip 5mg 297 nifedipine tablets ip 10 mg ( sustained release ) 298 nitroglycerin inj 5 mg / ml 299 propranolol tab ip 40 mg 300 streptokinase injection 15 lac units ip 301 verapamil tab ip 40 mg film coated 302 labetalol tab ip 100mg 303 labetalol hcl inj ip 20mg / 4ml 304 aspirin delayed release tablet / aspirin gastroresistant tab ip ( each enteric coated tablet contains acetyl salicylic acid 75 mg ) 305 amlodipine and enalapril maleate tablets ( amlodipine besilate equivalent to amlodipine 5 mg, enalapril maleate 5 mg ) 306 losartan potassium and amlodipine tablets ip ( losartan potassium 50 mg, amlodipine besilate eq to amlopdipine 5mg ) 307 losartan potassium and hydrochlorothiazide tablets ip ( losartan potassium 50 mg, hydochlorothiazide 12.5 mg ) 308 amlodipine and lisinopril tablets amlodipine besilate equivalent to amlodipine 5 mg, lisinopril eq to lisinopril ( anhydrous ) 5 mg 309 amlodipine and atenolol tablet ( amlodipine besilate equivalent to amlodipine 5mg, atenolol 50mg ) 310 atenolol tab ip 25 mg 311 enalapril maleate tablets ip 10 mg 312 lisinopril tablets ip 10 mg 313 lisinopril tab ip 2.5 mg 314 losartan tab ip 25 mg 315 adenosine injection ip 6 mg / 2ml 316 atorvastatin tablets ip 40 mg 317 clopidogrel and aspirin tables, clopidogrel 75 mg and aspirin 75 mg 318 fenofibrate capsules / tab ip 200 mg 319 isoprenaline injection ip 2mg / ml 320 metoprolol tablets ip 25 mg 321 metoprolol succinate extended release tablets ip 50 mg 322 noradrenaline injection ip 2 mg / ml 323 prazosin tablets ( extended release ) 2.5 mg 324 telmisartan tablets ip 40 mg 325 urokinase injection 5 lac unit ( lyophilized ) 326 ramipril tablets ip 2.5 mg 327 glyceryl trinitrate tablets 2.6 mg controlled release tablets 328 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) 329 sotalol hydrochloride tablet usp / bp 40mg ( each film coated tablet contains sotalol hydrochloride usp / bp 40mg ) 330 esmolol hydrochloride injection 10mg / ml 10ml size 331 carvedilol tablet 3.125 mg 332 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) 333 rosuvastatin tablet 10 mg 334 sacubitril 24 mg and valsartan 26 mg tablet 335 chlorhexidine mouthwash ip 0.2 o / o 336 dental gel choline salicylate 8.7 o / o, benzalkonium chloride 0.01 o / o, lignocaine hcl 2 o / o ( flavoured gel base ) 337 tooth gel sodium monofluorophosphate 0.7 o / o and potassium nitrate 5 o / o ( in flavoured base ) 338 gum paint containing tannic acid 2%, cetrimide 0.1%, zinc chloride 1% 339 metronidazole 1% and chlorhexidine gluconade 0.25% gel 340 compound benzoic acid ointment ip benzoic acid 6 o / o + salicylic acid 3 o / o 341 acyclovir cream 5% 342 cetrimide cream ip 15 gm 343 fusidic acid cream ip 2% 344 glycerin ip 400 gm 345 liquid paraffin ip 400 ml 346 miconazole nitrate cream ip 2% 347 povidone iodine ointment 5% 15 gm 348 neomycin bacitracin and sulphacetamide powder ( neomycin 5 mg, bacitracin 250 units, sulphacetamide 60 mg ) 349 silver sulphadiazine cream ip 1% 50gm tube 350 gentian violet topical solution usp 1o / o 351 clotrimazole mouth paint ( clotrimazole 1 o / o w / v ) 352 beclomethasone, neomycin and clotrimazole cream ( beclomethasone dipropionate 0.025 %, neomycin sulphate 0.5 % and clotrimazole 1 % ) 353 gamma benzene hexachloride lotion 1% ( lindane lotion usp ) 354 betamethasone dipropionate cream ip 0.05% 355 betamethasone lotion ip 0.05 o / o 356 clindamycin phosphate gel usp 1 o / o 357 clobetasol propionate cream ip 0.05 o / o 358 glycerin ip 100 ml 359 ketoconazole cream 2% 360 permethrin lotion 5% 361 permethrin cream 5% 362 tretenoin cream usp 0.025% 363 coal tar 6% & salicylic acid 3% ointment 364 calamine lotion ip 100ml 365 powder clotrimazole 1% w / w 30 gm 366 terbinafine cream 1%w / w ( 10 gm tube ) 367 oitment mupirocin ip 2% 368 anti a blood grouping serum ip ( anti a monoclonal serum ) 369 anti b blood grouping serum ip ( anti b mono clonal serum ) 370 anti d ( rh ) blood grouping serum ip / anti d blood grouping serum ip 371 diatrizoate meglumine & diatrizoate sodium inj usp 60% ( iodine conc.= 292 mg / ml ) 372 diatrizoate meglumine and diat sod inj usp 76%w / v ( iodine = 370 mg / ml ) 373 vdrl antigen ( with + ve and ve control ) / rpr slide kit 374 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aquous solution 300 mg iodine / ml 375 iohexol usp ( solution for injection ) non ionic contrast medium in sterile aqueous solution 350 mg iodine / ml. 376 multistix test strip 377 povidone iodine solution ip 5 % 500 ml 378 compound benzoin tincture ip 379 formaldehyde solution ( 34.5 per. 38 per. ) 380 gluteraldehyde solution 2% 381 hydrogen peroxide solution ip 6 o / o ( 20 vol ) 382 lysol ( cresol with soap solution ) ip ( cresol 50 o / o + soap 50 o / o ) 383 povidone iodine scrub solution / cleansing solution 7.5 o / o w / v povidone iodine ( suitable for hand wash ) 384 surgical spirit ip ( 500 ml ) 385 chlorhexidine gluconate solution 5% 250 ml 386 surgical spirit ip ( 100 ml ) 387 povidone iodine solution ip 5% 100ml bottle 388 povidone iodine ointment usp 250 gm 389 povidone iodine solution ip 10 % 390 silver sulphadiazine cream ip 1% 500 gm jar 391 acetazolamide tab ip 250mg 392 frusemide tab ip 40 mg 393 furosemide injection ip 10mg / ml ( im and iv use ) 394 hydrochlorthiazide tab ip 12.5 mg 395 mannitol inj ip 20% w / v 396 spironolactone tab ip 25mg 397 torsemide tab 10 ip mg 398 hydrochlorthiazide tab ip 25mg 399 torsemide inj 10 mg / ml 400 spironolactone tablets ip 50 mg 401 ciprofloxacin 0.3 o / o and dexamethasone 0.1 o / o ear drops ciprofloxacin and dexamethasone otic suspension usp 402 clotrimazole 1 o / o with beclomethasone dipropionate 0.025 o / o ear drops 403 neomycin, polymixin b and hydrocortisone ear drops neomycin sulphate 3400 iu, polymixin b sulphate 10000 iu, and hydrocortisone 10 mg per ml neomycin and polymixin b sulfate and hydrocortisone otic solution usp 404 ceruminolytic drops ( wax dissolving ear drops ) paradichlorobenzene 2 o / o , benzocaine 2.7 o / o , chlorbutol 5 o / o, turpentine oil 15 o / o 405 drotaverine hydrochloride inj 40 mg / 2 ml 406 ointment containing lidocaine ip 3 o / o zinc oxide ip 5 o / o , hydrocortisone ip 0.25 o / o, allantoin ip 0.5 o / o 407 antacid tablets.formula, each chewable tablet contains magnesium trisilicate 250 mg, dried aluminium hydroxide gel 120 mg, peppermint oil 408 antacid liquid, each 5ml contains dried aluminium hydroxide gel 250 mg, magnesium hydroxide 250mg, activated polydimethyl siloxane 50mg 409 bisacodyl tab ip 5 mg 410 dicyclomine tab ip 10 mg 411 dicyclomine inj ip 10 mg / ml 412 dicyclomine hydrochloride oral solution ip 10mg / 5ml 413 domperidone suspension ip 5mg / 5ml 414 domperidone tab ip 10 mg 415 hyoscine butylbromide inj ip 20 mg / ml 416 loperamide tab ip 2 mg 417 metoclopramide inj ip 10mg / 2ml 418 metoclopramide tab ip 10 mg 419 omeprazole cap ip 20 mg 420 ondansetron inj ip 2mg / ml 421 ors powder ip 422 pentoprazole inj 40 mg 423 ranitidine hcl injection ip 50mg / 2ml 424 ranitidine tab ip 150mg film coated 425 sodium phosphates enema bp each 100ml contains sodium dihydrogen phosphate dihydrate 10 o / o disodium hydrogen phosphate dodecahydrate 8 o / o 426 hyoscine butyl bromide tablets ip 10mg 427 drotaverine tab ip 40 mg 428 ranitidine tab ip 300mg film coated 429 dicyclomine hydrochloride and activated dimethicone suspension each ml contains dicyclomine hydrochloride 10mg activated dimethicone 40mg 430 dicyclomine and paracetamol tablets dicyclomine hydrochloride 20 mg + paracetamol 325 mg tablets 431 metoclopramide hydrochloride syrup ip 5 mg / 5ml 432 domperidone oral drops 10mg / ml ( 10ml ) 433 drotaverine and mefenamic acid tablets drotaverine 80 mg and mefenamic acid 250 mg 434 lactic acid bacillus tab 60 million spores 435 lactulose solution usp / bp 10gm / 15ml or 3.35 gm / 5ml 436 liquid paraffin ip 100 ml 437 ondansetron orally disintegrating tablets ip 4mg 438 pantoprazole 40mg and domperidone 30mg sr cap ip pantoprazole as enteric coated pellets and domperidone as sr pellets 439 ursodeoxycholic acid tablets ip 300 mg 440 doxylamine succinate 20 mg & pyridoxine hydrochloride 20 mg tablet ( each enteric coated tablet contains doxylamine succinate usp 20 mg & pyridoxine hydrochloride ip 20 mg ) 441 prochlorperazine mesylate injection 12.5mg / ml 5ml size 442 probiotic sachets 1 gm size ( each gram sachet contains saccharomyces boulardii 250mg & lactic acid bacillus 150 million spores ) 443 mesalamine tablet usp 1.2 gm enteric coated ( each enteric coated prolonged release tablet conatin mesalamine usp 1.2 gm ) 444 allopurinol tablets ip 100 mg 445 hydroxychloroquine sulphate tablets 200mg 446 leflunomide tablets ip 10mg ( film coated ) 447 leflunomide tablets ip / usp 20mg ( film coated ) 448 sulfasalazine gastroresistant tablets ip 500 mg ip 449 biphasic isophane insulin inj ip ( 30 % soluble insulin and 70 % isophane insulin ) inj. 40 iu / ml ( r dna origin ) 450 carbimazole tabs ip 5 mg ( film coated ) 451 carboprost tromethamine injection ip each ml contains carboprost 0.25 mg / ml 452 clomifene tab ip 25 mg 453 clomiphene tab ip 50 mg 454 conjugated estrogen tabs usp 0.625 mg. 455 dinoprostone cream / gel 0.5 mg dinoprostone in syringe 456 ethinyloestradiol tabs ip 50 mcg 457 glibenclamide tab ip 5 mg 458 gliclazide tab ip 40 mg 459 glimepiride tab ip 2 mg 460 glimepiride tab ip 1mg 461 glipizide tab ip 5mg 462 hydroxyprogesterone inj ip 250mg / ml 463 isophane insulin inj ip 40 iu / ml 464 metformin tab ip 500 mg ( film coated ) 465 norethisterone tab ip 5 mg 466 pioglitazone tab ip 15 mg 467 progesterone inj 200 mg / 2ml 468 insulin injection ip ( soluble insulin / neutral insulin injection ) 40 iu / ml ( r.dna origin ) 469 thyroxine sodium tablets ip 100mcg 470 metformin hydrochloride ( sustained release tablets ip 1000 mg 471 glipizide and metformin hydrochloride tablets usp ( glipizide 5 mg, metformin hydrochloride 500 mg ) 472 glibenclamide and metformin hydrochloride ( sr ) tablets glibenclamide 5 mg, metformin hydrochloride 500 mg ( sustained release ) 473 metformin hcl ( sustained release ) and glimepiride tab metformin hcl ( sustained release ) 500mg , glimepiride 1mg 474 metformin hydrochloride ( sustained release ) and glimepiride tablets ip ( metformin hydrochloride ( sustained release ) 500 mg, glimipiride 2mg ) 475 glimepiride, pioglitazone and metformin hydrochloride ( sustained release ) tablets each tablet contains glimepiride 2mg, pioglitazone 15 mg, metformin hydrochloride ( sustained release ) 500 mg 476 gliclazide and metformin tablets ( gliclazide 80 mg and metformin hcl 500 mg ) 477 medroxyprogesterone acetate tablets ip 10 mg 478 thyroxine tablets ip 50 mcg 479 insulin glargine 3ml ( 100iu / ml ) with 15 insulin syringes and needles / cartridge 3ml ( 100iu / ml ) with 15 needles and 1 pen per 20 cartridges 480 tenaligliptin tablet ip 20mg 481 insulin glargine 10 ml vial ( 100 iu / ml ) with 30 insuline syringes with needle 482 human anti d immunoglobulin injection 300mcg ( im use ) 483 human anti d immunoglobulin 150 mcg 484 human rabies immunoglobulin inj 150 iu / ml 485 rabies vaccine human ( cell culture ) ip ( intradermal ) 2.5 iu 486 rabies vaccine human ( cell culture ) ip ( intramuscular ) 2.5 iu / dose 487 snake venum anti serum ip ( lyophilized ) polyvalent anti snake venum, serum enzyme refined.contain purified equine globulins.1 ml of serum neutralizes 0.6 mg of cobra venum, 0.45 mg of common kraite ( bungaras ) venum ( details in rc ) 488 tetanus immunoglobulin ip 250 iu / vial 489 tetanus vaccine ( adsorbed ) ip 5 ml vial 490 rabies antiserum ip ( equine ) 300 units per ml contains equine anti rabies immunoglobulin fragments ( i.m. / sc use ) 491 diphtheria antitoxin 10000 iu 492 hepatitis b immunologlobin injection ip 200 i.u 493 atracurium inj 10 mg / ml 494 glycopyrrolate inj ip 0.2 mg / ml 495 midazolam inj ip 1 mg / ml 496 neostigmine inj ip 0.5 mg / ml 497 neostigmine tab ip 15 mg 498 succinylcholine inj. ip 50 mg / ml ( iv use ) 499 valethamate bromide inj 8mg / ml 500 vecuronium bromide for injection 4mg ( freeze dried ) 501 chlorzoxazone , diclofenac sodium & paracetamol tablets ( chlorzoxazone 250mg , diclofenac sodium 50mg paracetamol 325 mg ) 502 neostigmine injection ip 2.5mg / 5ml 503 tropicamide eye drop ip 1o / o 504 atropine eye ointment ip 1% 505 atropine sulphate ophthalmic solution usp 1% 506 chloramphenicol eye drops ip 0.5 0 / 0 507 ciprofloxacin eye drops ip 0.3 o / o w / v 508 ciprofloxacin ophthalmic ointment usp 0.3% 509 hydroxypropylmethyl cellulose solution 20 mg / ml 510 tobramycin and dexamethasone ophthalmic suspension usp 0.3 o / o +0.1 o / o 511 tobramycin eye drops 0.3% [ 331 ] 512 tobramycin ophthalmic ointment usp 0.3% 513 flurbiprofen sodium ophthalmic solution ip 0.03 o / o w / v 514 hyaluronidase injection ip each vial contains hyaluronidase ip 1500 i.u. 515 lidocaine hcl topical solution usp 4% 516 fluconazole eye drops 0.3% 517 timolol eye drops ip 0.5 o / o w / v 518 homatropine eye drops ip 2% 519 travoprost eye drops ip 0.004 o / o 520 brimonidine tartrate & timolol maleate eye drops 0.15% + 0.5% 521 betaxolol eye drops 0.5 o / o 522 carboxymethylcellulose eye drops ip 0.5% 523 phenylephrine hydrochloride opthalmic solution usp / phenylephrine eye drops bp 5% 524 acyclovir eye ointment ip 3% w / w 5gm size 525 eye drop moxifloxacin 0.5% w / v ophthalmic solution ip 5ml size 526 chloramphenicol 1% w / w eye ointment ip, 3gm size 527 isoxsuprine inj ip 5 mg / ml 528 isoxsuprine tab ip 20 mg 529 methylergometrine inj ip 0.2 mg / ml 530 methylergometrine tab ip 0.125 mg 531 misoprostol tab ip 200 mcg 532 oxytocin inj ip 5 iu / ml 533 mifepristone tab ip 200mg 534 natural micronised progesteron soft gelatin capsule 200 mg ( each soft gelatin capsule contains progesteron ip 200 mg ) / natural micronised progesteron tablet 200 mg ( each tablet contains progesteron ip 200 mg ) 535 cabergoline tablet ip 0.5mg ( each uncoated coated tablet contains cabergoline ip 0.5mg ) 536 human chorionic gonadotropin injection ip 5000 i.u. 537 alprazolam tab ip 0.25 mg 538 alprazolam tab ip 0.5mg 539 amitriptyline tab ip 25mg film coated 540 chlordiazepoxide tablets ip 10mg 541 chlorpromazine tablets ip 100 mg ( coated tablet ) 542 chlorpromazine tablets ip 25 mg ( sugar coated ) 543 chlorpromazine tablets ip 50 mg ( coated tablets ) 544 chlorpromazine inj. ip 25mg / ml 545 diazepam inj ip 10mg / 2ml ( 1m / iv use ) 546 diazepam tab ip 5 mg 547 escitalopram tab ip 10 mg 548 fluoxetine cap ip 20 mg 549 haloperidol inj ip 5 mg / ml 550 haloperidol tab ip 1.5 mg 551 haloperidol tab ip 5 mg 552 imipramine tab ip 25 mg ( coated tab ) 553 imipramine tab ip 75 mg ( coated ) 554 lithium carbonate tab ip 300 mg 555 lorazepam inj ip 2 mg / ml 556 olanzapine tab ip 5 mg 557 risperidone tab 2mg 558 risperidone tab 1 mg 559 sertraline tab ip 50 mg 560 trifluperazine tab ip 5 mg coated 561 clonazepam tablet 0.5 mg 562 levosulpiride tablet 25 mg ( each uncoated tablet contains levosulpiride 25 mg ) 563 lorazepam tablet ip 2 mg ( each uncoated tablet contains lorazepam ip 2 mg ) 564 zolpidem tablet 5 mg 565 aminophylline inj ip 25 mg / ml 566 beclomethasone inhalation ip 200 mcg / dose 567 budesonide nebulizer suspension 0.25mg / ml 568 cough syrup each 5 ml contains chloropheniramine maleate ip 3 mg, ammonium chloride 130 mg, sodium citrate 65 mg, menthol 0.5 mg, syrup q.s. 569 ipratropium bromide nebulizer solution 250 mcg / ml 570 salbutamol tablet ip 4 mg 571 salbutamol inhalation 100 mcg / dose 572 salbutamol nebuliser solution bp 5 mg / ml 573 salbutamol tab ip 2 mg 574 theophylline and etofylline injection ( anhydrous theophylline 50.6mg + etofylline 169.4 mg ) 575 theophylline and etofylline tablets ( theophylline ip 23mg + etofylline 77 mg ) 576 theophylline tablet 400mg sustained release / controlled release ( theophylline prolonged released tablet ip ) 577 salbutamol syrup ip 2mg / 5ml 578 dextromethorphan hbr syrup ip 13.5mg / 5ml 579 saline nasal solution ( drops ) ( sodium chloride 0.65 o / o ) 580 formoterol fumerate & budesonide powder for inhalation ip 6 mcg + 200 mcg 581 budesonide powder for inhalation 200 mcg 582 ipratropium powder for inhalation ip 40 mcg 583 terbutaline tablets ip 2.5 mg 584 xylometazoline nasal drops ip 0.1% 585 cough syrup / expectorant ( 50 ) ml 586 acebrophylline tablet / capsule 100 mg 587 compound sodium lactate inj. ip 588 dextrose inj ip 25% w / v 589 dextrose inj ip 10% 590 dextrose inj ip 5% 591 multiple electrolytes and dextrose injection type i ip ( electrolyte p injection ) 592 multiple electrolytes and dextrose injection type iii ip electroylte m injection ( i.v. ) 593 potassium chloride inj. 0.15 gm / ml 594 potassium chloride oral solution u.s.p 500mg / 5ml 595 sodium chloride and dextrose injection ip 0.9 o / o + 5 o / o 596 sodium chloride inj ip 500 ml 597 sodium chloride injection ip 100 ml 598 ringer acetate infusion 500 ml 599 sodium chloride 0.45% w / v polypack 500 ml 600 finasteride tablets ip 5 mg 601 tamsulosin hcl tablets / capsule 0.4 mg 602 flavoxate tablets ip 200 mg ( coated tablet ) 603 sodium bicarbonate tablet usp 1 gm ( each film coated tablet contains sodium bicarbonate usp 1 gm ) 604 phenazopyridine tablet 5 mg 605 dutasteride tablet 0.5 mg 606 alkylizer syrup 1.4 gm / 5 ml ( 100 ml ) ( disodium hydrogen citrate ) 607 betahistine tab ip 8 mg 608 betahistine tab ip 16 mg 609 cinnarizine tablets ip 25 mg 610 cinnarizine tablet ip 75 mg 611 ascorbic acid tab ip 500 mg 612 calcium gluconate inj ip 10% ( iv use ) 613 ferrous sulphate with folic acid tab ip each film coated tab. containing dried ferrous sulphate ip equiv 100 mg elemental iron and folic acid ip 0.5 mg 614 ferrous sulphate with folic acid tab ( paediatric ) ip each film coated tab. containing dried ferrous sulphate ip eqivalent to 20mg elemental iron and folic acid ip 100 mcg 615 folic acid tab ip 5 mg 616 multivitamin drops each ml contains vit a 3000 iu, vit d3 300 iu, vit b1 1mg, riboflavine phosphate sodium 2mg, d panthenol 2.5mg, niacinamide 10mg, pyridoxine hcl 1mg, cyanocobalamin 1mcg, lysine hcl 10mg 617 multivitamin tablets nfi formula sugar coated vit a 2500 iu vit b1 2mg vit b6 0.5mg vit c 50mg calcium pantothenate 1mg vit d3 200iu vit b2 2 mg niacinamide 25mg folic acid 0.2 mg 618 vitamin b complex inj nfi 619 vitamin b complex tablet nfi ( prophylactic ) b1 2mg b2 2mg b6 0.5mg niacinamide 25mg calcium pantothenate 1mg ( with appropriate overages ) 620 vitamin a paediatric oral solution ip ( vitamin a concentrate oil ip ) each ml contains vitamin a 100000 iu 621 calcium and vitamin d3 suspension ( each 5 ml contains calcium carbonate equivalent to elemental calcium 250 mg, vitamin d3 125 iu ) 622 iron and folic acid suspension. each 5ml contains ferrous fumerate equivalent to elemental iron 100mg, folic acid 500 mcg 623 zinc sulphate dispersible tablets ip elemental zinc 10 mg 624 iron sucrose injection usp / bp 20mg / ml ( for iv use ) each ml contains ferric hydroxide in complex with sucrose equiv. to elemental iron 20 mg 625 calcium with vitamin d tablets usp / calcium and colecalciferol tablets bp / calcium and vitamin d3 tablets ip ( elemental calcium 500 mg, vitamin d3 250 iu ) ( non chewable ) 626 cholecalciferol granules 60, 000 iu / gm 627 mecobalamin inj 500 mcg / ml 628 pyridoxine tablet ip 10 mg 629 pyridoxine tablet ip 40mg 630 thiamine tablets ip 100 mg 631 calcitriol capsules ip 0.25 mcg 632 methyl cobalmine tablet 500mcg 633 methyl cobalmine tablet 1500mcg 634 vitamin d3 oral solution 60000 iu 635 ferric carboxymaltose injection 50 mg / ml 10 ml size 636 multi vitamin syrup 637 flunarizine tab 5 mg 638 black disinfectant fluid ( phenyl ) as per schedule o grade iii 639 conc haemodialysis fluid b.p acetate concentrate 10 litre can 640 peritonial dialysis solution ip 641 sodium bicarbonate inj ip 7.5% w / v 642 water for inj ip 643 normal human intravenous immunoglobulin 5g / 100ml 644 pregabalin cap ip 75 mg 645 surfactant for intratrecheal instillation ( natural bovine lung surfactant ) 646 concentrated solution for hameodialysis bp sodium hydrogen carbonate concentrate in 10 litre cans 647 pyridostigmine tablet ip 60 mg ( each tablet contains pyridostigmine ip 60 mg ) 648 caffeine citrate usp injection 20mg / ml ( equivalent to 10 mg caffeine base / ml ) 3ml size 649 vitamin e capsule 400 mg 650 inj poractant alpha 80 mg / ml in pack of 1.5 ml ( detail in rc ) 651 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 40 mm length 76 cm ) size 1 / 0 652 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 20 mm length 76 cm ) size 3 / 0 653 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 2 / 0 654 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 30 mm length 76 cm ) size 1 / 0 655 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 40mm length 76 cm ) size 1 / 0 656 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 3 / 8 cir rb needle 30 mm length 76 cm ) size 2 / 0 657 absorbable surgical suture ( sterile catgut ) bp / usp needled suture chromic ( 1 / 2 cir rb needle 45 mm length 100 cm ) size 1 658 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 1 / 2cir rb needle 20mm length 70 cm 659 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 30mm length 90 cm 660 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) 1 / 2 cir rb needle size 1 / 0 30mm length 90 cm 661 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm 662 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir rb needle40mm length 90 cm 663 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed 664 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) 665 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 2 / 0 1 / 2 cir rb needle 40mm l 90cm 666 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 / 0 ( 1 / 2 cir rb needle 40mm length 90 cm ) 667 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm 668 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm 669 chromic catgut suture ( 3 / 8 cir rcutting needle 16 mm, suture length 76 cm ) size 5 / 0 ( details in rc ) 670 chromic catgut suture ( 3 / 8 cir cutting needle 8 mm, suture length 35 cm ) size 6 / 0 ( details in rc ) 671 chromic catgut suture ( 3 / 8 cir r cutting needle 19 mm needle, suture length 76 cm ) size 4 / 0 ( details in rc ) 672 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 1 / 2 cir rb needle 20mm, length 76 cm ) 673 non absorbable surgical suture, sterilised needled black braided silk size 3 / 0 ( 3 / 8cir reverse cutting needle 26mm, length 76 cm ) 674 non absorbable surgical suture, sterilised needled black braided silk size 2 / 0 ( 3 / 8cir reverse cutting needle 45mm, length 76 cm ) 675 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 8 / 0 ( 3 / 8 cir micropoint round body , 6mm length 38 cm ) 676 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) 677 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 2 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 678 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 1 / 0 ( 3 / 8 cir r cutting needle 45mm length 70 cm. ) 679 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 5 / 0 ( 3 / 8cir rb 16 mm needle, length 70 cm ) 680 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 / 0 ( 1 / 2 cir rb needle 30mm length 90 cm ) 681 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy needle 45mm length 90 cm ) 682 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm 683 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) 684 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 3 / 8 cir cutting needle 25mm length 45 cm ) 685 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 1 ( 1 / 2 cir rb heavy 40mm, length 90 cm ) 686 b.b silk suture ( 3 / 8 cir rb needle 20mm, length 76 cm size 4 / 0 ( details in rc ) 687 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) 688 absorbable surgical sutures sterilised needled monofilamentpolyglecaprone / polyglyconate size 3 / 0 ( 3 / 8 circle cutting 25mm needle, suture length of 70cm ) 689 absorbable surgical suture ( synthetic ) sterilised needled suture monofilament polydioxanone violet size 1 / 0 ( 1 / 2 circle rb 30mm needle, length 70cm ) 690 absorbable surgical suture ( synthetic ) antibacterial coated sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 691 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle ct round bodied 40mm, gs needle, suture length 90 cm 692 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 2 / 0 1 / 2 circle round bodied 30mm, suture length 90 cm 693 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 1 / 2 circle reverse cutting, os 40mm, suture length 90 cm 694 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 1 / 0 1 / 2 circle reverse cutting 36mm, os needle, suture length 90 cm 695 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 1 / 2 circle round bodied 20mm, suture length 70 cm 696 absorbable surgical suture ( synthetic ) antibacterial with sterilised needled suture ( braided coated polyglactin / polyglycolic acid violet ) size 3 / 0 3 / 8 circle r cutting, ps 1, 24mm, suture length 70 cm 697 absorbable gelatin sponge 80 x 50x 10mm ( details in rc ) 698 absorbent cotton wool ip 500 gm 699 asepto syringe with transparent bulb sterile, 60 ml 700 blood administration set blood transfusion set ( details in rc ) 701 gloves size 6.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 702 gloves size 6.5 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) 703 gloves size 7 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 704 gloves size 7 inches, powder free ( disposable sterile surgical rubber gloves ) ( details in rc ) 705 gloves size 7.5 inches, powdered ( disposable sterile surgical rubber gloves ) ( details in rc ) 706 gloves size 7 .5inches, powder free ( disposablesterile surgical rubber gloves ) ( details in rc ) 707 suction catheter, sterile.size: fg 5 ( details in rc ) 708 suction catheter, sterile. size: f g 6 ( details in rc ) 709 suction catheter, sterile. size: f g 8 ( details in rc ) 710 suction catheter, sterile. size: f g 10 ( details in rc ) 711 suction catheter, sterile. size: f g 12 ( details in rc ) 712 suction catheter, sterile. size: f g 14 ( details in rc ) 713 suction catheter, sterile. size: f g 16 ( details in rc ) 714 suction catheter, sterile. size: f g 18 ( details in rc ) 715 suction catheter, sterile. size: f g 20 ( details in rc ) 716 suction catheter, sterile. size: f g 22 ( details in rc ) 717 catheter, size 8 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 718 catheter, size 10 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 719 catheter, size 16 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 720 catheter, size 18 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 721 catheter, size 20 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 722 catheter, size 22 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 723 catheter, size 24 ( foleys ballon catheter sterile, 2 way for urinary drainage, single use, ) silicon coated natural latex material ( details in rc ) 724 infant feeding tube size 10fg ( details in rc ) 725 infant feeding tube size 8fg ( details in rc ) 726 infant feeding tube size 5fg ( details in rc ) 727 perfusion set with airway and needle, ( adult use ) sterile disposable ( details in rc ) 728 measured volume infusion set with airway and needle ( paediatric use ) sterile disposable 729 infusion set with microdrip, ( i.v. ) sterile disposable ( details in rc ) 730 insulin syringe ( 40 units ) with ( fixed ) 30 g needle shall conforn to is 12227 731 sterile disposable ( single use ) teflon / ptfe i.v cannula with integrated 3 way stop cock size 16g ( details in rc ) 732 sterile disposable ( single useteflon / ptfe i.v. cannula with integrated 3 way stop cock. ) size 18g ( details in rc ) 733 sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 20 g ( details in rc ) 734 sterile disposable ( single use ) teflon / ptfe i.v. cannula with integrated 3 way stop cock.size 22g ( details in rc ) 735 sterile disposable ( single use ) teflon / ptfe i.v. cannula without port size 24g ( details in rc ) 736 mucus extractor sterile ( details in rc ) 737 nasal oxygen set, twin bore all sizes adult ( details in rc ) 738 nasal oxygen set, twin bore all sizes paediatrics ( details in rc ) 739 paper adhesive plaster 1 inch x 9.0 mts ( with cutter ) non woven adhesive tape 740 paper adhesive plaster 2 inch x 9.0 mts ( with cutter ) non woven adhesive tape 741 paper adhesive plaster 3 inch x 9.0 mts ( with cutter ) non woven adhesive tape 742 plaster of paris bandage 15cm x 2.7 mts / roll 743 plaster of paris bandage 10cm x 2.7mts 744 ryles tube / nasogastric tube size: 10 ( details in rc ) 745 ryles tube / nasogastric tube size: 12 ( details in rc ) 746 ryles tube / nasogastric tube size:14 ( details in rc ) 747 ryles tube / nasogastric tube size: 16 ( details in rc ) 748 ryles tube / nasogastric tube size: 18 ( details in rc ) 749 scalp vein set ( disposable ) size 18g ( details in rc ) 750 scalp vein set ( disposable ) size 20g ( details in rc ) 751 scalp vein set ( disposable ) size 22g ( details in rc ) 752 scalp vein set ( disposable ) size 24 g ( details in rc ) 753 syringe 2 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) 754 syringe 5 ml hypodermic with needle attached 24g, sterile, single use disposable ( details in rc ) 755 syringe 10 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) 756 syringe 20 ml hypodermic with needle attached 22g, sterile, single use disposable ( details in rc ) 757 surgical blade sterile, size 11 ( details in rc ) 758 surgical blade sterile, size 15 ( details in rc ) 759 surgical blade sterile, size 22 ( details in rc ) 760 suture needles curved 1 / 2 circle round body assorted size 11 15 ( details in rc ) 761 suture needles curved 1 / 2 circle round body assorted size 1 5 ( details in rc ) 762 suture needles curved 1 / 2 circle round body assorted size 16 20 ( details in rc ) 763 suture needles curved 1 / 2 circle round body assorted size 6 10 ( details in rc ) 764 suture needles curved and cutting 1 / 2 circle cutting size 6 10 ( details in rc ) 765 suture needles curved and cutting 1 / 2 circle size 11 15 ( details in rc ) 766 suture needles curved and cutting 1 / 2 circle size 16 20 ( details in rc ) 767 suture needles curved and cutting size 1 5 ( details in rc ) 768 sterile disposable spinal needle for single use. 22g x 3 1 / 2 inch ( details in rc ) 769 sterile disposable spinal needle for single use. 25g x 3 1 / 2 inch ( details in rc ) 770 urine collecting bag, disposable 2000 ml ( details in rc ) 771 endotracheal tube, plain size 2.5 ( details in rc ) 772 endotracheal tube, plain size 3 ( details in rc ) 773 endotracheal tube, plain size 3.5 ( details in rc ) 774 endotracheal tube, plain size 4 ( details in rc ) 775 endotracheal tube, plain size 4.5 ( details in rc ) 776 endotracheal tube, plain size 5 ( details in rc ) 777 endotracheal tube, plain size 5.5 ( details in rc ) 778 endotracheal tube, plain size 6 ( details in rc ) 779 endotracheal tube, plain size 6.5 ( details in rc ) 780 endotracheal tube, plain size 7 ( details in rc ) 781 endotracheal tube, plain size 7.5 ( details in rc ) 782 endotracheal tube, plain size 8 ( details in rc ) 783 endotracheal tube, plain size 8.5 ( details in rc ) 784 endotracheal tube, cuffed size 4 ( details in rc ) 785 endotracheal tube, cuff size 4.5 ( details in rc ) 786 endotracheal tube, cuff size 5 details in rc 787 endotracheal tube, cuff size 6 ( details in rc ) 788 endotracheal tube, cuff size 6.5 ( details in rc ) 789 endotracheal tube, cuff size 7 ( details in rc ) 790 endotracheal tube, cuff size 7.5 ( details in rc ) 791 endotracheal tube, cuff size 8 ( details in rc ) 792 endotracheal tube, cuff size 8.5 ( details in rc ) 793 endotracheal tube, cuff size 9 ( details in rc ) 794 tracheostomy tube, plain all sizes ( details in rc ) 795 tracheostomy tube ( pvc ) , cuffed all sizes ( details in rc ) 796 abdominal drain kit ( with collection bag 2000 ml size 24 ( details in rc ) 797 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) size 28 ( details in rc ) 798 abdominal drain kit, sterile, having drainage cather and collection bag ( 2000 ) ml size 32 ( details in rc ) 799 corrugated drainage sheet all sizes ( details in rc ) 800 polypropylene nonabsorbable synthetic surgical mesh 7.6cm x 15cm or 7.5cm x 15cm 801 polypropylene nonabsorbable synthetic surgical mesh 15 cm x 15 cm 802 sterilized umbilical cotton tape width 3 mm, length 75 cm ( details in rc ) 803 bone wax sterilised 804 skin graft knife blade ( sterile ) ( details in rc ) 805 k wire, length 375 mm; 1mm ( details in rc ) 806 k wire, length 375 mm; 1.6mm ( details in rc ) 807 k wire, length 375 mm; 1.8mm ( details in rc ) 808 face mask, disposable ( details in rc ) 809 surgical cap disposable ( for surgeons ) ( details in rc ) 810 surgical cap, disposable ( for nurses ) ( details in rc ) ( details in rc ) 811 foldable intra ocular lense with injector ( details in rc ) 11 to 17.5 812 foldable intra ocular lense with injector ( details in rc ) 18 to 24 813 foldable intra ocular lense with injector ( details in rc ) 24.5 to 28.5 814 standard pama intra ocular lenses ( details in rc ) 11 to 17.5 815 standard pama intra ocular lenses ( details in rc ) 18 to 24 816 standard pama intra ocular lenses ( details in rc ) 24.5 to 28.5 817 disposable sterile surgical rubber gloves size 8 inches, powdered 818 disposable sterile surgical rubber gloves size 8 inches, powder free 819 rubber examination gloves, non sterile, extra small ( details in rc ) 820 rubber examination gloves, size small ( details in rc ) 821 rubber examination gloves, size medium ( details in rc ) 822 rubber examination gloves made of natural rubber latex, non sterile, size large ( details in rc ) 823 pressure monitoring line / high pressure extension line ( details in rc ) 824 urine collecting bag for new born / paediatric urine collection bag, capacity 100ml ( details in rc ) 825 umbilical catheter for new born, all sizes ( details in rc ) 826 umbilical cord clamp ( details in rc ) 827 absorbable oxidized regenerated cellulose netsize 2 x 3 topical absorbable haemostatic bactericidal property ( details in rc ) 828 close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 16 ( details in rc ) 829 close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, catheter size 18 ( details in rc ) 830 t tube for common bile duct drainage, length 20x60 cm, size ( details in rc ) 831 bone cement 832 sanitary napkin beltless ( details in rc ) 833 sanitary pads belt type ( details in rc ) 834 sanitary napkin beltless with wings ( details in rc ) 835 oxygen mask ( adult ) 836 oxygen mask ( pediatric ) 837 foleys catheter no. 14 ( detail in rc ) 838 nelaton catheter size 14 fg ( detail in rc ) 839 ecg electrode ( detail in rc ) 840 surgical blade sterile, size 23 single peel package in metal foil as per is 3319 ( detail in rc ) 841 sterile hypodermic syringe with needle attached, 22g, single use 50 ml ( detail in rc ) 842 urethral catheter 90 ( fg 14 ) made up of medical grade pvc ( detail in rc ) 843 urethral catheter 91 ( fg 10 ) , made up of medical grade pvc ( detail in rc ) 844 vaccum suction set, 2.5 meter length ( detail in rc ) 845 3 way stop cock , non pyrogenic and single use, should be leak proof, with smooth movements ( detail in rc ) 846 3 way stop cock with extension tube ( vein o extension line ) size 10cm ( non pyrogenic & single use ) ( detail in rc ) 847 3 way stop cock with extension tube ( vein o extension line ) size 50cm ( non pyrogenic & single use ) ( detail in rc ) 848 3 way stop cock with extension tube ( vein o extension line ) size 100cm ( non pyrogenic & single use ) ( detail in rc ) 849 3 way stop cock with extension tube ( vein o extension line ) size 150cm ( non pyrogenic & single use ) ( detail in rc ) 850 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 16 ) ( detail in rc ) 851 abdominal drain kit, sterile, having drainage catheter and collection bag ( 2000 ml ) ( size 20 ) ( detail in rc ) 852 nasal pronge neonatal ( flexible medical grade, 2 meter long, multichannel kink resistance tube ( detail in rc ) 853 elastic adhesive bandage bp 10cm x 1mtr stretched length adhesive material should have good quality sticking property ( detail in rc ) 854 sterile disposable ( single use teflon / ptfe i.v cannula with integrated 3 way stop cock size 26g ( detail in rc ) 855 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for ventilator without vent ( detail in rc ) 856 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for ventilator without vent ( detail in rc ) 857 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult large size for bipap with vent ( detail in rc ) 858 niv mask ( noninvasive ventilation mask ) oro nasal covering ( nose & mouth ) mask adult medium size for bipap with vent ( detail in rc ) 859 niv mask ( noninvasive ventilation mask ) oro nasal mask paediatric with bronchoscopy and co2 and o2 port with chin support ( detail in rc ) 860 nebulization mask adult ( detail in rc ) 861 nebulization mask paediatric ( detail in rc ) 862 oseltamivir capsule ip 75 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 75 mg ) 863 oseltamivir capsule ip 45 mg capsule ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 45 mg ) 864 oseltamivir capsule ip 30 mg ( each capsule contains oseltamivir phosphate equivalent to oseltamivir 30 mg ) 865 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 866 oseltamivir phosphate for oral suspension ip 12 mg / ml ( each ml contains 12 mg oseltamivir base after reconstitution ) 867 act kit containing 3 tablets of artesunate ( 25mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 250mg+12.5mg ) 868 act kit containing 3 tablets of artesunate ( 50 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) 869 act kit containing 3 tablets of artesunate ( 100 mg each ) and 1 tablet of sulphadoxine and pyrimethamine ( 750mg+37.5mg ) 870 act kit containing 3 tablets of artesunate ( 150 mg each ) and 2 tablet of sulphadoxine and pyrimethamine ( 500mg+25mg ) 871 each combi bliste pack: containing 3 tablets of artesunate ( 200 mg each ) and 2 tablet of sulphadoxine pyrimethamine ( 750mg+37.5mg ) each or 3 tablets of sulphadoxine pyrimethamine ( 500+25 ) mg 872 rh erythropoetininj 4000 iu [ 179 ] 873 cefepime injection ip 500 mg [ 510 ] 874 linezolid tablets ip 600 mg [ 516 ] 875 linezolid inj200mg / 100ml [ 517 ] 876 vancomycin for intravenous infusion ip 500 mg [ 523 ] 877 isoprenaline injection ip 2mg / ml [ 551 ] 878 finasteride tablets ip 5 mg [ 575 ] 879 leflunomide tablets ip 10mg ( film coated ) [ 600 ] 880 leflunomide tablets ip / usp 20mg ( film coated ) [ 601 ] 881 sulfasalazine gastroresistant tablets ip 500 mg ip [ 602 ] 882 betaxolol eye drops 0.5 o / o [ 612 ] 883 topiramate tablet ip 25 mg ( each film coated tablet contains topiramate ip 25 mg ) [ 705 ] 884 ceftriaxone 1 gm + tazobactum 125 mginjection [ 708 ] 885 tranexamic acid injection ip 100mg / ml 5ml size [ 747 ] 886 clonidine hydrochloride tablet ip 0.1 mg ( each tablet contains clonidine hydrochloride ip 0.1 mg ) [ 751 ] 887 esmolol hydrochloride injection 10mg / ml 10ml size [ 753 ] 888 rosuvastatin tablet ip 20 mg ( each film coated tablet contains rosuvastatin calcium ip equivalent to rosuvastatin 20 mg ) [ 756 ] 889 rosuvastatin tablet 10 mg [ 757 ] 890 sacubitril 24 mg and valsartan 26 mg tablet [ 758 ] 891 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 1 1 / 2 cir tapercut needle ( heavy ) 40mm length 90 cm [ r12 ] 892 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 ( 1 / 2 cir conventional 25mm length 90 cm ) undyed [ r14 ] 893 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 ( 1 / 2 cir rb needle 20mm length 70 cm ) [ r15 ] 894 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 3 / 0 3 / 8 circle cutting needle 22mm length 45 cm [ r18 ] 895 absorbable surgical suture ( synthetic ) sterilised needled ( braided ) coated polyglactin / polyglycolic acid / poly ( glycolide co l lactide ) size 4 / 0 3 / 8 circle cutting 16mm needle, suture length 70cm [ r19 ] 896 non absorbable surgical suture, sterilised needled polyamide monofilament black ( nylon ) size 3 / 0 ( 3 / 8 conventional cutting needle 16mm length 70 cm ) [ r24 ] 897 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 3 / 0 ( 1 / 2 cir rb needle 25mm, length 90 cm ) double arm [ r37 ] 898 non absorbable surgical suture, sterilised needled monofilament polypropylene blue size 2 / 0 ( 1 / 2 cir rb needle 30mm, length 90 cm ) [ r38 ] 899 b.b silk suture ( 3 / 8 cir rb needle 16mm, length 76 cm size 5 / 0 ( details in rc ) [ r79 ] 900 tab hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 20mg ) 901 tab hydrochlorothiazide ( 12.5mg ) + olmesartan medoxomil ( 40mg ) 902 tab nicumalone 1 mg 903 tab nicumalone 4 mg 904 tab chymotrysin 905 tab citicoline 906 tab clarithromycin 500mg 907 tab dapagliflozin 10mg 908 tab deflazacort 6 mg 909 tab esomeprazole 40 mg 910 tab febuxastat 40 mg 911 tab febuxastat 80 mg 912 tab glucosamine + diacerein 50 mg tab 913 tab ketorolac 10 mg 914 tab levothyroxine sodium tablet 25 mcg 915 tab methylpredinisolone 16 mg 916 tab methylpredinisolone 8 mg 917 tab moxifloxacin 400 mg 918 tab nitrazepam 10 mg 919 tab paracetamol 650 mg 920 tab pentoprazole 40 + levosulpiride 150 mg cap 921 tab propylthiouracial 100 mg 922 tab repaglinide and voglibose ( 0.5+0.3 ) 923 tab rifaximin 500mg 924 tab rosuvastatin 160mg + finofib 10mg 925 tab serratiopeptidase 10mg 926 tab silodocin 4 mg cap 927 tab silodocin 8 mg cap 928 tab sitagliptin 50mg 929 tab sulphasalazine 500 mg 930 tab thiocolchicosite 4 mg 931 tab vildagliptine 50mg 932 tab voglibose 0.2 mg tab 933 tab voglibose 0.3 mg tab 934 tab zinc 50mg 935 syp azithromycine 100 mg 936 syp azithromycine 200 mg 937 syp cefpodoxime 100 mg 938 syp cyproheptidine 939 syp drotavarine 940 syp mefenamice acid 100mg / 5ml 941 syp montelucast+levocetrizine 942 syp phenobarbitone 20mg / 5ml, 100 ml 943 syp levofloxacine 944 syp ondansetron 945 syp zink 20 mg, 100 ml 946 surgical abdominal suction set 947 surgical arterial line 948 surgical av blood line 949 surgical av fistula needle 16g 950 surgical av fistula needle 17g 951 surgical baby diaper small size for infents 952 surgical bain circuit adult 953 surgical bain circuit ped. 954 surgical bains circuit paediatric / adult 955 surgical bandage 10 inch 956 surgical bandage 15 inch 957 surgical bandage 2.5 inch 958 surgical bandage 4 inch 959 surgical bandage 6 inch 960 surgical bandage 7.5 inch 961 surgical bipolar prosthesis set 962 surgical calcanum plate all size 963 surgical ccs screw 4 mm, 6mm, 5mm 964 surgical chest drainage catheter ( i.c.d. ) ( thoracic catheter ) size : fg: 16, 20, 24, 28, 32, 36 & 40. 965 surgical chlorhexidine inpregnade paraffin gauze 10x10 966 surgical chlorhexidine inpregnade paraffin gauze 30x10 967 surgical chlorhexidine inpregnade paraffin gauze roll 968 surgical clavical plate all size 969 surgical close circuit 970 surgical close wound drainage device under negative pressure ( closed wound suction unit ) size of bellow 800 ml, ( all size ) 971 surgical creep bandage 10 inch 972 surgical creep bandage 2 inch 973 surgical creep bandage 4 inch 974 surgical creep bandage 6 inch 975 surgical diaper adult ( s / m / l ) 976 surgical distal femur plate all size 977 surgical distal humerus ( posterial & medial ) plate all size 978 surgical distal humerus extra artecuilar plate all size ( right & left ) 979 surgical distal radius t / oblique plate all size 980 surgical distal tebia medial plate all size 981 surgical dynamic hip screw size 80 to 110 with plate long barrer & short barrer all size 982 surgical endres nail 2.5mm, 3 mm, 3.5mm, 4mm, 4.5mm 983 surgical febulla tubualar plate all size 984 surgical femur nail no. 9 / 32, 9 / 34, 9 / 36, 9 / 38, 9 / 40, 9 / 42, 10 / 32, 10 / 34, 10 / 36, 10 / 38, 10 / 40, 10 / 42, 11 / 32, 11 / 34, 11 / 36, 11 / 38, 11 / 40, 11 / 42, 12 / 32, 12 / 34, 12 / 36, 12 / 38, 12 / 40, 12 / 42 985 surgical fistula needle 16 g 986 surgical fixator set 987 surgical gudel airway 988 surgical hook plate all size 989 surgical humerus nail all size 990 surgical i / l femur nail set 991 surgical i / l tibile nail with bolt set 992 surgical knee cap 993 surgical lignocain 10 % spray 994 surgical locking plateall size 995 surgical merocel nasal pack 996 surgical needle ( all size 14 to 27 g ) 997 surgical pedicle screw titanium with set all size 998 surgical poteriomedial proximal tebia plate all size 999 surgical proximal femur nail long & short no. 9 / 32, 9 / 34, 9 / 36, 9 / 38, 9 / 40, 9 / 42, 10 / 32, 10 / 34, 10 / 36, 10 / 38, 10 / 40, 11 / 4211 / 32, 11 / 34, 11 / 36, 11 / 38, 11 / 40, 11 / 4, 29 / 25, 10 / 25, 11 / 25, 12 / 25 1000 surgical proximal hocky plate set 1001 surgical proximal humerus plate all size 1002 surgical proximal tebia t plate all size 1003 surgical raft plate ( right & left ) all size 1004 surgical recon plate all size 1005 surgical spine feusion cage all size 1006 surgical square nail 2 mm, 2.5mm, 3 mm, 3.5mm 1007 surgical tibia nail & femur nail no. 8 / 28, 8 / 30, 8 / 32, 8 / 34, 8 / 36, 8 / 38, 9 / 28, 9 / 30, 9 / 32, 9 / 34, 9 / 36, 9 / 38, 10 / 28, 10 / 30, 10 / 32, 10 / 34, 10 / 36, 10 / 38, 11 / 28, 11 / 30, 11 / 32, 11 / 34, 11 / 36, 11 / 38 1008 oint cream luliconazole 1% w / w 1009 mouth paint lignocain mouth paint 1010 injection alpha beta arteether [ lp.26 ] [ m ] 1011 inj multivitamine 1012 inj azithromycin 10 ml vial equivalent to 500 mg 1013 inj caffein 10 mg 1014 inj citicoline 250 / 500 mg 1015 inj colistine 10 lakh unit 1016 inj compound sodium 500ml, glass bottel 1017 inj dexmedetomidine 100mcg / ml 1018 inj doxcyline 100 mg 1019 inj etomidate 10ml 1020 inj etomidate 20 mg 1021 inj ferric carbo maltose 500mg / 10 ml vial 1022 inj fluconazole 200mg 1023 inj gdw 5% glass bottle 1024 inj levofloxacine 100 ml 1025 inj l ornithine l aspartate 10 ml 1026 inj mephentermine 30ml / ml 1027 inj methylprednisolon injection 40mg 1028 inj moxifloxacin 100ml 1029 inj nandrolone decanoate 50 mg inj 1030 inj nicorandil 48 mg 1031 inj normal saline 500 ml glass bottle 1032 inj ondansetron 8 mg 1033 inj pilocarpine 0.5 %v / v 1034 inj piracetam 200 mg 1035 inj ravici 5 ml 1036 inj reteplase 18 mg 1037 inj tirofiban 0.5 mg 1038 inj vitamin d ( 600000 iu ) 1039 eye ointment chloramphenicol +polymycine 1040 eye ointment chloramphenicol +polymycine + dexamethason 1041 eye drop carboxymethylcellulose + glycerin 1042 eye drop gatifloxacin and prednisolone 1043 eye drop moxifloxacilline+ dyliprednate 1044 eye drop moxifloxacilline+ prednisone 1045 eye drop natamycin 5% 1046 eye drop sodium chloride 5% 1047 eye drop tropicamide + phenlyephrine 1048 eye drop dorzolamide 1049 eye drop moxifloxacin and prednisolone eye drop 1050 eye drop olaptadine & ketrolac 1051 ear drop polymyxin b 10000iu / gm + neomycin 3400iu / gm 1052 drop anti cold 15 ml 1053 drop calcium 30 ml 1054 drop diastase pepsin with simethicone 15 ml 1055 drop digestive enzyme 15 ml 1056 drop hydroxyzine 15 ml 1057 drop ondensetrone 30 ml 1058 drop prednisolone 10 ml 1059 drop terbutalin 1060 drop vitamind3 400 iu 1061 drop vitamind3 800 iu 1062 cap alpha+lipoic acid + leycopen +multivitamin and miltiminerals 1063 cap anti oxidants capsule ( beta carotene 10 mg, vit e 25mg, vit c 100 mg, copper 1.5 mg, managanese 1.5 mg, zinc 7.5 mg, selenium 150 microgram ) 1064 cap aprebitant 125 / 80 1065 cap dulexitim 20mg 1066 cap dulexitim 30mg 1067 cap glucosamine + chloride +msm 1068 cap racecadotril 100mg 1069 cap rebeprazole +levosulpiride 1070 face mask pediatric 1071 nasal cannula 1072 venturi mask 1073 tracheostomy kit 1074 multilumen central catheter 1075 cannula for intravenous aecers and arterial lines 1076 disposable needles 1077 spacers and mask 1078 icd tube portex with trocher 18 1079 arterial line transducers 1080 air mattresses 1081 laryngeal mask airway 1082 rebreather mask 1083 non rebreathermask 1084 closed suction catheters 5 1085 baby diper small 1086 brain circuit adult 1087 brain circuit pediatric 1088 hand wash liquid 1089 formalin tablets 1090 ambu bag 250ml 1091 ambu bag 500ml 1092 polydixanone 1, with antibacterial coated with triclosan 1 / 2 circle taper pointaper40mm, 90 cm. 1093 synthetic absorable coatedantibacterial sutures poliglecaprone 25 with irgacare mp, 3 / 8 circle reverse cutting fs, 26mm, monofilament undyed70 cm, 3 0 1094 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 1, 1 / 2 circle r.c. o.s. 40mm needle 1095 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 1 0, 1 / 2 circle r.c. o.s. needle 36mm 1096 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 1 0 1 / 2 circle r.b. g.s.needle 40mm 1097 abs+e26orbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 1, 1 / 2 circle r.b. g.s.needle 40mm 1098 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 2 0 1 / 2 circle r.b. 30mm needle 1099 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 3 0 1 / 2 circle r.b. 20mm needle 1100 synthetic absorbable coatedpolyglactin 910 with irgacare mp, 1 / 2 circle rc portt , 22 mm, violetbraided5 cm, 1 0 1101 synthetic absorbable coatedpolyglactin 910 with irgacare mp, 1 / 2 circle rc portt , 22 mm, violetbraided35 cm, 1 1102 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 3 0, 3 / 8circle , 24mm needle 1103 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosansize 1, 1 / 2circle rb , 36.4mm needle 1104 absorbable surgical suture, ( synthetic ) coated polyglactin910 voilet antibacterial with coated with triclosan size 1 0, 1 / 2circle rb , 36.4mm needle 1105 syntheticabsorbable co polymer of glycolide & lactide with reduced molecular weight, 1 / 2 circle tapercut v 34, 36mm, undyed braided90 cm, 2 0 1106 syntheticabsorbable co polymer of glycolide & lactide with reduced molecular weight, 3 / 8 curved reverse cutting, 36mm, undyed braided60 cm, 2 0 1107 syntheticabsorbable co polymer of glycolide & lactide with reduced molecular weight, 3 / 8 curved reverse cutting, 26mm, undyed braided70 cm, 3 0 1108 syntheticabsorbable co polymer of glycolide & lactide with reduced molecular weight, 1 / 2 circle taper point, 40mm, undyed braided 110 cm, 0 1109 coated, braided polyster suturesize : 5, 1 / 2 circle taper cut double armed, 4 green suture per foil, 55 mm, 75cm 1110 coated, braided polyster suturesize : 2, 1 / 2 circle taper cut heavy, 1 green suture per foil, 45mm, 100cm 1111 absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 36mm 1 / 2 circle reverse cutting os 6 needle, 45 cm 1112 absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 2 0, 36mm 1 / 2 circle taper point needle, 45 cm 1113 absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 1, 40mm 1 / 2 circle taper point needle, 45 cm 1114 absorbable unidirectional barbed device, symmetric anchoring pattern, triclosan coated polydioxanone, size 0, 40mm 1 / 2 circle taper point needle, 45 cm 1115 triple layer ( polydioxanone / polypropylene / polydioxanone ) tissue separating mesh with orc layer for ventral hernia repair. 10*15 cm , oval usfda / european ce approved 1116 triple layer ( polydioxanone / polypropylene / polydioxanone ) tissue